Exogenous Methyl Jasmonate Mediated Physiological and Transcriptomic Network Improves Thrips tolerance in alfalfa (Medicago Sativa. L)

Exogenous Methyl Jasmonate Mediated Physiological and Transcriptomic Network Improves Thrips tolerance in alfalfa (Medicago Sativa. L) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Exogenous Methyl Jasmonate Mediated Physiological and Transcriptomic Network Improves Thrips tolerance in alfalfa (Medicago Sativa. L) Shuang Shuang, Huo Xiaowei, qi chen, Dai Rui, Jianwei li, Jiaxin yan, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4853165/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Feb, 2025 Read the published version in Journal of Pest Science → Version 1 posted 9 You are reading this latest preprint version Abstract Exogenous methyl jasmonate is widely acknowledged for its role in triggering plants' defense systems against pest invasions. Nonetheless, there has been a dearth of research exploring the elicitation of defense mechanisms by jasmonic acid in alfalfa. In order to investigate the effect of methyl jasmonate on thrips resistance in alfalfa, Medicago sativa L.cv. Caoyuan No. 4 was exogenously sprayed with different concentrations of methyl jasmonate, and thrips and Orius strigicolli (natural enemies) behavioral choice, physiological and transcriptomic analyses were performed. The results revealed a concentration-dependent inducible effect of methyl jasmonate on the behavioral choice, feeding and oviposition of thrips mediated by volatile organic compounds. Moreover, methyl jasmonate treatment at varying concentrations significantly influenced the activity levels of defense enzymes and secondary metabolites in alfalfa. Notably, the most pronounced induction effect of methyl jasmonate was observed at a concentration of 0.1 mmol/L, particularly evident in the enhanced activity of peroxidase, polyphenol oxidase, lipoxygenase and tannins. Transcriptome analysis showed that differentially expressed genes between methyl jasmonate treatment and CK were mainly enriched in metabolic pathways and plant hormone signal transduction pathways such as terpenoid biosynthesis, linoleic acid metabolism and jasmonate signal transduction. Subsequent pathway analysis elucidated the potential of methyl jasmonate treatment to elevate endogenous jasmonic acid levels and instigate the activation of the jasmonate signaling pathway. Methyl jasmonate Alfalfa Thrips Volatiles Transcriptome Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Key Message Thrips are polyphagous invasive pests that significantly threaten the productivity of alfalfa. 0.1 mmol/L and 0.01 mmol/L exogenous MeJA treatment significantly limited the behavioral choice, feeding and oviposition of thrips in alfalfa. 6 differentially VOCs which might be involved in the thrips behavioral choice were detected. Terpenoid biosynthesis, linoleic acid metabolism and jasmonate signal transduction pathways might response to MeJA-mediated thrips resistance in alfalfa. Introduction Alfalfa ( Medicago sativa L.), one of the most vital leguminous forage crops worldwide, is renowned for its exceptional adaptability, high yield, superior quality, and robust stress resistance. Thrips are significant agricultural pests, known for their high adaptability and polyphagous feeding habits. Research indicates that thrips are among the primary pests affecting alfalfa in Northwest China, inflicting substantial damage by ovipositing and feeding on young leaves, petals, and pollen. This activity depletes plant nutrients, inhibits growth, and severely reduces yield (Mound 2005 ; Liu et al. 2021 ; Wu et al. 2021 ). Furthermore, thrips serve as the primary vectors for Tomato Spotted Wilt Virus (TSWV), which can lead to crop losses ranging from 30–50% (Reitz 2014 ). Their small size, rapid reproduction, and short generation times make thrips particularly challenging to control. The extensive use of chemical insecticides has led to significant resistance in thrips populations, adverse effects on non-target organisms, and environmental contamination (Jensen 2000 ; Han et al. 2019 ). Consequently, alternative pest management strategies are imperative throughout the growing season to reduce reliance on insecticides and mitigate damage. Through the co-evolutionary arms race with herbivorous insects, plants have evolved intricate defense mechanisms to mitigate herbivory. These defense strategies primarily encompass constitutive defenses and inducible defenses. Constitutive defenses are intrinsic plant capabilities that have progressively evolved over prolonged periods of growth and evolution, whereas inducible defenses are activated in response to herbivory, mechanical damage, or exogenous signal induction (Liu et al. 2022 ). Notably, certain constitutive defenses are markedly amplified upon plant damage, and inducible defenses, which exhibit high species specificity, do not impose a considerable metabolic burden on the host plant. Consequently, they have emerged as a prominent research focus in recent years. Each defense type can be classified as either direct or indirect defense (Fer and Boland 2012 ). A quintessential example of direct defense includes morphological defenses such as augmented trichomes, thorns, and lignification (War et al. 2018 ). For instance, glandular trichomes of plants secrete and store specialized secondary metabolites, potentially containing toxic substances that mitigate feeding, inhibit digestion, or reduce oviposition (Feng et al. 2023 ). Indirect defenses can attract organisms from other trophic levels (Heil 2008 ). For instance, certain volatile organic compounds (VOCs) emitted by plants serve to attract natural enemies or repel herbivorous insects (Karban 2011 ). Inducible defense mechanisms can be elicited by exogenous applications of synthetic elicitors, such as JA and MeJA (Williams et al. 2017 ) . Upon attack by pests and pathogens, plants orchestrate their defense responses through a network of interconnected signaling pathways, notably the JA, salicylic acid (SA), and ethylene (ET) pathways (Sarde et al. 2019 ). Among these pathways, the JA pathway predominantly regulates the expression of downstream defense genes, playing a pivotal role in plant defense mechanisms. Studies have demonstrated that thrip infestation triggers the activation of genes involved in JA synthesis and signal transduction. Post-infestation, the expression levels of JA synthesis genes and JA content markedly increase in Arabidopsis and tomato. Moreover, the exogenous application of JA has been shown to bolster plant resistance to thrips by activating the JA pathway (Abe et al. 2008 ; Escobar-Bravo et al. 2017 ). Our prior research identified that thrip infestation significantly upregulates the key genes within the JA signaling pathway in alfalfa (Zhang et al. 2021 ). Therefore, we hypothesize that JA plays a critical role in the inducible anti-thrip defense mechanism in alfalfa. Nevertheless, the precise mechanisms underlying JA-mediated thrip resistance in alfalfa remain elusive and necessitate further investigation. MeJA exhibits greater activity and volatility compared to other jasmonate derivatives when applied exogenously (Horbowicz et al. 2011 ). Exogenous application of MeJA can enhance plant defensive metabolites, activate plant defense genes, and generate toxic and repellent compounds, negatively impacting the feeding, growth, and reproduction of pests(Kazemi 2014 ). For example, tomatoes treated with MeJA exhibited detrimental effects on the reproductive capacity and population growth rate of aphids (Boughton et al. 2006 ). Exogenous MeJA treatment activated endogenous defenses in mustard ( Brassica juncea L.) against aphids, inhibiting the population growth potential of mustard aphids(Koramutla et al. 2014 ). MeJA treatment induced defensive responses in cassava ( Manihot esculenta L.) against two-spotted spider mites ( Tetranychus urticae Koch), including reduced oviposition, adult longevity, slower development, and prolonged egg duration(Zhang et al. 2023 ). War et al. ( 2011a ) applied JA to three peanut ( Arachis hypogaea L.) cultivars with varying levels of pest resistance to induce resistance against Helicoverpa armigera . The study demonstrated that JA induction significantly increased PPO, POD, and total phenol content in the leaves of the three cultivars, enhancing the resistance level of the susceptible cultivar TMV 2 against H. armigera . VOCs play pivotal roles in predator search for suitable prey or hosts on herbivore-infested plants (War et al. 2011b ). For instance, following the exogenous application of JA to sugarcane, both the sugarcane borer ( Diatraea saccharalis ) and the fall armyworm ( Spodoptera frugiperda ) exhibited a preference for feeding on control plants over JA-treated plants in dual-choice experiments (Sanches et al. 2017 ). Furthermore, under field conditions, wheat plants treated with varying doses of MeJA exhibited inhibitory effects on thrips while attracting ladybird beetle communities (Bayram and Tonğa 2018 ) . To investigate the effect of exogenous jasmonic acid on thrips resistance in alfalfa, alfalfa plants were exogenously sprayed with distilled water (CK), 0.01 mmol/L, 0.1 mmol/L, and 1 mmol/L MeJA, respectively, and thrips and Orius strigicolli (natural enemies) behavioral choice, insect index, physiological and biochemical indexes, and hormone were analyzed. To gain comprehensive insights into the potential mechanisms underlying MeJA-induced resistance, we conducted further analyses of the volatile compounds and transcriptomic profiles of alfalfa subjected to 0.1 mmol/L exogenous MeJA treatment. The findings of this study elucidate the impact of jasmonic acid-related plant defense mechanisms on thrips and offer novel insights for the development of effective thrips management strategies. Materials and methods 1.1 Plants and insect s The test plant utilized in this study was the ‘CaoYuan No. 4’ alfalfa cultivar, bred by Inner Mongolia Agricultural University. One day prior to sowing, the seeds were immersed in a 10% sodium hypochlorite solution for 15 minutes, thoroughly rinsed with distilled water, and subsequently soaked in distilled water for 12 hours. Six plants were initially cultivated per pot. Upon the emergence of the fourth true leaf, uniformly growing seedlings were thinned to three plants per pot to ensure consistent growth conditions. These plants were cultivated for 45 days prior to testing. The test insect employed was Odontothrips loti , collected from the alfalfa cultivation base at Inner Mongolia Agricultural University. Thrips were captured using an insect aspirator and subsequently transported to the laboratory, where they were reared on broad beans within an incubator. Multiple generations of thrips were cultured to obtain uniform growth stages for test. The incubator conditions were maintained at a temperature of 25 ± 1°C, relative humidity of 65 ± 1%, and a photoperiod of 16 hours light and 8 hours dark. Orius strigicolli was sourced from Keyun Bio of Baiyun Industrial Co., Ltd., Jiyuan, Henan Province, China, with technical support provided by the Chinese Academy of Sciences. 1.2 Behavioral Choice Assay for Thrips and Orius strigicolli After 45 days of cultivation, alfalfa plants were subjected to treatments with exogenous applications of 0.01 mmol/L, 0.1 mmol/L, and 1 mmol/L MeJA. Distilled water treatment served as the control (CK). The plants were sprayed for three consecutive days until the treatment solution thoroughly covered the leaves and dripped off. To prevent evaporation, the plants were covered with transparent plastic bags post-spraying, which were removed 8 hours later. An olfactometer was employed to analyze the attraction of Odontothrips loti and Orius strigicolli to leaves treated with varying concentrations of MeJA in comparison to the CK, referencing the method of Fraga et al. ( 2017a ), with minor modifications. The olfactometer was constructed from transparent acrylic and featured four arms, sequentially connected via silicone tubes to odor source bottles, activated charcoal, and flow meters. To mitigate interference from natural light during the experiment, a 15 W fluorescent lamp was utilized to provide balanced illumination directly above the apparatus(Mizuno et al. 2022 ). The airflow in each arm was regulated at 300 mL/min, and the room temperature was maintained at 25 ± 3°C. Plant materials were placed in the odor source bottles, ensuring identical treatments on opposite arms. A vacuum was applied for 10 minutes to saturate the arms with the odor. Subsequently, thrips were introduced into the activity chamber of the olfactometer, which had a diameter of 12 cm. Each set of odor sources was tested with 30 Odontothrips loti and Orius strigicolli , repeated five times, with the bioassay conducted from 9:00 to 15:00. The test duration was 10 minutes, and Odontothrips loti and Orius strigicolli that reached halfway along any arm were considered to have made a choice, while those that did not were recorded as unresponsive. Following each test, the olfactometer was meticulously wiped inside and out with anhydrous ethanol and dried, then rotated and reconnected to the odor source bottles. 1.3 Thrips feeding and oviposition analysis Exogenous applications of 0.01 mmol/L, 0.1 mmol/L, and 1 mmol/L MeJA were conducted, with distilled water serving as the control (CK). The plants were sprayed for three consecutive days, subsequently inoculated with 30 Odontothrips loti per plant. Post-inoculation, a 200-mesh insect-proof net was utilized to prevent the thrips from escaping. The inoculation periods were set to 7 days and 14 days. A standardized counting method was employed to determine the results of thrips feeding on the entire alfalfa plant. Each treatment was replicated three times. The trypan blue staining method was utilized to analyze the thrips oviposition, referencing the technique of Steenbergen et al. ( 2020 ). Three leaves from identical positions on the upper half of the alfalfa plant were selected for each treatment, with three replicates. The leaves were stained using the trypan blue staining method and subsequently observed under an Olympus SZX10 research-grade stereo microscope to count the number of eggs laid by the thrips. 1.4 Determination of physiological indices of MeJA-treated leaves 1.4.1 Measurement of defense enzymes and secondary metabolites Leaves from both CK and 0.1 mmol/L exogenous MeJA-treated plants were rapidly immersed in liquid nitrogen, and all samples subsequently stored in an ultra-low temperature freezer at -80°C for future physiological measurements. The physiological indices were assessed using reagent kits, all procured from Solarbio Science & Technology Co., Ltd., Beijing. Superoxide dismutase (SOD), peroxidase (POD), phenylalanine ammonia-lyase (PAL), polyphenol oxidase (PPO), flavonoids, total phenols, and tannins(batch number 2305001); lipoxygenase (LOX) (batch number 2304001) were among the indices measured. The specific procedures adhered to the instructions provided with the reagent kits. 1.4.2 Hormone measurement Measurement of JA and SA content in plant materials treated with 0.1 mmol/L MeJA and inoculated with thrips. SA measurement Take 1 mL of formic acid and dilute it to 1000 mL with a methanol-water mixture. Weigh exactly 2 g of the sample and place it in a 100 mL stoppered conical flask. Accurately add 50 mL of extraction solvent and extract by shaking at 150 r/min for 10 minutes. Transfer 3 mL of the extract into a 10 mL centrifuge tube and centrifuge at 5000 r/min for 10 minutes. Filter 1 mL of the supernatant through an organic phase filter membrane, and analyze the filtrate using high-performance liquid chromatography (HPLC). HPLC conditions: Use a Shimadzu LC-20AT high-performance liquid chromatograph with a C18 column (3.5 µm, 250 mm × 4.6 mm). The mobile phase consists of A: 1% formic acid in acetonitrile, and B: 1% formic acid in water. The column temperature is 40°C, the injection volume is 10 µL, the flow rate is 1 mL/min, and the run time is 40 minutes. Detection is performed using a fluorescence detector with an excitation wavelength of 290 nm and an emission wavelength of 400 nm. JA measurement Weigh 1g of liquid nitrogen-ground alfalfa leaves and place them in an EP tube, then add 20 ng of dihydrojasmonic acid (internal standard). Vortex mix, then add 10 mL of methanol. Extract at 4°C, then centrifuge at 12,000 r/min for 10 minutes to obtain the supernatant. Evaporate the supernatant to dryness under nitrogen in an ice bath, then dissolve in the mobile phase and pass through a solid-phase extraction column. Elute the sample, evaporate to dryness under nitrogen, then reconstitute to 1 mL with 0.05% acetic acid aqueous solution/acetonitrile (V = 80:20). Vortex mix and filter through a membrane before quantification by HPLC. Chromatography conditions: Waters Acquity UPLC with a C18 column (1.7 µm, 2.1 × 50 mm). Mobile phase: A: 0.05% acetic acid aqueous solution, B: acetonitrile. Injection volume: 10 µL, flow rate: 0.3 mL/min, column temperature: 30°C. Mass spectrometry conditions: Tandem mass spectrometer (MS/MS): Waters Quattro Premier XE, ionization mode: ES-, detection method: MRM, capillary voltage: 2.8 kV, ion source temperature: 120°C, desolvation gas temperature: 380°C, cone gas flow rate: 50 L/h, desolvation gas flow rate: 600 L/h, collision gas: argon, collision gas flow rate: 0.18 mL/min. 1.5 VOCs analysis 1.5.1 Extraction and Identification of Volatiles Volatile components in the 0.1 mmol/L MeJA exogenous treatment and CK samples were extracted and identified using an Agilent 7697A-8890-7000D headspace gas chromatography-mass spectrometry (GC-MS) system provided by Shanghai Majorbio Bio-Pharm Technology Co., Ltd. Precisely weighed 3 g of each sample was placed in a 20 mL headspace vial and immediately sealed for testing, with three replicates prepared for each sample. Headspace conditions: oven temperature of 130°C, loop temperature of 150°C, transfer line temperature of 170°C, vial equilibration time of 20 minutes, injection duration of 0.5 minutes, GC cycle time of 35 minutes, and final loop pressure of 10 psi. Chromatographic conditions: VF-WAXms capillary column (25 m × 0.25 mm × 0.2 µm, Agilent CP9204), high-purity helium as the carrier gas at a flow rate of 2 mL/min, injector temperature of 180°C, split injection mode with an injection volume of 1 µL and a split ratio of 10:1. Temperature program: initial temperature of 40°C held for 2 minutes, then ramped to 100°C at a rate of 5°C/min, then to 230°C at a rate of 15°C/min, held for 5 minutes, and finally maintained at 230°C for an additional 2 minutes. Mass spectrometry conditions: electron impact (EI) ion source with an electron energy of 70 eV, transfer line temperature of 310°C, ion source temperature of 230°C, and quadrupole temperature of 150°C; full scan mode (SCAN); mass scan range of m/z 30-1000, with a scan rate of 3.2 scans/s (Li et al. 2021 ). 1.5.2 Data Preprocessing Following the run, the raw GC/MS data were processed through filtering of low-quality peaks, filling in missing values, normalization, and standardization to obtain the final data matrix for subsequent analysis. The preprocessed data matrix was subjected to principal component analysis (PCA) and orthogonal partial least squares discriminant analysis (OPLS-DA) utilizing the ropls package (Version 1.6.2) in R. The selection of significantly different metabolites was determined based on the variable importance in projection (VIP) values obtained from the OPLS-DA model and the P-values from Student’s t-test, with metabolites having VIP > 1 and P < 0.05 considered significantly different. 1.6 RNA extraction, illumina sequencing, and transcriptome data analysis 1.6.1 RNA preparation, cDNA library construction, and RNA sequencing Transcriptomic sequencing was conducted using alfalfa treated with 0.1 mmol/L MeJA and untreated controls (CK) as test materials, with three biological replicates for each treatment. The treated samples were promptly frozen in liquid nitrogen and stored in an ultra-low temperature freezer at -80°C. Total RNA was extracted utilizing the MJZol total RNA extraction kit. The concentration and purity of the extracted RNA were measured with a Nanodrop 2000, and RNA integrity was assessed via agarose gel electrophoresis. mRNA was isolated from total RNA utilizing Oligo(dT) magnetic beads paired with polyA bases, followed by fragmentation. cDNA was synthesized via reverse transcription, adapters were ligated, and PCR amplification was performed on the sorted products. The purified cDNA library was sequenced on the Illumina NovaSeq 6000 platform provided by Shanghai Majorbio Bio-Pharm Technology Co., Ltd. The raw sequences obtained from sequencing were archived in the NCBI database ( http://www.ncbi.nlm.nih.gov/bioproject/1053830 ). To ensure data quality and reliability, the raw data were filtered to obtain high-quality sequencing data (clean data). The quality-controlled clean data (reads) were aligned to the reference genome. The expression levels of genes and transcripts were quantitatively analyzed utilizing RSEM software. 1.6.2 Differential expression genes (DEGs) analysis After obtaining the read counts of genes, differential expression analysis between samples was performed for projects with multiple samples (≥ 2) to identify DEGs. The software utilized for differential expression analysis was DESeq2. The default criteria for identifying significantly differentially expressed genes are: FDR < 0.05 and |log2FC| ≥ 1. The differentially expressed genes were annotated utilizing the GO ( http://geneontology.org/ ) and KEGG ( https://www.genome.jp/kegg/ ) databases. GO enrichment analysis was performed utilizing the Goatools software, employing Fisher's exact test as the method. To control the false positive rate of calculations, P-values were corrected using four multiple testing methods: BH, BY, Holm, and Bonferroni. Software utilized: Goatools ( https://github.com/tanghaibao/GOatools ). KEGG pathway enrichment analysis was performed utilizing the Python scipy package, following the same principles as GO functional enrichment analysis. 1.7 qRT-PCR analysis Total RNA was extracted from MeJA-treated and untreated alfalfa leaves using Trizol reagent (Invitrogen). The RNA concentration and purity were measured using a spectrophotometer (NanoVue™ plus, Wilmington, DE, USA). Reverse transcription was performed using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China). Differentially expressed genes were randomly selected from the transcriptome sequencing results for expression analysis. Alfalfa β-actin gene was used as the internal reference. Primers were designed using the NCBI online tool (Table 1). qRT-PCR validation was performed according to the kit instructions (SYBR Premix Ex Taq™ II (Tli RNaseH Plus) (Takara, Dalian, China)). The relative expression levels of the target genes were calculated using the 2 −ΔΔCT method. Table.1 Primers used in qRT-PCR analysis Gene ID Forward Primer(5'→3') Reverse Primer(5'→3') MS.gene70524 TGCACTTGCTCGGAGTTCAT GTAGTGCTTGGTCGGGGAAA MS.gene53357 TTCCAAGTGAAACACCGGCT AAGAACTGGACGAGCCAAGG MS.gene044274 ATGCACTTGCTCGGAGTTCA GTCGGGGAAAACCCAATCCT MS.gene89156 TCGCCTACGAATGCAACTGA TTGAGGAATTTCGGGCTCCT MS.gene65988 ACCTACGCGATTTTCTGGCA TGTTCTTCTGGAGGCGTGAC MS.gene048435 ACCTACGCGATTTTCTGGCA TGTTCTTCTGGAGGCGTGAC MS.gene99583 GGCTACCACTGAAGGGTGTC TCGCCGACGAAAACCTAACA MS.gene066472 TTCCTTCCCGGACGATCTCT GTTGCCGGTGGTGGTTTTAC MS.gene51160 GACACATGTGCCGGTATCCA GCAGCACTAGCGACAGTGTA β-actin TTTGAGACTTTCAATGTGCCCGCC TAGCATGTGGGAGTGCATAACCCT 1.8 Statistical Analysis The chis-quare test was conducted using SPSS Statistics 27.0.1 to compare the preferences of thrips towards two groups of treated alfalfa. One-way ANOVA followed by Duncan's multiple range test was used to compare the effects of different MeJA treatment dosages on the production performance of thrips and the physiology of alfalfa. Results 2.1 Effects of exogenous MeJA treatment on choice bioassay of thrips and Orius strigicolli This investigation assessed the directional behavior of thrips and its natural predator, Orius strigicolli , in response to alfalfa plants exposed to varying concentrations of MeJA. In olfactometer assays, thrips demonstrated differential behavioral choices towards alfalfa treated with different concentrations of exogenous MeJA. Given that MeJA possesses a distinctive odor, we conducted orientation trials with thrips using distilled water (H 2 O) and MeJA solution as odor sources to ascertain whether its intrinsic scent influences thrips orientation. Thrips didn’t exhibit a distinct preference for either the H 2 O or MeJA solution (Fig. 1 a). However, an intriguing phenomenon emerged when exogenous MeJA was applied to the plants: thrips displayed no significant preference between control (CK) and 0.01 mmol/L MeJA-treated plants, while they showed a tendency to favor CK-treated plants over those treated with 0.1 mmol/L or 1 mmol/L MeJA. These findings suggest that the alteration in alfalfa’s volatile compounds due to exogenous MeJA treatment elicits varied orientation responses in thrips (Fig. 1 b). Orius strigicolli did not demonstrate any specific behavioral choice for alfalfa treated with varying concentrations of MeJA (Fig. 1 c). To further investigate the impact of exogenous MeJA application on thrips' performance in alfalfa, thrips insect density and oviposition on alfalfa leaves under varying concentrations of MeJA treatments were measured. The results indicated that after 7 days of thrips feeding, thrips insect density on plants treated with 0.01 mmol/L and 0.1 mmol/L MeJA was significantly lower than that on CK ( P < 0.05). However, thrips insect density on plants treated with 1 mmol/L MeJA exhibited no significant difference compared to CK. After 14 days of thrips feeding, the thrips insect density on plants treated with 0.01 mmol/L, 0.1 mmol/L, and 1 mmol/L MeJA was significantly lower than that on CK ( P < 0.05) (Fig. 2 a). After 7 days of feeding, the oviposition of thrips on plants treated with 0.1 mmol/L MeJA was significantly lower than that on CK ( P < 0.05), while other treatments did not exhibit any significant difference compared to CK. After 14 days of feeding, the oviposition of thrips on plants treated with 0.01 mmol/L and 0.1 mmol/L MeJA was both significantly lower than that on CK ( P < 0.05). In contrast, the oviposition on plants treated with 1 mmol/L MeJA showed no significant difference compared to CK (Fig. 2 b). 2.2 Effects of exogenous MeJA on physiology and biochemistry of alfalfa leaves Jasmonates (JAs) can trigger the synthesis of various insect-resistant compounds in plants, including defensive enzymes and toxic secondary metabolites. We hypothesize that exogenous MeJA treatment might enhance the activity of defense enzymes and increase the levels of secondary metabolites in alfalfa, consequently influencing the feeding and oviposition behaviors of thrips. To validate this hypothesis, we measured the activity of defensive enzymes and the levels of secondary metabolites associated with insect resistance. The results indicated that the activities of SOD and PPO in alfalfa leaves were significantly elevated under different doses of MeJA treatments (Fig. 3 a, 3 d), and 0.1 mmol/L and 1 mmol/L MeJA treatments significantly enhanced the activities of POD and PAL in alfalfa leaves (Fig. 3 b, 3 c). The LOX activity in alfalfa leaves treated with 0.1 mmol/L MeJA was significantly higher compared to the control group (CK) (Fig. 3 e). Compared to CK, treatment with 0.1 mmol/L MeJA significantly elevated the contents of tannins and flavonoids in alfalfa leaves (Fig. 3 f, 3 g). Treatment with 0.01 mmol/L MeJA significantly elevated the total phenol content in alfalfa, while the other two doses showed no significant difference (Fig. 3 h). 2.3 Volatile metabolomics In order to elucidate the factors affecting thrips' preference towards MeJA-treated alfalfa, the volatile organic compounds (VOCs) in alfalfa leaves both pre- and post-treatment with MeJA was analyzed. The results showed that a total of 137 VOCs were identified in CK, while 150 VOCs were detected in MeJA-treated leaves, indicating that exogenous MeJA treatment induced the release of additional VOCs. There were 12 unique VOCs in CK leaves and 25 unique VOCs in MeJA-treated leaves, with 125 VOCs common to both treatments (Fig. 4 a). To elucidate the differential profiles of volatile metabolites across various treatments, an orthogonal partial least squares discriminant analysis (OPLS-DA) model was used to perform a differential analysis. The treatment samples were situated within the confidence interval, demonstrating significant separation across distinct comparison groups. These findings highlight the OPLS-DA model's robust capability to distinguish between the treatment conditions (Fig. 4 b). The OPLS-DA model was employed to screen VOC components with VIP values greater than 1 in the CK and MeJA treatment groups. A t-test was performed to compute the P -values, and compounds with VIP values greater than 1 and P < 0.05 were selected as differential metabolites. As illustrated in Table 1, 6 components with VIP values greater than 1 and P < 0.05 were identified in the OPLS-DA model between the two treatments. These components are "(1s,7s,8ar)-1,8a-dimethyl-7-(prop-1-en-2-yl)-1,2,3,7,8a-hexahydronaphthalene", "2-ethylhexyl salicylate", "9-oxo-nonanoic acid ethyl ester", "benzyl benzoate", "butyl 2-pentyl phthalate" and "9-oxo-nonanoic acid methyl ester". (Table 2 ). Table 2 Differential Volatile Metabolites (VIP values) number Name VIP_value P _value log2FC 1 (1s,7s,8ar)-1,8a-dimethyl-7-(prop-1-en-2-yl)-1,2,3,7,8,8a-hexahydronaphthalene 2.5209 0.00000009546 -0.9126 2 2-ethylhexyl salicylate 2.6834 0.000005739 0.911066667 3 Nonanoic acid,9-oxo-,ethyl ester 2.5932 0.00001072 0.910433333 4 Benzyl benzoate 2.5437 0.00001148 0.910333333 5 Phthalic acid,butyl 2-pentyl ester 2.6285 0.000000008711 0.9128 6 Nonanoic acid,9-oxo-,methyl ester 2.6052 0.00000003058 0.912733333 2.4 Transcriptomic Analysis Principal component analysis (PCA) was performed on the two sample groups to evaluate intra-group repeatability and inter-group differences. The results indicated that samples from the CK and MeJA treatment groups clustered separately, revealing significant differences between the treatments (Fig. 5 a). The correlation coefficients among samples within the CK treatment group ranged from 0.833 to 0.909, while those within the exogenous MeJA treatment group ranged from 0.798 to 0.894, with samples from each treatment clustering together, indicating good intra-group repeatability. The inter-group correlation coefficient, based on the mean analysis of the grouped samples, was 0.801, demonstrating high sample similarity and suggesting the reliability of the experiment and the appropriateness of sample selection (Fig. 5 b). A total of 1,403 DEGs were detected between MeJA and CK treatment, with 764 genes upregulated and 639 genes downregulated (Fig. 5 c). Annotating DEGs in the KEGG database facilitates the integration of genomic information with high-level functional insights, thereby enhancing the understanding of gene functions. Using a P -value threshold of < 0.05 for significant enrichment, the identified significantly enriched pathways can highlight the main biochemical metabolic pathways involving DEGs. Here, DEGs in the MeJA_vs_CK comparison were enriched in 107 metabolic pathways. The KEGG enrichment bubble chart illustrated the top 20 metabolic pathways, of which 8 were significantly enriched: linoleic acid metabolism, terpenoid backbone biosynthesis, sesquiterpenoid and triterpenoid biosynthesis, vitamin B6 metabolism, alanine, aspartate, and glutamate metabolism, glycerophospholipid metabolism, plant hormone signal transduction, and purine metabolism. Notably, genes within the JA biosynthesis pathway and linoleic acid metabolism pathway were significantly upregulated, suggesting that exogenous MeJA treatment positively influenced the synthesis of endogenous JA in plants (Fig. 5 d). 2.5 Key pathways analysis 2.5.1 Hormone signal transduction pathway Through a comprehensive analysis of the linoleic acid metabolic pathway, it was discovered that the regulatory genes within this pathway are exclusively LOX-encoding, and they exhibited significant upregulation (Fig. 6 a). The lipoxygenase (LOX) pathway is a primary route for the biosynthesis of jasmonic acid. LOX enzymes catalyze the conversion of α-linolenic acid into 13-hydroperoxylinolenic acid. This 13-hydroperoxylinolenic acid undergoes a cascade of enzymatic reactions, culminating in the formation of jasmonic acid. Subsequently, jasmonic acid activates a suite of defense genes via signal transduction pathways, thereby bolstering the plant’s defense mechanisms (Rahimi et al. 2016 ). Therefore, we quantified the levels of JA and SA and observed that exogenous MeJA treatment resulted in a significant increase in JA levels in alfalfa, while SA levels markedly decreased ( P < 0.05) (Fig. 6 b). Further dissection of hormone signal transduction pathways revealed that exogenous MeJA treatment activated both JA and SA signal transduction pathways. The JA signaling pathway was markedly induced, characterized by significant upregulation of the negative regulator JAZ and the major regulator MYC2 genes. Conversely, the SA signaling pathway was inhibited, evidenced by the significant downregulation of key genes TGA and PR-1 (Fig. 6 c). 2.5.2 Terpenoid biosynthesis pathway Terpenoids play a pivotal role in plant defense responses against insects and pathogens. The synthesis of terpenoids is governed by enzyme-catalyzed reactions and key enzyme genes in the mevalonate (MVA) and methylerythritol phosphate (MEP) pathways, as well as by the regulation of exogenous elicitors. The application of exogenous MeJA can enhance enzymatic reactions, leading to the synthesis of endogenous terpenoid metabolites, thereby bolstering plant resistance. In this study, 11 genes were differentially expressed in the MVA and MEP pathways of terpenoid synthesis. These included one acetyl-CoA acetyltransferase (ACAT), four 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), one mevalonate diphosphate decarboxylase (MVD), one 1-deoxy-D-xylulose-5-phosphate synthase (DXS), one isopentenyl-diphosphate delta-isomerase (IDI), one farnesyl diphosphate synthase (FDPS), one geranylgeranyl diphosphate synthase (GGPS), and one dehydrodolichyl diphosphate synthase (DHDDS). Among these, the genes encoding HMGCR and DXS, which are involved in the formation of the common terpenoid precursors isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate (DMAP), along with other key enzymes such as IDI, ACAT, MVD, and FDPS, were significantly upregulated. Conversely, the genes encoding GGPS and DHDDS were downregulated. This suggested that MeJA treatment might bolster plant insect resistance by inducing the expression of key genes in the terpenoid biosynthesis pathway (Fig. 7 ). 2.5.3 qRT-PCR validation To verify the reproducibility and accuracy of differential gene expression identified by RNA-Seq, we randomly selected 9 genes ( MS.gene70524 , MS.gene53357 , MS.gene044274 , MS.gene89156 , MS.gene65988 , MS.gene048435 , MS.gene99583 , MS.gene066472 , and MS.gene511609 ) from KEGG significantly enriched pathways for qRT-PCR validation. The results indicated that while the fold changes for these 9 genes obtained through qRT-PCR validation were not entirely consistent with the RNA-Seq results, the expression trends were similar, suggesting that the transcriptome sequencing data are relatively reliable. Discussion Synthetic elicitors such as MeJA and JA serve as valuable tools for investigating plant responses to stress at molecular, biochemical, and organismal levels, as well as for elucidating the interactions between plant responses and pest and beneficial insect dynamics. The behavioral mechanisms through which elicitors activate plant-induced defense systems to mitigate herbivorous insect feeding damage remain poorly understood. VOCs emitted by JA-treated plants function in indirect defense by repelling pests or attracting natural enemies of herbivorous insects (Dicke et al. 1999 ; De Moraes et al. 2001 ; Bruinsma et al. 2008 ). We investigated the effects of MeJA elicitor treatment on alfalfa and its impact on thrips behavior. Our findings revealed that the release of MeJA-induced plant volatiles influenced thrips behavior in a concentration-dependent manner. In olfactory behavior assays, thrips exhibited a preference for control plants over alfalfa treated with 0.1 mmol/L and 1 mmol/L MeJA, indicating that higher concentrations of exogenous MeJA diminished the behavioral choice of thrips for alfalfa. This observation aligns with the findings of Rodriguez-Saona et al. ( 2011 ) and Ballhorn et al. ( 2013 ), who demonstrated that JA-induced VOCs repel herbivorous insects. JA-induced plants typically reduce pest selectivity. Research has found that treating Macaranga tanarius with 1 mmol/L jasmonic acid induced extrafloral nectar production, which attracted predatory enemies, significantly reducing the number of pests on treated plants(Heil et al. 2001 ). Gols et al. ( 1999 ) treated Gerbera jamesonii with exogenous jasmonic acid, inducing the production of VOCs that attracted the predatory mite Phytoseiulus persimilis . In this study, the olfactory preference test for Orius strigicolli revealed that its selection rate increased with higher concentrations of MeJA, although not to a significant extent. This finding is consistent with the results of Rodriguez-Saona et al. ( 2013 ), who observed no significant effect on Orius strigicolli behavior following MeJA treatment of Vaccinium macrocarpon . This discrepancy may be attributed to differences in the VOC components released by various plants induced by JAs. We also observed that thrips insect density and oviposition were influenced by MeJA-mediated defenses. The insect density and oviposition on JA-treated plant leaves were significantly reduced in comparison to control plants. This finding aligns with the results of other studies, such as the field verification by El-Wakeil et al. ( 2010 ). Spraying JA solution on two varieties of winter wheat fields led to a reduction in the number of various pests, including four species of aphids, two species of thrips, and two species of grain bugs, in the treated plots compared to the control plots after 15 days. Research indicated that under tropical and temperate climate conditions, the application of exogenous MeJA significantly reduces the feeding area of pine weevils in nurseries of four conifer species ( Pinus radiata , Pinus monticola , Pinus sylvestris , and Picea abies ) (Zas et al. 2014 ). Previous studies have demonstrated that exogenous hormones can enhance the activity of defense enzymes, such as PPO, PAL, and POD, thereby reducing the performance of herbivores (Rani and Jyothsna 2010 ; Tan et al. 2012 ; Lv et al. 2017 ). Subsequently, we investigated whether the reduction in the number of insects and eggs was attributable to the effects of accumulated defensive enzymes and secondary metabolites in alfalfa. The activities of SOD, POD, PAL, PPO, and LOX in plants are closely associated with plant insect resistance (Fraga et al. 2017b ). JA and its precursors and derivatives (jasmonates, JAs) play a crucial role in mediating plant responses and defenses against biotic and abiotic stresses (Wang et al. 2021 ). Although JAs themselves are not toxic to insects, they can induce the synthesis or enhance the activity of various defensive enzymes in plants, such as PPO, protease inhibitors (PI), LOX, POD, and PAL (Koramutla et al. 2014 ; Moosa et al. 2019 ). Additionally, they induce the synthesis of various toxic secondary metabolites in plants, such as flavonoids, alkaloids, terpenes, phenolics, quinones, callose, glucosinolates, cyanogenic glycosides, and acylsugars (Baldwin and Hamilton 2000 ; Falk et al. 2014 ). Upon ingestion by pests, some of these secondary metabolites can disrupt insect gut digestion and absorption functions, interfere with nutrient intake, and impede insect development, while others can directly kill the pests(Rillon and Ramawat 2020 ). In this study, we observed that exogenous MeJA treatment variably induced the activity of defensive enzymes such as LOX, PAL, POD and PPO, as well as the synthesis of secondary metabolites such as tannins and flavonoids in alfalfa. This suggests that the effect of MeJA treatment on thrips feeding and oviposition is closely linked to changes in enzyme activity. It is plausible that the increased enzyme activity exerted toxic effects on thrips. Our findings are consistent with those of Soffan et al. ( 2014 ), who reported that elevated PPO, and POD activities resulted in higher aphid mortality rates and prolonged development times on plants. Plant hormones are regarded as key signals in regulating the production and emission of VOCs. JA induces plants to synthesize and release a complex mixture of VOCs, which serve as chemical cues and play critical roles in herbivore movement and plant-plant signal transduction(Allmann and Baldwin 2010 ; Nagegowda 2010 ; Munawar et al. 2023 ). Exogenous JAs can influence the biosynthetic pathways of plant volatiles, altering both the composition and release of these compounds. An increase in repellent components or a decrease in attractant components within the volatiles can reduce pest preference for oviposition and feeding on plants. For example, treating potato ( Solanum tuberosum ) with cis-jasmone (CJ) can induce the release of volatile components such as (E,E)-4,8,12-trimethyl-1,3,7,11-tridecatetraene (TMTT), (E)-β-farnesene, and (E)-4,8-dimethyl-1,3,7-undecatriene (DMNT), which are repellent to the potato aphid ( Macrosiphum euphorbiae ), thereby reducing the oviposition attraction of female aphids to treated plants (Sobhy et al. 2017 ). The mechanisms by which JA-mediated olfactory cues influence thrips' olfactory preferences remain unclear. To identify VOCs that may lead to thrips' aversion, such as repellent plant volatiles, we analyzed the volatile compound composition of alfalfa leaves before and after MeJA treatment. The results indicated that MeJA treatment induced the release of VOCs in alfalfa. We identified 6 differential volatile metabolites which might influence thrips' selection, either individually or in specific combinations. This necessitates further testing with an insect olfactometer. The mechanism by which jasmonic acid induces changes in volatile substances may involve MeJA entering the plant through stomata, where part of it activates the synthesis of protease inhibitors via receptor-mediated signaling pathways, inducing an anti-insect response. Another part is hydrolyzed into JA, facilitating long-distance signal transmission and intercellular communication, thereby transmitting information (Farmer and Ryan 1990 ). Future research on how plant hormones regulate the emission of specific VOCs could help integrate these mechanisms into the biological control strategies for agricultural pests. Transcriptome KEGG enrichment analysis revealed that differentially expressed genes were significantly enriched in metabolic pathways, plant hormone signal transduction, and terpene biosynthesis pathways. In this study, five metabolic pathways were enriched with differentially expressed genes, suggesting that exogenous MeJA induction plays a crucial role in the synthesis of secondary metabolites, involving various signal transduction and interaction factors (Zhao et al. 2005 ). Linoleic acid metabolism exhibited the highest level of enrichment. Analysis of the linoleic acid metabolic pathway revealed that all the genes regulating this pathway were encoded by LOX genes, which were all significantly upregulated. These findings corroborated earlier observations of increased LOX enzyme activity. Overexpression of the LOX2.2 gene in barley ( Hordeum vulgare L.) led to the upregulation of certain JA-responsive genes, whereas downregulation of LOX2.2 resulted in the downregulation of these JA-responsive genes. Although changes in LOX2.2 expression did not affect aphid selectivity or lifespan, they significantly influenced aphid reproduction. This suggests that LOX2.2 plays a role in activating JA-mediated responses and is involved in barley's basal defense response (Losvik et al. 2017 ). Studies on the activation of LOX pathway gene expression have also been documented in Arabidopsis (Nalam et al. 2012 ) and soybean (Fortunato et al. 2006 ). In this study, exogenous MeJA treatment resulted in the upregulation of LOX genes, indicating that LOX plays a key defensive role in MeJA-induced resistance in alfalfa. Lipoxygenase primarily catalyzes the oxygenation of linoleic acid and unsaturated fatty acids and their corresponding esters in plants, producing peroxides and a series of secondary metabolites. It plays a crucial role in regulating plant growth, development, and resistance to pests and diseases, serving as a key enzyme in plant metabolic processes and JA biosynthesis. The upregulated LOX2S genes in the linoleic acid pathway participate in the jasmonic acid biosynthesis pathway, promoting the synthesis of endogenous jasmonic acid and activating the JA signal transduction pathway. The JAZ and MYC2 genes in the JA signal transduction pathway were significantly upregulated, aligning with the findings of Premathilake et al. ( 2020 ), which demonstrated differential expression of JA signal factors following MeJA induction. Under normal conditions devoid of external environmental disturbances, plants contain only trace amounts of jasmonic acid. The repressor protein JAZ in the jasmonic acid signaling pathway binds with other inhibitors and the primary regulatory factor MYC2 to suppress JA responses. When stimulated by exogenous JA or other damage, the JA content in the plant increases rapidly. Under conditions of high JA-Ile abundance, JAZ is degraded by the SCFCOI1 ubiquitin-proteasome complex, releasing the inhibition of MYC2 by JAZs, thereby activating the expression of downstream genes (Wasternack and Kombrink 2010 ). Additionally, MYC2, as a major regulatory factor, modulates the biosynthesis of JA-mediated secondary metabolites(Kazan and Manners 2013 ). MeJA treatment can influence the signal transduction roles of plant hormones within the intricate crosstalk network among different pathways. In this study, MeJA significantly induced the expression of JA biosynthesis and signal transduction genes while inhibiting the expression of TGA and PR1 genes within the SA signal transduction pathway. This suggests antagonism between JA and SA signaling pathways in this study. This finding is consistent with our previous observations, wherein exogenous MeJA treatment increased endogenous JA levels and decreased SA levels in plants. Therefore, it is hypothesized that exogenous MeJA induced extensive cascading reactions within the plant. JA and SA, as critical signaling molecules, may induce the expression of downstream stress-related genes through the upregulation of JAZ protein genes, thereby enhancing plant resistance to thrips. Terpenoids represent the largest and most structurally diverse class of compounds in plant secondary metabolism. Most terpenoids in plants are secondary metabolites that play crucial roles in plant-environment interactions, such as attracting pollinators, deterring herbivores, resisting abiotic stress, and defending against microbial pathogens(Gershenzon and Dudareva 2007 ; Moses et al. 2013 ). In plants, the mevalonate (MVA) and methylerythritol phosphate (MEP) pathways are the primary biosynthetic routes for terpenoids(Rohmer 2003 ). Liu et al. ( 2017 ) investigated the defense mechanisms of resistant and susceptible Pinus massoniana following inoculation with pine wood nematode ( Bursaphelenchus xylophilus ) and found that terpenoids exerted a significant defensive effect against the nematode. Research has shown that MeJA treatment to Artemisia annua plants, significantly increases artemisinin content. They detected elevated levels of six sesquiterpenes and three triterpenes using OSC-PLS analysis (Wang et al. 2010 ). One of the primary regulatory mechanisms by which MeJA mediates many plant secondary metabolites is through the regulation of genes in the biosynthetic pathway. MeJA treatment can stimulate the expression of genes related to terpenoid synthases and other metabolic pathways (Liu et al. 2018 ). Transcription factors such as WRKY, MYB, and MYC2, along with the promoters of key enzyme genes, are upregulated under methyl jasmonate induction. Their interaction and binding are significantly enhanced, thereby increasing the expression of key enzyme genes and the accumulation of triterpenoids (Sun et al. 2018 ; Sharma et al. 2019 ). Overexpression of ORCA3 enhances the expression of terpenoid biosynthesis genes such as Tdc, Str, and D4h, leading to an increased accumulation of terpenoid indole alkaloids in Catharanthus roseus (van der Fits and Memelink 2001 ). Our findings are consistent with previous studies. In this study, 0.1 mmol/L MeJA treatment of alfalfa significantly upregulated the differentially expressed genes HMGCR , DXS , IDI , ACAT , MVD , and FDPS in the terpenoid biosynthesis pathway. Most of these genes were upregulated in the MVA pathway. Additionally, eight genes were enriched in the sesquiterpene and triterpene biosynthesis pathways in the KEGG enrichment analysis, suggesting that MeJA primarily regulates the MVA pathway to synthesize sesquiterpenes and triterpenes. Evidence suggested that sesquiterpenoids can obstruct the response of chemoreceptors in the mouthparts of Lepidoptera insects to glucose, sucrose, and inositol, thereby inhibiting pest feeding. In genetic engineering studies of Arabidopsis , increasing terpenoid production to enhance insect resistance has been successful(Kappers et al. 2005 ). Therefore, we hypothesize that in this study, exogenous MeJA treatment promotes the synthesis of terpenoid compounds by regulating key enzyme-encoding genes in the terpenoid biosynthesis pathway, thereby enhancing resistance by modulating the accumulation of secondary metabolites. Conclusion 4.Conclusion: Exogenous JA treatment induces the release of volatile compounds in alfalfa, enhances the activity of defense enzymes and increases secondary metabolite levels, ultimately reducing the olfactory preference of thrips and inhibiting their feeding and oviposition. Exogenous JA treatment primarily regulates the LOX-encoding genes in the linoleic acid metabolism pathway, elevates endogenous JA levels, and activates the JA signal transduction pathway. When JA-Ile levels are abundant, JAZ proteins are degraded by the SCFCOI1 ubiquitin-proteasome system, lifting the repression on MYC2 , which in turn activates the expression of downstream genes. This activation leads to the synthesis of terpenoid compounds and associated secondary metabolites that enhance thrips resistance (Fig. 9 ). Declarations Conflict of interest The authors declare that they have no conflict of interest. Ethical approval It is not applicable. Consent to publication All authors contributed critically to the drafts and gave final approval for publication. Funding This work was supported by Fundamental scientific research funds of Inner Mongolia, China (BR22-11-12); Youth Science and Technology Talent Support Project of Inner Mongolia, China (NJYT23009); the National Natural Science Foundation of China (32160333); Pratacultural Science Youth Fund of Inner Mongolia Agricultural University, China (IMAUCXQJ2023004), Inner Mongolia Seed Industry Science and technology innovation major demonstration project (2022JBGS0016). Author Contribution ZZQ,SS and CQ conceptualized and designed the experiments;SS,HXW,JXH and YJX conducted the experiments;SS,HXW,DR,LJW,and TY analyzed the data;SS,HXW and ZZQ wrote the manuscript .All authors read and approved the final manuscript. Acknowledgement We thank the drawing tools provided by Figdraw. Data Availability The datasets generated during and analysed during the current study are available from the corresponding author on reasonable request. References Abe H, Ohnishi J, Narusaka M, Seo S, Narusaka Y, Tsuda S, Kobayashi M. 2008. Function of jasmonate in response and tolerance of arabidopsis to thrip feeding. Plant and Cell Physiology 49(1): 68–80. https://doi.org/10.1093/pcp/pcm168 . Allmann S, Baldwin IT. 2010. Insects betray themselves in nature to predators by rapid isomerization of green leaf volatiles. Science 329(5995): 1075–1078. https://doi.org/10.1126/science.1191634 . Baldwin IT, Hamilton W. 2000. Jasmonate-induced responses of nicotiana sylvestris results in fitness costs due to impaired competitive ability for nitrogen. Journal of Chemical Ecology 26: 915–952. Ballhorn DJ, Kautz S, Heil M. 2013. Distance and sex determine host plant choice by herbivorous beetles. Plos One 8(2): e55602. https://doi.org/10.1371/journal.pone.0055602 . Bayram A, Tonğa A. 2018. Cis-jasmone treatments affect pests and beneficial insects of wheat ( triticum aestivum L.): The influence of doses and plant growth stages. Crop Protection 105: 70–79. https://doi.org/https://doi.org/10.1016/j.cropro.2017.11.011 . Boughton AJ, Hoover K, Felton GW. 2006. Impact of chemical elicitor applications on greenhouse tomato plants and population growth of the green peach aphid, myzus persicae. Entomologia Experimentalis Et Applicata 120(3): 175–188. https://doi.org/https://doi.org/10.1111/j.1570-7458.2006.00443.x . Bruinsma M, Ijdema H, van Loon J, Dicke M. 2008. Differential effects of jasmonic acid treatment of brassica nigra on the attraction of pollinators, parasitoids, and butterflies. Entomologia Experimentalis Et Applicata 128: 109–116. https://doi.org/10.1111/j.1570-7458.2008.00695.x . De Moraes CM, Mescher MC, Tumlinson JH. 2001. Caterpillar-induced nocturnal plant volatiles repel conspecific females. Nature 410(6828): 577–580. https://doi.org/10.1038/35069058 . Dicke M, Gols R, Ludeking DJW, Posthumus MA. 1999. Jasmonic acid and herbivory differentially induce carnivore-attracting plant volatiles in lima bean plants. Journal of Chemical Ecology 25: 1907–1922. El-Wakeil NE, Volkmar C, Sallam AA. 2010. Jasmonic acid induces resistance to economically important insect pests in winter wheat. Pest Management Science 66(5): 549–554. https://doi.org/https://doi.org/10.1002/ps.1906 . Escobar-Bravo R, Klinkhamer PGL, Leiss KA. 2017. Induction of jasmonic acid-associated defenses by thrips alters host suitability for conspecifics and correlates with increased trichome densities in tomato. Plant and Cell Physiology 58(3): 622–634. https://doi.org/10.1093/pcp/pcx014 . Falk KL, Kästner J, Bodenhausen N, Schramm K, Paetz C, Vassão DG, Reichelt M, von Knorre D, Bergelson J, Erb M, Gershenzon J, Meldau S. 2014. The role of glucosinolates and the jasmonic acid pathway in resistance of arabidopsis thaliana against molluscan herbivores. Molecular Ecology 23(5): 1188–1203. https://doi.org/https://doi.org/10.1111/mec.12610 . Farmer EE, Ryan CA. 1990. Interplant communication: airborne methyl jasmonate induces synthesis of proteinase inhibitors in plant leaves. Proceedings of the National Academy of Sciences of the United States of America 87(19): 7713–7716. https://doi.org/10.1073/pnas.87.19.7713 . Feng Z, Sun L, Dong M, Fan S, Shi K, Qu Y, Zhu L, Shi J, Wang W, Liu Y, Song L, Weng Y, Liu X, Ren H. 2023. Novel players in organogenesis and flavonoid biosynthesis in cucumber glandular trichomes. Plant Physiology 192(4): 2723–2736. https://doi.org/10.1093/plphys/kiad236 . Fer AMO, Boland W. 2012. Plant defense against herbivores: chemical aspects. Annual Review of Plant Biology 63: 431–450. Fortunato FDS, Oliveira MGA, Brumano MHN, Zanuncio JEC, de Oliveira JAON, Pilon AM, de Almeida FICT, Sediyama CS, Moreira MILA. 2006. Effect of the anticarsia gemmatalis injury on the lipoxygenases activity from soybean leaves. Bioscience Journal 20: 37–46. Fraga D, Parker J, Carlos B, Hamilton G, Nielsen A, Rodriguez-Saona C. 2017a. Behavioral responses of predaceous minute pirate bugs to tridecane, a volatile emitted by the brown marmorated stink bug. Journal of Pest Science 90. https://doi.org/10.1007/s10340-016-0825-9 . Fraga D, Parker J, Carlos B, Hamilton G, Nielsen A, Rodriguez-Saona C. 2017b. Behavioral responses of predaceous minute pirate bugs to tridecane, a volatile emitted by the brown marmorated stink bug. Journal of Pest Science 90. https://doi.org/10.1007/s10340-016-0825-9 . Gershenzon J, Dudareva N. 2007. The function of terpene natural products in the natural world. Nature Chemical Biology 3(7): 408–414. https://doi.org/10.1038/nchembio.2007.5 . Gols R, Posthumus MA, Dicke M. 1999. Jasmonic acid induces the production of gerbera volatiles that attract the biological control agent phytoseiulus persimilis. Entomologia Experimentalis Et Applicata 93(1): 77–86. https://doi.org/https://doi.org/10.1046/j.1570-7458.1999.00564.x . Han SH, Kim JH, Kim K, Lee SH. 2019. Selection of lethal genes for ingestion rna interference against western flower thrips, frankliniella occidentalis, via leaf disc-mediated dsrna delivery. Pesticide Biochemistry and Physiology 161: 47–53. https://doi.org/10.1016/j.pestbp.2019.07.014 . Heil M. 2008. Indirect defence via tritrophic interactions. New Phytologist 178(1): 41–61. https://doi.org/10.1111/j.1469-8137.2007.02330.x . Heil M, Koch T, Hilpert A, Fiala B, Boland W, Linsenmair KE. 2001. Extrafloral nectar production of the ant-associated plant, macaranga tanarius, is an induced, indirect, defensive response elicited by jasmonic acid. Proceedings of the National Academy of Sciences 98(3): 1083–1088. https://doi.org/10.1073/pnas.98.3.1083 . Horbowicz M, Mioduszewska H, Koczkodaj D, Saniewski M. 2011. The effect of cis-jasmone, jasmonic acid and methyl jasmonate on accumulation of anthocyanins and proanthocyanidins in seedlings of common buckwheat ( fagopyrum esculentum moench). Acta Societatis Botanicorum Poloniae 78: 271–277. https://doi.org/10.5586/asbp.2009.035 . Jensen SE. 2000. Insecticide resistance in the western flower thrips, frankliniella occidentalis. Integrated Pest Management Reviews 5(2): 131–146. https://doi.org/10.1023/A:1009600426262 . Kappers IF, Aharoni A, van Herpen TW, Luckerhoff LL, Dicke M, Bouwmeester HJ. 2005. Genetic engineering of terpenoid metabolism attracts bodyguards to arabidopsis. Science 309(5743): 2070–2072. https://doi.org/10.1126/science.1116232 . Karban R. 2011. The ecology and evolution of induced resistance against herbivores. Functional Ecology 25(2): 339–347. https://doi.org/https://doi.org/10.1111/j.1365-2435.2010.01789.x . Kazan K, Manners JM. 2013. Myc2: the master in action. Molecular Plant 6(3): 686–703. https://doi.org/https://doi.org/10.1093/mp/sss128 . Kazemi M. 2014. Effect of foliar application with salicylic acid and methyl jasmonate on growth, flowering, yield and fruit quality of tomato. Koramutla MK, Kaur A, Negi M, Venkatachalam P, Bhattacharya R. 2014. Elicitation of jasmonate-mediated host defense in brassica juncea (l.) Attenuates population growth of mustard aphid lipaphis erysimi (kalt.). Planta 240(1): 177–194. https://doi.org/10.1007/s00425-014-2073-7 . Koramutla MK, Kaur A, Negi M, Venkatachalam P, Bhattacharya R. 2014. Elicitation of jasmonate-mediated host defense in brassica juncea (l.) Attenuates population growth of mustard aphid lipaphis erysimi (kalt.). Planta 240(1): 177–194. https://doi.org/10.1007/s00425-014-2073-7 . Li C, Xin M, Li L, He X, Yi P, Tang Y, Li J, Zheng F, Liu G, Sheng J, Li Z, Sun J. 2021. Characterization of the aromatic profile of purple passion fruit (passiflora edulis sims) during ripening by hs-spme-gc/ms and rna sequencing. Food Chemistry 355: 129685. https://doi.org/https://doi.org/10.1016/j.foodchem.2021.129685 . Liu JP, Hu J, Liu YH, Yang CP, Zhuang YF, Guo XL, Li YJ, Zhang L. 2018. Transcriptome analysis of hevea brasiliensis in response to exogenous methyl jasmonate provides novel insights into regulation of jasmonate-elicited rubber biosynthesis. Physiology and Molecular Biology of Plants 24(3): 349–358. https://doi.org/10.1007/s12298-018-0529-0 . Liu Q, Wei Y, Xu L, Hao Y, Chen X, Zhou Z. 2017. Transcriptomic profiling reveals differentially expressed genes associated with pine wood nematode resistance in masson pine (pinus massoniana lamb.). Scientific Reports 7(1): 4693. https://doi.org/10.1038/s41598-017-04944-7 . Liu Y, Li J, Ban L. 2021. Morphology and distribution of antennal sensilla in three species of thripidae (thysanoptera) infesting alfalfa medicago sativa. Insects. https://doi.org/10.3390/insects12010081 ER -. Liu Y, Wang X, Luo S, Ma L, Zhang W, Xuan S, Wang Y, Zhao J, Shen S, Ma W, Gu A, Chen X. 2022. Metabolomic and transcriptomic analyses identify quinic acid protecting eggplant from damage caused by western flower thrips. Pest Management Science 78(12): 5113–5123. https://doi.org/10.1002/ps.7129 . Losvik A, Beste L, Glinwood R, Ivarson E, Stephens J, Zhu L, Jonsson L. 2017. Overexpression and down-regulation of barley lipoxygenase lox2.2 affects jasmonate-regulated genes and aphid fecundity. International journal of molecular sciences. p. E2765. https://doi.org/10.3390/ijms18122765 . Lv M, Kong H, Liu H, Lu Y, Zhang C, Liu J, Ji C, Zhu J, Su J, Gao X. 2017. Induction of phenylalanine ammonia-lyase (pal) in insect damaged and neighboring undamaged cotton and maize seedlings. International Journal of Pest Management 63(2): 166–171. https://doi.org/10.1080/09670874.2016.1255804 . Mizuno Y, Kuramitsu K, Kainoh Y. 2022. Determining suitable observation times for testing odor preferences of a parasitoid wasp, cotesia kariyai, using a four-arm olfactometer. Entomologia Experimentalis Et Applicata 170: 843–849. Moosa A, Sahi ST, Khan SA, Malik AU. 2019. Salicylic acid and jasmonic acid can suppress green and blue moulds of citrus fruit and induce the activity of polyphenol oxidase and peroxidase. Folia Horticulturae 31(1): 195–204. https://doi.org/doi:10.2478/fhort-2019-0014 . Moses T, Pollier J, Thevelein JM, Goossens A. 2013. Bioengineering of plant (tri)terpenoids: from metabolic engineering of plants to synthetic biology in vivo and in vitro. The New Phytologist 200 1: 27–43. Mound LA. 2005. Thysanoptera: diversity and interactions. Annual Review of Entomology 50(1): 247–269. https://doi.org/10.1146/annurev.ento.49.061802.123318 . Munawar A, Xu Y, Abou EA, Zhang Y, Zhong J, Mao Z, Chen X, Guo H, Zhang C, Sun Y, Zhu Z, Baldwin IT, Zhou W. 2023. Tissue-specific regulation of volatile emissions moves predators from flowers to attacked leaves. Current Biology 33(11): 2321–2329. https://doi.org/10.1016/j.cub.2023.04.074 . Nagegowda DA. 2010. Plant volatile terpenoid metabolism: biosynthetic genes, transcriptional regulation and subcellular compartmentation. Febs Letters 584(14): 2965–2973. https://doi.org/10.1016/j.febslet.2010.05.045 . Nalam VJ, Keeretaweep J, Sarowar S, Shah J. 2012. Root-derived oxylipins promote green peach aphid performance on arabidopsis foliage. The Plant Cell 24(4): 1643–1653. https://doi.org/10.1105/tpc.111.094110 . Premathilake AT, Ni J, Shen J, Bai S, Teng Y. 2020. Transcriptome analysis provides new insights into the transcriptional regulation of methyl jasmonate-induced flavonoid biosynthesis in pear calli. Bmc Plant Biology 20(1): 388. https://doi.org/10.1186/s12870-020-02606-x . Rahimi S, Kim YJ, Sukweenadhi J, Zhang D, Yang DC. 2016. Pglox6 encoding a lipoxygenase contributes to jasmonic acid biosynthesis and ginsenoside production in panax ginseng. Journal of Experimental Botany 67(21): 6007–6019. https://doi.org/10.1093/jxb/erw358 . Rani PU, Jyothsna Y. 2010. Biochemical and enzymatic changes in rice plants as a mechanism of defense. Acta Physiologiae Plantarum 32: 695–701. Reitz S. 2014. Biology and ecology of the western flower thrips (thysanoptera: thripidae): the making of a pest. Florida Entomologist 92: 7–13. https://doi.org/10.1653/024.092.0102 . Rillon JME, Ramawat KG. 2020. Plant defence: biological control. Plant Defence: Biological Control. Rodriguez-Saona C, Polashock J, Malo E. 2013. Jasmonate-mediated induced volatiles in the american cranberry, vaccinium macrocarpon: from gene expression to organismal interactions. Frontiers in Plant Science 4. Rodriguez-Saona C, Vorsa N, Singh A, Johnson-Cicalese J, Szendrei Z, Mescher M, Frost C. 2011. Tracing the history of plant traits under domestication in cranberries: potential consequences on anti-herbivore defences. Journal of Experimental Botany 62: 2633–2644. https://doi.org/10.1093/jxb/erq466 . Rohmer M. 2003. Mevalonate-independent methylerythritol phosphate pathway for isoprenoid biosynthesis. Elucidation and distribution 75(2–3): 375–388. https://doi.org/doi:10.1351/pac200375020375 . Sanches PA, Santos F, Peñaflor M, Bento J. 2017. Direct and indirect resistance of sugarcane to diatraea saccharalis induced by jasmonic acid. Bulletin of Entomological Research 107(6): 828–838. https://doi.org/10.1017/S0007485317000372 . Sarde SJ, Bouwmeester K, Venegas-Molina J, David A, Boland W, Dicke M. 2019. Involvement of sweet pepper calox2 in jasmonate-dependent induced defence against western flower thrips. Journal of Integrative Plant Biology 61(10): 1085–1098. https://doi.org/10.1111/jipb.12742 . Sharma A, Rather GA, Misra P, Dhar MK, Lattoo SK. 2019. Jasmonate responsive transcription factor wsmyc2 regulates the biosynthesis of triterpenoid withanolides and phytosterol via key pathway genes in withania somnifera (l.) Dunal. Plant Molecular Biology 100(4–5): 543–560. https://doi.org/10.1007/s11103-019-00880-4 . Sobhy IS, Woodcock CM, Powers SJ, Caulfield JC, Pickett JA, Birkett MA. 2017. Cis-jasmone elicits aphid-induced stress signalling in potatoes. Journal of Chemical Ecology 43(1): 39–52. https://doi.org/10.1007/s10886-016-0805-9 . Soffan A, Alghamdi SS, Aldawood AS. 2014. Peroxidase and polyphenol oxidase activity in moderate resistant and susceptible vicia faba induced by aphis craccivora (hemiptera: aphididae) infestation. Journal of Insect Science 14: 285. https://doi.org/10.1093/jisesa/ieu147 . Steenbergen M, Broekgaarden C, Pieterse C, Van Wees S. 2020. Bioassays to evaluate the resistance of whole plants to the herbivorous insect thrips. Methods Mol Biol 2085: 93–108. https://doi.org/10.1007/978-1-0716-0142-6_7 . Sun WJ, Zhan JY, Zheng TR, Sun R, Wang T, Tang ZZ, Bu TL, Li CL, Wu Q, Chen H. 2018. The jasmonate-responsive transcription factor cbwrky24 regulates terpenoid biosynthetic genes to promote saponin biosynthesis in conyza blinii h. Lév. Journal of Genetics 97(5): 1379–1388. Tan C, Chiang S, Ravuiwasa KT, Yadav J, Hwang S. 2012. Jasmonate-induced defenses in tomato against helicoverpa armigera depend in part on nutrient availability, but artificial induction via methyl jasmonate does not. Arthropod-Plant Interactions 6(4): 531–541. https://doi.org/10.1007/s11829-012-9206-3 . van der Fits L, Memelink J. 2001. The jasmonate-inducible ap2/erf-domain transcription factor orca3 activates gene expression via interaction with a jasmonate-responsive promoter element. Plant Journal 25(1): 43–53. https://doi.org/10.1046/j.1365-313x.2001.00932.x . Wang H, Ma C, Li Z, Ma LQ, Wang H, Ye H, Xu G, Liu B. 2010. Effects of exogenous methyl jasmonate on artemisinin biosynthesis and secondary metabolites in artemisia annua l. Industrial Crops and Products 31: 214–218. Wang Y, Mostafa S, Zeng W, Jin B. 2021. Function and mechanism of jasmonic acid in plant responses to abiotic and biotic stresses. International Journal of Molecular Sciences 22(16). https://doi.org/10.3390/ijms22168568 . War AR, Paulraj MG, War MY, Ignacimuthu S. 2011a. Jasmonic acid-mediated-induced resistance in groundnut (arachis hypogaea l.) Against helicoverpa armigera (hubner) (lepidoptera: noctuidae). Journal of Plant Growth Regulation 30: 512–523. War AR, Paulraj MG, War MY, Ignacimuthu S. 2011b. Jasmonic acid-mediated-induced resistance in groundnut (arachis hypogaea l.) Against helicoverpa armigera (hubner) (lepidoptera: noctuidae). Journal of Plant Growth Regulation 30: 512–523. War AR, Taggar GK, Hussain B, Taggar MS, Nair RM, Sharma HC. 2018. Plant defence against herbivory and insect adaptations. Aob Plants 10(4): ply037. https://doi.org/10.1093/aobpla/ply037 . Wasternack C, Kombrink E. 2010. Jasmonates: structural requirements for lipid-derived signals active in plant stress responses and development. Acs Chemical Biology 5(1): 63–77. https://doi.org/10.1021/cb900269u . Williams LR, Rodriguez-Saona C, Castle DCS. 2017. Methyl jasmonate induction of cotton: a field test of the 'attract and reward' strategy of conservation biological control. Aob Plants 9(5): plx032. https://doi.org/10.1093/aobpla/plx032 . Wu F, Shi S, Li Y, Miao J, Kang W, Zhang J, Yun A, Liu C. 2021. Physiological and biochemical response of different resistant alfalfa cultivars against thrips damage. Physiology and Molecular Biology of Plants 27(3): 649–663. https://doi.org/10.1007/s12298-021-00961-z . Zas R, Rklund NBO, Nordlander GOR, N CESC, Hellqvist C, Sampedro L. 2014. Exploiting jasmonate-induced responses for field protection of conifer seedlings against a major forest pest, hylobius abietis. Forest Ecology and Management 313: 212–223. Zhang Y, Liu Y, Liang X, Wu C, Liu X, Wu M, Yao X, Qiao Y, Zhan X, Chen Q. 2023. Exogenous methyl jasmonate induced cassava defense response and enhanced resistance to tetranychus urticae. Experimental and Applied Acarology 89: 1–16. https://doi.org/10.1007/s10493-022-00773-0 . Zhang Z, Chen Q, Tan Y, Shuang S, Dai R, Jiang X, Temuer B. 2021. Combined transcriptome and metabolome analysis of alfalfa response to thrips infection. Genes 12(12). https://doi.org/10.3390/genes12121967 . Zhao J, Davis LC, Verpoorte R. 2005. Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnology Advances 23(4): 283–333. https://doi.org/10.1016/j.biotechadv.2005.01.003 . Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 26 Feb, 2025 Read the published version in Journal of Pest Science → Version 1 posted Editorial decision: Revision requested 12 Nov, 2024 Reviews received at journal 11 Nov, 2024 Reviews received at journal 07 Nov, 2024 Reviewers agreed at journal 18 Oct, 2024 Reviewers agreed at journal 17 Oct, 2024 Reviewers invited by journal 16 Oct, 2024 Editor assigned by journal 05 Aug, 2024 Submission checks completed at journal 05 Aug, 2024 First submitted to journal 03 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4853165","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":339770365,"identity":"a82f9e68-2867-4097-ad0d-a4a69485f83a","order_by":0,"name":"Shuang Shuang","email":"","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Shuang","middleName":"","lastName":"Shuang","suffix":""},{"id":339770366,"identity":"51eb93fe-d978-4b09-9da0-332ae8c08931","order_by":1,"name":"Huo Xiaowei","email":"","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Huo","middleName":"","lastName":"Xiaowei","suffix":""},{"id":339770367,"identity":"e6e1d483-4761-4240-9e0d-a8f6eac7a012","order_by":2,"name":"qi chen","email":"","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"qi","middleName":"","lastName":"chen","suffix":""},{"id":339770368,"identity":"2774df48-88aa-4a89-9596-0b800c9fc5f3","order_by":3,"name":"Dai Rui","email":"","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Dai","middleName":"","lastName":"Rui","suffix":""},{"id":339770370,"identity":"4e83651f-a385-4859-8460-5182bb420efe","order_by":4,"name":"Jianwei li","email":"","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jianwei","middleName":"","lastName":"li","suffix":""},{"id":339770371,"identity":"a04f5984-e7e0-41fa-992c-da5fe3ad98bd","order_by":5,"name":"Jiaxin yan","email":"","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jiaxin","middleName":"","lastName":"yan","suffix":""},{"id":339770372,"identity":"a345f951-a90a-4ff7-acec-6f43f6976270","order_by":6,"name":"xiaohong jiang","email":"","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"xiaohong","middleName":"","lastName":"jiang","suffix":""},{"id":339770373,"identity":"439e6ba6-eed5-4580-bcd9-fbcfd3ec83e3","order_by":7,"name":"yao tan","email":"","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"yao","middleName":"","lastName":"tan","suffix":""},{"id":339770374,"identity":"e94c94a0-8424-490e-8042-6544e7c8646a","order_by":8,"name":"zhiqiang zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBUlEQVRIiWNgGAWjYDACCQjFw8/efPBBAoRjQJQWGcmeY8kGJGmxMbiRYwZlE9AiP7v52cMvf6x5DM6cMat4mGOX2MDevE2CoeYOTi2Mc46ZG8vwpPNIHm8ru5G4LTmxgedYmQTDsWc4tTBLJJhJS0gc5uE7c3gbUAtzYoME0IWMDYdxamGTSP8mLWFwmIfhRoJZQeK2+sQG+Tf4tfAAzZT8kHCYR+BGihlD4rbDQFt48GuRkMgpk2Y4APQLMJAlErcdN27jSSu2SDiGW4v8jPRtkj/+WNuDovLjz23Vsv3shzfe+FCDWws4CHgYmJF8ByIS8GoABvQPZC2jYBSMglEwCtABAG8oVDMS1LwrAAAAAElFTkSuQmCC","orcid":"","institution":"Inner Mongolia Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"zhiqiang","middleName":"","lastName":"zhang","suffix":""}],"badges":[],"createdAt":"2024-08-03 11:53:23","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4853165/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4853165/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10340-025-01878-2","type":"published","date":"2025-02-26T15:58:09+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":64078967,"identity":"6b1e98dd-449b-4626-8e02-88c419df7562","added_by":"auto","created_at":"2024-09-06 09:36:09","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":201028,"visible":true,"origin":"","legend":"\u003cp\u003ebehavioral choice of thrips and \u003cem\u003eOrius strigicolli\u003c/em\u003e to alfalfa treated with different concentrations of exogenous MeJA\u003c/p\u003e\n\u003cp\u003eA: behavioral choice of thrips to different concentrations of MeJA solvent; B: behavioral choice of thrips to alfalfa treated with different concentrations of MeJA; C: behavioral choice of \u003cem\u003eOrius strigicolli \u003c/em\u003eto alfalfa treated with different concentrations of MeJA.\u003c/p\u003e","description":"","filename":"Fig.1.png","url":"https://assets-eu.researchsquare.com/files/rs-4853165/v1/59378d079e82fa710d8ea89a.png"},{"id":64078969,"identity":"8cb07f98-c6bc-4559-aa9a-376215bc7ad2","added_by":"auto","created_at":"2024-09-06 09:36:09","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":162181,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of different concentrations of MeJA treatment on the insect density and oviposition of thrips on alfalfa\u003c/p\u003e\n\u003cp\u003ea: Insect density of thrips on alfalfa treated with different concentrations of MeJA; b: Oviposition of thrips on alfalfa treated with different concentrations of MeJA\u003c/p\u003e","description":"","filename":"Fig.2.png","url":"https://assets-eu.researchsquare.com/files/rs-4853165/v1/149368b72fbca834397aeb73.png"},{"id":64078975,"identity":"96a7ee96-57e5-46ea-9f00-82c07c69b894","added_by":"auto","created_at":"2024-09-06 09:36:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":341181,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of different concentrations of MeJA on defense enzymes and secondary metabolites in alfalfa leaves\u003c/p\u003e","description":"","filename":"Fig.3.png","url":"https://assets-eu.researchsquare.com/files/rs-4853165/v1/8e142ce99ffcd4914078afbd.png"},{"id":64079450,"identity":"ff3f4012-90dc-4eae-adf3-277690a05760","added_by":"auto","created_at":"2024-09-06 09:44:09","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":186676,"visible":true,"origin":"","legend":"\u003cp\u003ePreliminary analysis of volatile metabolomics\u003c/p\u003e\n\u003cp\u003ea: Venn diagram b: OPLS-DA plot\u003c/p\u003e","description":"","filename":"Fig.4.png","url":"https://assets-eu.researchsquare.com/files/rs-4853165/v1/574a3f105552b75b70959028.png"},{"id":64079764,"identity":"b813afa4-f41c-4539-8017-426979cf569f","added_by":"auto","created_at":"2024-09-06 09:52:09","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1747026,"visible":true,"origin":"","legend":"\u003cp\u003eTranscriptomic data analysis of alfalfa leaves\u003c/p\u003e\n\u003cp\u003ea: PCA score plot of all samples b: Heatmap of correlation analysis among all samples c: Volcano plot of differentially expressed genes d: KEGG pathway bubble plot of MeJA vs. CK in alfalfa\u003c/p\u003e","description":"","filename":"Fig.5.png","url":"https://assets-eu.researchsquare.com/files/rs-4853165/v1/6bfea5643f72993fc903e032.png"},{"id":64078971,"identity":"593452e7-984c-4c4e-8526-cba7cfdbf8ce","added_by":"auto","created_at":"2024-09-06 09:36:09","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":993669,"visible":true,"origin":"","legend":"\u003cp\u003ePreliminary analysis of KEGG pathways\u003c/p\u003e\n\u003cp\u003ea: Heatmap of LOX genes in the linoleic acid metabolism pathway b: JA and SA content C: Plant hormone signal transductionpathway\u003c/p\u003e","description":"","filename":"Fig.6.png","url":"https://assets-eu.researchsquare.com/files/rs-4853165/v1/a5f8f430962ee62a1fcdbb0e.png"},{"id":64079765,"identity":"fd396a9e-021f-4b14-9d5e-0a8c39a3bb0e","added_by":"auto","created_at":"2024-09-06 09:52:09","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":674028,"visible":true,"origin":"","legend":"\u003cp\u003eTerpenoid biosynthesis pathway\u003c/p\u003e","description":"","filename":"Fig.7.png","url":"https://assets-eu.researchsquare.com/files/rs-4853165/v1/0790f17c17433a31102c34bd.png"},{"id":64079452,"identity":"ae016561-7471-487d-bdc0-1d0f6b8802b5","added_by":"auto","created_at":"2024-09-06 09:44:09","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":471645,"visible":true,"origin":"","legend":"\u003cp\u003eqRT-PCR validation \u0026nbsp;of differential expressed genes\u003c/p\u003e\n\u003cp\u003eNote: The vertical axis represents gene expression levels and log10 (FPKM) values. The horizontal axis represents different treatments of alfalfa. Bar graphs represent qRT-PCR, while line graphs represent RNA-seq.\u003c/p\u003e","description":"","filename":"Fig.8.png","url":"https://assets-eu.researchsquare.com/files/rs-4853165/v1/636979d2a561ee58ced4e05c.png"},{"id":64079453,"identity":"bf1e8d14-d57e-4467-b464-dd45bbad1621","added_by":"auto","created_at":"2024-09-06 09:44:09","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":813309,"visible":true,"origin":"","legend":"\u003cp\u003eMechanism map of methyl jasmonate-mediated resistance to thrips\u003c/p\u003e\n\u003cp\u003eNote：Brown insects represent thrips, and plants on both sides represent alfalfa.\u003c/p\u003e","description":"","filename":"Fig.9.png","url":"https://assets-eu.researchsquare.com/files/rs-4853165/v1/5e0970b437b898768e764387.png"},{"id":77622596,"identity":"97a7771d-489f-4c1f-899c-881c0e82cd91","added_by":"auto","created_at":"2025-03-03 16:08:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7144766,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4853165/v1/8e1745a2-a380-40b8-83ea-671c7e192649.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Exogenous Methyl Jasmonate Mediated Physiological and Transcriptomic Network Improves Thrips tolerance in alfalfa (Medicago Sativa. L)","fulltext":[{"header":"Key Message","content":"\u003cul\u003e\n \u003cli\u003eThrips are polyphagous invasive pests that significantly threaten the productivity of alfalfa.\u003c/li\u003e\n \u003cli\u003e0.1 mmol/L and\u0026nbsp;0.01\u0026nbsp;mmol/L exogenous MeJA treatment significantly limited the behavioral choice, feeding and oviposition of thrips in alfalfa.\u003c/li\u003e\n \u003cli\u003e6 differentially VOCs which might be involved in the thrips behavioral choice were detected.\u003c/li\u003e\n \u003cli\u003eTerpenoid biosynthesis, linoleic acid metabolism and jasmonate signal transduction pathways might \u0026nbsp;response to MeJA-mediated thrips resistance in alfalfa.\u003c/li\u003e\n\u003c/ul\u003e"},{"header":"Introduction","content":"\u003cp\u003eAlfalfa (\u003cem\u003eMedicago sativa\u003c/em\u003e L.), one of the most vital leguminous forage crops worldwide, is renowned for its exceptional adaptability, high yield, superior quality, and robust stress resistance. Thrips are significant agricultural pests, known for their high adaptability and polyphagous feeding habits. Research indicates that thrips are among the primary pests affecting alfalfa in Northwest China, inflicting substantial damage by ovipositing and feeding on young leaves, petals, and pollen. This activity depletes plant nutrients, inhibits growth, and severely reduces yield (Mound \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Wu et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Furthermore, thrips serve as the primary vectors for Tomato Spotted Wilt Virus (TSWV), which can lead to crop losses ranging from 30\u0026ndash;50% (Reitz \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Their small size, rapid reproduction, and short generation times make thrips particularly challenging to control. The extensive use of chemical insecticides has led to significant resistance in thrips populations, adverse effects on non-target organisms, and environmental contamination (Jensen \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Han et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Consequently, alternative pest management strategies are imperative throughout the growing season to reduce reliance on insecticides and mitigate damage.\u003c/p\u003e \u003cp\u003eThrough the co-evolutionary arms race with herbivorous insects, plants have evolved intricate defense mechanisms to mitigate herbivory. These defense strategies primarily encompass constitutive defenses and inducible defenses. Constitutive defenses are intrinsic plant capabilities that have progressively evolved over prolonged periods of growth and evolution, whereas inducible defenses are activated in response to herbivory, mechanical damage, or exogenous signal induction (Liu et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Notably, certain constitutive defenses are markedly amplified upon plant damage, and inducible defenses, which exhibit high species specificity, do not impose a considerable metabolic burden on the host plant. Consequently, they have emerged as a prominent research focus in recent years. Each defense type can be classified as either direct or indirect defense (Fer and Boland \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). A quintessential example of direct defense includes morphological defenses such as augmented trichomes, thorns, and lignification (War et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). For instance, glandular trichomes of plants secrete and store specialized secondary metabolites, potentially containing toxic substances that mitigate feeding, inhibit digestion, or reduce oviposition (Feng et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Indirect defenses can attract organisms from other trophic levels (Heil \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). For instance, certain volatile organic compounds (VOCs) emitted by plants serve to attract natural enemies or repel herbivorous insects (Karban \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Inducible defense mechanisms can be elicited by exogenous applications of synthetic elicitors, such as JA and MeJA (Williams et al. \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) .\u003c/p\u003e \u003cp\u003eUpon attack by pests and pathogens, plants orchestrate their defense responses through a network of interconnected signaling pathways, notably the JA, salicylic acid (SA), and ethylene (ET) pathways (Sarde et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Among these pathways, the JA pathway predominantly regulates the expression of downstream defense genes, playing a pivotal role in plant defense mechanisms. Studies have demonstrated that thrip infestation triggers the activation of genes involved in JA synthesis and signal transduction. Post-infestation, the expression levels of JA synthesis genes and JA content markedly increase in Arabidopsis and tomato. Moreover, the exogenous application of JA has been shown to bolster plant resistance to thrips by activating the JA pathway (Abe et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Escobar-Bravo et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Our prior research identified that thrip infestation significantly upregulates the key genes within the JA signaling pathway in alfalfa (Zhang et al. \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Therefore, we hypothesize that JA plays a critical role in the inducible anti-thrip defense mechanism in alfalfa. Nevertheless, the precise mechanisms underlying JA-mediated thrip resistance in alfalfa remain elusive and necessitate further investigation.\u003c/p\u003e \u003cp\u003eMeJA exhibits greater activity and volatility compared to other jasmonate derivatives when applied exogenously (Horbowicz et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Exogenous application of MeJA can enhance plant defensive metabolites, activate plant defense genes, and generate toxic and repellent compounds, negatively impacting the feeding, growth, and reproduction of pests(Kazemi \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). For example, tomatoes treated with MeJA exhibited detrimental effects on the reproductive capacity and population growth rate of aphids (Boughton et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Exogenous MeJA treatment activated endogenous defenses in mustard (\u003cem\u003eBrassica juncea\u003c/em\u003e L.) against aphids, inhibiting the population growth potential of mustard aphids(Koramutla et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). MeJA treatment induced defensive responses in cassava (\u003cem\u003eManihot esculenta\u003c/em\u003e L.) against two-spotted spider mites (\u003cem\u003eTetranychus urticae\u003c/em\u003e Koch), including reduced oviposition, adult longevity, slower development, and prolonged egg duration(Zhang et al. \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). War et al. (\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2011a\u003c/span\u003e) applied JA to three peanut (\u003cem\u003eArachis hypogaea\u003c/em\u003e L.) cultivars with varying levels of pest resistance to induce resistance against \u003cem\u003eHelicoverpa armigera\u003c/em\u003e. The study demonstrated that JA induction significantly increased PPO, POD, and total phenol content in the leaves of the three cultivars, enhancing the resistance level of the susceptible cultivar TMV 2 against \u003cem\u003eH. armigera\u003c/em\u003e. VOCs play pivotal roles in predator search for suitable prey or hosts on herbivore-infested plants (War et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2011b\u003c/span\u003e). For instance, following the exogenous application of JA to sugarcane, both the sugarcane borer (\u003cem\u003eDiatraea saccharalis\u003c/em\u003e) and the fall armyworm (\u003cem\u003eSpodoptera frugiperda\u003c/em\u003e) exhibited a preference for feeding on control plants over JA-treated plants in dual-choice experiments (Sanches et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Furthermore, under field conditions, wheat plants treated with varying doses of MeJA exhibited inhibitory effects on thrips while attracting ladybird beetle communities (Bayram and Tonğa \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) .\u003c/p\u003e \u003cp\u003eTo investigate the effect of exogenous jasmonic acid on thrips resistance in alfalfa, alfalfa plants were exogenously sprayed with distilled water (CK), 0.01 mmol/L, 0.1 mmol/L, and 1 mmol/L MeJA, respectively, and thrips and \u003cem\u003eOrius strigicolli\u003c/em\u003e (natural enemies) behavioral choice, insect index, physiological and biochemical indexes, and hormone were analyzed. To gain comprehensive insights into the potential mechanisms underlying MeJA-induced resistance, we conducted further analyses of the volatile compounds and transcriptomic profiles of alfalfa subjected to 0.1 mmol/L exogenous MeJA treatment. The findings of this study elucidate the impact of jasmonic acid-related plant defense mechanisms on thrips and offer novel insights for the development of effective thrips management strategies.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e \u003cb\u003e1.1 Plants and insect\u003c/b\u003es\u003c/p\u003e \u003cp\u003eThe test plant utilized in this study was the \u0026lsquo;CaoYuan No. 4\u0026rsquo; alfalfa cultivar, bred by Inner Mongolia Agricultural University. One day prior to sowing, the seeds were immersed in a 10% sodium hypochlorite solution for 15 minutes, thoroughly rinsed with distilled water, and subsequently soaked in distilled water for 12 hours. Six plants were initially cultivated per pot. Upon the emergence of the fourth true leaf, uniformly growing seedlings were thinned to three plants per pot to ensure consistent growth conditions. These plants were cultivated for 45 days prior to testing.\u003c/p\u003e \u003cp\u003eThe test insect employed was \u003cem\u003eOdontothrips loti\u003c/em\u003e, collected from the alfalfa cultivation base at Inner Mongolia Agricultural University. Thrips were captured using an insect aspirator and subsequently transported to the laboratory, where they were reared on broad beans within an incubator. Multiple generations of thrips were cultured to obtain uniform growth stages for test. The incubator conditions were maintained at a temperature of 25\u0026thinsp;\u0026plusmn;\u0026thinsp;1\u0026deg;C, relative humidity of 65\u0026thinsp;\u0026plusmn;\u0026thinsp;1%, and a photoperiod of 16 hours light and 8 hours dark. \u003cem\u003eOrius strigicolli\u003c/em\u003e was sourced from Keyun Bio of Baiyun Industrial Co., Ltd., Jiyuan, Henan Province, China, with technical support provided by the Chinese Academy of Sciences.\u003c/p\u003e \u003cp\u003e \u003cb\u003e1.2 Behavioral Choice Assay for Thrips and\u003c/b\u003e \u003cb\u003eOrius strigicolli\u003c/b\u003e\u003c/p\u003e \u003cp\u003eAfter 45 days of cultivation, alfalfa plants were subjected to treatments with exogenous applications of 0.01 mmol/L, 0.1 mmol/L, and 1 mmol/L MeJA. Distilled water treatment served as the control (CK). The plants were sprayed for three consecutive days until the treatment solution thoroughly covered the leaves and dripped off. To prevent evaporation, the plants were covered with transparent plastic bags post-spraying, which were removed 8 hours later. An olfactometer was employed to analyze the attraction of \u003cem\u003eOdontothrips loti\u003c/em\u003e and \u003cem\u003eOrius strigicolli\u003c/em\u003e to leaves treated with varying concentrations of MeJA in comparison to the CK, referencing the method of Fraga et al. (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2017a\u003c/span\u003e), with minor modifications.\u003c/p\u003e \u003cp\u003eThe olfactometer was constructed from transparent acrylic and featured four arms, sequentially connected via silicone tubes to odor source bottles, activated charcoal, and flow meters. To mitigate interference from natural light during the experiment, a 15 W fluorescent lamp was utilized to provide balanced illumination directly above the apparatus(Mizuno et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The airflow in each arm was regulated at 300 mL/min, and the room temperature was maintained at 25\u0026thinsp;\u0026plusmn;\u0026thinsp;3\u0026deg;C. Plant materials were placed in the odor source bottles, ensuring identical treatments on opposite arms. A vacuum was applied for 10 minutes to saturate the arms with the odor. Subsequently, thrips were introduced into the activity chamber of the olfactometer, which had a diameter of 12 cm. Each set of odor sources was tested with 30 \u003cem\u003eOdontothrips loti\u003c/em\u003e and \u003cem\u003eOrius strigicolli\u003c/em\u003e, repeated five times, with the bioassay conducted from 9:00 to 15:00. The test duration was 10 minutes, and \u003cem\u003eOdontothrips loti\u003c/em\u003e and \u003cem\u003eOrius strigicolli\u003c/em\u003e that reached halfway along any arm were considered to have made a choice, while those that did not were recorded as unresponsive. Following each test, the olfactometer was meticulously wiped inside and out with anhydrous ethanol and dried, then rotated and reconnected to the odor source bottles.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e1.3 Thrips feeding and oviposition analysis\u003c/h2\u003e \u003cp\u003eExogenous applications of 0.01 mmol/L, 0.1 mmol/L, and 1 mmol/L MeJA were conducted, with distilled water serving as the control (CK). The plants were sprayed for three consecutive days, subsequently inoculated with 30 \u003cem\u003eOdontothrips loti\u003c/em\u003e per plant. Post-inoculation, a 200-mesh insect-proof net was utilized to prevent the thrips from escaping. The inoculation periods were set to 7 days and 14 days.\u003c/p\u003e \u003cp\u003eA standardized counting method was employed to determine the results of thrips feeding on the entire alfalfa plant. Each treatment was replicated three times. The trypan blue staining method was utilized to analyze the thrips oviposition, referencing the technique of Steenbergen et al. (\u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Three leaves from identical positions on the upper half of the alfalfa plant were selected for each treatment, with three replicates. The leaves were stained using the trypan blue staining method and subsequently observed under an Olympus SZX10 research-grade stereo microscope to count the number of eggs laid by the thrips.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e1.4 Determination of physiological indices of MeJA-treated leaves\u003c/h2\u003e \u003cdiv id=\"Sec5\" class=\"Section3\"\u003e \u003ch2\u003e1.4.1 Measurement of defense enzymes and secondary metabolites\u003c/h2\u003e \u003cp\u003eLeaves from both CK and 0.1 mmol/L exogenous MeJA-treated plants were rapidly immersed in liquid nitrogen, and all samples subsequently stored in an ultra-low temperature freezer at -80\u0026deg;C for future physiological measurements. The physiological indices were assessed using reagent kits, all procured from Solarbio Science \u0026amp; Technology Co., Ltd., Beijing. Superoxide dismutase (SOD), peroxidase (POD), phenylalanine ammonia-lyase (PAL), polyphenol oxidase (PPO), flavonoids, total phenols, and tannins(batch number 2305001); lipoxygenase (LOX) (batch number 2304001) were among the indices measured. The specific procedures adhered to the instructions provided with the reagent kits.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e1.4.2 Hormone measurement\u003c/h2\u003e \u003cp\u003eMeasurement of JA and SA content in plant materials treated with 0.1 mmol/L MeJA and inoculated with thrips.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eSA measurement\u003c/h2\u003e \u003cp\u003eTake 1 mL of formic acid and dilute it to 1000 mL with a methanol-water mixture. Weigh exactly 2 g of the sample and place it in a 100 mL stoppered conical flask. Accurately add 50 mL of extraction solvent and extract by shaking at 150 r/min for 10 minutes. Transfer 3 mL of the extract into a 10 mL centrifuge tube and centrifuge at 5000 r/min for 10 minutes. Filter 1 mL of the supernatant through an organic phase filter membrane, and analyze the filtrate using high-performance liquid chromatography (HPLC).\u003c/p\u003e \u003cp\u003eHPLC conditions: Use a Shimadzu LC-20AT high-performance liquid chromatograph with a C18 column (3.5 \u0026micro;m, 250 mm \u0026times; 4.6 mm). The mobile phase consists of A: 1% formic acid in acetonitrile, and B: 1% formic acid in water. The column temperature is 40\u0026deg;C, the injection volume is 10 \u0026micro;L, the flow rate is 1 mL/min, and the run time is 40 minutes. Detection is performed using a fluorescence detector with an excitation wavelength of 290 nm and an emission wavelength of 400 nm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eJA measurement\u003c/h2\u003e \u003cp\u003eWeigh 1g of liquid nitrogen-ground alfalfa leaves and place them in an EP tube, then add 20 ng of dihydrojasmonic acid (internal standard). Vortex mix, then add 10 mL of methanol. Extract at 4\u0026deg;C, then centrifuge at 12,000 r/min for 10 minutes to obtain the supernatant. Evaporate the supernatant to dryness under nitrogen in an ice bath, then dissolve in the mobile phase and pass through a solid-phase extraction column. Elute the sample, evaporate to dryness under nitrogen, then reconstitute to 1 mL with 0.05% acetic acid aqueous solution/acetonitrile (V\u0026thinsp;=\u0026thinsp;80:20).\u003c/p\u003e \u003cp\u003eVortex mix and filter through a membrane before quantification by HPLC.\u003c/p\u003e \u003cp\u003eChromatography conditions: Waters Acquity UPLC with a C18 column (1.7 \u0026micro;m, 2.1 \u0026times; 50 mm). Mobile phase: A: 0.05% acetic acid aqueous solution, B: acetonitrile. Injection volume: 10 \u0026micro;L, flow rate: 0.3 mL/min, column temperature: 30\u0026deg;C.\u003c/p\u003e \u003cp\u003eMass spectrometry conditions: Tandem mass spectrometer (MS/MS): Waters Quattro Premier XE, ionization mode: ES-, detection method: MRM, capillary voltage: 2.8 kV, ion source temperature: 120\u0026deg;C, desolvation gas temperature: 380\u0026deg;C, cone gas flow rate: 50 L/h, desolvation gas flow rate: 600 L/h, collision gas: argon, collision gas flow rate: 0.18 mL/min.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e1.5 VOCs analysis\u003c/h2\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e1.5.1 Extraction and Identification of Volatiles\u003c/h2\u003e \u003cp\u003eVolatile components in the 0.1 mmol/L MeJA exogenous treatment and CK samples were extracted and identified using an Agilent 7697A-8890-7000D headspace gas chromatography-mass spectrometry (GC-MS) system provided by Shanghai Majorbio Bio-Pharm Technology Co., Ltd. Precisely weighed 3 g of each sample was placed in a 20 mL headspace vial and immediately sealed for testing, with three replicates prepared for each sample.\u003c/p\u003e \u003cp\u003eHeadspace conditions: oven temperature of 130\u0026deg;C, loop temperature of 150\u0026deg;C, transfer line temperature of 170\u0026deg;C, vial equilibration time of 20 minutes, injection duration of 0.5 minutes, GC cycle time of 35 minutes, and final loop pressure of 10 psi.\u003c/p\u003e \u003cp\u003eChromatographic conditions: VF-WAXms capillary column (25 m \u0026times; 0.25 mm \u0026times; 0.2 \u0026micro;m, Agilent CP9204), high-purity helium as the carrier gas at a flow rate of 2 mL/min, injector temperature of 180\u0026deg;C, split injection mode with an injection volume of 1 \u0026micro;L and a split ratio of 10:1. Temperature program: initial temperature of 40\u0026deg;C held for 2 minutes, then ramped to 100\u0026deg;C at a rate of 5\u0026deg;C/min, then to 230\u0026deg;C at a rate of 15\u0026deg;C/min, held for 5 minutes, and finally maintained at 230\u0026deg;C for an additional 2 minutes.\u003c/p\u003e \u003cp\u003eMass spectrometry conditions: electron impact (EI) ion source with an electron energy of 70 eV, transfer line temperature of 310\u0026deg;C, ion source temperature of 230\u0026deg;C, and quadrupole temperature of 150\u0026deg;C; full scan mode (SCAN); mass scan range of m/z 30-1000, with a scan rate of 3.2 scans/s (Li et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e1.5.2 Data Preprocessing\u003c/h2\u003e \u003cp\u003eFollowing the run, the raw GC/MS data were processed through filtering of low-quality peaks, filling in missing values, normalization, and standardization to obtain the final data matrix for subsequent analysis. The preprocessed data matrix was subjected to principal component analysis (PCA) and orthogonal partial least squares discriminant analysis (OPLS-DA) utilizing the ropls package (Version 1.6.2) in R. The selection of significantly different metabolites was determined based on the variable importance in projection (VIP) values obtained from the OPLS-DA model and the P-values from Student\u0026rsquo;s t-test, with metabolites having VIP\u0026thinsp;\u0026gt;\u0026thinsp;1 and P\u0026thinsp;\u0026lt;\u0026thinsp;0.05 considered significantly different.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e1.6 RNA extraction, illumina sequencing, and transcriptome data analysis\u003c/h2\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e1.6.1 RNA preparation, cDNA library construction, and RNA sequencing\u003c/h2\u003e \u003cp\u003eTranscriptomic sequencing was conducted using alfalfa treated with 0.1 mmol/L MeJA and untreated controls (CK) as test materials, with three biological replicates for each treatment. The treated samples were promptly frozen in liquid nitrogen and stored in an ultra-low temperature freezer at -80\u0026deg;C. Total RNA was extracted utilizing the MJZol total RNA extraction kit. The concentration and purity of the extracted RNA were measured with a Nanodrop 2000, and RNA integrity was assessed via agarose gel electrophoresis. mRNA was isolated from total RNA utilizing Oligo(dT) magnetic beads paired with polyA bases, followed by fragmentation. cDNA was synthesized via reverse transcription, adapters were ligated, and PCR amplification was performed on the sorted products. The purified cDNA library was sequenced on the Illumina NovaSeq 6000 platform provided by Shanghai Majorbio Bio-Pharm Technology Co., Ltd. The raw sequences obtained from sequencing were archived in the NCBI database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/bioproject/1053830\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/bioproject/1053830\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). To ensure data quality and reliability, the raw data were filtered to obtain high-quality sequencing data (clean data). The quality-controlled clean data (reads) were aligned to the reference genome. The expression levels of genes and transcripts were quantitatively analyzed utilizing RSEM software.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e1.6.2 Differential expression genes (DEGs) analysis\u003c/h2\u003e \u003cp\u003eAfter obtaining the read counts of genes, differential expression analysis between samples was performed for projects with multiple samples (\u0026ge;\u0026thinsp;2) to identify DEGs. The software utilized for differential expression analysis was DESeq2. The default criteria for identifying significantly differentially expressed genes are: FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and |log2FC| \u0026ge; 1.\u003c/p\u003e \u003cp\u003eThe differentially expressed genes were annotated utilizing the GO (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://geneontology.org/\u003c/span\u003e\u003cspan address=\"http://geneontology.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and KEGG (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.genome.jp/kegg/\u003c/span\u003e\u003cspan address=\"https://www.genome.jp/kegg/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) databases. GO enrichment analysis was performed utilizing the Goatools software, employing Fisher's exact test as the method. To control the false positive rate of calculations, P-values were corrected using four multiple testing methods: BH, BY, Holm, and Bonferroni. Software utilized: Goatools (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/tanghaibao/GOatools\u003c/span\u003e\u003cspan address=\"https://github.com/tanghaibao/GOatools\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). KEGG pathway enrichment analysis was performed utilizing the Python scipy package, following the same principles as GO functional enrichment analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e1.7 qRT-PCR analysis\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted from MeJA-treated and untreated alfalfa leaves using Trizol reagent (Invitrogen). The RNA concentration and purity were measured using a spectrophotometer (NanoVue\u0026trade; plus, Wilmington, DE, USA). Reverse transcription was performed using the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, Dalian, China). Differentially expressed genes were randomly selected from the transcriptome sequencing results for expression analysis. Alfalfa β-actin gene was used as the internal reference. Primers were designed using the NCBI online tool (Table\u0026nbsp;1). qRT-PCR validation was performed according to the kit instructions (SYBR Premix Ex Taq\u0026trade; II (Tli RNaseH Plus) (Takara, Dalian, China)). The relative expression levels of the target genes were calculated using the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003eTable.1 Primers used in qRT-PCR analysis\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer(5'\u0026rarr;3')\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer(5'\u0026rarr;3')\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMS.gene70524\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTGCACTTGCTCGGAGTTCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTAGTGCTTGGTCGGGGAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMS.gene53357\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCCAAGTGAAACACCGGCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAAGAACTGGACGAGCCAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMS.gene044274\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATGCACTTGCTCGGAGTTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTCGGGGAAAACCCAATCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMS.gene89156\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGCCTACGAATGCAACTGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTTGAGGAATTTCGGGCTCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMS.gene65988\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCTACGCGATTTTCTGGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTTCTTCTGGAGGCGTGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMS.gene048435\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eACCTACGCGATTTTCTGGCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTTCTTCTGGAGGCGTGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMS.gene99583\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCTACCACTGAAGGGTGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCGCCGACGAAAACCTAACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMS.gene066472\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTCCTTCCCGGACGATCTCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTGCCGGTGGTGGTTTTAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMS.gene51160\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACACATGTGCCGGTATCCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGCACTAGCGACAGTGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eβ-actin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTGAGACTTTCAATGTGCCCGCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGCATGTGGGAGTGCATAACCCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e1.8 Statistical Analysis\u003c/h2\u003e \u003cp\u003eThe chis-quare test was conducted using SPSS Statistics 27.0.1 to compare the preferences of thrips towards two groups of treated alfalfa. One-way ANOVA followed by Duncan's multiple range test was used to compare the effects of different MeJA treatment dosages on the production performance of thrips and the physiology of alfalfa.\u003c/p\u003e \u003c/div\u003e "},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e2.1 Effects of exogenous MeJA treatment on choice bioassay of thrips and\u003c/strong\u003e \u003cstrong\u003eOrius strigicolli\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis investigation assessed the directional behavior of thrips and its natural predator, \u003cem\u003eOrius strigicolli\u003c/em\u003e, in response to alfalfa plants exposed to varying concentrations of MeJA. In olfactometer assays, thrips demonstrated differential behavioral choices towards alfalfa treated with different concentrations of exogenous MeJA. Given that MeJA possesses a distinctive odor, we conducted orientation trials with thrips using distilled water (H\u003csub\u003e2\u003c/sub\u003eO) and MeJA solution as odor sources to ascertain whether its intrinsic scent influences thrips orientation. Thrips didn\u0026rsquo;t exhibit a distinct preference for either the H\u003csub\u003e2\u003c/sub\u003eO or MeJA solution (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ea). However, an intriguing phenomenon emerged when exogenous MeJA was applied to the plants: thrips displayed no significant preference between control (CK) and 0.01 mmol/L MeJA-treated plants, while they showed a tendency to favor CK-treated plants over those treated with 0.1 mmol/L or 1 mmol/L MeJA. These findings suggest that the alteration in alfalfa\u0026rsquo;s volatile compounds due to exogenous MeJA treatment elicits varied orientation responses in thrips (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eb). \u003cem\u003eOrius strigicolli\u003c/em\u003e did not demonstrate any specific behavioral choice for alfalfa treated with varying concentrations of MeJA (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003ec).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo further investigate the impact of exogenous MeJA application on thrips' performance in alfalfa, thrips insect density and oviposition on alfalfa leaves under varying concentrations of MeJA treatments were measured. The results indicated that after 7 days of thrips feeding, thrips insect density on plants treated with 0.01 mmol/L and 0.1 mmol/L MeJA was significantly lower than that on CK (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). However, thrips insect density on plants treated with 1 mmol/L MeJA exhibited no significant difference compared to CK. After 14 days of thrips feeding, the thrips insect density on plants treated with 0.01 mmol/L, 0.1 mmol/L, and 1 mmol/L MeJA was significantly lower than that on CK (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003ea). After 7 days of feeding, the oviposition of thrips on plants treated with 0.1 mmol/L MeJA was significantly lower than that on CK (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), while other treatments did not exhibit any significant difference compared to CK. After 14 days of feeding, the oviposition of thrips on plants treated with 0.01 mmol/L and 0.1 mmol/L MeJA was both significantly lower than that on CK (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). In contrast, the oviposition on plants treated with 1 mmol/L MeJA showed no significant difference compared to CK (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eb).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n\u003ch2\u003e2.2 Effects of exogenous MeJA on physiology and biochemistry of alfalfa leaves\u003c/h2\u003e\n\u003cp\u003eJasmonates (JAs) can trigger the synthesis of various insect-resistant compounds in plants, including defensive enzymes and toxic secondary metabolites. We hypothesize that exogenous MeJA treatment might enhance the activity of defense enzymes and increase the levels of secondary metabolites in alfalfa, consequently influencing the feeding and oviposition behaviors of thrips. To validate this hypothesis, we measured the activity of defensive enzymes and the levels of secondary metabolites associated with insect resistance. The results indicated that the activities of SOD and PPO in alfalfa leaves were significantly elevated under different doses of MeJA treatments (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ea, \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ed), and 0.1 mmol/L and 1 mmol/L MeJA treatments significantly enhanced the activities of POD and PAL in alfalfa leaves (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eb, \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ec). The LOX activity in alfalfa leaves treated with 0.1 mmol/L MeJA was significantly higher compared to the control group (CK) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ee). Compared to CK, treatment with 0.1 mmol/L MeJA significantly elevated the contents of tannins and flavonoids in alfalfa leaves (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003ef, \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eg). Treatment with 0.01 mmol/L MeJA significantly elevated the total phenol content in alfalfa, while the other two doses showed no significant difference (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003eh).\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n\u003ch2\u003e2.3 Volatile metabolomics\u003c/h2\u003e\n\u003cp\u003eIn order to elucidate the factors affecting thrips' preference towards MeJA-treated alfalfa, the volatile organic compounds (VOCs) in alfalfa leaves both pre- and post-treatment with MeJA was analyzed. The results showed that a total of 137 VOCs were identified in CK, while 150 VOCs were detected in MeJA-treated leaves, indicating that exogenous MeJA treatment induced the release of additional VOCs. There were 12 unique VOCs in CK leaves and 25 unique VOCs in MeJA-treated leaves, with 125 VOCs common to both treatments (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003ea).\u003c/p\u003e\n\u003cp\u003eTo elucidate the differential profiles of volatile metabolites across various treatments, an orthogonal partial least squares discriminant analysis (OPLS-DA) model was used to perform a differential analysis. The treatment samples were situated within the confidence interval, demonstrating significant separation across distinct comparison groups. These findings highlight the OPLS-DA model's robust capability to distinguish between the treatment conditions (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eb).\u003c/p\u003e\n\u003cp\u003eThe OPLS-DA model was employed to screen VOC components with VIP values greater than 1 in the CK and MeJA treatment groups. A t-test was performed to compute the \u003cem\u003eP\u003c/em\u003e-values, and compounds with VIP values greater than 1 and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were selected as differential metabolites. As illustrated in Table\u0026nbsp;1, 6 components with VIP values greater than 1 and \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were identified in the OPLS-DA model between the two treatments. These components are \"(1s,7s,8ar)-1,8a-dimethyl-7-(prop-1-en-2-yl)-1,2,3,7,8a-hexahydronaphthalene\", \"2-ethylhexyl salicylate\", \"9-oxo-nonanoic acid ethyl ester\", \"benzyl benzoate\", \"butyl 2-pentyl phthalate\" and \"9-oxo-nonanoic acid methyl ester\". (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003cdiv class=\"colspec\" align=\"left\"\u003e\u0026nbsp;\u003c/div\u003e\n\u003ctable id=\"Tab1\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eDifferential Volatile Metabolites (VIP values)\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003enumber\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eName\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eVIP_value\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003eP\u003c/em\u003e_value\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003elog2FC\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e(1s,7s,8ar)-1,8a-dimethyl-7-(prop-1-en-2-yl)-1,2,3,7,8,8a-hexahydronaphthalene\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e2.5209\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.00000009546\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e-0.9126\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e2-ethylhexyl salicylate\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e2.6834\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.000005739\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.911066667\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e3\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNonanoic acid,9-oxo-,ethyl ester\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e2.5932\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.00001072\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.910433333\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eBenzyl benzoate\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e2.5437\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.00001148\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.910333333\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e5\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003ePhthalic acid,butyl 2-pentyl ester\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e2.6285\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.000000008711\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.9128\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eNonanoic acid,9-oxo-,methyl ester\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e2.6052\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.00000003058\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e0.912733333\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n\u003ch2\u003e2.4 Transcriptomic Analysis\u003c/h2\u003e\n\u003cp\u003ePrincipal component analysis (PCA) was performed on the two sample groups to evaluate intra-group repeatability and inter-group differences. The results indicated that samples from the CK and MeJA treatment groups clustered separately, revealing significant differences between the treatments (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ea). The correlation coefficients among samples within the CK treatment group ranged from 0.833 to 0.909, while those within the exogenous MeJA treatment group ranged from 0.798 to 0.894, with samples from each treatment clustering together, indicating good intra-group repeatability. The inter-group correlation coefficient, based on the mean analysis of the grouped samples, was 0.801, demonstrating high sample similarity and suggesting the reliability of the experiment and the appropriateness of sample selection (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eb). A total of 1,403 DEGs were detected between MeJA and CK treatment, with 764 genes upregulated and 639 genes downregulated (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ec).\u003c/p\u003e\n\u003cp\u003eAnnotating DEGs in the KEGG database facilitates the integration of genomic information with high-level functional insights, thereby enhancing the understanding of gene functions. Using a \u003cem\u003eP\u003c/em\u003e-value threshold of \u0026lt;\u0026thinsp;0.05 for significant enrichment, the identified significantly enriched pathways can highlight the main biochemical metabolic pathways involving DEGs. Here, DEGs in the MeJA_vs_CK comparison were enriched in 107 metabolic pathways. The KEGG enrichment bubble chart illustrated the top 20 metabolic pathways, of which 8 were significantly enriched: linoleic acid metabolism, terpenoid backbone biosynthesis, sesquiterpenoid and triterpenoid biosynthesis, vitamin B6 metabolism, alanine, aspartate, and glutamate metabolism, glycerophospholipid metabolism, plant hormone signal transduction, and purine metabolism. Notably, genes within the JA biosynthesis pathway and linoleic acid metabolism pathway were significantly upregulated, suggesting that exogenous MeJA treatment positively influenced the synthesis of endogenous JA in plants (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003ed).\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n\u003ch2\u003e2.5 Key pathways analysis\u003c/h2\u003e\n\u003cdiv id=\"Sec22\" class=\"Section3\"\u003e\n\u003ch2\u003e2.5.1 Hormone signal transduction pathway\u003c/h2\u003e\n\u003cp\u003eThrough a comprehensive analysis of the linoleic acid metabolic pathway, it was discovered that the regulatory genes within this pathway are exclusively LOX-encoding, and they exhibited significant upregulation (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ea). The lipoxygenase (LOX) pathway is a primary route for the biosynthesis of jasmonic acid. LOX enzymes catalyze the conversion of \u0026alpha;-linolenic acid into 13-hydroperoxylinolenic acid. This 13-hydroperoxylinolenic acid undergoes a cascade of enzymatic reactions, culminating in the formation of jasmonic acid. Subsequently, jasmonic acid activates a suite of defense genes via signal transduction pathways, thereby bolstering the plant\u0026rsquo;s defense mechanisms (Rahimi et al. \u003cspan class=\"CitationRef\"\u003e2016\u003c/span\u003e). Therefore, we quantified the levels of JA and SA and observed that exogenous MeJA treatment resulted in a significant increase in JA levels in alfalfa, while SA levels markedly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eb). Further dissection of hormone signal transduction pathways revealed that exogenous MeJA treatment activated both JA and SA signal transduction pathways. The JA signaling pathway was markedly induced, characterized by significant upregulation of the negative regulator JAZ and the major regulator MYC2 genes. Conversely, the SA signaling pathway was inhibited, evidenced by the significant downregulation of key genes TGA and PR-1 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003ec).\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\n\u003ch2\u003e2.5.2 Terpenoid biosynthesis pathway\u003c/h2\u003e\n\u003cp\u003eTerpenoids play a pivotal role in plant defense responses against insects and pathogens. The synthesis of terpenoids is governed by enzyme-catalyzed reactions and key enzyme genes in the mevalonate (MVA) and methylerythritol phosphate (MEP) pathways, as well as by the regulation of exogenous elicitors. The application of exogenous MeJA can enhance enzymatic reactions, leading to the synthesis of endogenous terpenoid metabolites, thereby bolstering plant resistance. In this study, 11 genes were differentially expressed in the MVA and MEP pathways of terpenoid synthesis. These included one acetyl-CoA acetyltransferase (ACAT), four 3-hydroxy-3-methylglutaryl-CoA reductase (HMGCR), one mevalonate diphosphate decarboxylase (MVD), one 1-deoxy-D-xylulose-5-phosphate synthase (DXS), one isopentenyl-diphosphate delta-isomerase (IDI), one farnesyl diphosphate synthase (FDPS), one geranylgeranyl diphosphate synthase (GGPS), and one dehydrodolichyl diphosphate synthase (DHDDS). Among these, the genes encoding HMGCR and DXS, which are involved in the formation of the common terpenoid precursors isopentenyl pyrophosphate (IPP) and its isomer dimethylallyl pyrophosphate (DMAP), along with other key enzymes such as IDI, ACAT, MVD, and FDPS, were significantly upregulated. Conversely, the genes encoding GGPS and DHDDS were downregulated. This suggested that MeJA treatment might bolster plant insect resistance by inducing the expression of key genes in the terpenoid biosynthesis pathway (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\n\u003ch2\u003e2.5.3 qRT-PCR validation\u003c/h2\u003e\n\u003cp\u003eTo verify the reproducibility and accuracy of differential gene expression identified by RNA-Seq, we randomly selected 9 genes (\u003cem\u003eMS.gene70524\u003c/em\u003e, \u003cem\u003eMS.gene53357\u003c/em\u003e, \u003cem\u003eMS.gene044274\u003c/em\u003e, \u003cem\u003eMS.gene89156\u003c/em\u003e, \u003cem\u003eMS.gene65988\u003c/em\u003e, \u003cem\u003eMS.gene048435\u003c/em\u003e, \u003cem\u003eMS.gene99583\u003c/em\u003e, \u003cem\u003eMS.gene066472\u003c/em\u003e, \u003cem\u003eand MS.gene511609\u003c/em\u003e) from KEGG significantly enriched pathways for qRT-PCR validation. The results indicated that while the fold changes for these 9 genes obtained through qRT-PCR validation were not entirely consistent with the RNA-Seq results, the expression trends were similar, suggesting that the transcriptome sequencing data are relatively reliable.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eSynthetic elicitors such as MeJA and JA serve as valuable tools for investigating plant responses to stress at molecular, biochemical, and organismal levels, as well as for elucidating the interactions between plant responses and pest and beneficial insect dynamics. The behavioral mechanisms through which elicitors activate plant-induced defense systems to mitigate herbivorous insect feeding damage remain poorly understood. VOCs emitted by JA-treated plants function in indirect defense by repelling pests or attracting natural enemies of herbivorous insects (Dicke et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; De Moraes et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Bruinsma et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). We investigated the effects of MeJA elicitor treatment on alfalfa and its impact on thrips behavior. Our findings revealed that the release of MeJA-induced plant volatiles influenced thrips behavior in a concentration-dependent manner. In olfactory behavior assays, thrips exhibited a preference for control plants over alfalfa treated with 0.1 mmol/L and 1 mmol/L MeJA, indicating that higher concentrations of exogenous MeJA diminished the behavioral choice of thrips for alfalfa. This observation aligns with the findings of Rodriguez-Saona et al. (\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) and Ballhorn et al. (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), who demonstrated that JA-induced VOCs repel herbivorous insects. JA-induced plants typically reduce pest selectivity. Research has found that treating \u003cem\u003eMacaranga tanarius\u003c/em\u003e with 1 mmol/L jasmonic acid induced extrafloral nectar production, which attracted predatory enemies, significantly reducing the number of pests on treated plants(Heil et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Gols et al. (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e1999\u003c/span\u003e) treated \u003cem\u003eGerbera jamesonii\u003c/em\u003e with exogenous jasmonic acid, inducing the production of VOCs that attracted the predatory mite \u003cem\u003ePhytoseiulus persimilis\u003c/em\u003e. In this study, the olfactory preference test for \u003cem\u003eOrius strigicolli\u003c/em\u003e revealed that its selection rate increased with higher concentrations of MeJA, although not to a significant extent. This finding is consistent with the results of Rodriguez-Saona et al. (\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2013\u003c/span\u003e), who observed no significant effect on \u003cem\u003eOrius strigicolli\u003c/em\u003e behavior following MeJA treatment of \u003cem\u003eVaccinium macrocarpon\u003c/em\u003e. This discrepancy may be attributed to differences in the VOC components released by various plants induced by JAs.\u003c/p\u003e \u003cp\u003eWe also observed that thrips insect density and oviposition were influenced by MeJA-mediated defenses. The insect density and oviposition on JA-treated plant leaves were significantly reduced in comparison to control plants. This finding aligns with the results of other studies, such as the field verification by El-Wakeil et al. (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Spraying JA solution on two varieties of winter wheat fields led to a reduction in the number of various pests, including four species of aphids, two species of thrips, and two species of grain bugs, in the treated plots compared to the control plots after 15 days. Research indicated that under tropical and temperate climate conditions, the application of exogenous MeJA significantly reduces the feeding area of pine weevils in nurseries of four conifer species (\u003cem\u003ePinus radiata\u003c/em\u003e, \u003cem\u003ePinus monticola\u003c/em\u003e, \u003cem\u003ePinus sylvestris\u003c/em\u003e, and \u003cem\u003ePicea abies\u003c/em\u003e) (Zas et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Previous studies have demonstrated that exogenous hormones can enhance the activity of defense enzymes, such as PPO, PAL, and POD, thereby reducing the performance of herbivores (Rani and Jyothsna \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Tan et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Lv et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Subsequently, we investigated whether the reduction in the number of insects and eggs was attributable to the effects of accumulated defensive enzymes and secondary metabolites in alfalfa.\u003c/p\u003e \u003cp\u003eThe activities of SOD, POD, PAL, PPO, and LOX in plants are closely associated with plant insect resistance (Fraga et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2017b\u003c/span\u003e). JA and its precursors and derivatives (jasmonates, JAs) play a crucial role in mediating plant responses and defenses against biotic and abiotic stresses (Wang et al. \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Although JAs themselves are not toxic to insects, they can induce the synthesis or enhance the activity of various defensive enzymes in plants, such as PPO, protease inhibitors (PI), LOX, POD, and PAL (Koramutla et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Moosa et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Additionally, they induce the synthesis of various toxic secondary metabolites in plants, such as flavonoids, alkaloids, terpenes, phenolics, quinones, callose, glucosinolates, cyanogenic glycosides, and acylsugars (Baldwin and Hamilton \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Falk et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Upon ingestion by pests, some of these secondary metabolites can disrupt insect gut digestion and absorption functions, interfere with nutrient intake, and impede insect development, while others can directly kill the pests(Rillon and Ramawat \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In this study, we observed that exogenous MeJA treatment variably induced the activity of defensive enzymes such as LOX, PAL, POD and PPO, as well as the synthesis of secondary metabolites such as tannins and flavonoids in alfalfa. This suggests that the effect of MeJA treatment on thrips feeding and oviposition is closely linked to changes in enzyme activity. It is plausible that the increased enzyme activity exerted toxic effects on thrips. Our findings are consistent with those of Soffan et al. (\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), who reported that elevated PPO, and POD activities resulted in higher aphid mortality rates and prolonged development times on plants.\u003c/p\u003e \u003cp\u003ePlant hormones are regarded as key signals in regulating the production and emission of VOCs. JA induces plants to synthesize and release a complex mixture of VOCs, which serve as chemical cues and play critical roles in herbivore movement and plant-plant signal transduction(Allmann and Baldwin \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Nagegowda \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Munawar et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Exogenous JAs can influence the biosynthetic pathways of plant volatiles, altering both the composition and release of these compounds. An increase in repellent components or a decrease in attractant components within the volatiles can reduce pest preference for oviposition and feeding on plants. For example, treating potato (\u003cem\u003eSolanum tuberosum\u003c/em\u003e) with cis-jasmone (CJ) can induce the release of volatile components such as (E,E)-4,8,12-trimethyl-1,3,7,11-tridecatetraene (TMTT), (E)-β-farnesene, and (E)-4,8-dimethyl-1,3,7-undecatriene (DMNT), which are repellent to the potato aphid (\u003cem\u003eMacrosiphum euphorbiae\u003c/em\u003e), thereby reducing the oviposition attraction of female aphids to treated plants (Sobhy et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The mechanisms by which JA-mediated olfactory cues influence thrips' olfactory preferences remain unclear. To identify VOCs that may lead to thrips' aversion, such as repellent plant volatiles, we analyzed the volatile compound composition of alfalfa leaves before and after MeJA treatment. The results indicated that MeJA treatment induced the release of VOCs in alfalfa. We identified 6 differential volatile metabolites which might influence thrips' selection, either individually or in specific combinations. This necessitates further testing with an insect olfactometer. The mechanism by which jasmonic acid induces changes in volatile substances may involve MeJA entering the plant through stomata, where part of it activates the synthesis of protease inhibitors via receptor-mediated signaling pathways, inducing an anti-insect response. Another part is hydrolyzed into JA, facilitating long-distance signal transmission and intercellular communication, thereby transmitting information (Farmer and Ryan \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e1990\u003c/span\u003e). Future research on how plant hormones regulate the emission of specific VOCs could help integrate these mechanisms into the biological control strategies for agricultural pests.\u003c/p\u003e \u003cp\u003eTranscriptome KEGG enrichment analysis revealed that differentially expressed genes were significantly enriched in metabolic pathways, plant hormone signal transduction, and terpene biosynthesis pathways. In this study, five metabolic pathways were enriched with differentially expressed genes, suggesting that exogenous MeJA induction plays a crucial role in the synthesis of secondary metabolites, involving various signal transduction and interaction factors (Zhao et al. \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Linoleic acid metabolism exhibited the highest level of enrichment. Analysis of the linoleic acid metabolic pathway revealed that all the genes regulating this pathway were encoded by LOX genes, which were all significantly upregulated. These findings corroborated earlier observations of increased LOX enzyme activity. Overexpression of the \u003cem\u003eLOX2.2\u003c/em\u003e gene in barley (\u003cem\u003eHordeum vulgare\u003c/em\u003e L.) led to the upregulation of certain JA-responsive genes, whereas downregulation of \u003cem\u003eLOX2.2\u003c/em\u003e resulted in the downregulation of these JA-responsive genes. Although changes in \u003cem\u003eLOX2.2\u003c/em\u003e expression did not affect aphid selectivity or lifespan, they significantly influenced aphid reproduction. This suggests that \u003cem\u003eLOX2.2\u003c/em\u003e plays a role in activating JA-mediated responses and is involved in barley's basal defense response (Losvik et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Studies on the activation of LOX pathway gene expression have also been documented in Arabidopsis (Nalam et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) and soybean (Fortunato et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). In this study, exogenous MeJA treatment resulted in the upregulation of LOX genes, indicating that LOX plays a key defensive role in MeJA-induced resistance in alfalfa. Lipoxygenase primarily catalyzes the oxygenation of linoleic acid and unsaturated fatty acids and their corresponding esters in plants, producing peroxides and a series of secondary metabolites. It plays a crucial role in regulating plant growth, development, and resistance to pests and diseases, serving as a key enzyme in plant metabolic processes and JA biosynthesis. The upregulated \u003cem\u003eLOX2S\u003c/em\u003e genes in the linoleic acid pathway participate in the jasmonic acid biosynthesis pathway, promoting the synthesis of endogenous jasmonic acid and activating the JA signal transduction pathway. The \u003cem\u003eJAZ\u003c/em\u003e and \u003cem\u003eMYC2\u003c/em\u003e genes in the JA signal transduction pathway were significantly upregulated, aligning with the findings of Premathilake et al. (\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), which demonstrated differential expression of JA signal factors following MeJA induction. Under normal conditions devoid of external environmental disturbances, plants contain only trace amounts of jasmonic acid. The repressor protein JAZ in the jasmonic acid signaling pathway binds with other inhibitors and the primary regulatory factor MYC2 to suppress JA responses. When stimulated by exogenous JA or other damage, the JA content in the plant increases rapidly. Under conditions of high JA-Ile abundance, JAZ is degraded by the SCFCOI1 ubiquitin-proteasome complex, releasing the inhibition of MYC2 by JAZs, thereby activating the expression of downstream genes (Wasternack and Kombrink \u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Additionally, MYC2, as a major regulatory factor, modulates the biosynthesis of JA-mediated secondary metabolites(Kazan and Manners \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). MeJA treatment can influence the signal transduction roles of plant hormones within the intricate crosstalk network among different pathways. In this study, MeJA significantly induced the expression of JA biosynthesis and signal transduction genes while inhibiting the expression of TGA and PR1 genes within the SA signal transduction pathway. This suggests antagonism between JA and SA signaling pathways in this study. This finding is consistent with our previous observations, wherein exogenous MeJA treatment increased endogenous JA levels and decreased SA levels in plants. Therefore, it is hypothesized that exogenous MeJA induced extensive cascading reactions within the plant. JA and SA, as critical signaling molecules, may induce the expression of downstream stress-related genes through the upregulation of JAZ protein genes, thereby enhancing plant resistance to thrips.\u003c/p\u003e \u003cp\u003eTerpenoids represent the largest and most structurally diverse class of compounds in plant secondary metabolism. Most terpenoids in plants are secondary metabolites that play crucial roles in plant-environment interactions, such as attracting pollinators, deterring herbivores, resisting abiotic stress, and defending against microbial pathogens(Gershenzon and Dudareva \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Moses et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). In plants, the mevalonate (MVA) and methylerythritol phosphate (MEP) pathways are the primary biosynthetic routes for terpenoids(Rohmer \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Liu et al. (\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) investigated the defense mechanisms of resistant and susceptible Pinus massoniana following inoculation with pine wood nematode (\u003cem\u003eBursaphelenchus xylophilus\u003c/em\u003e) and found that terpenoids exerted a significant defensive effect against the nematode.\u003c/p\u003e \u003cp\u003eResearch has shown that MeJA treatment to Artemisia annua plants, significantly increases artemisinin content. They detected elevated levels of six sesquiterpenes and three triterpenes using OSC-PLS analysis (Wang et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). One of the primary regulatory mechanisms by which MeJA mediates many plant secondary metabolites is through the regulation of genes in the biosynthetic pathway. MeJA treatment can stimulate the expression of genes related to terpenoid synthases and other metabolic pathways (Liu et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Transcription factors such as WRKY, MYB, and MYC2, along with the promoters of key enzyme genes, are upregulated under methyl jasmonate induction. Their interaction and binding are significantly enhanced, thereby increasing the expression of key enzyme genes and the accumulation of triterpenoids (Sun et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Sharma et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Overexpression of ORCA3 enhances the expression of terpenoid biosynthesis genes such as Tdc, Str, and D4h, leading to an increased accumulation of terpenoid indole alkaloids in Catharanthus roseus (van der Fits and Memelink \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Our findings are consistent with previous studies. In this study, 0.1 mmol/L MeJA treatment of alfalfa significantly upregulated the differentially expressed genes \u003cem\u003eHMGCR\u003c/em\u003e, \u003cem\u003eDXS\u003c/em\u003e, \u003cem\u003eIDI\u003c/em\u003e, \u003cem\u003eACAT\u003c/em\u003e, \u003cem\u003eMVD\u003c/em\u003e, and \u003cem\u003eFDPS\u003c/em\u003e in the terpenoid biosynthesis pathway. Most of these genes were upregulated in the MVA pathway. Additionally, eight genes were enriched in the sesquiterpene and triterpene biosynthesis pathways in the KEGG enrichment analysis, suggesting that MeJA primarily regulates the MVA pathway to synthesize sesquiterpenes and triterpenes. Evidence suggested that sesquiterpenoids can obstruct the response of chemoreceptors in the mouthparts of Lepidoptera insects to glucose, sucrose, and inositol, thereby inhibiting pest feeding. In genetic engineering studies of \u003cem\u003eArabidopsis\u003c/em\u003e, increasing terpenoid production to enhance insect resistance has been successful(Kappers et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). Therefore, we hypothesize that in this study, exogenous MeJA treatment promotes the synthesis of terpenoid compounds by regulating key enzyme-encoding genes in the terpenoid biosynthesis pathway, thereby enhancing resistance by modulating the accumulation of secondary metabolites.\u003c/p\u003e \u003c/div\u003e "},{"header":"Conclusion","content":"\u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003e4.Conclusion:\u003c/h2\u003e \u003cp\u003eExogenous JA treatment induces the release of volatile compounds in alfalfa, enhances the activity of defense enzymes and increases secondary metabolite levels, ultimately reducing the olfactory preference of thrips and inhibiting their feeding and oviposition. Exogenous JA treatment primarily regulates the LOX-encoding genes in the linoleic acid metabolism pathway, elevates endogenous JA levels, and activates the JA signal transduction pathway. When JA-Ile levels are abundant, JAZ proteins are degraded by the SCFCOI1 ubiquitin-proteasome system, lifting the repression on \u003cem\u003eMYC2\u003c/em\u003e, which in turn activates the expression of downstream genes. This activation leads to the synthesis of terpenoid compounds and associated secondary metabolites that enhance thrips resistance (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e).\u003c/p\u003e"},{"header":"Declarations","content":" \u003cp\u003e \u003cstrong\u003eConflict of interest\u003c/strong\u003e \u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eEthical approval\u003c/strong\u003e \u003cp\u003eIt is not applicable.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eConsent to publication\u003c/strong\u003e \u003cp\u003eAll authors contributed critically to the drafts and gave final approval for publication.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by Fundamental scientific research funds of Inner Mongolia, China (BR22-11-12); Youth Science and Technology Talent Support Project of Inner Mongolia, China (NJYT23009); the National Natural Science Foundation of China (32160333); Pratacultural Science Youth Fund of Inner Mongolia Agricultural University, China (IMAUCXQJ2023004), Inner Mongolia Seed Industry Science and technology innovation major demonstration project (2022JBGS0016).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eZZQ,SS and CQ conceptualized and designed the experiments;SS,HXW,JXH and YJX conducted the experiments;SS,HXW,DR,LJW,and TY analyzed the data;SS,HXW and ZZQ wrote the manuscript .All authors read and approved the final manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eWe thank the drawing tools provided by Figdraw.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eThe datasets generated during and analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAbe H, Ohnishi J, Narusaka M, Seo S, Narusaka Y, Tsuda S, Kobayashi M. 2008. Function of jasmonate in response and tolerance of arabidopsis to thrip feeding. Plant and Cell Physiology 49(1): 68\u0026ndash;80. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/pcp/pcm168\u003c/span\u003e\u003cspan address=\"10.1093/pcp/pcm168\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllmann S, Baldwin IT. 2010. Insects betray themselves in nature to predators by rapid isomerization of green leaf volatiles. Science 329(5995): 1075\u0026ndash;1078. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.1191634\u003c/span\u003e\u003cspan address=\"10.1126/science.1191634\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaldwin IT, Hamilton W. 2000. Jasmonate-induced responses of nicotiana sylvestris results in fitness costs due to impaired competitive ability for nitrogen. Journal of Chemical Ecology 26: 915\u0026ndash;952.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBallhorn DJ, Kautz S, Heil M. 2013. Distance and sex determine host plant choice by herbivorous beetles. Plos One 8(2): e55602. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0055602\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0055602\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBayram A, Tonğa A. 2018. Cis-jasmone treatments affect pests and beneficial insects of wheat (\u003cem\u003etriticum aestivum\u003c/em\u003e L.): The influence of doses and plant growth stages. Crop Protection 105: 70\u0026ndash;79. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.cropro.2017.11.011\u003c/span\u003e\u003cspan address=\"10.1016/j.cropro.2017.11.011\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoughton AJ, Hoover K, Felton GW. 2006. Impact of chemical elicitor applications on greenhouse tomato plants and population growth of the green peach aphid, myzus persicae. Entomologia Experimentalis Et Applicata 120(3): 175\u0026ndash;188. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1111/j.1570-7458.2006.00443.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1570-7458.2006.00443.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBruinsma M, Ijdema H, van Loon J, Dicke M. 2008. Differential effects of jasmonic acid treatment of brassica nigra on the attraction of pollinators, parasitoids, and butterflies. Entomologia Experimentalis Et Applicata 128: 109\u0026ndash;116. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1570-7458.2008.00695.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1570-7458.2008.00695.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDe Moraes CM, Mescher MC, Tumlinson JH. 2001. Caterpillar-induced nocturnal plant volatiles repel conspecific females. Nature 410(6828): 577\u0026ndash;580. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/35069058\u003c/span\u003e\u003cspan address=\"10.1038/35069058\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDicke M, Gols R, Ludeking DJW, Posthumus MA. 1999. Jasmonic acid and herbivory differentially induce carnivore-attracting plant volatiles in lima bean plants. Journal of Chemical Ecology 25: 1907\u0026ndash;1922.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Wakeil NE, Volkmar C, Sallam AA. 2010. Jasmonic acid induces resistance to economically important insect pests in winter wheat. Pest Management Science 66(5): 549\u0026ndash;554. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1002/ps.1906\u003c/span\u003e\u003cspan address=\"10.1002/ps.1906\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEscobar-Bravo R, Klinkhamer PGL, Leiss KA. 2017. Induction of jasmonic acid-associated defenses by thrips alters host suitability for conspecifics and correlates with increased trichome densities in tomato. Plant and Cell Physiology 58(3): 622\u0026ndash;634. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/pcp/pcx014\u003c/span\u003e\u003cspan address=\"10.1093/pcp/pcx014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFalk KL, K\u0026auml;stner J, Bodenhausen N, Schramm K, Paetz C, Vass\u0026atilde;o DG, Reichelt M, von Knorre D, Bergelson J, Erb M, Gershenzon J, Meldau S. 2014. The role of glucosinolates and the jasmonic acid pathway in resistance of arabidopsis thaliana against molluscan herbivores. Molecular Ecology 23(5): 1188\u0026ndash;1203. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1111/mec.12610\u003c/span\u003e\u003cspan address=\"10.1111/mec.12610\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFarmer EE, Ryan CA. 1990. Interplant communication: airborne methyl jasmonate induces synthesis of proteinase inhibitors in plant leaves. Proceedings of the National Academy of Sciences of the United States of America 87(19): 7713\u0026ndash;7716. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.87.19.7713\u003c/span\u003e\u003cspan address=\"10.1073/pnas.87.19.7713\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng Z, Sun L, Dong M, Fan S, Shi K, Qu Y, Zhu L, Shi J, Wang W, Liu Y, Song L, Weng Y, Liu X, Ren H. 2023. Novel players in organogenesis and flavonoid biosynthesis in cucumber glandular trichomes. Plant Physiology 192(4): 2723\u0026ndash;2736. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/plphys/kiad236\u003c/span\u003e\u003cspan address=\"10.1093/plphys/kiad236\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFer AMO, Boland W. 2012. Plant defense against herbivores: chemical aspects. Annual Review of Plant Biology 63: 431\u0026ndash;450.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFortunato FDS, Oliveira MGA, Brumano MHN, Zanuncio JEC, de Oliveira JAON, Pilon AM, de Almeida FICT, Sediyama CS, Moreira MILA. 2006. Effect of the anticarsia gemmatalis injury on the lipoxygenases activity from soybean leaves. Bioscience Journal 20: 37\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFraga D, Parker J, Carlos B, Hamilton G, Nielsen A, Rodriguez-Saona C. 2017a. Behavioral responses of predaceous minute pirate bugs to tridecane, a volatile emitted by the brown marmorated stink bug. Journal of Pest Science 90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10340-016-0825-9\u003c/span\u003e\u003cspan address=\"10.1007/s10340-016-0825-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFraga D, Parker J, Carlos B, Hamilton G, Nielsen A, Rodriguez-Saona C. 2017b. Behavioral responses of predaceous minute pirate bugs to tridecane, a volatile emitted by the brown marmorated stink bug. Journal of Pest Science 90. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10340-016-0825-9\u003c/span\u003e\u003cspan address=\"10.1007/s10340-016-0825-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGershenzon J, Dudareva N. 2007. The function of terpene natural products in the natural world. Nature Chemical Biology 3(7): 408\u0026ndash;414. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nchembio.2007.5\u003c/span\u003e\u003cspan address=\"10.1038/nchembio.2007.5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGols R, Posthumus MA, Dicke M. 1999. Jasmonic acid induces the production of gerbera volatiles that attract the biological control agent phytoseiulus persimilis. Entomologia Experimentalis Et Applicata 93(1): 77\u0026ndash;86. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1046/j.1570-7458.1999.00564.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1570-7458.1999.00564.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan SH, Kim JH, Kim K, Lee SH. 2019. Selection of lethal genes for ingestion rna interference against western flower thrips, frankliniella occidentalis, via leaf disc-mediated dsrna delivery. Pesticide Biochemistry and Physiology 161: 47\u0026ndash;53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.pestbp.2019.07.014\u003c/span\u003e\u003cspan address=\"10.1016/j.pestbp.2019.07.014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeil M. 2008. Indirect defence via tritrophic interactions. New Phytologist 178(1): 41\u0026ndash;61. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/j.1469-8137.2007.02330.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1469-8137.2007.02330.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeil M, Koch T, Hilpert A, Fiala B, Boland W, Linsenmair KE. 2001. Extrafloral nectar production of the ant-associated plant, macaranga tanarius, is an induced, indirect, defensive response elicited by jasmonic acid. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e 98(3): 1083\u0026ndash;1088. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.98.3.1083\u003c/span\u003e\u003cspan address=\"10.1073/pnas.98.3.1083\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHorbowicz M, Mioduszewska H, Koczkodaj D, Saniewski M. 2011. The effect of cis-jasmone, jasmonic acid and methyl jasmonate on accumulation of anthocyanins and proanthocyanidins in seedlings of common buckwheat (\u003cem\u003efagopyrum esculentum\u003c/em\u003e moench). Acta Societatis Botanicorum Poloniae 78: 271\u0026ndash;277. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5586/asbp.2009.035\u003c/span\u003e\u003cspan address=\"10.5586/asbp.2009.035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJensen SE. 2000. Insecticide resistance in the western flower thrips, frankliniella occidentalis. Integrated Pest Management Reviews 5(2): 131\u0026ndash;146. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1023/A:1009600426262\u003c/span\u003e\u003cspan address=\"10.1023/A:1009600426262\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKappers IF, Aharoni A, van Herpen TW, Luckerhoff LL, Dicke M, Bouwmeester HJ. 2005. Genetic engineering of terpenoid metabolism attracts bodyguards to arabidopsis. Science 309(5743): 2070\u0026ndash;2072. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.1116232\u003c/span\u003e\u003cspan address=\"10.1126/science.1116232\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarban R. 2011. The ecology and evolution of induced resistance against herbivores. Functional Ecology 25(2): 339\u0026ndash;347. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1111/j.1365-2435.2010.01789.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-2435.2010.01789.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKazan K, Manners JM. 2013. Myc2: the master in action. Molecular Plant 6(3): 686\u0026ndash;703. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1093/mp/sss128\u003c/span\u003e\u003cspan address=\"10.1093/mp/sss128\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKazemi M. 2014. Effect of foliar application with salicylic acid and methyl jasmonate on growth, flowering, yield and fruit quality of tomato.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoramutla MK, Kaur A, Negi M, Venkatachalam P, Bhattacharya R. 2014. Elicitation of jasmonate-mediated host defense in brassica juncea (l.) Attenuates population growth of mustard aphid lipaphis erysimi (kalt.). Planta 240(1): 177\u0026ndash;194. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00425-014-2073-7\u003c/span\u003e\u003cspan address=\"10.1007/s00425-014-2073-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoramutla MK, Kaur A, Negi M, Venkatachalam P, Bhattacharya R. 2014. Elicitation of jasmonate-mediated host defense in brassica juncea (l.) Attenuates population growth of mustard aphid lipaphis erysimi (kalt.). Planta 240(1): 177\u0026ndash;194. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00425-014-2073-7\u003c/span\u003e\u003cspan address=\"10.1007/s00425-014-2073-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi C, Xin M, Li L, He X, Yi P, Tang Y, Li J, Zheng F, Liu G, Sheng J, Li Z, Sun J. 2021. Characterization of the aromatic profile of purple passion fruit (passiflora edulis sims) during ripening by hs-spme-gc/ms and rna sequencing. Food Chemistry 355: 129685. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.foodchem.2021.129685\u003c/span\u003e\u003cspan address=\"10.1016/j.foodchem.2021.129685\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu JP, Hu J, Liu YH, Yang CP, Zhuang YF, Guo XL, Li YJ, Zhang L. 2018. Transcriptome analysis of hevea brasiliensis in response to exogenous methyl jasmonate provides novel insights into regulation of jasmonate-elicited rubber biosynthesis. Physiology and Molecular Biology of Plants 24(3): 349\u0026ndash;358. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12298-018-0529-0\u003c/span\u003e\u003cspan address=\"10.1007/s12298-018-0529-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Q, Wei Y, Xu L, Hao Y, Chen X, Zhou Z. 2017. Transcriptomic profiling reveals differentially expressed genes associated with pine wood nematode resistance in masson pine (pinus massoniana lamb.). Scientific Reports 7(1): 4693. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41598-017-04944-7\u003c/span\u003e\u003cspan address=\"10.1038/s41598-017-04944-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Li J, Ban L. 2021. Morphology and distribution of antennal sensilla in three species of thripidae (thysanoptera) infesting alfalfa medicago sativa. Insects. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/insects12010081\u003c/span\u003e\u003cspan address=\"10.3390/insects12010081\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eER -.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu Y, Wang X, Luo S, Ma L, Zhang W, Xuan S, Wang Y, Zhao J, Shen S, Ma W, Gu A, Chen X. 2022. Metabolomic and transcriptomic analyses identify quinic acid protecting eggplant from damage caused by western flower thrips. Pest Management Science 78(12): 5113\u0026ndash;5123. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/ps.7129\u003c/span\u003e\u003cspan address=\"10.1002/ps.7129\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLosvik A, Beste L, Glinwood R, Ivarson E, Stephens J, Zhu L, Jonsson L. 2017. Overexpression and down-regulation of barley lipoxygenase lox2.2 affects jasmonate-regulated genes and aphid fecundity. International journal of molecular sciences. p. E2765. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms18122765\u003c/span\u003e\u003cspan address=\"10.3390/ijms18122765\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLv M, Kong H, Liu H, Lu Y, Zhang C, Liu J, Ji C, Zhu J, Su J, Gao X. 2017. Induction of phenylalanine ammonia-lyase (pal) in insect damaged and neighboring undamaged cotton and maize seedlings. International Journal of Pest Management 63(2): 166\u0026ndash;171. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/09670874.2016.1255804\u003c/span\u003e\u003cspan address=\"10.1080/09670874.2016.1255804\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMizuno Y, Kuramitsu K, Kainoh Y. 2022. Determining suitable observation times for testing odor preferences of a parasitoid wasp, cotesia kariyai, using a four-arm olfactometer. Entomologia Experimentalis Et Applicata 170: 843\u0026ndash;849.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoosa A, Sahi ST, Khan SA, Malik AU. 2019. Salicylic acid and jasmonic acid can suppress green and blue moulds of citrus fruit and induce the activity of polyphenol oxidase and peroxidase. Folia Horticulturae 31(1): 195\u0026ndash;204. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/doi:10.2478/fhort-2019-0014\u003c/span\u003e\u003cspan address=\"doi:10.2478/fhort-2019-0014\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoses T, Pollier J, Thevelein JM, Goossens A. 2013. Bioengineering of plant (tri)terpenoids: from metabolic engineering of plants to synthetic biology in vivo and in vitro. The New Phytologist 200 1: 27\u0026ndash;43.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMound LA. 2005. Thysanoptera: diversity and interactions. Annual Review of Entomology 50(1): 247\u0026ndash;269. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1146/annurev.ento.49.061802.123318\u003c/span\u003e\u003cspan address=\"10.1146/annurev.ento.49.061802.123318\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMunawar A, Xu Y, Abou EA, Zhang Y, Zhong J, Mao Z, Chen X, Guo H, Zhang C, Sun Y, Zhu Z, Baldwin IT, Zhou W. 2023. Tissue-specific regulation of volatile emissions moves predators from flowers to attacked leaves. Current Biology 33(11): 2321\u0026ndash;2329. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cub.2023.04.074\u003c/span\u003e\u003cspan address=\"10.1016/j.cub.2023.04.074\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNagegowda DA. 2010. Plant volatile terpenoid metabolism: biosynthetic genes, transcriptional regulation and subcellular compartmentation. Febs Letters 584(14): 2965\u0026ndash;2973. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.febslet.2010.05.045\u003c/span\u003e\u003cspan address=\"10.1016/j.febslet.2010.05.045\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNalam VJ, Keeretaweep J, Sarowar S, Shah J. 2012. Root-derived oxylipins promote green peach aphid performance on arabidopsis foliage. The Plant Cell 24(4): 1643\u0026ndash;1653. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.111.094110\u003c/span\u003e\u003cspan address=\"10.1105/tpc.111.094110\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePremathilake AT, Ni J, Shen J, Bai S, Teng Y. 2020. Transcriptome analysis provides new insights into the transcriptional regulation of methyl jasmonate-induced flavonoid biosynthesis in pear calli. Bmc Plant Biology 20(1): 388. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/s12870-020-02606-x\u003c/span\u003e\u003cspan address=\"10.1186/s12870-020-02606-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRahimi S, Kim YJ, Sukweenadhi J, Zhang D, Yang DC. 2016. Pglox6 encoding a lipoxygenase contributes to jasmonic acid biosynthesis and ginsenoside production in panax ginseng. Journal of Experimental Botany 67(21): 6007\u0026ndash;6019. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jxb/erw358\u003c/span\u003e\u003cspan address=\"10.1093/jxb/erw358\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRani PU, Jyothsna Y. 2010. Biochemical and enzymatic changes in rice plants as a mechanism of defense. Acta Physiologiae Plantarum 32: 695\u0026ndash;701.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReitz S. 2014. Biology and ecology of the western flower thrips (thysanoptera: thripidae): the making of a pest. Florida Entomologist 92: 7\u0026ndash;13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1653/024.092.0102\u003c/span\u003e\u003cspan address=\"10.1653/024.092.0102\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRillon JME, Ramawat KG. 2020. Plant defence: biological control. Plant Defence: Biological Control.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodriguez-Saona C, Polashock J, Malo E. 2013. Jasmonate-mediated induced volatiles in the american cranberry, vaccinium macrocarpon: from gene expression to organismal interactions. Frontiers in Plant Science 4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRodriguez-Saona C, Vorsa N, Singh A, Johnson-Cicalese J, Szendrei Z, Mescher M, Frost C. 2011. Tracing the history of plant traits under domestication in cranberries: potential consequences on anti-herbivore defences. Journal of Experimental Botany 62: 2633\u0026ndash;2644. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jxb/erq466\u003c/span\u003e\u003cspan address=\"10.1093/jxb/erq466\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRohmer M. 2003. Mevalonate-independent methylerythritol phosphate pathway for isoprenoid biosynthesis. Elucidation and distribution 75(2\u0026ndash;3): 375\u0026ndash;388. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/doi:10.1351/pac200375020375\u003c/span\u003e\u003cspan address=\"doi:10.1351/pac200375020375\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSanches PA, Santos F, Pe\u0026ntilde;aflor M, Bento J. 2017. Direct and indirect resistance of sugarcane to diatraea saccharalis induced by jasmonic acid. Bulletin of Entomological Research 107(6): 828\u0026ndash;838. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/S0007485317000372\u003c/span\u003e\u003cspan address=\"10.1017/S0007485317000372\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarde SJ, Bouwmeester K, Venegas-Molina J, David A, Boland W, Dicke M. 2019. Involvement of sweet pepper calox2 in jasmonate-dependent induced defence against western flower thrips. Journal of Integrative Plant Biology 61(10): 1085\u0026ndash;1098. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/jipb.12742\u003c/span\u003e\u003cspan address=\"10.1111/jipb.12742\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma A, Rather GA, Misra P, Dhar MK, Lattoo SK. 2019. Jasmonate responsive transcription factor wsmyc2 regulates the biosynthesis of triterpenoid withanolides and phytosterol via key pathway genes in withania somnifera (l.) Dunal. Plant Molecular Biology 100(4\u0026ndash;5): 543\u0026ndash;560. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11103-019-00880-4\u003c/span\u003e\u003cspan address=\"10.1007/s11103-019-00880-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSobhy IS, Woodcock CM, Powers SJ, Caulfield JC, Pickett JA, Birkett MA. 2017. Cis-jasmone elicits aphid-induced stress signalling in potatoes. Journal of Chemical Ecology 43(1): 39\u0026ndash;52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10886-016-0805-9\u003c/span\u003e\u003cspan address=\"10.1007/s10886-016-0805-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSoffan A, Alghamdi SS, Aldawood AS. 2014. Peroxidase and polyphenol oxidase activity in moderate resistant and susceptible vicia faba induced by aphis craccivora (hemiptera: aphididae) infestation. Journal of Insect Science 14: 285. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jisesa/ieu147\u003c/span\u003e\u003cspan address=\"10.1093/jisesa/ieu147\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSteenbergen M, Broekgaarden C, Pieterse C, Van Wees S. 2020. Bioassays to evaluate the resistance of whole plants to the herbivorous insect thrips. \u003cem\u003eMethods Mol Biol\u003c/em\u003e 2085: 93\u0026ndash;108. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/978-1-0716-0142-6_7\u003c/span\u003e\u003cspan address=\"10.1007/978-1-0716-0142-6_7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun WJ, Zhan JY, Zheng TR, Sun R, Wang T, Tang ZZ, Bu TL, Li CL, Wu Q, Chen H. 2018. The jasmonate-responsive transcription factor cbwrky24 regulates terpenoid biosynthetic genes to promote saponin biosynthesis in conyza blinii h. L\u0026eacute;v. Journal of Genetics 97(5): 1379\u0026ndash;1388.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan C, Chiang S, Ravuiwasa KT, Yadav J, Hwang S. 2012. Jasmonate-induced defenses in tomato against helicoverpa armigera depend in part on nutrient availability, but artificial induction via methyl jasmonate does not. Arthropod-Plant Interactions 6(4): 531\u0026ndash;541. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11829-012-9206-3\u003c/span\u003e\u003cspan address=\"10.1007/s11829-012-9206-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan der Fits L, Memelink J. 2001. The jasmonate-inducible ap2/erf-domain transcription factor orca3 activates gene expression via interaction with a jasmonate-responsive promoter element. Plant Journal 25(1): 43\u0026ndash;53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1046/j.1365-313x.2001.00932.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1365-313x.2001.00932.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang H, Ma C, Li Z, Ma LQ, Wang H, Ye H, Xu G, Liu B. 2010. Effects of exogenous methyl jasmonate on artemisinin biosynthesis and secondary metabolites in artemisia annua l. Industrial Crops and Products 31: 214\u0026ndash;218.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Y, Mostafa S, Zeng W, Jin B. 2021. Function and mechanism of jasmonic acid in plant responses to abiotic and biotic stresses. International Journal of Molecular Sciences 22(16). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms22168568\u003c/span\u003e\u003cspan address=\"10.3390/ijms22168568\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWar AR, Paulraj MG, War MY, Ignacimuthu S. 2011a. Jasmonic acid-mediated-induced resistance in groundnut (arachis hypogaea l.) Against helicoverpa armigera (hubner) (lepidoptera: noctuidae). Journal of Plant Growth Regulation 30: 512\u0026ndash;523.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWar AR, Paulraj MG, War MY, Ignacimuthu S. 2011b. Jasmonic acid-mediated-induced resistance in groundnut (arachis hypogaea l.) Against helicoverpa armigera (hubner) (lepidoptera: noctuidae). Journal of Plant Growth Regulation 30: 512\u0026ndash;523.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWar AR, Taggar GK, Hussain B, Taggar MS, Nair RM, Sharma HC. 2018. Plant defence against herbivory and insect adaptations. Aob Plants 10(4): ply037. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/aobpla/ply037\u003c/span\u003e\u003cspan address=\"10.1093/aobpla/ply037\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWasternack C, Kombrink E. 2010. Jasmonates: structural requirements for lipid-derived signals active in plant stress responses and development. Acs Chemical Biology 5(1): 63\u0026ndash;77. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/cb900269u\u003c/span\u003e\u003cspan address=\"10.1021/cb900269u\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilliams LR, Rodriguez-Saona C, Castle DCS. 2017. Methyl jasmonate induction of cotton: a field test of the 'attract and reward' strategy of conservation biological control. Aob Plants 9(5): plx032. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/aobpla/plx032\u003c/span\u003e\u003cspan address=\"10.1093/aobpla/plx032\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWu F, Shi S, Li Y, Miao J, Kang W, Zhang J, Yun A, Liu C. 2021. Physiological and biochemical response of different resistant alfalfa cultivars against thrips damage. Physiology and Molecular Biology of Plants 27(3): 649\u0026ndash;663. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12298-021-00961-z\u003c/span\u003e\u003cspan address=\"10.1007/s12298-021-00961-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZas R, Rklund NBO, Nordlander GOR, N CESC, Hellqvist C, Sampedro L. 2014. Exploiting jasmonate-induced responses for field protection of conifer seedlings against a major forest pest, hylobius abietis. Forest Ecology and Management 313: 212\u0026ndash;223.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Liu Y, Liang X, Wu C, Liu X, Wu M, Yao X, Qiao Y, Zhan X, Chen Q. 2023. Exogenous methyl jasmonate induced cassava defense response and enhanced resistance to tetranychus urticae. Experimental and Applied Acarology 89: 1\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10493-022-00773-0\u003c/span\u003e\u003cspan address=\"10.1007/s10493-022-00773-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Z, Chen Q, Tan Y, Shuang S, Dai R, Jiang X, Temuer B. 2021. Combined transcriptome and metabolome analysis of alfalfa response to thrips infection. Genes 12(12). \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/genes12121967\u003c/span\u003e\u003cspan address=\"10.3390/genes12121967\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao J, Davis LC, Verpoorte R. 2005. Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnology Advances 23(4): 283\u0026ndash;333. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.biotechadv.2005.01.003\u003c/span\u003e\u003cspan address=\"10.1016/j.biotechadv.2005.01.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-pest-science","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pest","sideBox":"Learn more about [Journal of Pest Science](https://www.springer.com/journal/10340)","snPcode":"10340","submissionUrl":"https://submission.nature.com/new-submission/10340/3","title":"Journal of Pest Science","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Methyl jasmonate, Alfalfa, Thrips, Volatiles, Transcriptome","lastPublishedDoi":"10.21203/rs.3.rs-4853165/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4853165/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eExogenous methyl jasmonate is widely acknowledged for its role in triggering plants' defense systems against pest invasions. Nonetheless, there has been a dearth of research exploring the elicitation of defense mechanisms by jasmonic acid in alfalfa. In order to investigate the effect of methyl jasmonate on thrips resistance in alfalfa, \u003cem\u003eMedicago sativa\u003c/em\u003e L.cv. Caoyuan No. 4 was exogenously sprayed with different concentrations of methyl jasmonate, and thrips and \u003cem\u003eOrius strigicolli\u003c/em\u003e (natural enemies) behavioral choice, physiological and transcriptomic analyses were performed. The results revealed a concentration-dependent inducible effect of methyl jasmonate on the behavioral choice, feeding and oviposition of thrips mediated by volatile organic compounds. Moreover, methyl jasmonate treatment at varying concentrations significantly influenced the activity levels of defense enzymes and secondary metabolites in alfalfa. Notably, the most pronounced induction effect of methyl jasmonate was observed at a concentration of 0.1 mmol/L, particularly evident in the enhanced activity of peroxidase, polyphenol oxidase, lipoxygenase and tannins. Transcriptome analysis showed that differentially expressed genes between methyl jasmonate treatment and CK were mainly enriched in metabolic pathways and plant hormone signal transduction pathways such as terpenoid biosynthesis, linoleic acid metabolism and jasmonate signal transduction. Subsequent pathway analysis elucidated the potential of methyl jasmonate treatment to elevate endogenous jasmonic acid levels and instigate the activation of the jasmonate signaling pathway.\u003c/p\u003e","manuscriptTitle":"Exogenous Methyl Jasmonate Mediated Physiological and Transcriptomic Network Improves Thrips tolerance in alfalfa (Medicago Sativa. L)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-09-06 09:36:04","doi":"10.21203/rs.3.rs-4853165/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-11-12T11:22:33+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-11T17:06:01+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-07T19:51:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"57926116550389628978214209092010327766","date":"2024-10-18T17:03:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"7425235878761835700861721295991576381","date":"2024-10-17T16:05:00+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-10-16T06:07:30+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-08-05T14:12:45+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-08-05T14:11:29+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Pest Science","date":"2024-08-03T11:49:33+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-pest-science","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pest","sideBox":"Learn more about [Journal of Pest Science](https://www.springer.com/journal/10340)","snPcode":"10340","submissionUrl":"https://submission.nature.com/new-submission/10340/3","title":"Journal of Pest Science","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"6461f7f4-d939-4353-89d4-318fdee2fb0c","owner":[],"postedDate":"September 6th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-03-03T16:03:35+00:00","versionOfRecord":{"articleIdentity":"rs-4853165","link":"https://doi.org/10.1007/s10340-025-01878-2","journal":{"identity":"journal-of-pest-science","isVorOnly":false,"title":"Journal of Pest Science"},"publishedOn":"2025-02-26 15:58:09","publishedOnDateReadable":"February 26th, 2025"},"versionCreatedAt":"2024-09-06 09:36:04","video":"","vorDoi":"10.1007/s10340-025-01878-2","vorDoiUrl":"https://doi.org/10.1007/s10340-025-01878-2","workflowStages":[]},"version":"v1","identity":"rs-4853165","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4853165","identity":"rs-4853165","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}