The amyloid oligomer modulator anle138b has disease modifying effects in a human IAPP transgenic mouse model of type 2 diabetes mellitus (hIAPP Ob/Ob mice)

The amyloid oligomer modulator anle138b has disease modifying effects in a human IAPP transgenic mouse model of type 2 diabetes mellitus (hIAPP Ob/Ob mice) | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results The amyloid oligomer modulator anle138b has disease modifying effects in a human IAPP transgenic mouse model of type 2 diabetes mellitus (hIAPP Ob/Ob mice) Mohammed M. H. Albariqi , Sanne M.G. Baauw , Sjors J.P.J. Fens , Sabine Versteeg , Sergey Ryazanov , Andrei Leonov , Hanneke L.D.M. Willemen , Nikolas Stathonikos , Raina Marie Seychell , Adam El Saghir , Bram Gerritsen , Lucie Khemtemourian , Neville Vassallo , Armin Giese , Niels Eijkelkamp , Christian Griesinger , Jo W. M. Höppener doi: https://doi.org/10.1101/2024.08.27.609850 Mohammed M. H. Albariqi 1 Center for Translational Immunology, University Medical Center Utrecht, Utrecht University , 3584 EA Utrecht, The Netherlands 4 Applied Genomics Technologies Institute, Health Sector, King Abdulaziz City for Science and Technology , P.O. Box 6086, 11461 Riyadh, Saudi Arabia Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sanne M.G. Baauw 1 Center for Translational Immunology, University Medical Center Utrecht, Utrecht University , 3584 EA Utrecht, The Netherlands Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sjors J.P.J. Fens 1 Center for Translational Immunology, University Medical Center Utrecht, Utrecht University , 3584 EA Utrecht, The Netherlands Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sabine Versteeg 1 Center for Translational Immunology, University Medical Center Utrecht, Utrecht University , 3584 EA Utrecht, The Netherlands Find this author on Google Scholar Find this author on PubMed Search for this author on this site Sergey Ryazanov 5 Department of NMR Based Structural Biology, Max Planck Institute for Multidisciplinary Sciences , Göttingen, Germany Find this author on Google Scholar Find this author on PubMed Search for this author on this site Andrei Leonov 5 Department of NMR Based Structural Biology, Max Planck Institute for Multidisciplinary Sciences , Göttingen, Germany Find this author on Google Scholar Find this author on PubMed Search for this author on this site Hanneke L.D.M. Willemen 1 Center for Translational Immunology, University Medical Center Utrecht, Utrecht University , 3584 EA Utrecht, The Netherlands Find this author on Google Scholar Find this author on PubMed Search for this author on this site Nikolas Stathonikos 3 Department of Pathology, University Medical Center Utrecht, Utrecht University , 3584 EA Utrecht, The Netherlands Find this author on Google Scholar Find this author on PubMed Search for this author on this site Raina Marie Seychell 6 Department of Physiology and Biochemistry, Faculty of Medicine and Surgery , Find this author on Google Scholar Find this author on PubMed Search for this author on this site Adam El Saghir 6 Department of Physiology and Biochemistry, Faculty of Medicine and Surgery , Find this author on Google Scholar Find this author on PubMed Search for this author on this site Bram Gerritsen 1 Center for Translational Immunology, University Medical Center Utrecht, Utrecht University , 3584 EA Utrecht, The Netherlands Find this author on Google Scholar Find this author on PubMed Search for this author on this site Lucie Khemtemourian 8 Univ. Bordeaux, CNRS, Bordeaux INP, CBMN , UMR 5248, F-33600 Pessac, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Neville Vassallo 6 Department of Physiology and Biochemistry, Faculty of Medicine and Surgery , 7 Centre for Molecular Medicine and Biobanking, University of Malta , Msida, Malta Find this author on Google Scholar Find this author on PubMed Search for this author on this site Armin Giese 9 MODAG GmbH, Mikro-Forum-Ring 3, 55234 Wendelsheim, Germany Find this author on Google Scholar Find this author on PubMed Search for this author on this site Niels Eijkelkamp 1 Center for Translational Immunology, University Medical Center Utrecht, Utrecht University , 3584 EA Utrecht, The Netherlands Find this author on Google Scholar Find this author on PubMed Search for this author on this site Christian Griesinger 5 Department of NMR Based Structural Biology, Max Planck Institute for Multidisciplinary Sciences , Göttingen, Germany 10 Cluster of Excellence: “Multiscale Bioimaging: From Molecular Machines to Networks of Excitable Cells” (MBExC), University of Göttingen , Göttingen, Germany Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: jlamwhoppener{at}hetnet.nl cigr{at}mpinat.mpg.de Jo W. M. Höppener 1 Center for Translational Immunology, University Medical Center Utrecht, Utrecht University , 3584 EA Utrecht, The Netherlands 2 Center for Molecular Medicine, University Medical Center Utrecht, Utrecht University , 3584 EA Utrecht, The Netherlands Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: jlamwhoppener{at}hetnet.nl cigr{at}mpinat.mpg.de Abstract Full Text Info/History Metrics Supplementary material Preview PDF Summary Cytotoxic aggregates of human islet amyloid polypeptide (hIAPP) contribute to type 2 diabetes mellitus (T2DM) pathogenesis by damaging pancreatic islet β cells and reducing insulin production. Anle138b is an amyloid oligomer modulator with disease modifying properties in mouse models of neurodegenerative diseases linked to protein aggregation and with favorable results in phase 1 clinical studies. We tested whether anle138b has disease modifying properties in a severe hIAPP transgenic mouse model of T2DM. Oral administration of anle138b in hIAPP Ob/Ob mice reduced hyperglycemia, decreased glycated hemoglobin levels, increased islet β-cell mass and improved islet function compared to non-treated mice. In contrast, anle138b administration did not affect these parameters in non-transgenic Ob/Ob mice, indicating that the anti-diabetic effects of anle138b are hIAPP-dependent. In vitro , anle138b inhibited hIAPP aggregation and toxic effects of hIAPP on mitochondria. These results indicate that anle138b is a promising drug candidate for treating and/or preventing T2DM -associated pathology. Introduction Type 2 diabetes mellitus (T2DM) is a common metabolic disease, affecting more than 500 million people globally in 2021 and this number is expected to rise to more than 600 million by 2030 [ 1 ]. The WHO has declared T2DM as the first non-infectious epidemic [ 2 ]. Because T2DM is strongly associated with obesity, these two conditions are together also referred to as the “twin epidemics”[ 3 ]. T2DM is characterized by impaired insulin action, often called “insulin resistance”, and by insufficient insulin production by the pancreatic islet β cells, referred to as “β-cell failure”, causing hyperglycemia which is the central feature of T2DM. A distinct histopathological feature of T2DM is the presence of extracellular amyloid (fibrillar, congophilic protein deposits) within the pancreatic islets. This “islet amyloid” is detected in 80-90% of T2DM patients and is mainly composed of the protein islet amyloid polypeptide (IAPP), also named amylin [ 4 ]. IAPP is co-produced and co-secreted with insulin from the pancreatic islet β-cells. As a monomer, IAPP is a soluble protein involved as a hormone in a.o. gastric emptying and satiety, but when overproduced (notably as a consequence of insulin resistance) IAPP can aggregate and form amyloid. In humans, monkeys and cats with T2DM, islet amyloid formation has been associated with ß-cell failure [ 4 – 6 ]. Conversely, in mice and rats, species which do not naturally develop T2DM, IAPP does not form amyloid due to a different amino acid sequence [ 7 , 8 ]. Amyloid fibrils feature a characteristic cross-β structure, formed by stacking of β-sheets from the fibril-forming protein molecules [ 9 ]. Soluble pre-fibrillar human IAPP (hIAPP) oligomers, that form in the lag phase of amyloid fibril formation, have been shown to be the most toxic species of hIAPP, and are directly toxic to insulin-producing islet β-cells [ 10 ]. Increasing evidence shows that soluble toxic hIAPP oligomers significantly contribute to β-cell dysfunction and metabolic dysregulation associated with T2DM [ 11 – 13 ]. Transgenic rodent models that overexpress hIAPP in islet β-cells have been shown to display mitochondrial dysfunction [ 14 ], and impaired glucose homeostasis [ 5 , 15 ]. Protein aggregation and its associated cytotoxicity are linked to various prevalent and debilitating chronic diseases, such as Alzheimer’s disease (AD), Parkinson’s disease (PD) and prion diseases. A growing body of literature indicates that hIAPP aggregation in pancreatic islets plays a similar role in T2DM as Aβ, tau and α-Synuclein do for the neurological protein aggregation diseases AD and PD [ 16 ]. Therefore, small molecule compounds and antibodies that interfere with amyloid protein aggregation are being developed to reduce amyloid-associated cell and tissue damage in these diseases. This is exemplified by the recent success of lecanemab, a humanized monoclonal antibody against diffusible aggregates of the AD-associated amyloid beta protein (Aβ) [ 17 ], and antibodies against hIAPP proto-fibrils [ 18 , 19 ]. In addition, active immunization against hIAPP oligomers showed ameliorating effects in a transgenic T2DM mouse model [ 20 ]. Despite the pathogenic role of hIAPP in T2DM, therapies targeting hIAPP aggregation are currently an unmet need for T2DM patients, probably in part because the role of hIAPP aggregation as a main driver of T2DM pathogenesis is not yet in the focus of clinical research. The diphenyl-pyrazole (DPP) compound anle138b modulates early aggregation of α-Synuclein, a key protein in the pathogenesis of PD, and inhibits aggregation of α-Synuclein in vivo after oral administration in transgenic PD mouse models [ 21 , 22 ]. Importantly, anle138b reduced disease progression in mouse models for the neurodegenerative amyloid disorders AD (based on aggregation of tau) [ 23 , 24 ], PD [ 25 , 26 ], Multiple system atrophy (MSA) [ 27 ] and prion diseases [ 21 ]. Anle138b treatment also inhibits spreading (i.e. physical transfer of protein aggregates from cell to cell) of α-Synuclein in a PD mouse model [ 21 ] and of tau in cell-based experiments [ 28 ]. Anle138b has been tested in a phase I clinical trial ( NCT04208152 ) and in a phase Ib study ( NCT04685265 ) and showed no adverse effects at concentrations expected to be therapeutically efficacious [ 29 ]. Since anle138b was effective in various neurodegenerative proteinopathies by interfering with aggregation of α-Synuclein, Aβ, tau and Prion protein, we hypothesized that anle138b also has disease modifying effects for T2DM by acting on hIAPP. To test this hypothesis, the therapeutic potential of anle138b was assessed by oral administration via dietary admixture to transgenic obese mice overexpressing hIAPP in their pancreatic islet β cells (hIAPP Ob/Ob) [ 15 ]. Contrary to non-obese hIAPP mice [ 30 ], hIAPP Ob/Ob mice develop severe insulin resistance, hypoinsulinemia and marked hyperglycemia already at a young age, associated with formation of amyloid in their pancreatic islets [ 15 ]. The effects of anle138b on hIAPP aggregation in vitro and on prevention of hIAPP toxicity in mitochondrial assays were also assessed. Results Anle138b inhibits hIAPP aggregation in solution We first determined the ability of anle138b to inhibit hIAPP aggregation in solution. We evaluated the morphology and abundance of hIAPP aggregates by means of transmission electron microscopy (TEM). In the absence of anle138b, hIAPP efficiently formed mature amyloid fibrils, clearly visible in TEM micrographs, with only very few smaller aggregates ( Fig 1A-C ). hIAPP fibrils displayed the characteristic dense mats of long fibrils, with widths between 7 and 10 nm, embedded in small and large networks ( Fig 1B ). On the other hand, no amyloid fibril formation was observed in the hIAPP:anle138b (1:5 molar ratio) mixture. Instead, only small, protofibrillar aggregates were present ( Fig. 1D-F ), confirming full inhibition of hIAPP fibril formation at this molar ratio. Download figure Open in new tab Figure 1. Characterization of hIAPP aggregation in the absence or presence of anle138b. Representative TEM images of hIAPP (1 μM) aggregated in the absence (A, B) and in the presence of anle138b at a molar ratio of 1:5 (hIAPP:anle138b) (D, E). (A) Smaller aggregates and (B) a matt of amyloid fibrils of hIAPP in the absence of anle138b, (D) smaller and (E) larger aggregate clusters of hIAPP + anle138b. (C, F) Quantification of the different hIAPP species in the absence and presence of anle138b, respectively. Data are presented as mean ± SEM from 3 representative square grid sections. G) Mean aggregate sizes determined by DLS of hIAPP (5 μM) in the absence and presence of 10 μM or 1 μM anle138b, following a 60-min time period of aggregation. Data are presented as mean ± SEM from 3-5 independent experiments; One-way ANOVA followed by Bonferroni’s posthoc test; *** p<0.001. (H) Representative DLS histogram denoting particle size distribution of 5 µM hIAPP in the absence and presence of 10 µM anle138b, respectively, from at least 3 independent experiments. Particle size 300 nm as “fibrillar”. Dynamic light scattering (DLS) [ 31 ] was used to corroborate the TEM findings. In addition, we investigated the disaggregating potential of anle138b. The starting hydrodynamic diameter (HD) of hIAPP species under these experimental conditions was 38-60 nm, indicating that hIAPP was present as protofibrillar aggregates ( Fig 1G , H). After 1 h of incubation, very large particles of >400 nm were present, indicating the generation of amyloid (proto)fibrils. Conversely, a 1 h incubation of a mixture of hIAPP:anle138b (1:2 molar ratio) generated species with a HD of ∼3 nm, representing monomeric hIAPP ( Fig 1G,H ). The disaggregation of hIAPP protofibrillar aggregates by anle138b was not present at a 5:1 molar ratio, but the compound still significantly inhibited hIAPP fibrillization at this ratio ( Fig 1G ). Collectively, anle138b inhibits hIAPP amyloid fibril formation, and also has the potential to disaggregate preexisting hIAPP protofibrillar aggregates into monomers. Anle138b reduces hyperglycemia and glycated HbA1c levels and improves pancreatic islet function in hIAPP Ob/Ob mice Next, we investigated whether anle138b inhibits hIAPP aggregation in vivo and reduces diabetic symptoms in a hIAPP Ob/Ob mouse model of T2DM. Therefore, we treated the mice with a dietary admixture containing 2 g anle138b /kg food for 8 months, starting at an age of approximately 3 weeks (immediately after weaning), in order to perform preventive or early curative treatment. This dose was also used in previous studies with other disease models [ 20 – 26 ]. To investigate whether the effects of anle138b treatment are hIAPP-dependent, we also treated non-transgenic Ob/Ob mice, which lack hIAPP expression and islet amyloid and which are less severely diabetic [ 15 ], with anle138b under the same conditions. Remarkably, hIAPP Ob/Ob mice fed anle138b had significantly lower fasting blood glucose levels compared to mice fed the same chow diet but without anle138b, after 16 weeks and onwards ( Fig 2A ). In contrast, anle138b did not affect fasting blood glucose levels in non-transgenic Ob/Ob control mice ( Fig 2A ). In the hIAPP Ob/Ob mice, the blood glucose levels were much higher after 8, 24 and 34 weeks as compared to 16 and 32 weeks, most probably due to the different period of fasting prior to the bloodsampling (6h versus overnight). A trend for increased fasting plasma insulin levels was observed after 16 and 23 weeks of treatment of hIAPP Ob/Ob mice with anle138b, but these differences were not statistically significant ( Fig 2B , p = 0.35 and 0.07), respectively ( Fig 2B ). Moreover, in hIAPP Ob/Ob mice, anle138b treatment did not affect fasting plasma IAPP levels, body weight or food intake (Suppl. Fig 1 A-C). In Ob/Ob mice, anle138b did not affect plasma insulin levels ( Fig 2B ), plasma IAPP levels, body weight or food intake (Suppl. Fig 1 A-C). Download figure Open in new tab Figure 2. Anle138b reduces hyperglycaemia in hIAPP Ob/Ob mice, but not in Ob/Ob mice. (A) Basal blood glucose levels determined after 4 h fasting in the morning (t=0 weeks), after 6 h fasting in the morning (at 8, 24 and 34 weeks) or after overnight fasting (at 16 and 32 weeks) (n= 12-18 per group at each time point). (B) Basal plasma insulin levels determined after 4 h fasting in the morning (t=0 weeks), after 6 h fasting in the morning (at 23 weeks) or after overnight fasting (at 16 and 32 weeks) (n= 12-18 per group at each timepoint). (C, D) Blood HbA1c levels at 16 weeks and 32 weeks, respectively. (E, F) Correlation between blood glucose and blood HbA1c levels of Ob/Ob and hIAPP Ob/Ob mice, respectively (data at 16 and 32 weeks combined). (G) Correlation between blood glucose levels and plasma insulin levels of hIAPP Ob/Ob mice treated with anle138b or control diet during 16, 23 and 32 weeks (n= 12-15 per group at each time point). All experiments were performed in male mice. (A-D) Data are presented as mean ± SEM; Two-way ANOVA with Tukey’s test; *p<0.05, **p<0.01, ***p<0.001 vs hIAPP Ob/Ob mice without anle138b. (E-G) Pearson Correlation’s test; the correlation coefficient (r) and the two-tailed p-value are indicated for both the treated and the untreated mice. Linear regression was performed to examine if the slopes of the two regression lines are significantly different (p-value indicated at the top of the figures). Glycated haemoglobin (HbA1c) levels in blood reflect the average blood glucose levels during the previous 2-3 months, corresponding to the average half-life of erythrocytes. Therefore, HbA1c levels provide a more reliable indication of glycemia over a longer period of time as compared to a single blood glucose measurement. In line with the blood glucose data, anle138b treatment reduced blood HbA1c levels of hIAPP Ob/Ob mice significantly, compared to non-treated mice, with ∼ 50% decrease and near-normalization after 32 weeks, whereas in Ob/Ob mice HbA1c levels were not affected by anle138b treatment ( Fig 2 C, D ). Moreover, in treated hIAPP Ob/Ob mice blood glucose and blood HbA1c levels correlated significantly ( Fig 2F ), while in non-treated hIAPP Ob/Ob mice ( Fig 2F ) and in the Ob/Ob mice (treated and non-treated) ( Fig 2E ) this correlation was not significant. Importantly, only in the hIAPP Ob/Ob mice treated with anle138b, there was a significant inverse correlation between fasting plasma insulin and blood glucose levels at 16 and 23 weeks, and this correlation was borderline significant at 32 weeks, whereas no significant correlation was observed in the non-treated mice ( Fig 2G ), indicating that anle138b restored the insulin-glucose relationship. Overall, these findings indicate that anle138b efficiently reduces blood glucose levels in diabetic hIAPP Ob/Ob mice and that this is mediated, at least partly, via beneficial effects on insulin production/secretion. To determine whether anle138b influences insulin sensitivity, insulin sensitivity tests (ISTs) were performed. An intraperitoneal (i.p.) insulin administration caused significantly lower blood glucose levels in mice treated with anle138b than in non-treated mice only at 1 or 2 timepoints during each IST, and mainly in the “recovery phase”, i.e. after 100 minutes ( Fig 3 A-C ). The relative changes in blood glucose level after insulin injection, i.e. glucose levels relative to the level immediately prior to the insulin injection, were not significantly different between anle138b treated and non-treated hIAPP Ob/Ob mice at any timepoint (Suppl. Fig 2 A-C). Together these data suggest that anle138b may slightly improve insulin sensitivity in hIAPP Ob/Ob mice only at a timepoint when basal glucose levels were still the same as in the non-treated mice, i.e. after 8 weeks of treatment. In Ob/Ob mice, insulin administration did not reduce blood glucose levels differently in anle138b treated vs non-treated mice at any timepoint ( Fig 3 D, E ). Also, the relative changes in blood glucose level after insulin injection were comparable between anle138b treated and non-treated Ob/Ob mice at every timepoint (Suppl. Fig 2 D, E). Next, we evaluated glucose tolerance in Ob/Ob mice (glucose tolerance tests could not be performed in the hIAPP Ob/Ob mice due to their severe hyperglycemia). Glucose injections to Ob/Ob mice increased blood glucose concentrations comparably in anle138b treated vs non-treated mice ( Fig 3F , Suppl. Fig 2F), indicating that anle138b does not affect glucose tolerance in Ob/Ob mice. Overall, the data indicate that anle138b does not significantly affect insulin sensitivity in hIAPP Ob/Ob mice, nor in Ob/Ob mice. Download figure Open in new tab Figure 3. Insulin sensitivity of hIAPP Ob/Ob and Ob/Ob mice, with and without anle138b treatment. (A-C) Insulin sensitivity test (IST) of hIAPP Ob/Ob mice after 8, 24 and 34 weeks of treatment, respectively. (D, E) IST of Ob/Ob mice after 8 and 24 weeks of treatment, respectively. (F) Glucose tolerance test (GTT) of Ob/Ob mice, after 34 weeks of treatment. (n= 12-15 per group at each time point). Insulin sensitivity and glucose tolerance were assessed by intraperitoneal injection of insulin (3 units/kg in Ob/Ob mice at 8 weeks, 4 units/kg in Ob/Ob mice at 24 weeks and 2.25 units/kg in hIAPP Ob/Ob mice at 8, 24 and 34 weeks) or glucose (0.8 gr/kg), respectively, after 6 h of fasting from 7 am onwards. Direct blood glucose measurements were performed immediately before injection and over a period of 150 min after injection. Data are presented as mean ± SEM; Two-way ANOVA with Sidak’s test; *p<0.05, **p<0.01, ***p<0.001 vs hIAPP Ob/Ob mice without anle138b. Anle138b increases islet number and pancreatic β-cell mass in hIAPP Ob/Ob mice Next, we assessed whether anle138b affects histopathological features of T2DM by examining the pancreatic islets of hIAPP Ob/Ob mice. The average wet-weight of the pancreas was indistinguishable between the treated and non-treated mice (154 ± 40 mg vs 166 ± 47 mg; p = 0.53). However, the number of islets was significantly higher in pancreas of hIAPP Ob/Ob mice fed with anle138b ( Fig 4A ). The average cross-sectional islet area was similar between the two groups, with a similar variation within the groups, varying from approximately 13.000 to 50.000 μm 2 as average islet size for individual mice ( Fig 4B ). No correlation between islet number and islet size was found (Suppl. Fig 3A). In the hIAPP Ob/Ob mice treated with anle138b, islet number correlated positively with fasting plasma insulin levels ( Fig 4C ), and negatively with fasting blood glucose levels ( Fig 4D ); importantly, these correlations were not observed in the untreated hIAPP Ob/Ob mice. Islet number also negatively correlated with the blood HbA1c levels at 32 weeks, but this was not statistically significant (Suppl. Fig. 3B). In agreement with the increase in islet number, the total pancreatic β-cell mass (insulin-positive cell mass) was bigger in the treated mice compared to the non-treated mice ( Fig 4E-G ). Only in the anle138b-treated mice, the β-cell mass correlated negatively with the blood glucose levels at the end of the study ( Fig. 4I ) as well as with the blood HbA1c levels at 32 weeks (Suppl. Fig. 3C). In the non-treated mice, β-cell mass was positively correlated with the blood glucose levels ( Fig. 4I ) and did not correlate with the blood HbA1c levels at 32 weeks (Suppl. Fig. 3C). Download figure Open in new tab Fig 4. Anle138b increases islet β-cell mass and improves islet function in hIAPP Ob/Ob mice. Quantification of (A) pancreatic islet number and (B) islet size (average cross-sectional islet area). (C, D) Correlations between islet number and metabolic parameters after 36 weeks of treatment. (E, F) Images of a pancreatic section stained for insulin (yellow color indicates insulin immunoreactivity) from a hIAPP Ob/Ob mouse, non-treated and treated with anle138b, respectively. (G) Quantification of total β-cell mass. (H, I) Correlations between β-cell mass and metabolic parameters after 36 weeks of treatment. (J, K) Images of a pancreatic islet from a hIAPP Ob/Ob mouse, stained with Congo red. (J) Brightfield image with pink color indicating amyloid deposits: islet amyloid; (K) Same islet section as in panel J, upon exposure to red light; the Congo red-positive amyloid deposits reveal a fluorescence which was quantified for each individual islet. (L) Islet amyloid prevalence (% of islets containing amyloid) and (M) islet amyloid severity (% of cross-sectional islet area being amyloid-positive). (N) Correlations between islet amyloid prevalence and blood glucose levels after 36 weeks of treatment. All experiments were performed in male mice. (A, B, G, L, M) For both groups of mice, the data are presented as the individual values and the median; Mann-Whitney test; * p<0.05, ** p<0.01 vs hIAPP Ob/Ob mice without anle138b. (C, D, N) Pearson correlation test and (H, I) Spearman correlation test (because of non-normality of the data); correlation coefficient (r) and two-tailed p-value are indicated for both the treated and the untreated mice. (C, D, N) Linear regression was performed to examine if the slopes of the two regression lines are significantly different (p-value indicated at the top of the figures). To determine the degree of islet amyloid formation, amyloid was quantified in pancreatic sections stained with the amyloid-specific dye Congo red ( Fig 4 J, K ). Both the average percentage of islets containing amyloid (amyloid prevalence, Fig 4L ) and the percentage of islet area consisting of amyloid (amyloid severity, Fig 4M ) were lower in mice treated with anle138b, although this difference did not reach statistically significance (p= 0.29 and p= 0.08, respectively). For both the treated and non-treated mice, there was a highly significant positive correlation between amyloid prevalence and amyloid severity, i.e. the higher the percentage of amyloid-positive islets in a mouse, the higher the amount of amyloid in the individual islets from that mouse (Suppl. Fig 4A). In addition, there was a significant positive correlation between islet size and amyloid prevalence, i.e. the bigger the islets of a mouse, the higher the percentage of islets which contain amyloid in that mouse (Suppl. Fig 4B). Islet size and amyloid severity were also positively correlated, but not statistically significant (Suppl. Fig 4C). In the non-treated mice, amyloid prevalence and amyloid severity correlated negatively with plasma insulin levels and positively with blood glucose levels, respectively, (p-values: 0.089, 0.058, 0.034 and 0.167) whereas in the anle138b-treated mice there was no such correlation (p-values > 0.795) ( Fig 4N , Suppl. Fig 5A-C). Overall, these data indicate that anle138b increases islet number, pancreatic β-cell mass and islet function in hIAPP Ob/Ob mice, resulting in a highly significant reduction of the blood glucose levels (which correlate significantly with higher insulin levels), and of the HbA1c levels. The degree of islet amyloid deposition shows a trend towards lower amyloid prevalence and amyloid severity in anle138b-treated hIAPP Ob/Ob mice, but this does not correlate to plasma insulin or blood glucose levels in these mice, indicating that the amyloid load of the islets is not a strong/main determinant of overall islet function in anle138b-treated hIAPP Ob/Ob mice. Anle138b reduces hIAPP-induced damage to mitochondria in vitro Mitochondrial impairment in pancreatic β-cells contributes to T2DM [ 32 , 33 ], and amyloid proteins, including hIAPP and Aβ, cause damage to mitochondria [ 34 , 35 ]. Therefore, we investigated whether anle138b prevents hIAPP aggregate-induced damage to isolated mitochondria. Anle138b is membrane permeable and thus has the ability to also reach intracellular targets such as mitochondria. Indeed, anle138b dramatically reduced hIAPP-induced cytochrome c release from isolated mitochondria ( Fig. 5A ) and completely prevented mitochondrial swelling ( Fig 5B ). To gain further insights into how anle138b affects hIAPP-induced mitochondrial damage, we evaluated changes in mitochondrial membrane potential (ΔΨm). Preformed hIAPP protofibrillar aggregates reduced the ΔΨm of isolated mitochondria by 33%, as assessed with the fluorescent probe JC-1. Incubation with 10 μM anle138b nearly completely restored ΔΨm to that of untreated mitochondria ( Fig. 5C ), indicating that anle138b prevents hIAPP-induced loss of mitochondrial membrane potential in vitro . Download figure Open in new tab Figure 5: Anle138b has protective effects against hIAPP-induced mitochondrial damage. (A) Mitochondria from SH-SY5Y cells were incubated for 10 min with 10 μM anle138b, prior to addition of and 1 h incubation with hIAPP oligomers (5 μM) and then incubated for another hour. The cytochrome c concentration (ng/ml) in the supernatant was quantified from hIAPP-treated mitochondria, with or without pretreatment with anle138b, and is indicated as the percentage of cytochrome c release by Triton X-100 (Tx-100). Bars indicate mean ± SEM (n=3; *** p<0.001; unpaired two-way Student’s t-test). (B) Fresh mitochondrial suspensions were exposed to swelling agent alamethicin, 5 μM or 10 μM hIAPP oligomers; or 10 μM hIAPP oligomers after pre-incubation with 10 μM anle138b for 10 min before addition of the oligomers. Bars indicate mean ± SEM of the average mitochondrial size measured by DLS. Comparisons were carried out by one-way ANOVA with Bonferroni’s posthoc correction, relative to vehicle treated mitochondria (n=3-6; *p<0.05, ***p<0.001). (C) End-point changes in the membrane potential (ΔΨm) of isolated mitochondria in mitochondrial buffer, monitored using the JC-1 dye, after 45 min in the absence and presence of 5 μM hIAPP oligomers, with or without 10 μM anle138. Bars indicate mean ± SEM (n=3-6, *** p<0.001; one-way ANOVA with Bonferroni’s posthoc correction). Discussion In the present investigation, we combined in vitro and in vivo studies to assess the potential therapeutic efficacy of anle138b in T2DM, a proteinopathy characterized by hIAPP aggregation and pancreatic islet amyloid formation [ 4 , 8 , 12 ]. Anle138b is a small molecule inhibitor which has been shown to target early aggregates of several amyloidogenic proteins [ 22 , 24 , 27 ]. Thus, the effects of anle138b on hIAPP aggregation in solution and on hIAPP-induced mitochondrial damage were investigated in vitro . The compound was then administered through dietary admixture to hIAPP Ob/Ob mice, a model of severe T2DM. The severity of diabetes in this mouse model and the early development of hyperglycemia [ 15 ] necessitated treatment with anle138b to be started very early, at the time of weaning. Our study revealed that anle138b inhibits the aggregation of hIAPP in solution. In addition, anle138b disaggregates hIAPP protofibrils, as observed by DLS studies consistent with formation of monomers. The inhibition of aggregation and the disassembly of aggregates observed in the presence of anle138b highlight the efficiency of anle138b against amyloid protein aggregation. Anle138b also successfully mitigated hIAPP-induced damage to mitochondria, such as efflux of cytochrome c , mitochondrial swelling and loss of mitochondrial membrane potential. In hIAPP Ob/Ob mice, oral administration of anle138b for 8 months resulted in a considerable improvement of glucose homeostasis, with a significant reduction in basal blood glucose levels and glycated hemoglobin (HbA1c) levels. In addition, anle138b restored the correlation between blood insulin and glucose levels in hIAPP Ob/Ob mice, indicating that this compound reduces hyperglycemia by improving insulin production/secretion from the pancreatic islets. In the pancreas, anle138b treatment significantly increased the number of islets and the total β-cell mass, and there was a trend towards a reduction of the islet amyloid content. Bodyweight and food intake were not affected by anle138b in hIAPP Ob/Ob mice, indicating that this compound does not affect caloric intake and global metabolism. The protective effects of anle138b were not observed in Ob/Ob mice, indicating that these effects are hIAPP-dependent. Overall, these results support the notion that hIAPP aggregation contributes to T2DM development [ 4 , 16 ], and strongly indicate that treatment with anle138b significantly suppresses hIAPP-induced β-cell pathology and can restore glycemic control. There are several other T2DM rodent models that also rely on hIAPP aggregation, such as e.g. FVB/N-Tg (Ins2-IAPP) RHFSoel/J mice [ 36 ]. Each model has specific characteristics and limitations (reviewed in [ 37 ]). Notably, the hIAPP Ob/Ob model of T2DM recapitulates many features of the metabolic syndrome observed in human T2DM, including: obesity, dyslipidemia, insulin resistance and hyperinsulinemia, pancreatic islet amyloid deposits and β-cell failure [ 15 ]. The early development of hyperglycemia, at 4 weeks of age, and the high blood glucose levels observed in these mice demonstrate the development of severe diabetes in this model [ 15 , 38 ]. The fact that anle138b can significantly reduce hyperglycemia even in this “aggressive” mouse model of severe T2DM robustly demonstrates the strong potential of this compound for T2DM. Accumulation and aggregation of misfolded proteins are important factors in the development and progression of several neurodegenerative diseases [ 39 ]. Consequently, the use of agents/therapies capable of preventing and/or inhibiting pathological protein aggregation is a promising approach for slowing the development and progression of these diseases [ 40 , 41 ]. Also for human T2DM there is a great deal of interest in strategies to prevent islet amyloid formation and its toxicity and several therapeutic approaches in this field are currently under development [ 42 – 44 ]. For instance, amyloid protein protofibril-specific antibodies have been developed and have shown potential in T2DM rodent models [ 18 – 20 ]. Small molecules, however, have numerous advantages compared to antibodies, including the potential for oral dosing and the ability to reach intracellular targets (such as mitochondria) by various mechanisms, mainly via passive diffusion in the case of lipophilic compounds like anle138b [ 22 , 40 , 45 ]. These are important considerations, particularly in the case of islet amyloidosis, since increasing evidence in rodent models shows that both extracellular and intracellular formation of toxic hIAPP aggregates can activate multiple overlapping pathological cellular signaling mechanisms leading to β-cell toxicity [ 14 , 46 , 47 ]. Our in vivo data show that oral treatment of hIAPP Ob/Ob mice with anle138b significantly reduces hyperglycemia and HbA1c levels. These findings are in agreement with the therapeutic impact of anle138b shown in animal models of other amyloid diseases, such as PD [ 21 ], AD [ 24 ] and MSA [ 27 ]. Anle138b-treated hIAPP Ob/Ob mice had a higher number of islets and a bigger total β-cell mass. In addition, these islet characteristics correlate negatively with blood glucose levels, while islet number also positively correlates with plasma insulin levels, suggesting that anle138b has a protective impact on pancreatic islets and islet β-cells and preserves insulin production/secretion. This might also explain why the relative decrease in blood glucose levels during the ISTs became lower in anle138b treated vs non-treated hIAPP Ob/Ob mice at higher ages (Suppl. Fig 2C), although the same dose of insulin was injected. This indicates that the treated mice were less in need of additional insulin in conditions where the basal glucose levels had already been reduced substantially, suggesting that anle138b treatment has caused a reset of glucose homeostasis. To test whether the observed therapeutic effects of anle138b are indeed mediated via hIAPP, we performed the same experiment with dietary admixture of anle138b in non-transgenic Ob/Ob mice. The obesity-related insulin resistance in this model accounts for the elevated insulin production and associated IAPP overproduction, but since mouse IAPP is not amyloidogenic (due to the six amino acid sequence differences between mouse and human IAPP) [ 7 , 48 ] Ob/Ob mice do not form islet amyloid [ 15 ]. In contrast to the hIAPP Ob/Ob mice, anle138b treatment in Ob/Ob mice had no effect on basal blood glucose-, blood HbA1c- or plasma insulin levels; nor did it have any effect on insulin sensitivity or glucose tolerance. These results convincingly demonstrate that the anti-diabetic effects of anle138b in hIAPP Ob/Ob mice are hIAPP-dependent and reinforce the notion, and previous studies indicating, that anle138 affects amyloid disorders via modulating pathogenic protein aggregation [ 22 ]. This is in contrast to other (postulated) mechanisms of anti-diabetic therapy, e.g. the autophagy inhibitor MSL-7 showed anti-diabetic effects in obese mice both with and without expression of hIAPP [ 49 , 50 ]. Mitochondrial damage can have detrimental effects on cellular function, ultimately leading to cellular senescence or even apoptotic cell death [ 51 , 52 ]. One crucial aspect of this process is the release of cytochrome c , which triggers the activation of caspase-3, caspase-9, and other factors that promote cell death [ 53 ]. hIAPP disrupts mitochondrial dynamics by interfering with membrane fusion and fission, leading to mitochondrial fragmentation [ 14 , 54 ]. Furthermore, hIAPP inhibits mitophagy and impairs the activity of complex I, further compromising mitochondrial function [ 55 ]. In our study using isolated mitochondria, we demonstrated that anle138b attenuated hIAPP aggregate-induced cytochrome c release, mitochondrial swelling, and reduction in mitochondrial membrane potential. These findings are consistent with a previous report that demonstrated the ability of anle138b to reduce the impact of α-Synuclein, tau and Aβ1-42 exposure on mitochondrial membranes [ 56 ]. These findings indicate that anle138b has a broad impact on preserving membrane integrity in amyloid-related diseases. Collectively, the results provide valuable insights into the potential benefits of anle138b as a therapeutic agent targeting mitochondrial dysfunction caused by amyloidogenic proteins. Although some of our in vivo data indicate inhibitory effects of anle138b on islet amyloid formation, the major beneficial effect of anle138b is likely at the level of protofibrillar aggregates/oligomers, as was shown previously [ 21 ]. In agreement with this concept, the absolute degree of islet amyloid deposition (occupying less than 1 % of the islet area) is unlikely to considerably affect the insulin-producing capacity of the islets. In addition, the reduction of amyloid content caused by anle138b (on average from 0.8 to 0.4 % of the islet area) is unlikely to explain its huge beneficial effect on the blood glucose levels. This notion is supported by the finding that in the anle138b-treated hIAPP Ob/Ob mice islet amyloid prevalence and severity did not correlate at all with plasma insulin or blood glucose levels, whereas such correlations were seen in the non-treated hIAPP Ob/Ob mice. Therefore, it is most probable that anle138b reduces the concentration and/or pathogenicity of small hIAPP aggregates/oligomers not only in vitro ( Fig 1 , Fig 5 ) but also in vivo. This is consistent with previous studies in transgenic hIAPP rodent models which indicate that toxic pre-amyloid aggregates are the major cause of hIAPP-induced β-cell defects [ 14 , 47 ]. There are currently no methods to discriminate between toxic and non-toxic pre-amyloid aggregates in tissue. More studies and tools are needed to specifically identify and quantify cytotoxic pre-amyloid aggregates in vivo . In conclusion, anle138b effectively inhibits aggregation and amyloid fibril formation of hIAPP in solution, as well as hIAPP aggregate-induced mitochondrial damage in vitro . hIAPP Ob/Ob mice treated with anle138b from weaning onwards had more pancreatic islets and a bigger total β-cell mass, with a trend towards less islet amyloid, allowing them to produce more insulin and to achieve lower blood glucose levels. In agreement with this notion, we observed a significant inverse relationship between plasma insulin and blood glucose levels only in hIAPP Ob/Ob mice treated with anle138b. These beneficial effects of anle138b in this mouse model of severe T2DM indicate a strong potential of this compound, and related compounds, for T2DM. Prior preclinical research has already indicated the therapeutic efficacy of anle138b for a number of neurodegenerative amyloid diseases; the data presented here strongly support the continued development of anle138b for a potential clinical application in T2DM and other proteinopathies, particularly since phase 1 studies of this compound demonstrated a well-tolerated safety profile in humans at potentially efficacious doses. [ 29 ]. Anle138b being able to modulate not only aggregation of hIAPP, but also that of Aβ, tau and α-synuclein, could be beneficial not only for T2DM, but also ideally suited for the comorbidities observed between T2DM and AD or PD [ 57 , 58 ]. Materials and Methods Mice Transgenic mice overexpressing hIAPP in the pancreatic islet β-cells, under transcriptional control of a rat insulin 2 gene promoter, were generated as described previously. Founder mice on a C57BL6J/DBA2 background were back-crossed to C57Bl6J. Homozygous hIAPP mice (hIAPP +/+ ) were obtained by intrabreeding hemizygous hIAPP mice (hIAPP +/- ) and selecting for homozygous offspring by Southern dot blot hybridization [ 30 ]. Leptin-Ob mice on a C57Bl/6J background were originally obtained from Harlan. Homozygous inactivation of the Leptin gene causes obesity and mild hyperglycemia [ 59 ]. By cross-breeding the hIAPP transgenic line GG0018 with Leptin-Ob mice, the hIAPP/Ob line GG2653 was generated [ 15 ]. By selective breeding, a subline of GG2653 with the Leptin-Ob mutation but without the hIAPP transgene was obtained on the same genetic background (“non-transgenic Ob”). Presence of the inactivating missense mutation in the leptin gene from Leptin-Ob mice was detected by PCR of ear DNA with primers flanking the point mutation (Ob1: 5’ TGC CTT CCC AAA ATG TGC TGC 3’ and Ob2: 5’ CAT TCA GGG CTA ACA TCC ACC 3’), generating a product of 250 bp in all mice. In addition to presence of a single “wildtype” DdeI restriction site in this PCR product, generating fragments of 150 bp and 100bp upon DdeI digestion, a second DdeI site is generated by the Leptin-Ob point mutation, causing cleavage of the 100 bp fragment in fragments of 48 and 52 bp (co-migrating around 50 bp in a 3% agarose gel). Consequently, agarose gel electrophoresis of DdeI digestion of the 250 bp PCR product yields DNA fragments of 150 and 100 bp for wildtype mice; fragments of 150, 100 and 50 bp for heterozygous Ob mutant mice and fragments of 150 and 50 bp for homozygous Ob mutant mice. Since the Leptin-Ob mutation is recessive, the obese and hyperglycemic phenotype of Leptin-Ob mice is present only in mice homozygous for this mutation (Ob/Ob). Since both sexes of such Ob/Ob mice are not fertile, they have to be generated by pairing of heterozygous Ob males and females, obtaining 25% homozygous Ob/Ob offspring, both among males and females. Presence of the hIAPP transgene was proven by PCR with a forward primer in the rat insulin 2 gene promoter (RIPRev3F: 5’ GAGATGGAGACAGCTGGCTC 3’) and a reverse primer in exon 1 of the human IAPP gene (8910 + : 5’ GTCAGCAATATCAGCAAATGCTTCTG 3’), generating a product of approximately 700 bp in hIAPP transgenic mice only. Homozygosity for the hIAPP transgene in the hIAPP/Ob line was assessed using quantitative Southern dot blot hybridization [ 4 ]. In mice used for breeding hIAPP Ob/Ob offspring for this study, hIAPP homozygosity was confirmed by previous test matings with non-transgenic mice, yielding only hIAPP transgenic offspring. At an age of 2-3 weeks, pups were individually marked by ear cuts and the ear tissue removed was used for DNA analysis (PCR and DdeI digestion). All the mice were housed and bred in polypropylene cages containing hardwood bedding and maintained in air-conditioned rooms at 20-22 °C on a 12 h light/dark cycle in the Animal house of Utrecht University and the UMC Utrecht (GDL, which has an AADDCC license accreditation). Food and water were provided ad libitum. Anle138b was administered to mice via dietary admixture with CRM(E) food (at a dose of 2 g anle138b/kg food), prepared by Ssniff Spezialdiäten GmbH (Soest, Germany). Mice from the control groups received CRM (E) food without anle138b (Ssniff Spezialdiäten GmbH, Soest, Germany). For this study, only male mice from the non-transgenic Ob and the homozygous hIAPP/Ob sublines were used. Offspring from heterozygous Ob breeding pairs were genotyped, and homozygous Ob/Ob, as well as homozygous hIAPP Ob/Ob, males were treated with anle138b for 34-36 weeks from weaning (age 3-4 weeks) onwards. Male Ob/Ob and hIAPP Ob/Ob littermates were also used in the control groups, which received CRM(E) food without anle138b. Ob/Ob and hIAPP Ob/Ob mice were randomly assigned to each of the two treatment groups (with or without anle138b). Both the animal care takers of the GDL and the investigators performing the experiments and analyses were blinded to the treatment; the foods were coded before arrival at the GDL and these codes were not cracked until all data had been collected and analyzed. Bodyweight/food intake Bodyweights were determined prior to blood sampling, insulin sensitivity tests (IST) and glucose tolerance tests (GTT). Food intake was assessed after 6-7 months of treatment, by determining the weight of the food pellets placed on the grid of the cage on 4 consecutive days (each day between 9-10 am). The daily decrease in weight on each of these 3 days was first averaged per cage, then averaged per mouse for the 2-3 mice sharing the same cage, and expressed as grams/mouse/day. Blood sampling, IST, GTT Immediately before start of the compound treatment (t=0, age 3-4 weeks), blood for measurement of basal blood glucose-, plasma insulin- and plasma IAPP levels was obtained by submandibular (cheek pouch) puncture (without anesthesia), after 4 hours of fasting in the morning (at this timepoint 4 h of fasting was used since the mice were still very young; for the later timepoints 6h or 16 h of fasting was used). Blood was collected in K3 EDTA Minicollect tubes (Greiner GmbH, Germany) and stored on ice. Plasma was obtained by centrifugation of the EDTA blood sample for 5 min at 14000 x g at 4⁰C; the supernatant was aliquoted for insulin- and IAPP measurements and stored at -80⁰C until analyzed. After 16 and 32 weeks of treatment, blood for measurement of basal HbA1C-, glucose-, insulin- and IAPP levels was obtained by submandibular puncture after overnight fasting, collected in EDTA tubes (Greiner) and stored on ice. Prior to centrifugation for plasma collection, 30 µl of whole EDTA blood was taken for HbA1C determination and stored at -80⁰C until analyzed. Plasma obtained from the remainder of the blood was aliquoted for insulin- and IAPP measurements and stored at -80⁰C until analyzed. For the hIAPP Ob/Ob mice, additional blood sampling was performed after 23 weeks of treatment (1 week before the second IST, see below), after 6 h of fasting from 7 am onwards, mainly to get information about the insulin levels of the mice after a fasting procedure equal to that performed for the IST. Blood glucose measurements were performed during blood samplings at 0, 16, 23 and 32 weeks, by directly assessing 1 drop of whole blood using an Accu Chek Aviva glucose meter (Roche Diagnostics, Germany). In addition to the blood samplings described above, an intraperitoneal insulin sensitivity test (i.p. IST) was performed after 8 and 24 weeks of treatment. In the hIAPP Ob/Ob mice, an additional IST was performed after 34 weeks of treatment, whereas in the Ob/Ob mice an intraperitoneal glucose tolerance test (i.p. GTT) was performed after 34 weeks of treatment (because IST at earlier timepoints did not show an effect in the Ob/Ob mice; GTT was not considered appropriate for the hIAPP Ob/Ob mice because of their high basal blood glucose levels). All mice were killed by cervical dislocation after 34 weeks (Ob/Ob mice, after the GTT) or 36 weeks (hIAPP Ob/Ob mice, after overnight fasting) of treatment. Several organs (including pancreas) were collected and stored for further analysis. Bloodsampling immediately prior to cervical dislocation was performed by submandibular puncture and EDTA plasma was stored at -80⁰C until used for further analysis. IST: mice were fasted for 6 h from 7 am onwards and injected intraperitoneally with insulin at a dose of 3 units/kg (Ob/Ob mice at 8 weeks), 4 units/kg (Ob/Ob mice at 24 weeks) or 2.25 units/kg (hIAPP Ob/Ob mice at 8, 24 and 34 weeks). The insulin dose used at each age was determined by pilot studies in age- and bodyweight-matched (hIAPP)ObOb mice on control diet without anle138b, to determine a dose which would give an appropriate change in blood glucose levels, i.e. providing a sufficient window of opportunity to detect a significant change of insulin sensitivity. Human insulin intrarapid (Sanofi, France) was diluted with 0.9% NaCl to a concentration of 0.4 MUnit/µl, which was used for the i.p. injections. Blood sampling was performed immediately prior to insulin injection (t=0 min) and at 30, 60, 90, 120, 135 and 150 min after insulin injection, by tail tip bleeding, and 1 drop of blood was used for direct blood glucose measurements using an Accu Chek Aviva glucose meter (Roche Diagnostics). During all 3 ISTs of the hIAPP Ob/Ob mice (i.e. at 8, 24 and 34 weeks), blood glucose levels exceeded the upper limit of the glucose meter (33,3 mM) for several mice, both in the treated and the non-treated group, at one or more timepoints during this test. For these mice/timepoints, a second bloodsample was taken immediately, diluted 2-fold with 0.9% NaCl and measured. The read-out of this diluted blood sample was multiplied by 1,53 (this factor was empirically determined by similar dilution of bloodsamples with a known (< 33,3 mM) concentration). For two mice, several bloodsamples had to be diluted 3-fold and multiplied by 2.0 (also empirically determined) in order to get a read-out < 33,3 mM. GTT: mice were fasted for 6 h from 7 am onwards and injected intraperitoneally with glucose at a dose of 0.8 g/kg. The glucose dose used was determined by pilot studies in age- and bodyweight-matched Ob/Ob mice on control diet without anle138b, to determine a dose which would give an appropriate increase in blood glucose levels, i.e. providing a sufficient window of opportunity to detect a significant change in glucose tolerance. A 20% glucose solution in water was diluted 1:1 with 0.9% NaCl to a concentration of 10%; from this solution, 8 µl was injected per g bodyweight, corresponding to a dose of 0.8 g glucose per kg bodyweight. Blood sampling was performed immediately prior to glucose injection (t=0 min) and at 15, 30, 60, 90, 120 and 150 min after glucose injection, by tail tip bleeding, and 1 drop of blood was used for direct blood glucose measurements using an Accu Chek Aviva glucose meter (Roche Diagnostics). For 2 of the non-treated and 3 of the anle138b-treated Ob/Ob mice, blood glucose levels during the GTT exceeded the upper limit of the glucose meter ( > 33,3 mM); these mice were excluded from the analysis of this GTT. Blood HbA1c (mM glycated Hemoglobin/M total Hemoglobin) was determined in 30 µl of full (EDTA) blood by a direct whole blood enzymatic assay (Abbott Diagnostics, USA, product number 3L82-21) Plasma insulin was determined using a rat insulin RIA from Merck-Millipore (cat # RI-13K) cross-reacting with mouse insulin. Plasma IAPP was determined using a human IAPP (Amylin) ELISA from Merck-Millipore (cat # EZHA-52K) cross-reacting with mouse IAPP. Histological analyses After pancreas collection, the wet weight was determined and the tissue was fixed in 10 ml of 10% buffered formalin (overnight at room temperature). The formalin-fixed tissues were dehydrated and embedded in paraffin blocks. For quantification of the number of islets, islet size and amyloid content, 5 µm paraffin sections were cut at 3 different regions of the pancreas and stained with Congo red/haematoxylin, as described previously [ 15 ]. Congo red stained amyloid can be detected by fluorescence upon illumination with red light. Congo red stained slides were scanned using a Hamamatsu nanozoomer 2.0 RS, both in brightfield as well as in fluorescence mode using a TRITC filter (red channel); the brightfield- and fluorescence scans of each slide had an identical size. The resulting scans were annotated manually to select the islets (using the bright-field scans) and binary masks were generated to calculate the total cross-sectional area of islets. The smallest size of islets included for this analysis was 1915 ± 1382 µm 2 (average from all mice), corresponding to an islet diameter of approximately 5 cells. Using the red channel of the fluorescence scans, the islets were localized and by thresholding the fluorescence signal (using a predefined threshold), the resulting area of amyloid in each islet was calculated over the total islet area. The “islet number”, the average cross-sectional islet area (“islet size”), the average percentage of amyloid-positive islets (“amyloid prevalence”) and the average percentage of amyloid-positive islet area (“amyloid severity”) were determined for each mouse, by using the cumulative data from the 3 sections analyzed for each mouse. For quantification of the pancreatic β-cell mass, 3 µm paraffin sections cut at 3 different regions of the pancreas were stained with a rabbit anti-human insulin antibody (Invitrogen, clone 4C3Y9, 1:200) and a goat anti-rabbit Alexa Fluor 555 secondary antibody (Invitrogen, 1:200). The sections were mounted with Vectashield hardset with DAPI (Vector). The slides were scanned using a Hamamatsu nanozoomer 2.0 RS, both in bright-field as well as in fluorescence mode using a red filter. The total cross-sectional tissue area on each slide was quantified in QuPath (version 0.4.4) using the DAPI staining. The cross-sectional insulin-positive pancreas area on each slide was determined in Qupath using the immunofluorescence staining. The percentage of insulin-positive pancreas area (averaged from the 3 sections at the different regions) was multiplied by the wet weight of the total pancreas (determined at the time of collection) to quantify the total pancreatic β-cell mass of each mouse in mg. Transmission electron microscopy (TEM) Aliquots (4.5 µL) of 1 µM hIAPP 1-37 with amidated C-terminus and a Cys-2 to Cys-7 intramolecular disulfide bridge (Bachem, Switzerland), with or without 5 µM anle138b, were blotted for 1 min on carbon coated 200 mesh copper grids, that were glow-discharged beforehand, and then dried on a filter paper. The grids were then negatively stained with 4% uranyl acetate two times for 1 min, with drying between the two stainings and at the end of the last staining. TEM grids were imaged using a FEI-CM 120 electron microscope, operated at 120 kV. Images were recorded with a US1900 GATAN CCD camera (Gatan, Pleasanton, CA, USA). At low magnification, 50 square grid sections were observed; at high magnification, 10 square grid sections were observed. At high magnification, the different hIAPP species were observed for 3 representative square grid sections (each 80 µm 2 , from different regions of the same grid), counted and averaged per square. hIAPP aggregation and Dynamic light scattering (DLS) analysis DLS measurements of hIAPP in the absence and presence of anle138b were conducted on a Zetasizer Advance Red instrument (Malvern Instruments, UK) using a light scattering angle of 90°. The peptide sample (diluted from the 1.4 mM stock in DMSO/TFA to a final concentration 5 μM) was added to buffer containing 100 mM KCl, 10 mM MOPS/Tris at pH 7.4, in a clear disposable cell and equilibrated at room temperature for 60 s before data collection was started. Aliquots of anle138b, dissolved in DMSO, were added at the indicated concentrations prior to addition of the hIAPP. Each measurement was an average of three replicates measured on the same sample. The volume percentage (y-axis) gives the particle size distribution based on the volume of the multiple particles present in the sample, rather than their scattering intensity. The ZS Xplorer® application software was used for measurement control and data processing. Preparation of hIAPP oligomers for mitochondria experiments 1.4 mM stock solutions of hIAPP 1-37 with amidated C-terminus and a Cys-2 to Cys-7 intramolecular disulfide bridge (Abcam, UK) were prepared by dissolving 1 mg of lyophilised peptide in 99.9% DMSO/0.1% TFA. Aliquots of hIAPP stock were kept in LoBind® epitubes (Eppendorf) and snap-frozen immediately in liquid nitrogen to prevent aggregation. All samples were stored at -80 °C. hIAPP aggregation was carried out in a 96-well microtitre plate, by incubating 5 μM fresh monomeric hIAPP (diluted from the 1.4 mM stock in DMSO/TFA) in 10 mM MOPS (4-morpholinepropanesulfonic acid)/Tris, pH 7.4, buffer in a total volume of 200 μl. The plate was kept under shaking conditions (450 rpm) in a Comfort Thermomixer® (Eppendorf) at 37 °C for 45 min until oligomer formation. The latter was confirmed by (i) using the fluorescence probes DCVJ [9-(2,2-dicyanovinyl) julodine], which exhibits high sensitivity for early protein misfolding aggregates in the lag phase [ 60 ], and Thioflavin-T (ThT), which detects the cross-β structure of amyloid fibrils [ 61 ], hence, the oligomers were DCVJ-positive and ThT-negative; (ii) particle sizing using DLS (< 60 nm), and (iii) positive reactivity to A11 anti-oligomer antibodies [ 62 ]. The oligomer sample was either used immediately, or kept on ice and used within 1 h of preparation. Mitochondrial swelling and DLS analysis Mitochondria were harvested from SH-SY5Y cells using a cell mitochondrial isolation kit (MITOISO2, Sigma-Aldrich, Germany) according to the instructions provided. Mitochondria were harvested approximately once per week when cells had achieved 90% confluency. Typical mitochondrial pellet yield was ∼1mg/ml buffer (10 mM HEPES, pH 7.5, containing 0.25M sucrose, 1 mM ATP, 0.08 mM ADP, 5 mM sodium succinate, 2 mM K2HPO4). Mitochondria were stored for up to 48 h at 2-8 °C (to maintain their activity). Swelling assays on 0.125mg/ml mitochondria were performed at 25 °C in a low-volume disposable sizing cell, with readings taken every 10 min for 1 h using the multiple narrow modes analysis model of the ZS Xplorer® software. Mitochondria were incubated without treatment, with hIAPP oligomers and with hIAPP oligomers + anle138b. In the latter condition, anle138b was incubated with mitochondria for 10 min prior to addition of the hIAPP oligomers. The pore-forming peptide alamethicin was used as a positive control agent for mitochondrial swelling. Cytochrome c release (CCR) assay A cytochrome c release (CCR) assay (R&D systems Quantikine® ELISA) was employed to measure direct mitochondrial membrane damage by hIAPP oligomers, as described previously [ 63 ]. In these studies, isolated mitochondria (40 μg) were incubated at 30°C for 60 min with hIAPP oligomers and with hIAPP oligomers + anle138b. In the latter condition, anle138b was incubated with mitochondria for 10 min prior to addition of the hIAPP oligomers. The final volume in this assay was 100 μl in 1× mitochondrial storage buffer (MITOISO2®, Sigma-Aldrich, Germany). Supernatant fractions were obtained by pelleting the mitochondria (16,000 ×g, 10 min, 4 °C) and the amount of cytochrome c present in the supernatant was quantified using a colorimetric enzyme-linked immunosorbent assay (Quantikine®). Results are expressed as a percentage of CCR induced by 1% (v/v) Triton X-100 detergent (theoretical maximium: 100%). Mitochondrial membrane potential (JC-1) assay The potential across the inner mitochondrial membrane (ΔΨm) is around -150 mV in respiring mitochondria. Loss of inner membrane integrity leads to dissipation of the ΔΨm. The impact of hIAPP oligomers on ΔΨm of isolated mitochondria was assessed kinetically (every 5 min) by measuring the uptake of the fluorescent cationic dye JC-1 into the mitochondrial matrix over 45 min, using a proprietary kit as per instructions (Sigma-Aldrich, CS0760). In viable mitochondria, this dye concentrates in the matrix, where it forms bright red fluorescent agglomerates. Any event that leads to membrane depolarization (i.e. a decrease in the ΔΨm) prevents the uptake of the JC-1 dye into the mitochondria. The resulting dispersion of the dye remaining in solution causes a shift from red (agglomerated JC-1) to green fluorescence (JC-1 monomers). The JC-1 assay was performed using 5 μg of isolated mitochondria at 30 °C, with fluorescence top readings taken at 485 nm excitation and 590 nm emission in a microplate reader (Tecan Infinite® 200 Pro). Mitochondria were incubated without treatment, with hIAPP oligomers and with hIAPP oligomers + anle138b. In the latter condition, anle138b was incubated with mitochondria for 10 min prior to addition of the hIAPP oligomers. In each experiment, the protonophore FCCP (5 μM) was used to induce complete collapse of the ΔΨm; this baseline fluorescence value in the presence of FCCP was subtracted from all mitochondrial sample values. Statistical analysis Results are presented as means ± SEM (standard error of the mean) or as individual datapoints with their median value ( Fig. 4 ). An unpaired two-sided Student’s t test was used to analyze the effect of anle138b on mitochondrial cytochrome c release. Mann-Whithey test was used to analyze differences between the anle138b-treated and control groups in the assessment of islet number, islet size, pancreatic β-cell mass, and prevalence and severity of islet amyloidosis. One-way ANOVA (analysis of variance) with Bonferroni’s posthoc correction was used to analyze the effect of anle138b on hIAPP aggregation (DLC measurements), and on hIAPP induced mitochondrial swelling and mitochondrial membrane potential. Two-way ANOVA was used to analyze the effect of anle138b on food intake and blood HbA1c ratios; two-way ANOVA with repeated measures was used to assess differences in the time courses of bodyweight, basal blood glucose, and plasma insulin- and IAPP levels, as well as for the IST and GTT measurements. Relations between metabolic parameters (blood glucose, blood HbA1c and plasma insulin) and histomorphological parameters (islet number, islet size, pancreatic β-cell mass, islet amyloid prevalence and islet amyloid severity) were assessed using two-tailed Pearson or Spearman correlation coefficient (r). Linear regression was performed using R version 4.2.1. to examine if the slopes of two regression lines are significantly different. A p-value of ≤ 0.05 was considered to indicate a statistically significant difference/correlation. Study approval The procedures concerning animal care, treatment and experimentation for this study were performed in accordance with international guidelines and with previous approval from the local Committee for Animal Experimentation of Utrecht University and University Medical Center Utrecht (DEC), the local Experimental Animal Welfare body (IVD, Workprotocol 323-6-01) and the national Central Authority for Scientific Procedures on Animals (CCD) (license number AVD115002015323). Author contributions J.W.M.H. and C.G. designed the research; M.M.H.A, S.M.G.B., S.J.P.J.F., S.V., R.M.S., A.E., L.K. and J.W.M.H. performed the experiments; N.S. developed the script for image analysis of the histological sections; A.L. and S.R. provided the mouse foods with/without anle138b and participated in the design of the study; A.G. and S.R. participated in ongoing discussions during the research; M.M.H.A., S.M.G.B., H.L.D.M.W, N.V. and J.W.M.H. analyzed the data; B.G. assisted with the statistical analyses; M.M.H.A and J.W.M.H. organized the original data and prepared the figures and the text; M.M.H.A., N.V., N.E., C.G. and J.W.M.H. performed the review and editing of the paper; N.V., N.E., C.G. and J.W.M.H. supervised the work. Further information and requests for resources and reagents should be directed to the Lead Contact: jlamwhoppener{at}hetnet.nl . Declaration of interests A. G. and C. G. are co-founders of MODAG. A.G. is a full-time employee of MODAG. A. L. and S.R. are partly employed by MODAG and are beneficiaries of the phantom share program of MODAG GmbH. A.L., S.R., C.G. and A.G. are co-inventors of WO/2010/000372. Anle138b is licensed by Teva Pharmaceutical Industries Ltd and is in clinical development in collaboration with MODAG. Acknowledgments This work was financially supported by the Max Planck Society in a project grant. We thank Anja van der Sar and Trudy Oosterveld-Romijn (GDL, Utrecht University, Utrecht, The Netherlands) for assistance with the mouse experiments; Inge Maitimu (Clinical Chemistry, University Medical Center Utrecht, The Netherlands) for the blood HbA1c, plasma insulin and plasma IAPP measurements; Domenico Castigliego (Pathology, University Medical Center Utrecht, The Netherlands) for scanning of the Congo red- and insulin stained pancreatic sections, Jens Brüning (Max Planck Institute for Metabolism Research, Cologne, Germany) for ongoing discussions during the research, and Andisheh Abedini (New York University, New York City, USA) for critical reading of the manuscript. NV acknowledges financial grant support from the Malta Council for Science & Technology (MCST) through the Research Excellence Programme (REP-2021-016). AE was supported by the Tertiary Education Scholarship Scheme (TESS) of the Ministry for Education and Employment, Malta. M.M.H.A acknowledges financial grant support from King Abdulaziz City for Science and Technology (KACST), Saudi Arabia. Footnotes ↵ 11 Lead contact References 1. ↵ Sun , H. , et al. , IDF Diabetes Atlas: Global, regional and country-level diabetes prevalence estimates for 2021 and projections for 2045 . Diabetes Res Clin Pract , 2022 . 183 : p. 109119 . OpenUrl CrossRef PubMed 2. ↵ Jaacks , L.M. , et al. , Type 2 diabetes: A 21st century epidemic . Best Pract Res Clin Endocrinol Metab , 2016 . 30 ( 3 ): p. 331 – 43 . OpenUrl PubMed 3. ↵ Smyth , S. and A. Heron , Diabetes and obesity: the twin epidemics . Nat Med , 2006 . 12 ( 1 ): p. 75 – 80 . OpenUrl CrossRef PubMed Web of Science 4. ↵ Höppener , J.W. , B. Ahren , and C.J. Lips , Islet amyloid and type 2 diabetes mellitus . N Engl J Med , 2000 . 343 ( 6 ): p. 411 – 9 . OpenUrl CrossRef PubMed Web of Science 5. ↵ Soeller , W.C. , et al. , Islet amyloid-associated diabetes in obese A(vy)/a mice expressing human islet amyloid polypeptide . Diabetes , 1998 . 47 ( 5 ): p. 743 – 50 . OpenUrl Abstract 6. ↵ Khemtemourian , L. , et al. , Recent insights in islet amyloid polypeptide-induced membrane disruption and its role in beta-cell death in type 2 diabetes mellitus . Exp Diabetes Res , 2008 . 2008: p. 421287 . 7. ↵ Westermark , P. et al. , Islet amyloid polypeptide: pinpointing amino acid residues linked to amyloid fibril formation . Proc Natl Acad Sci USA , 1990 . 87 ( 13 ): p. 5036 – 40 . OpenUrl Abstract / FREE Full Text 8. ↵ Hull , R.L. , et al. , Islet amyloid: a critical entity in the pathogenesis of type 2 diabetes . J Clin Endocrinol Metab , 2004 . 89 ( 8 ): p. 3629 – 43 . OpenUrl CrossRef PubMed Web of Science 9. ↵ Makin , O.S. , et al. , Molecular basis for amyloid fibril formation and stability . Proc Natl Acad Sci U S A , 2005 . 102 ( 2 ): p. 315 – 20 . OpenUrl Abstract / FREE Full Text 10. ↵ Abedini , A. , et al. , Time-resolved studies define the nature of toxic IAPP intermediates, providing insight for anti-amyloidosis therapeutics . Elife , 2016 . 5 . 11. ↵ Lorenzo , A. , et al. , Pancreatic islet cell toxicity of amylin associated with type-2 diabetes mellitus . Nature , 1994 . 368 ( 6473 ): p. 756 – 60 . OpenUrl CrossRef PubMed 12. ↵ Jurgens , C.A. , et al. , beta-cell loss and beta-cell apoptosis in human type 2 diabetes are related to islet amyloid deposition . Am J Pathol , 2011 . 178 ( 6 ): p. 2632 – 40 . OpenUrl CrossRef PubMed Web of Science 13. ↵ Kiriyama , Y. and H. Nochi , Role and Cytotoxicity of Amylin and Protection of Pancreatic Islet beta-Cells from Amylin Cytotoxicity . Cells , 2018 . 7 ( 8 ). 14. ↵ Montemurro , C. , et al. , IAPP toxicity activates HIF1alpha/PFKFB3 signaling delaying beta-cell loss at the expense of beta-cell function . Nat Commun , 2019 . 10 ( 1 ): p. 2679 . OpenUrl CrossRef PubMed 15. ↵ Höppener , J.W. , et al. , Extensive islet amyloid formation is induced by development of Type II diabetes mellitus and contributes to its progression: pathogenesis of diabetes in a mouse model . Diabetologia , 1999 . 42 ( 4 ): p. 427 – 34 . OpenUrl CrossRef PubMed Web of Science 16. ↵ Mukherjee , A. , et al. , Type 2 diabetes as a protein misfolding disease . Trends Mol Med , 2015 . 21 ( 7 ): p. 439 – 49 . OpenUrl CrossRef PubMed 17. ↵ van Dyck , C.H. , et al. , Lecanemab in Early Alzheimer’s Disease . N Engl J Med , 2023 . 388 ( 1 ): p. 9 – 21 . OpenUrl CrossRef 18. ↵ Bortoletto , A.S. , et al. , Human Islet Amyloid Polypeptide (hIAPP) Protofibril-Specific Antibodies for Detection and Treatment of Type 2 Diabetes . Adv Sci (Weinh) , 2022 . 9 ( 34 ): p. e2202342 . OpenUrl 19. ↵ Wirth , F. , et al. , A human antibody against pathological IAPP aggregates protects beta cells in type 2 diabetes models . Nat Commun , 2023 . 14 : 6294 OpenUrl 20. ↵ Bram , Y. , et al. , Active Immunization Against hIAPP Oligomers Ameliorates the Diabetes-Associated Phenotype in a Transgenic Mice Model . Sci Rep , 2017 . 7 ( 1 ): p. 14031 . OpenUrl 21. ↵ Wegrzynowicz , M. , et al. , Depopulation of dense alpha-synuclein aggregates is associated with rescue of dopamine neuron dysfunction and death in a new Parkinson’s disease model . Acta Neuropathol , 2019 . 138 ( 4 ): p. 575 – 595 . OpenUrl CrossRef PubMed 22. ↵ Wagner , J. , et al. , Anle138b: a novel oligomer modulator for disease-modifying therapy of neurodegenerative diseases such as prion and Parkinson’s disease . Acta Neuropathol , 2013 . 125 ( 6 ): p. 795 – 813 . OpenUrl CrossRef PubMed Web of Science 23. ↵ Wagner , J. , et al. , Reducing tau aggregates with anle138b delays disease progression in a mouse model of tauopathies . Acta Neuropathol , 2015 . 130 ( 5 ): p. 619 – 31 . OpenUrl CrossRef PubMed 24. ↵ Brendel , M. , et al. , Late-stage Anle138b treatment ameliorates tau pathology and metabolic decline in a mouse model of human Alzheimer’s disease tau . Alzheimers Res Ther , 2019 . 11 ( 1 ): p. 67 . OpenUrl 25. ↵ Martinez Hernandez , A. , et al. , Low-Expressing Synucleinopathy Mouse Models Based on Oligomer-Forming Mutations and C-Terminal Truncation of alpha-Synuclein . Front Neurosci , 2021 . 15 : p. 643391 . OpenUrl 26. ↵ Levin , J. , et al. , The oligomer modulator anle138b inhibits disease progression in a Parkinson mouse model even with treatment started after disease onset . Acta Neuropathol , 2014 . 127 ( 5 ): p. 779 – 80 . OpenUrl CrossRef PubMed 27. ↵ Heras-Garvin , A. , et al. , Anle138b modulates alpha-synuclein oligomerization and prevents motor decline and neurodegeneration in a mouse model of multiple system atrophy . Mov Disord , 2019 . 34 ( 2 ): p. 255 – 263 . OpenUrl CrossRef 28. ↵ Katsikoudi , A. , et al. , Quantitative propagation of assembled human Tau from Alzheimer’s disease brain in microfluidic neuronal cultures . J Biol Chem , 2020 . 295 ( 37 ): p. 13079 – 13093 . OpenUrl Abstract / FREE Full Text 29. ↵ Levin , J. , et al. , Safety, tolerability and pharmacokinetics of the oligomer modulator anle138b with exposure levels sufficient for therapeutic efficacy in a murine Parkinson model: A randomised, double-blind, placebo-controlled phase 1a trial . EBioMedicine , 2022 . 80 : p. 104021 . OpenUrl 30. ↵ Höppener , J.W. , et al. , Chronic overproduction of islet amyloid polypeptide/amylin in transgenic mice: lysosomal localization of human islet amyloid polypeptide and lack of marked hyperglycaemia or hyperinsulinaemia . Diabetologia , 1993 . 36 ( 12 ): p. 1258 – 65 . OpenUrl CrossRef PubMed Web of Science 31. ↵ Nedumpully-Govindan , P. , et al. , Stabilizing Off-pathway Oligomers by Polyphenol Nanoassemblies for IAPP Aggregation Inhibition . Sci Rep , 2016 . 6 : p. 19463 . OpenUrl CrossRef PubMed 32. ↵ Pinti , M.V. , et al. , Mitochondrial dysfunction in type 2 diabetes mellitus: an organ-based analysis . Am J Physiol Endocrinol Metab , 2019 . 316 ( 2 ): p. E268 – E285 . OpenUrl CrossRef 33. ↵ Weksler-Zangen , S ., Is Type 2 Diabetes a Primary Mitochondrial Disorder? Cells , 2022 . 11 ( 10 ). 34. ↵ Lim , Y.A. , et al. , Abeta and human amylin share a common toxicity pathway via mitochondrial dysfunction . Proteomics , 2010 . 10 ( 8 ): p. 1621 – 33 . OpenUrl CrossRef PubMed 35. ↵ Chen , J.X. and S.D. Yan , Amyloid-beta-induced mitochondrial dysfunction . J Alzheimers Dis , 2007 . 12 ( 2 ): p. 177 – 84 . OpenUrl 36. ↵ Janson , J. , et al. , Spontaneous diabetes mellitus in transgenic mice expressing human islet amyloid polypeptide . Proc Natl Acad Sci U S A , 1996 . 93 ( 14 ): p. 7283 – 8 . OpenUrl Abstract / FREE Full Text 37. ↵ Matveyenko , A.V. and P.C. Butler , Islet amyloid polypeptide (IAPP) transgenic rodents as models for type 2 diabetes . ILAR J , 2006 . 47 ( 3 ): p. 225 – 33 . OpenUrl CrossRef PubMed Web of Science 38. ↵ Albariqi , M.M. , et al. , Human IAPP is a contributor to painful diabetic peripheral neuropathy . J Clin Invest , 2023 . 133 ( 8 ). 39. ↵ Soto , C. and S. Pritzkow , Protein misfolding, aggregation, and conformational strains in neurodegenerative diseases . Nat Neurosci , 2018 . 21 ( 10 ): p. 1332 – 1340 . OpenUrl CrossRef PubMed 40. ↵ Eisele , Y.S. , et al. , Targeting protein aggregation for the treatment of degenerative diseases . Nat Rev Drug Discov , 2015 . 14 ( 11 ): p. 759 – 80 . OpenUrl CrossRef PubMed 41. ↵ Minakawa , E.N. and Y. Nagai , Protein Aggregation Inhibitors as Disease-Modifying Therapies for Polyglutamine Diseases . Front Neurosci , 2021 . 15 : p. 621996 . OpenUrl 42. ↵ Akter , R. , et al. , Islet Amyloid Polypeptide: Structure, Function, and Pathophysiology . J Diabetes Res , 2016 . 2016: p. 2798269 . 43. Chaari , A. and M. Ladjimi , Human islet amyloid polypeptide (hIAPP) aggregation in type 2 diabetes: Correlation between intrinsic physicochemical properties of hIAPP aggregates and their cytotoxicity . Int J Biol Macromol , 2019 . 136 : p. 57 – 65 . OpenUrl 44. ↵ Nguyen , P.H. , et al. , Amyloid Oligomers: A Joint Experimental/Computational Perspective on Alzheimer’s Disease, Parkinson’s Disease, Type II Diabetes, and Amyotrophic Lateral Sclerosis . Chem Rev , 2021 . 121 ( 4 ): p. 2545 – 2647 . OpenUrl CrossRef PubMed 45. ↵ Gadad , B.S. , G.B. Britton , and K.S. Rao , Targeting oligomers in neurodegenerative disorders: lessons from alpha-synuclein, tau, and amyloid-beta peptide . J Alzheimers Dis , 2011 . 24 Suppl 2 : p. 223 – 32 . OpenUrl 46. ↵ Masters , S.L. , et al. , Activation of the NLRP3 inflammasome by islet amyloid polypeptide provides a mechanism for enhanced IL-1beta in type 2 diabetes . Nat Immunol , 2010 . 11 ( 10 ): p. 897 – 904 . OpenUrl CrossRef PubMed Web of Science 47. ↵ Abedini , A. , et al. , RAGE binds preamyloid IAPP intermediates and mediates pancreatic beta cell proteotoxicity . J Clin Invest , 2018 . 128 ( 2 ): p. 682 – 698 . OpenUrl CrossRef 48. ↵ Höppener , J.W. and C.J. Lips , Role of islet amyloid in type 2 diabetes mellitus . Int J Biochem Cell Biol , 2006 . 38 ( 5-6 ): p. 726 – 36 . OpenUrl CrossRef PubMed 49. ↵ Lim , H. , et al. , A novel autophagy enhancer as a therapeutic agent against metabolic syndrome and diabetes . Nat Commun , 2018 . 9 ( 1 ): p. 1438 . OpenUrl CrossRef 50. ↵ Kim , J. , et al. , An autophagy enhancer ameliorates diabetes of human IAPP-transgenic mice through clearance of amyloidogenic oligomer . Nat Commun , 2021 . 12 ( 1 ): p. 183 . OpenUrl 51. ↵ Tait , S.W. and D.R. Green , Mitochondrial regulation of cell death . Cold Spring Harb Perspect Biol , 2013 . 5 ( 9 ). 52. ↵ Akbar , M. , et al. , Mitochondrial dysfunction and cell death in neurodegenerative diseases through nitroxidative stress . Brain Res , 2016 . 1637 : p. 34 – 55 . OpenUrl 53. ↵ Brustovetsky , N. , et al. , Calcium-induced cytochrome c release from CNS mitochondria is associated with the permeability transition and rupture of the outer membrane . J Neurochem , 2002 . 80 ( 2 ): p. 207 – 18 . OpenUrl CrossRef PubMed Web of Science 54. ↵ Li , X.L. , et al. , Involvement of mitochondrial dysfunction in human islet amyloid polypeptide-induced apoptosis in INS-1E pancreatic beta cells: An effect attenuated by phycocyanin . Int J Biochem Cell Biol , 2011 . 43 ( 4 ): p. 525 – 34 . OpenUrl CrossRef PubMed 55. ↵ Hernandez , M.G. , et al. , Pancreatic beta cells overexpressing hIAPP impaired mitophagy and unbalanced mitochondrial dynamics . Cell Death Dis , 2018 . 9 ( 5 ): p. 481 . OpenUrl 56. ↵ Martinez Hernandez , A. , et al. , The diphenylpyrazole compound anle138b blocks Abeta channels and rescues disease phenotypes in a mouse model for amyloid pathology . EMBO Mol Med , 2018 . 10 ( 1 ): p. 32 – 47 . OpenUrl Abstract / FREE Full Text 57. ↵ Komici , K. , et al. , Diabetes Mellitus and Parkinson’s Disease: A Systematic Review and Meta-Analyses . J Parkinsons Dis , 2021 . 11 ( 4 ): p. 1585 – 1596 . OpenUrl CrossRef 58. ↵ Santiago , J.A. and J.A. Potashkin , The Impact of Disease Comorbidities in Alzheimer’s Disease . Front Aging Neurosci , 2021 . 13 : p. 631770 . OpenUrl CrossRef 59. ↵ Suriano , F. , et al. , Novel insights into the genetically obese (ob/ob) and diabetic (db/db) mice: two sides of the same coin . Microbiome , 2021 . 9 ( 1 ): p. 147 . OpenUrl 60. ↵ Nagarajan , S. and L.J. Lapidus , Fluorescent Probe DCVJ Shows High Sensitivity for Characterization of Amyloid beta-Peptide Early in the Lag Phase . Chembiochem , 2017 . 18 ( 22 ): p. 2205 – 2211 . OpenUrl 61. ↵ LeVine , H ., 3rd, Quantification of beta-sheet amyloid fibril structures with thioflavin T . Methods Enzymol , 1999 . 309 : p. 274 – 84 . OpenUrl CrossRef PubMed Web of Science 62. ↵ Kayed , R. , et al. , Fibril specific, conformation dependent antibodies recognize a generic epitope common to amyloid fibrils and fibrillar oligomers that is absent in prefibrillar oligomers . Mol Neurodegener , 2007 . 2 : p. 18 . OpenUrl CrossRef PubMed 63. ↵ Camilleri , A. , et al. , Mitochondrial membrane permeabilisation by amyloid aggregates and protection by polyphenols . Biochim Biophys Acta , 2013 . 1828 ( 11 ): p. 2532 – 43 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted August 30, 2024. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following The amyloid oligomer modulator anle138b has disease modifying effects in a human IAPP transgenic mouse model of type 2 diabetes mellitus (hIAPP Ob/Ob mice) Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share The amyloid oligomer modulator anle138b has disease modifying effects in a human IAPP transgenic mouse model of type 2 diabetes mellitus (hIAPP Ob/Ob mice) Mohammed M. H. Albariqi , Sanne M.G. Baauw , Sjors J.P.J. Fens , Sabine Versteeg , Sergey Ryazanov , Andrei Leonov , Hanneke L.D.M. Willemen , Nikolas Stathonikos , Raina Marie Seychell , Adam El Saghir , Bram Gerritsen , Lucie Khemtemourian , Neville Vassallo , Armin Giese , Niels Eijkelkamp , Christian Griesinger , Jo W. M. Höppener bioRxiv 2024.08.27.609850; doi: https://doi.org/10.1101/2024.08.27.609850 Share This Article: Copy Citation Tools The amyloid oligomer modulator anle138b has disease modifying effects in a human IAPP transgenic mouse model of type 2 diabetes mellitus (hIAPP Ob/Ob mice) Mohammed M. H. Albariqi , Sanne M.G. Baauw , Sjors J.P.J. Fens , Sabine Versteeg , Sergey Ryazanov , Andrei Leonov , Hanneke L.D.M. Willemen , Nikolas Stathonikos , Raina Marie Seychell , Adam El Saghir , Bram Gerritsen , Lucie Khemtemourian , Neville Vassallo , Armin Giese , Niels Eijkelkamp , Christian Griesinger , Jo W. M. Höppener bioRxiv 2024.08.27.609850; doi: https://doi.org/10.1101/2024.08.27.609850 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Pathology Subject Areas All Articles Animal Behavior and Cognition (7651) Biochemistry (17746) Bioengineering (13928) Bioinformatics (42066) Biophysics (21499) Cancer Biology (18650) Cell Biology (25579) Clinical Trials (138) Developmental Biology (13409) Ecology (19947) Epidemiology (2067) Evolutionary Biology (24374) Genetics (15633) Genomics (22557) Immunology (17775) Microbiology (40505) Molecular Biology (17217) Neuroscience (88796) Paleontology (667) Pathology (2845) Pharmacology and Toxicology (4836) Physiology (7664) Plant Biology (15179) Scientific Communication and Education (2047) Synthetic Biology (4304) Systems Biology (9839) Zoology (2272)