Production of S100A10 in the mammary glands of goats

Production of S100A10 in the mammary glands of goats | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Production of S100A10 in the mammary glands of goats Jirapat Jaisue, Zi-Long Liang, Nur Laili Marufah, Yusaku Tsugami, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7626449/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract S100A10 is a calcium-binding protein associated with plasmin production in milk. However, the relationship of S100A10 production with inflammation and plasmin production in the mammary glands remains unclear. The present study was undertaken to identify the production of the S100A10 calcium-binding protein in the mammary glands of goats and its concentration in milk after intramammary lipopolysaccharide (LPS) infusion. In milk, the expression of the S100A10 protein was measured by ELISA, whereas that of the S100A10 mRNA in the somatic cells (SCs) was determined using RT-PCR. S100A10 localization was observed in the mammary epithelial cells and in the leukocytes in milk using immunohistochemistry and immunocytochemistry. S100A10 concentration in milk was dramatically increased after intramammary LPS infusion compared to that before infusion. The mRNA expression of plasminogen activator-related molecules was observed in the SCs in milk, wherein the expression of PLAU and PLAUR increased significantly after intramammary LPS infusion compared to that before infusion. Immune-positive cells of S100A10 were observed in the macrophages and neutrophils in milk as well as in the mammary tissue. These results suggest that S100A10 is produced in the mammary glands, and its production is related to inflammation and plasmin production. Antimicrobial protein plasmin milk mastitis inflammation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1 Introduction Mastitis is an important disease in dairy cows and causes huge economic losses in the dairy industry owing to the difficulties associated with its treatment. Antibiotics are used to treat mastitis; however, milk from antibiotic-treated animals is unfit for trade and consumption, while the frequent use of antibiotics increases the possibility of the development of resistant bacteria. Therefore, it is important to fully understand the mechanisms of mastitis to formulate effective treatments using antibiotic-free methods. Annexin A2 (ANXA2) is a calcium-dependent phospholipid-binding protein that forms heterotetrameric complexes with two small S100A10 molecules acting as co-receptors for plasmin activation [ 1 ]. These complexes are localized at the extracellular membrane of various cell types such as endothelial cells, monocytes, and macrophages [ 2 ]. This heterotetrameric complex, known as the ANXA2/S100A10 complex (AIIt), is an important plasminogen-binding protein that stimulates the conversion of plasminogen to plasmin via the urokinase and tissue plasminogen activators (uPA and tPA, respectively) [ 3 ]. Plasmin plays a crucial role in regulating key proteins involved in early coagulation, fibrinolysis, and the complement system. While these protease cascades are essential for maintaining physiological balance and necessary for initiating an effective inflammatory response [ 4 ]. The generation of plasmin on the cell surface is particularly important for recruiting macrophages [ 4 , 5 ]. The anti-inflammatory effects of the plasmin system occur through the modulation of inflammatory mediator synthesis [ 6 ] and reprogramming of the M1 macrophages into their M2 phenotype [ 4 ], which induces increased neutrophil apoptosis [ 6 ]. Plasmin cleaves the casein amino acid sequence to generate antimicrobial proteins. It also cleaves and activates a portion of the antimicrobial peptide. As plasmin has been reported to be converted from plasminogen by plasminogen activators (PA) in mammary epithelial cells [ 7 ] and milk leukocytes, it is possible that plasmin conversion mediated by S100A10 and Annexin plays a crucial role in enhancing immune function within the mammary gland. Although there are several studies on the role and mechanisms of annexins in the udder [ 8 , 9 ], few have investigated S100A10 production in the mammary glands of ruminant. The soluble urokinase plasminogen-activator receptor (suPAR) is a membrane protein derived from the cleavage of the urokinase-type plasminogen-activator receptor (uPAR), which is expressed on immune cells, endothelial cells, smooth muscle, and fibroblast cells [ 10 , 11 ]. Elevated suPAR levels have been observed under various conditions including infection, cardiovascular diseases, and COVID-19 [ 12 ], which indicate the activation of immune and inflammatory pathways. It is hypothesized that S100A10 and suPAR are associated with endothelial cell damage and function, and a positive correlation between their concentrations in blood has been reported in humans [ 13 ]. However, their relationship with inflammation in the mammary glands remains unknown. The S100 calcium-binding protein family includes S100A7 and S100A8, which play important roles in the innate immunity in the mammary glands [ 14 , 15 ]. S100A7 and S100A8 are produced in teat epithelial cells and leukocytes, respectively, and exhibit antimicrobial activities against certain bacteria. S100A10, another member of this family, is also believed to play a pivotal role in antimicrobial defense within the mammary glands. However, reports on S100A10 are limited. Therefore, in the present study, we aimed to examine whether S100A10 was produced in the mammary glands of goats in relation to other plasminogen-associated molecules, and to determine any variations in its production levels under inflammatory conditions. 2 Materials and methods 2.1 Experimental animals All experimental procedures were conducted in accordance with the guidelines for animal experiments issued by the Hiroshima University and approved by the Animal Research Committee of Hiroshima University (No. C 19–4). Ten lactating goats, with low somatic cell counts (SCC; <1,000,000 cells/mL) in their milk, were used for this study. They were fed 0.6 kg of hay and 0.2 kg of barley per day, and had free access to water and a trace-mineralized salt block. Lipopolysaccharide (LPS; Escherichia coli O111:B4; Wako Pure Chemical Industries, Osaka, Japan; 1 mg/mL) dissolved in 5 mL saline was infused into the mammary glands to induce inflammation. 2.2 Sample collection 2.2.1 Milk collection Milk from all goats was collected by hand before LPS infusion and 7 days after. The milk was centrifuged to remove fat, and the SCC was measured. The resulting skim milk was used to measure the S100A10 and serum amyloid A (SAA). Milk precipitates containing leukocytes were subjected to immunocytochemistry and RT-PCR analyses. 2.2.2 Mammary tissue collection Mammary tissue samples were collected from the goats 24 h after intramammary infusion with and without LPS infusion. Deep sedation and anesthesia were achieved through slow intravenous injections of xylazine (Bayer HealthCare Pharmaceuticals Inc., Leverkusen, Germany) and pentobarbital (Somnopentyl; Kyoritsu Seiyaku, Tokyo, Japan), respectively, after which the goats were euthanized by exsanguination. 2.3 Production of the S100A10 antibody The antibody was produced by immunizing a part of the amino sequence of S100A10 (Cys-FVVHMKQKGKK; SCRUM, Tokyo, Japan) with rabbit. Immunoglobulins were purified from the antiserum using a HiTrap Protein G High Performance Affinity column (Cytiva, Uppsala, Sweden), according to the manufacturer’s instructions. The affinity-purified S100A10 antibody was used for enzyme-linked immunosorbent assay (ELISA), immunohistochemistry, and immunocytochemistry. 2.4 ELISA Concentrations of S100A10 in milk were measured using ELISA as reported previously [16]. Briefly, 96-well plates were coated with goat anti-rabbit IgG antibody and then diluted samples, rabbit anti-S100A10 antibody, and horseradish-labeled S100A10 were added. After washing with phosphate-buffered saline (PBS) containing Tween 20, tetramethylbenzidine solution was added and the optical density was measured at 450 nm using a plate reader. SAA was measured as described previously [17]. 2.5 Immunostaining for S100A10 in mammary gland tissues and milk leukocytes 2.5.1 Immunohistochemistry and immunocytochemistry The collected mammary gland tissues were fixed, dehydrated, and embedded in paraffin. Sections (3-μm thick) were air-dried on MAS-coated slides. After deparaffinization and washing with PBS, antigen retrieval was performed by autoclaving the sections in a citric acid buffer (pH 6.0) for 20 min at 121°C. The sections were washed with PBS for 10 min. Sections and SCs seeded on the glass slides were incubated at 37°C for 3 h with rabbit antibodies against S100A10 diluted in PBS. After washing, the slides were incubated with peroxidase-labeled goat anti-rabbit IgG and anti-mouse IgG antibodies (Histofine MAX-PO; Nichirei Bioscience, Tokyo, Japan) for 1 h at room temperature. The immunosignals from the sections were visualized by incubation with a diaminobenzidine reaction mixture. The slides were counterstained with hematoxylin, dehydrated, and covered. Immunohistochemical images were obtained using an Eclipse E400 microscope and a Digital Sight DS-Fi1 camera (Nikon). 2.5.2 Immunofluorescence The mammary tissue sections were incubated overnight at 4°C with the rabbit antibody against S100A10 and mouse monoclonal antibodies against CD3 (#NBP2-53386; Novus Biologicals, Littleton, CO, USA) or IBA1 (#sc-32725; Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted in PBS-T containing 2.5% bovine serum albumin. After washing, the sections were incubated with secondary antibodies (Alexa Fluor 488-conjugated goat anti-rabbit, #A32731; Alexa Fluor 555-conjugated goat anti-mouse, #A32727; Thermo Fisher Scientific, Waltham, MA, USA) diluted with PBS-T containing 2.5% bovine serum albumin for 1 h at room temperature. Immunofluorescent images were obtained using a fluorescence microscope (BZ-9000) and processed using analysis software (Keyence, Osaka, Japan). 2.6 Real-time polymerase chain reaction (RT-PCR) Total RNA was extracted from the SCs using Sepasol RNA I Super (Nacalai Tesque, Inc., Kyoto, Japan) according to the manufacturer's instructions. The extracted total RNA samples were dissolved in TE buffer (10 mM Tris-HCl, pH 8.0, with 1 mM EDTA) and stored at −80°C until RT-PCR. The concentration of total RNA in each sample was measured using a NanoDrop Lite (Thermo Fisher Scientific). RNA samples were reverse-transcribed using ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo Co., Ltd., Osaka, Japan) on a PTC-100 programmable thermal controller (MJ Research, Waltham, MA, USA), programmed according to the manufacturer's instructions. Real-time PCR was performed using an Aria MX real-time PCR system (Agilent Technologies, Santa Clara, CA, USA) with Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies). Table 1 lists the primers used for PCR. The cycling parameters used for amplification were as follows: denaturation at 95°C for 5 s and annealing at 60°C for 10 s. Denaturation and annealing were performed for 55 cycles for all the primer sets. The cycle parameters for the melting step were 95°C for 30 s, 65°C for 30 s, and 95°C for 30 s. To calculate the relative levels of gene expression in each sample, real-time PCR data were analyzed using the 2 −ΔΔCT [∆Ct = Ct (target gene) – Ct (housekeeping gene); ∆∆Ct = ∆Ct (target sample) - ∆Ct (control sample)] method [18]. Expression levels of the target genes were normalized using the expression of Capra hircus ribosomal protein S18 ( RPS18 ), a housekeeping gene for goats. Table 1. Primers used for mRNA expression analysis. Gene Primer sequence Product Size Accession No. An x A2 F: CCAAGTGCATACGGGTCAGT 101 XM_018054288.1 R: ACCTCATCCACACCTTTGGTC PLAU F: CAGGACTGCTCTGCTGGAAAA 189 XM_005699221.3 R: GCCACCGCACAAGTAGGTAA PLAUR F: ACAGGCACTAAAGGACTGAGG 121 XM_005692612.3 R: AGCAGGAGACGTTGACATGG PLGRKT F: GTCTCTCTAACAGCTGGAGCAAT 98 XM_005683695.3 R: CCCATGTCATACTGGTAGGCAA S100A10 F: ACGTACTAAGGCGCCCTGC 132 XM_018046106.1 R: GGCGTGTTCCATTTGAGACG RPS18 F: GTGTGGGACGAAGATACGCT 101 NM_001285639.1 R: GATCACACGTTCCACCTCGT AnxA2 : Annexin A2; PLAU : Plasminogen activator urokinase; PLAUR : Plasminogen activator urokinase receptor; PLGRKT : Plasminogen receptor with C-terminal lysine; RPS18 : Ribosomal protein S18. 2.7 Statistical analysis Data are presented as the mean ± standard error (SEM). Statistical analyses were performed using the SAS software (version 9.4; SAS Institute Inc., Cary, NC, USA). Differences in S100A10 concentrations in milk between the groups were analyzed using the Wilcoxon test, and correlations between parameters were assessed using the Spearman’s rank correlation test. The qPCR results were log₁₀-transformed and the Anderson–Darling test was used to assess the normality of the data. For data that were not normally distributed, the Wilcoxon test was used for comparison. For normally distributed data, either the Wilcoxon test or Tukey’s multiple comparison test was used, as appropriate. A mixed-effects model was employed to evaluate the changes over time. Differences were considered statistically significant at p < 0.05. 3 Results 3.1 Production of S100A10 in leukocytes in milk and mammary gland tissues When leukocytes from milk were immunostained with the S100A10 antibody, immune-positive cells, such as macrophages and neutrophils, were also observed (Fig. 1). When healthy mammary gland tissues were stained and observed under a fluorescent microscope, S100A10-positive cells were observed and were identified as macrophages (Fig. 2). However, the tissues from inflamed mammary glands showed a greater number of cells positive for both S100A10 and IBA1 (Fig. 3), whereas the number of CD3-positive cells showed no increase. Several of these double-positive for both S100A10 and IBA1 cells were observed in the mammary gland tissue samples (Fig. 3). 3.2 S100A10 concentration in milk determined using ELISA The concentration of S100A10 in milk, measured using ELISA, showed a significantly increased concentration after intramammary LPS infusion compared to that detected before infusion (Fig. 4A). The S100A10 concentration was significantly higher at 24 h after intramammary LPS infusion than that before infusion; it increased sharply 2 h after LPS infusion and remained elevated until 24 h (Fig. 4B). To determine whether S100A10 was linked to inflammation, its correlation with other inflammatory markers (SCC and SAA) and the anti-inflammatory cytokine (interleukins-1 receptor antagonist; IL-1ra) were analyzed (Fig. 5). S100A10 showed a significant positive correlation with SCC (r = 0.542, p = 0.020) and SAA (r = 0.790, p = 0.002) and a significant negative correlation with IL-1ra (r = ­0.603, p = 0.038). 3.3 Expression of genes related to S100A10 RT-PCR analysis of the molecules involved in plasminogen activation revealed that S100A10 expression decreased significantly after LPS infusion, whereas that of AnxA2 and PLGRKT remained unchanged. In contrast, the expression levels of both PLAU and PLAUR showed significant increases at 8 h after intramammary LPS infusion compared to their pre-infusion levels; however, these levels subsequently decreased (Fig. 6). 4 Discussion Immunostaining of goat mammary glands was carried out to investigate the localization of S100A10. The results showed that S100A10 was localized in the connective tissue between the mammary alveoli. Furthermore, this positive reaction colocalized with a macrophage marker (IBA1) on double staining. In addition, immunostaining of the leukocytes in milk revealed the presence of both macrophages and neutrophils. These findings suggested that S100A10 is synthesized in the leukocytes, particularly in the macrophages and neutrophils. The S100A10 concentration in milk was below 1 µg/mL prior to LPS infusion but increased markedly to 1–4 µg/mL at 24 h post-infusion. A detailed time-course analysis revealed that the S100A10 concentration in milk rapidly increased within a few hours after intramammary LPS infusion, and subsequently decreased after approximately 2 days. These changes were largely consistent with those observed in SCC. These findings indicate that S100A10 concentrations increase rapidly in response to inflammatory stimuli. Thus, the S100A10 protein may serve as a valuable biomarker for inflammation based on the substantial differences in its concentrations between inflammatory and non-inflammatory conditions in tissues (2–70 fold in the present study). Although numerous studies have proposed various markers for mastitis, such as lactoferrin [ 19 ], N-acetyl-beta-d-glucosaminidase (NAGase) [ 20 ], lactoperoxidase [ 21 ], cathelicidin [ 22 ] and defensin [ 23 ], S100A10 appears to be among the most promising candidates. To investigate the association between S100A10 and inflammation, its correlation with inflammatory markers (SCC and SAA) and the anti-inflammatory cytokine, IL-1ra, was analyzed. S100A10 exhibited a significant positive correlation with SCC and SAA, and a significant negative correlation with IL-1ra. These results indicate that S100A10 is a protein whose expression increases in response to inflammation. Furthermore, an in vivo study demonstrated that knockdown of S100A10 inhibited the secretion of inflammatory cytokines, including TNF-α, IL-1β, and IL-10, in human chondrocytes stimulated with LPS [ 24 ]. The study also revealed that this effect involves the inhibition of the MAPK and NF-κB signaling pathways. Collectively, these results indicate that S100A10 not only responds to inflammation but may also play a functional role in modulating the immune response. S100A10 is a cell-surface plasminogen receptor that plays a crucial role in plasmin generation in response to various physiological stimuli. Plasmin contributes to the proinflammatory environment by promoting myeloid cell infiltration and cytokine release [ 1 ]. After intramammary LPS infusion, a significant increase in PLAUR and PLAU expression was observed at 12 h post-infusion. S100A10 facilitates plasminogen conversion to plasmin either by binding to ANXA2 or independently through its carboxy-terminal lysine in coordination with the uPA/uPAR complex [ 25 ]. This upregulation may contribute to the accumulation of S100A10 in milk and the subsequent increase in SCC, indicating enhanced leukocyte trafficking into the mammary glands during inflammation. Interestingly, although S100A10 protein levels in milk were elevated, its mRNA expression in leukocytes did not increase following LPS infusion. This suggests that the existing protein levels may be sufficient to sustain the inflammatory response, potentially negating the need for further transcriptional upregulation. While mRNA expression of PLGRKT , PLAU , and PLAUR was detected, S100A10 level remained unchanged. These results suggest that S100A10 plays a key role in regulating plasmin generation during inflammation in the mammary glands. Therefore, it is necessary to further investigate the relationship between S100A10 and plasmin production at the protein level. Plasmin activates proenzymes, such as matrix metalloproteinases (MMPs), procathepsin B, and pro-uPA, leading to extracellular matrix degradation and the release of growth factors through proteolysis. This process facilitates tissue remodeling and immune cell migration [ 26 – 28 ]. Additionally, O’Connell et al. [ 29 ] have reported that, in a model of peritoneal inflammation, S100A10-deficient mice showed significantly reduced macrophage migration and impaired plasmin generation, which suggests a direct role of S100A10 in macrophage recruitment and plasmin activation in response to inflammatory stimuli. In conclusion, S100A10 is synthesized by milk leukocytes, particularly macrophages and neutrophils. Intramammary LPS infusion promotes the secretion of S100A10 into milk, which regulates the inflammatory response within the mammary glands through plasminogen activation. These findings suggest that S100A10 could serve as a potential biomarker and therapeutic target for the management of mastitis. However, future studies are needed to elucidate additional factors influencing S100A10 production and function within the mammary gland. Declarations Funding This work was supported by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (JSPS Kakenhi; Grant Numbers 21K05893 and 24K09211). Conflict of Interest The authors declare that this study was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest. Ethics statement The study was conducted in accordance with the guidelines for animal experiments issued by the Hiroshima University and was approved by the Animal Research Committee of Hiroshima University (No. C 19–4). Author information Authors and Affiliations Graduate School of Integrated Sciences for Life, Hiroshima University, 1-4-4 Kagamiyama, Higashi-Hiroshima, 739-8528, Hiroshima, Japan Jirapat Jaisue, Zi-Long Liang, Nur Laili Marufah,Takahiro Nii & Naoki Isobe Faculty of Animal Science, Gadjah Mada University, Jl. Fauna No.3 Kampus UGM Bulaksumur, 555281, Yogyakarta, Indonesia Nur Laili Marufah National Institute of Animal Health, National Agriculture and Food Research Organization, 4 Hitsujigaoka, Toyohira, Sapporo, Hokkaido, 062-0045, Japan Yusaku Tsugami Author Contributions Jirapat Jaisue: Formal analysis, Investigation, Writing – original draft – review & editing; Zi-Long Liang: Formal analysis, Writing – original draft & review; Nur L Marufah: Investigation, Writing – review; Yusaku Tsugami: Formal analysis, Methodology, Resources, Writing – original draft & review; Takahiro Nii: Methodology, Resources, Writing – review; Naoki Isobe: Conceptualization, Funding acquisition, Formal analysis, Methodology, Resources, Validation, Writing – original draft – review & editing. Corresponding author Correspondence to Naoki Isobe References Miller VA, Madureira PA, Kamaludin AA, Komar J, Sharma V, Sahni G, et al. Mechanism of plasmin generation by S100A10. Thromb Haemost. 2017;117:1058-71. https://doi.org/10.1160/TH16-12-0936 Bharadwaj A, Bydoun M, Holloway R, Waisman D. Annexin A2 heterotetramer: Structure and function. Int J Mol Sci. 2013;14:6259-305. https://doi.org/10.3390/ijms14036259 Kassam G, Le BH, Choi KS, Kang HM, Fitzpatrick SL, Louie P, et al. The p11 subunit of the annexin II tetramer plays a key role in the stimulation of t-PA-dependent plasminogen activation. Biochem. 1998;37:16958-66. https://doi.org/10.1021/bi981713l Heissig B, Salama Y, Takahashi S, Osada T, Hattori K. The multifaceted role of plasminogen in inflammation. Cell Signal. 2020;75:109761. https://doi.org/10.1016/j.cellsig.2020.109761 Cox G, Crossley J, Xing Z. Macrophage engulfment of apoptotic neutrophils contributes to the resolution of acute pulmonary inflammation in vivo. Am J Respir Cell Mol Biol. 1995;12:232-7. https://doi.org/10.1165/ajrcmb.12.2.7865221 Perucci LO, Juliana PV. Miles LA, Sousa LP. Crosstalk between the plasminogen/plasmin system and inflammation resolution. J Thromb Haemost. 2023;21:2666-78. https://doi.org/10.1016/j.jtha.2023.07.013 Heegard CE, White JH, Zavizion B, Turner JD, Politis I. Production of various forms of plasminogen activator and plasminogen activator inhibitor by cultured mammary epithelial cells. J Dairy Sci. 1994;77:2949-58. https://doi.org/10.3168/jds.S0022-0302(94)77236-2 Zhang M, Dongying C, Zhen Z, Ao J, Xiaohan Y, Gao X. Annexin A2 positively regulates milk synthesis and proliferation of bovine mammary epithelial cells through the mTOR signaling pathway. J Cell Physiol. 2018;233:2464-2475. https://doi.org/10.1002/jcp.26123 Gao J, Li T,Lu Z, Wang X, Zhao X, Ma Y. Proteomic analyses of mammary glands provide insight into the immunity and metabolism pathways associated with clinical mastitis in meat sheep. Animals. 2019;9:309. https://doi.org/10.3390/ani9060309 Füller D, Liu C, Ko Y, Alkhoder AA, Desai SR, Almuwaqqat Z, et al. Soluble urokinase Plasminogen Activator Receptor (suPAR) mediates the effect of a lower education level on adverse outcomes in patients with coronary artery disease. Eur J Prev Cardiol. 2024;31:521-8. https://doi.org/10.1093/eurjpc/zwad311 Thuno M, Macho B, Eugen-Olsen J. suPAR: The molecular crystal ball. Dis Markers. 2009;27:157-72. https://doi.org/10.3233/DMA-2009-0657 Obeagu EI. The dynamic role of soluble urokinase plasminogen activator receptor (suPAR) in monitoring coagulation dysfunction during COVID-19 progression: a review. Ann Med Surg (Lond). 2024;87:635-40. https://doi.org/10.1097/MS9.0000000000002791 Donohue J, Gruen D, Iyanna N, Lorence J, Brown J, Guyette F, et al. Mechanism matters: mortality and endothelial cell damage marker differences between blunt and penetrating traumatic injuries across three prehospital clinical trials. Sci Rep. 2024;14:2747. https://doi.org/10.1038/s41598-024-53398-1 Zhang GW, Lai SJ, Yoshimura Y, Isobe N. Messenger RNA expression and immunolocalization of psoriasin in the goat mammary gland and its milk concentration after an intramammary infusion of lipopolysaccharide. Vet J. 2014;202:89-93. https://doi.org/10.1016/j.tvjl.2014.06.013 Purba FY, Nii T, Yoshimura Y, Isobe N. Short communication: Production of antimicrobial peptide S100A8 in the goat mammary gland and effect of intramammary infusion of lipopolysaccharide on S100A8 concentration in milk. J Dairy Sci. 2019;102:4674-81. https://doi.org/10.3168/jds.2018-15396 Isobe N, Nakamura J, Nakano H, Yoshimura Y. Existence of functional lingual antimicrobial peptide in bovine milk. J Dairy Sci. 2009;92:2691-5. https://doi.org/10.3168/jds.2008-1940 Marufah NL, Nii T, Suzuki N, Jaisue J, Isobe N. Interleukin 1 Receptor Antagonist (IL-1ra) production and expression dynamics in mammary glands after lipopolysaccharide infusion Anim Sci J. 2025;96:e70047. https://doi.org/10.1111/asj.70047 Nii T, Shinkoda T, Isobe N, Yoshimura Y. Intravaginal injection of Lactobacillus johnsonii may modulates oviductal microbiota and mucosal barrier function of laying hens. Poult Sci. 2023;102:102699. https://doi.org/10.1016/j.psj.2023.102699 Chaneton L, Bontá M, Pol M, Tirante L, Bussmann LE. Milk lactoferrin in heifers: Influence of health status and stage of lactation. J Dairy Sci. 2013;96:4977-82. https://doi.org/10.3168/jds.2012-6028 Hovinen M, Simojoki H, Pösö R, Suolaniemi J, Kalmus P, Suojala L, et al. N-acetyl -β-D-glucosaminidase activity in cow milk as an indicator of mastitis. J Dairy Res. 2016;83:219-27. https://doi.org/10.1017/S0022029916000224 Yamasaki A, Yoshimura Y, Isobe N. Changes in the concentrations of somatic cell counts, lingual antimicrobial peptide and lactoperoxidase activity in milk at periovulatory period in dairy cows. Anim Sci J. 2017;88:484-8. https://doi.org/10.1111/asj.12644 Addis M, Tedde V, Puggioni GMG, Pisanu S, Casula A, Locatelli C, et al. Evaluation of milk cathelicidin for detection of bovine mastitis. J Dairy Sci. 2016;99:8250-8. https://doi.org/10.3168/jds.2016-11407 Kawai K, Akamatsu H, Obayashi T, Nagahata H, Higuchi H, Iwano H, et al. Relationship between concentration of lingual antimicrobial peptide and somatic cell count in milk of dairy cows. Vet Immunol Immunopathol. 2013;153:298-301. https://doi.org/10.1016/j.vetimm.2013.03.002 Song C, Zhou X, Dong Q, Fan R, Wu G, Ji B, et al. Regulation of inflammatory response in human chondrocytes by lentiviral mediated RNA interference against S100A10. Inflamm. Res. 2012;61:1219–27. https://doi.org/10.1007/s00011-012-0519-6 Madureira PA, O'Connell PA, Surette AP, Miller VA, Waisman DM. The biochemistry and regulation of s100a10: a multifunctional plasminogen receptor involved in oncogenesis. J Biomed Biotechnol. 2012; https://doi.org/10.1155/2012/353687 Aĭsina RB, Mukhametova LI. Structure and function of plasminogen/plasmin system. Bioorg Khim. 2014;40:642-57. https://doi.org/10.1134/s1068162014060028 Saiki Y, Horii A. Multiple functions of S100A10, an important cancer promoter. Pathol Int. 2019;69:629-36. https://doi.org/10.1111/pin.12861 Mai J, Waisman DM, Sloane BF. Cell surface complex of cathepsin B/annexin II tetramer in malignant progression. Biochim Biophys Acta. 2000;1477:215-30. https://doi.org/10.1016/s0167-4838(99)00274-5 O'Connell PA, Surette AP, Liwski RS, Svenningsson P, Waisman DM. S100A10 regulates plasminogen-dependent macrophage invasion. Blood. 2010;116:1136-46. https://doi.org/10.1182/blood-2010-01-264754 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7626449","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":518465317,"identity":"a27115a6-0911-4963-8513-f13b04b39b65","order_by":0,"name":"Jirapat Jaisue","email":"","orcid":"","institution":"Hiroshima University","correspondingAuthor":false,"prefix":"","firstName":"Jirapat","middleName":"","lastName":"Jaisue","suffix":""},{"id":518465318,"identity":"607c0e29-e49d-4634-9350-e38e7acfcc61","order_by":1,"name":"Zi-Long Liang","email":"","orcid":"","institution":"Hiroshima University","correspondingAuthor":false,"prefix":"","firstName":"Zi-Long","middleName":"","lastName":"Liang","suffix":""},{"id":518465319,"identity":"9b548806-374a-413a-bfad-63637817638c","order_by":2,"name":"Nur Laili Marufah","email":"","orcid":"","institution":"Hiroshima University","correspondingAuthor":false,"prefix":"","firstName":"Nur","middleName":"Laili","lastName":"Marufah","suffix":""},{"id":518465320,"identity":"20d5447b-88c0-4f16-a4f8-e09cc343186d","order_by":3,"name":"Yusaku Tsugami","email":"","orcid":"","institution":"National Institute of Animal Health","correspondingAuthor":false,"prefix":"","firstName":"Yusaku","middleName":"","lastName":"Tsugami","suffix":""},{"id":518465321,"identity":"20e7970b-156c-498a-97a0-7b22ca0d231a","order_by":4,"name":"Takahiro Nii","email":"","orcid":"","institution":"Hiroshima University","correspondingAuthor":false,"prefix":"","firstName":"Takahiro","middleName":"","lastName":"Nii","suffix":""},{"id":518465322,"identity":"d2d31c98-17a9-4cc0-8a64-071112a55995","order_by":5,"name":"Naoki Isobe","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA6klEQVRIie3QsYrCMBjA8a8ctEuOrAnFd4gETjv4LieCU+q9gEhAyKau+iaO9QK6VFwdLYKTiwjCLWri4HLY2k0kf/gyBH58JAAu1yv2YeYgiTkRJPdbUkC8STli1aeEG3muWhBk28a0/oPxcva77kJTBnoD0fQxifqI8zgl0WTc+dZibghqM6DpY8I08sNYEcbWiGnhX5oSBABVeSTYhZElq9SQs9mC90UEvkLPkkQwHStDSOEWxKsDQ+jYkiFwRXYsyX3LapFt/lSPYZzyozhBZYRb2Zbm/Nj/fDOayjLE5h1KE5fL5Xrjrgl8StzKP9P4AAAAAElFTkSuQmCC","orcid":"","institution":"Hiroshima University","correspondingAuthor":true,"prefix":"","firstName":"Naoki","middleName":"","lastName":"Isobe","suffix":""}],"badges":[],"createdAt":"2025-09-16 06:08:45","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7626449/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7626449/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":92433121,"identity":"f3ad2760-a9c9-4b4f-bd53-74aa81f9e4e4","added_by":"auto","created_at":"2025-09-29 16:28:07","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3701852,"visible":true,"origin":"","legend":"","description":"","filename":"s100a10250718.docx","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/a4e24fa209115387c5d96733.docx"},{"id":92433100,"identity":"645abb71-67d5-4bd1-b47c-e3d29afa7105","added_by":"auto","created_at":"2025-09-29 16:28:06","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7180,"visible":true,"origin":"","legend":"","description":"","filename":"9d78fd1452464beea7432c7f138d5d34.json","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/434aea11e03ff7c20a891ab2.json"},{"id":92434853,"identity":"4ab8cab3-4c76-49b1-b042-7ebaed602a98","added_by":"auto","created_at":"2025-09-29 16:52:06","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":82550,"visible":true,"origin":"","legend":"","description":"","filename":"9d78fd1452464beea7432c7f138d5d341enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/cbc69521bd00a587d9155962.xml"},{"id":92433108,"identity":"178cfa04-374e-4592-8e2a-f83f09121073","added_by":"auto","created_at":"2025-09-29 16:28:06","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":337027,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/a9898cce06d8521d28eb4a12.png"},{"id":92433113,"identity":"7c47dd8b-eea2-4c78-8ec2-a330d274bec9","added_by":"auto","created_at":"2025-09-29 16:28:06","extension":"png","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1188124,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/06b2de020a060d83a798ed95.png"},{"id":92434318,"identity":"00c3561a-956a-40bc-8b01-0921949cdaf1","added_by":"auto","created_at":"2025-09-29 16:44:06","extension":"png","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1284269,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/4f706af84b2877ea1bcfc2de.png"},{"id":92433394,"identity":"84a00d11-d207-443e-9215-5e7b4339b8b6","added_by":"auto","created_at":"2025-09-29 16:36:06","extension":"png","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":62558,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/744fc42793ecb8d218307354.png"},{"id":92433106,"identity":"ec5f4e2c-219b-44b4-baaa-79d0197a99bb","added_by":"auto","created_at":"2025-09-29 16:28:06","extension":"png","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":66616,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/8cde7fab2de16495a080bc06.png"},{"id":92433393,"identity":"9ee4a117-671c-4bb3-8847-2e48b7c8568e","added_by":"auto","created_at":"2025-09-29 16:36:06","extension":"png","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":60320,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/b66e4b0746b720841ab084fe.png"},{"id":92433396,"identity":"89e40533-d781-48e4-86d8-a1452e6bce51","added_by":"auto","created_at":"2025-09-29 16:36:06","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":53283,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/f8b70db566f0643aa50eb6fc.png"},{"id":92434854,"identity":"19904fdc-8ee0-4270-b1f1-45814805b4de","added_by":"auto","created_at":"2025-09-29 16:52:06","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":175925,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/f897ffab0ce9f6d3c3f3e795.png"},{"id":92433399,"identity":"eaf3a59b-fe61-4307-bda6-e264ebf1664a","added_by":"auto","created_at":"2025-09-29 16:36:07","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":188826,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/7e3187510ab534e3dd1da97d.png"},{"id":92433117,"identity":"a695b489-ded1-420e-84c4-de3a6f244b4f","added_by":"auto","created_at":"2025-09-29 16:28:06","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16577,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/cb2c80e9f9d34e7c60187ce1.png"},{"id":92433119,"identity":"14ca7141-f501-4ad0-a1e9-5e214e6eab86","added_by":"auto","created_at":"2025-09-29 16:28:07","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18564,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/34a5b0c35d3c49a581e0c4f2.png"},{"id":92434320,"identity":"a6bbbb18-0ced-4915-86fa-f2e11739a593","added_by":"auto","created_at":"2025-09-29 16:44:06","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":36133,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/b62c45fe14aaad2b79206154.png"},{"id":92433120,"identity":"6fc9f8f3-18dd-417a-9ad2-4f14a307fb4f","added_by":"auto","created_at":"2025-09-29 16:28:07","extension":"xml","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":81526,"visible":true,"origin":"","legend":"","description":"","filename":"9d78fd1452464beea7432c7f138d5d341structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/98879c8c96f9c406e7e3f23e.xml"},{"id":92433118,"identity":"378207e9-75ca-4195-a6c4-9c415f722f62","added_by":"auto","created_at":"2025-09-29 16:28:06","extension":"html","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":90663,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/78214eae1fcaf2d6d9843eeb.html"},{"id":92433099,"identity":"4c255c08-5bf9-4a16-a3dc-3906a097c52b","added_by":"auto","created_at":"2025-09-29 16:28:06","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":126381,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Picture1.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/385462438540169a50dd185a.png"},{"id":92433101,"identity":"572c27c3-7b62-4339-9288-f933cc11e920","added_by":"auto","created_at":"2025-09-29 16:28:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":452005,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Picture2.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/e97e332e66f2ad7bcc6688e2.png"},{"id":92434316,"identity":"3cfa1eda-63b2-46f5-a69a-fb5b6672992d","added_by":"auto","created_at":"2025-09-29 16:44:06","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":408065,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Picture3.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/068e42b3a9bae1f0d980bc0e.png"},{"id":92433390,"identity":"841fa19b-ec6c-42eb-8243-e03f4c772ed2","added_by":"auto","created_at":"2025-09-29 16:36:06","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":137095,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Picture4.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/968225c30be27838fc45f00d.png"},{"id":92433103,"identity":"50036612-cf8f-4b47-9bb4-10c5c8632b51","added_by":"auto","created_at":"2025-09-29 16:28:06","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":154343,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Picture5.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/37a6929b1dd171246a0d6bee.png"},{"id":92433110,"identity":"a83f2cd8-2b7e-45ed-836a-0d37a7cebc18","added_by":"auto","created_at":"2025-09-29 16:28:06","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":258906,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"Picture6.png","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/c852034c2e58984c8a800e25.png"},{"id":93060048,"identity":"921630d4-64f3-476a-a0d0-b99203d4f18b","added_by":"auto","created_at":"2025-10-08 15:38:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2242710,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7626449/v1/5e653d61-23ea-4b82-9766-caccd240a379.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Production of S100A10 in the mammary glands of goats","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eMastitis is an important disease in dairy cows and causes huge economic losses in the dairy industry owing to the difficulties associated with its treatment. Antibiotics are used to treat mastitis; however, milk from antibiotic-treated animals is unfit for trade and consumption, while the frequent use of antibiotics increases the possibility of the development of resistant bacteria. Therefore, it is important to fully understand the mechanisms of mastitis to formulate effective treatments using antibiotic-free methods.\u003c/p\u003e\u003cp\u003eAnnexin A2 (ANXA2) is a calcium-dependent phospholipid-binding protein that forms heterotetrameric complexes with two small S100A10 molecules acting as co-receptors for plasmin activation [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. These complexes are localized at the extracellular membrane of various cell types such as endothelial cells, monocytes, and macrophages [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. This heterotetrameric complex, known as the ANXA2/S100A10 complex (AIIt), is an important plasminogen-binding protein that stimulates the conversion of plasminogen to plasmin via the urokinase and tissue plasminogen activators (uPA and tPA, respectively) [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Plasmin plays a crucial role in regulating key proteins involved in early coagulation, fibrinolysis, and the complement system. While these protease cascades are essential for maintaining physiological balance and necessary for initiating an effective inflammatory response [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The generation of plasmin on the cell surface is particularly important for recruiting macrophages [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The anti-inflammatory effects of the plasmin system occur through the modulation of inflammatory mediator synthesis [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] and reprogramming of the M1 macrophages into their M2 phenotype [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], which induces increased neutrophil apoptosis [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Plasmin cleaves the casein amino acid sequence to generate antimicrobial proteins. It also cleaves and activates a portion of the antimicrobial peptide. As plasmin has been reported to be converted from plasminogen by plasminogen activators (PA) in mammary epithelial cells [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] and milk leukocytes, it is possible that plasmin conversion mediated by S100A10 and Annexin plays a crucial role in enhancing immune function within the mammary gland. Although there are several studies on the role and mechanisms of annexins in the udder [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], few have investigated S100A10 production in the mammary glands of ruminant. The soluble urokinase plasminogen-activator receptor (suPAR) is a membrane protein derived from the cleavage of the urokinase-type plasminogen-activator receptor (uPAR), which is expressed on immune cells, endothelial cells, smooth muscle, and fibroblast cells [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Elevated suPAR levels have been observed under various conditions including infection, cardiovascular diseases, and COVID-19 [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], which indicate the activation of immune and inflammatory pathways. It is hypothesized that S100A10 and suPAR are associated with endothelial cell damage and function, and a positive correlation between their concentrations in blood has been reported in humans [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. However, their relationship with inflammation in the mammary glands remains unknown.\u003c/p\u003e\u003cp\u003eThe S100 calcium-binding protein family includes S100A7 and S100A8, which play important roles in the innate immunity in the mammary glands [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. S100A7 and S100A8 are produced in teat epithelial cells and leukocytes, respectively, and exhibit antimicrobial activities against certain bacteria. S100A10, another member of this family, is also believed to play a pivotal role in antimicrobial defense within the mammary glands. However, reports on S100A10 are limited.\u003c/p\u003e\u003cp\u003eTherefore, in the present study, we aimed to examine whether S100A10 was produced in the mammary glands of goats in relation to other plasminogen-associated molecules, and to determine any variations in its production levels under inflammatory conditions.\u003c/p\u003e"},{"header":"2 Materials and methods","content":"\u003ch2\u003e2.1\u0026nbsp; Experimental animals\u003c/h2\u003e\n\u003cp\u003eAll experimental procedures were conducted in accordance with the guidelines for animal experiments issued by the Hiroshima University and approved by the Animal Research Committee of Hiroshima University (No. C 19\u0026ndash;4). Ten lactating goats, with low somatic cell counts (SCC; \u0026lt;1,000,000 cells/mL) in their milk, were used for this study. They were fed 0.6 kg of hay and 0.2 kg of barley per day, and had free access to water and a trace-mineralized salt block. Lipopolysaccharide (LPS; \u003cem\u003eEscherichia coli\u003c/em\u003e O111:B4; Wako Pure Chemical Industries, Osaka, Japan; 1 mg/mL) dissolved in 5 mL saline was infused into the mammary glands to induce inflammation.\u003c/p\u003e\n\u003ch2\u003e2.2\u0026nbsp; Sample collection\u003c/h2\u003e\n\u003ch3\u003e2.2.1\u0026nbsp;\u0026nbsp;Milk collection\u003c/h3\u003e\n\u003cp\u003eMilk from all goats was collected by hand before LPS infusion and 7 days after. The milk was centrifuged to remove fat, and the SCC was measured. The resulting skim milk was used to measure the S100A10 and serum amyloid A (SAA). Milk precipitates containing leukocytes were subjected to immunocytochemistry and RT-PCR analyses.\u003c/p\u003e\n\u003ch3\u003e2.2.2\u0026nbsp;\u0026nbsp;Mammary tissue collection\u003c/h3\u003e\n\u003cp\u003eMammary tissue samples were collected from the goats 24 h after intramammary infusion with and without LPS infusion. Deep sedation and anesthesia were achieved through slow intravenous injections of xylazine (Bayer HealthCare Pharmaceuticals Inc., Leverkusen, Germany) and pentobarbital (Somnopentyl; Kyoritsu Seiyaku, Tokyo, Japan), respectively, after which the goats were euthanized by exsanguination.\u003c/p\u003e\n\u003ch2\u003e2.3 Production of the S100A10 antibody\u003c/h2\u003e\n\u003cp\u003eThe antibody was produced by immunizing a part of the amino sequence of S100A10 (Cys-FVVHMKQKGKK; SCRUM, Tokyo, Japan) with rabbit. Immunoglobulins were purified from the antiserum using a HiTrap Protein G High Performance Affinity column (Cytiva, Uppsala, Sweden), according to the manufacturer\u0026rsquo;s instructions. The affinity-purified S100A10 antibody was used for enzyme-linked immunosorbent assay (ELISA), immunohistochemistry, and immunocytochemistry.\u003c/p\u003e\n\u003ch2\u003e2.4 ELISA\u003c/h2\u003e\n\u003cp\u003eConcentrations of S100A10 in milk were measured using ELISA as reported previously [16]. Briefly, 96-well plates were coated with goat anti-rabbit IgG antibody and then diluted samples, rabbit anti-S100A10 antibody, and horseradish-labeled S100A10 were added. After washing with phosphate-buffered saline (PBS) containing Tween 20, tetramethylbenzidine solution was added and the optical density was measured at 450 nm using a plate reader. SAA was measured as described previously [17].\u003c/p\u003e\n\u003ch2\u003e2.5 Immunostaining for S100A10 in mammary gland tissues and milk leukocytes\u003c/h2\u003e\n\u003ch3\u003e2.5.1\u0026nbsp;\u0026nbsp;Immunohistochemistry and immunocytochemistry\u003c/h3\u003e\n\u003cp\u003eThe collected mammary gland tissues were fixed, dehydrated, and embedded in paraffin. Sections (3-\u0026mu;m thick) were air-dried on MAS-coated slides. After deparaffinization and washing with PBS, antigen retrieval was performed by autoclaving the sections in a citric acid buffer (pH 6.0) for 20 min at 121\u0026deg;C. The sections were washed with PBS for 10 min. Sections and SCs seeded on the glass slides were incubated at 37\u0026deg;C for 3 h with rabbit antibodies against S100A10 diluted in PBS. After washing,\u0026nbsp;the slides were incubated with peroxidase-labeled goat anti-rabbit IgG and anti-mouse IgG antibodies (Histofine MAX-PO; Nichirei Bioscience, Tokyo, Japan) for 1 h at room temperature. The immunosignals from the sections were visualized by incubation with a diaminobenzidine reaction mixture. The slides were counterstained with hematoxylin, dehydrated, and covered. Immunohistochemical images were obtained using an Eclipse E400 microscope and\u0026nbsp;a Digital Sight DS-Fi1 camera (Nikon).\u003c/p\u003e\n\u003ch3\u003e2.5.2\u0026nbsp;\u0026nbsp;Immunofluorescence\u003c/h3\u003e\n\u003cp\u003eThe mammary tissue sections were incubated overnight at 4\u0026deg;C with the rabbit antibody against S100A10 and mouse monoclonal antibodies against CD3 (#NBP2-53386; Novus Biologicals, Littleton, CO, USA) or IBA1 (#sc-32725; Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted in PBS-T containing 2.5% bovine serum albumin. After washing, the sections were incubated with secondary antibodies (Alexa Fluor 488-conjugated goat anti-rabbit, #A32731; Alexa Fluor 555-conjugated goat anti-mouse, #A32727; Thermo Fisher Scientific, Waltham, MA, USA) diluted with PBS-T containing 2.5% bovine serum albumin for 1 h at room temperature. Immunofluorescent images were obtained using a fluorescence microscope (BZ-9000) and processed using analysis software (Keyence,\u0026nbsp;Osaka, Japan).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e2.6\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003eReal-time polymerase chain reaction (RT-PCR)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from the SCs using Sepasol RNA I Super (Nacalai Tesque, Inc., Kyoto, Japan) according to the manufacturer\u0026apos;s instructions. The extracted total RNA samples were dissolved in TE buffer (10 mM Tris-HCl, pH 8.0, with 1 mM EDTA) and stored at \u0026minus;80\u0026deg;C until RT-PCR. The concentration of total RNA in each sample was measured using a NanoDrop Lite (Thermo Fisher Scientific). RNA samples were reverse-transcribed using ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo Co., Ltd., Osaka, Japan) on a PTC-100 programmable thermal controller (MJ Research, Waltham, MA, USA), programmed according to the manufacturer\u0026apos;s instructions. Real-time PCR was performed using an Aria MX real-time PCR system (Agilent Technologies, Santa Clara, CA, USA) with Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies).\u0026nbsp;Table 1 lists the primers used for PCR. The cycling parameters used for amplification were as follows: denaturation at 95\u0026deg;C for 5 s and annealing at 60\u0026deg;C for 10 s. Denaturation and annealing were performed for 55 cycles for all the primer sets. The cycle parameters for the melting step were 95\u0026deg;C for 30 s, 65\u0026deg;C for 30 s, and 95\u0026deg;C for 30 s. To calculate the relative levels of gene expression in each sample, real-time PCR data were analyzed using the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;CT\u003c/sup\u003e [∆Ct = Ct (target gene) \u0026ndash; Ct (housekeeping gene); ∆∆Ct = ∆Ct (target sample) - ∆Ct (control sample)] method\u0026nbsp;[18]. Expression levels of the target genes were normalized using the expression of \u003cem\u003eCapra hircus\u003c/em\u003e ribosomal protein S18 (\u003cem\u003eRPS18\u003c/em\u003e), a housekeeping gene for goats.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e Primers used for mRNA expression analysis.\u003c/p\u003e\n \u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"661\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003ePrimer sequence\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003eProduct Size\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eAccession No.\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e\u003cem\u003eAn\u003c/em\u003e\u003cem\u003ex\u003c/em\u003e\u003cem\u003eA2\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eF: CCAAGTGCATACGGGTCAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e101\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eXM_018054288.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eR: ACCTCATCCACACCTTTGGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e\u003cem\u003ePLAU\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eF: CAGGACTGCTCTGCTGGAAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e189\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eXM_005699221.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eR: GCCACCGCACAAGTAGGTAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e\u003cem\u003ePLAUR\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eF: ACAGGCACTAAAGGACTGAGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e121\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eXM_005692612.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eR: AGCAGGAGACGTTGACATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e\u003cem\u003ePLGRKT\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eF: GTCTCTCTAACAGCTGGAGCAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e98\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eXM_005683695.3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eR: CCCATGTCATACTGGTAGGCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e\u003cem\u003eS100A10\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eF: ACGTACTAAGGCGCCCTGC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e132\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eXM_018046106.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eR: GGCGTGTTCCATTTGAGACG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" valign=\"top\" style=\"width: 113px;\"\u003e\n \u003cp\u003e\u003cem\u003eRPS18\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eF: GTGTGGGACGAAGATACGCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e101\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003eNM_001285639.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 284px;\"\u003e\n \u003cp\u003eR: GATCACACGTTCCACCTCGT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 104px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cem\u003eAnxA2\u003c/em\u003e: Annexin A2; \u003cem\u003ePLAU\u003c/em\u003e: Plasminogen activator urokinase; \u003cem\u003ePLAUR\u003c/em\u003e: Plasminogen activator urokinase receptor; \u003cem\u003ePLGRKT\u003c/em\u003e: Plasminogen receptor with C-terminal lysine; \u003cem\u003eRPS18\u003c/em\u003e: Ribosomal protein S18.\u003c/p\u003e\n\u003ch2\u003e2.7 Statistical analysis\u003c/h2\u003e\n\u003cp\u003eData are presented as the mean \u0026plusmn; standard error (SEM). Statistical analyses were performed using the SAS software (version 9.4; SAS Institute Inc., Cary, NC, USA). Differences in S100A10 concentrations in milk between the groups were analyzed using the Wilcoxon test, and correlations between parameters were assessed using the Spearman\u0026rsquo;s rank correlation test.\u003c/p\u003e\n\u003cp\u003eThe qPCR results were log₁₀-transformed and the Anderson\u0026ndash;Darling test was used to assess the normality of the data. For data that were not normally distributed, the Wilcoxon test was used for comparison. For normally distributed data, either the Wilcoxon test or Tukey\u0026rsquo;s multiple comparison test was used, as appropriate. A mixed-effects model was employed to evaluate the changes over time.\u003c/p\u003e\n\u003cp\u003eDifferences were considered statistically significant at \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e"},{"header":"3 Results","content":"\u003ch2\u003e3.1 Production of S100A10 in leukocytes in milk and mammary gland tissues\u003c/h2\u003e\n\u003cp\u003eWhen leukocytes from milk were immunostained with the S100A10 antibody, immune-positive cells, such as macrophages and neutrophils, were also observed (Fig. 1). When healthy mammary gland tissues were stained and observed under a fluorescent microscope, S100A10-positive cells were observed and were identified as macrophages (Fig. 2). However, the tissues from inflamed mammary glands showed a greater number of cells positive for both S100A10 and IBA1 (Fig. 3), whereas the number of CD3-positive cells showed no increase. Several of these double-positive for both S100A10 and IBA1 cells were observed in the mammary gland tissue samples (Fig. 3).\u0026nbsp;\u003c/p\u003e\n\u003ch2\u003e3.2 S100A10 concentration in milk determined using ELISA\u003c/h2\u003e\n\u003cp\u003eThe concentration of S100A10 in milk, measured using ELISA, showed a significantly increased concentration after intramammary LPS infusion compared to that detected before infusion (Fig. 4A). The S100A10 concentration was significantly higher at 24 h after intramammary LPS infusion than that before infusion; it increased sharply 2 h after LPS infusion and remained elevated until 24 h (Fig. 4B).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo determine whether S100A10 was linked to inflammation, its correlation with other inflammatory markers (SCC and SAA) and the anti-inflammatory cytokine (interleukins-1 receptor antagonist; IL-1ra) were analyzed (Fig. 5). S100A10 showed a significant positive correlation with SCC (r = 0.542, \u003cem\u003ep\u003c/em\u003e = 0.020) and SAA (r = 0.790, \u003cem\u003ep\u003c/em\u003e = 0.002) and a significant negative correlation with IL-1ra (r = \u0026shy;0.603, \u003cem\u003ep\u003c/em\u003e = 0.038). \u0026nbsp;\u003c/p\u003e\n\u003ch2\u003e3.3 Expression of genes related to S100A10\u003c/h2\u003e\n\u003cp\u003eRT-PCR analysis of the molecules involved in plasminogen activation revealed that \u003cem\u003eS100A10\u003c/em\u003e expression decreased significantly after LPS infusion, whereas that of \u003cem\u003eAnxA2\u0026nbsp;\u003c/em\u003eand \u003cem\u003ePLGRKT\u003c/em\u003e\u0026nbsp; remained unchanged. In contrast, the expression levels of both \u003cem\u003ePLAU\u003c/em\u003e and \u003cem\u003ePLAUR\u003c/em\u003e showed significant increases at 8 h after intramammary LPS infusion compared to their pre-infusion levels; however, these levels subsequently decreased (Fig. 6).\u0026nbsp;\u003c/p\u003e"},{"header":"4 Discussion","content":"\u003cp\u003eImmunostaining of goat mammary glands was carried out to investigate the localization of S100A10. The results showed that S100A10 was localized in the connective tissue between the mammary alveoli. Furthermore, this positive reaction colocalized with a macrophage marker (IBA1) on double staining. In addition, immunostaining of the leukocytes in milk revealed the presence of both macrophages and neutrophils. These findings suggested that S100A10 is synthesized in the leukocytes, particularly in the macrophages and neutrophils.\u003c/p\u003e\u003cp\u003eThe S100A10 concentration in milk was below 1 \u0026micro;g/mL prior to LPS infusion but increased markedly to 1\u0026ndash;4 \u0026micro;g/mL at 24 h post-infusion. A detailed time-course analysis revealed that the S100A10 concentration in milk rapidly increased within a few hours after intramammary LPS infusion, and subsequently decreased after approximately 2 days. These changes were largely consistent with those observed in SCC. These findings indicate that S100A10 concentrations increase rapidly in response to inflammatory stimuli. Thus, the S100A10 protein may serve as a valuable biomarker for inflammation based on the substantial differences in its concentrations between inflammatory and non-inflammatory conditions in tissues (2\u0026ndash;70 fold in the present study). Although numerous studies have proposed various markers for mastitis, such as lactoferrin [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], N-acetyl-beta-d-glucosaminidase (NAGase) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], lactoperoxidase [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], cathelicidin [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e] and defensin [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], S100A10 appears to be among the most promising candidates.\u003c/p\u003e\u003cp\u003eTo investigate the association between S100A10 and inflammation, its correlation with inflammatory markers (SCC and SAA) and the anti-inflammatory cytokine, IL-1ra, was analyzed. S100A10 exhibited a significant positive correlation with SCC and SAA, and a significant negative correlation with IL-1ra. These results indicate that S100A10 is a protein whose expression increases in response to inflammation. Furthermore, an in vivo study demonstrated that knockdown of S100A10 inhibited the secretion of inflammatory cytokines, including TNF-α, IL-1β, and IL-10, in human chondrocytes stimulated with LPS [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. The study also revealed that this effect involves the inhibition of the MAPK and NF-κB signaling pathways. Collectively, these results indicate that S100A10 not only responds to inflammation but may also play a functional role in modulating the immune response.\u003c/p\u003e\u003cp\u003eS100A10 is a cell-surface plasminogen receptor that plays a crucial role in plasmin generation in response to various physiological stimuli. Plasmin contributes to the proinflammatory environment by promoting myeloid cell infiltration and cytokine release [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. After intramammary LPS infusion, a significant increase in \u003cem\u003ePLAUR\u003c/em\u003e and \u003cem\u003ePLAU\u003c/em\u003e expression was observed at 12 h post-infusion. S100A10 facilitates plasminogen conversion to plasmin either by binding to ANXA2 or independently through its carboxy-terminal lysine in coordination with the uPA/uPAR complex [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. This upregulation may contribute to the accumulation of S100A10 in milk and the subsequent increase in SCC, indicating enhanced leukocyte trafficking into the mammary glands during inflammation. Interestingly, although S100A10 protein levels in milk were elevated, its mRNA expression in leukocytes did not increase following LPS infusion. This suggests that the existing protein levels may be sufficient to sustain the inflammatory response, potentially negating the need for further transcriptional upregulation. While mRNA expression of \u003cem\u003ePLGRKT\u003c/em\u003e, \u003cem\u003ePLAU\u003c/em\u003e, and \u003cem\u003ePLAUR\u003c/em\u003e was detected, \u003cem\u003eS100A10\u003c/em\u003e level remained unchanged. These results suggest that S100A10 plays a key role in regulating plasmin generation during inflammation in the mammary glands. Therefore, it is necessary to further investigate the relationship between S100A10 and plasmin production at the protein level.\u003c/p\u003e\u003cp\u003ePlasmin activates proenzymes, such as matrix metalloproteinases (MMPs), procathepsin B, and pro-uPA, leading to extracellular matrix degradation and the release of growth factors through proteolysis. This process facilitates tissue remodeling and immune cell migration [\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Additionally, O\u0026rsquo;Connell et al. [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] have reported that, in a model of peritoneal inflammation, S100A10-deficient mice showed significantly reduced macrophage migration and impaired plasmin generation, which suggests a direct role of S100A10 in macrophage recruitment and plasmin activation in response to inflammatory stimuli.\u003c/p\u003e\u003cp\u003eIn conclusion, S100A10 is synthesized by milk leukocytes, particularly macrophages and neutrophils. Intramammary LPS infusion promotes the secretion of S100A10 into milk, which regulates the inflammatory response within the mammary glands through plasminogen activation. These findings suggest that S100A10 could serve as a potential biomarker and therapeutic target for the management of mastitis. However, future studies are needed to elucidate additional factors influencing S100A10 production and function within the mammary gland.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (JSPS Kakenhi; Grant Numbers 21K05893 and 24K09211).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that this study was conducted in the absence of any commercial or financial relationships that could be construed as potential conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was conducted in accordance with the guidelines for animal experiments issued by the Hiroshima University and was approved by the Animal Research Committee of Hiroshima University (No. C 19\u0026ndash;4).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors and Affiliations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGraduate School of Integrated Sciences for Life, Hiroshima University, 1-4-4 Kagamiyama, Higashi-Hiroshima, 739-8528, Hiroshima, Japan\u003cbr\u003e\u0026nbsp;\u003c/strong\u003eJirapat Jaisue, Zi-Long Liang,\u0026nbsp;Nur Laili Marufah,Takahiro Nii\u0026nbsp;\u0026amp;\u0026nbsp;Naoki Isobe\u003c/p\u003e\n\u003cp\u003eFaculty of Animal Science, Gadjah Mada University, Jl.\u0026nbsp;Fauna No.3 Kampus UGM Bulaksumur, 555281, Yogyakarta, Indonesia\u003cbr\u003eNur Laili Marufah\u003c/p\u003e\n\u003cp\u003eNational Institute of Animal Health, National Agriculture and Food Research Organization, 4 Hitsujigaoka, Toyohira, Sapporo, Hokkaido, 062-0045, Japan\u003cbr\u003eYusaku Tsugami\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eJirapat Jaisue: Formal analysis, Investigation, Writing \u0026ndash; original draft\u0026nbsp;\u0026ndash; review \u0026amp; editing;\u0026nbsp;Zi-Long Liang:\u0026nbsp;Formal analysis, Writing \u0026ndash; original draft \u0026amp; review;\u0026nbsp;Nur L Marufah:\u0026nbsp;Investigation, Writing \u0026ndash; review; Yusaku Tsugami: Formal analysis, Methodology,\u0026nbsp;Resources, Writing \u0026ndash; original draft \u0026amp; review;\u0026nbsp;Takahiro Nii:\u0026nbsp;Methodology, Resources, Writing \u0026ndash; review;\u0026nbsp;Naoki Isobe:\u0026nbsp;Conceptualization, Funding acquisition, Formal analysis, Methodology, Resources, Validation, Writing \u0026ndash; original draft \u0026ndash; review\u0026nbsp;\u0026amp; editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding author\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence to \u003cu\u003eNaoki Isobe\u003c/u\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMiller VA, Madureira PA, Kamaludin AA, Komar J, Sharma V, Sahni G, et al. Mechanism of plasmin generation by S100A10. Thromb Haemost. 2017;117:1058-71. https://doi.org/10.1160/TH16-12-0936\u003c/li\u003e\n\u003cli\u003eBharadwaj A, Bydoun M, Holloway R, Waisman D. Annexin A2 heterotetramer: Structure and function. Int J Mol Sci. 2013;14:6259-305. https://doi.org/10.3390/ijms14036259\u003c/li\u003e\n\u003cli\u003eKassam G, Le BH, Choi KS, Kang HM, Fitzpatrick SL, Louie P, et al. The p11 subunit of the annexin II tetramer plays a key role in the stimulation of t-PA-dependent plasminogen activation. Biochem. 1998;37:16958-66. https://doi.org/10.1021/bi981713l\u003c/li\u003e\n\u003cli\u003eHeissig B, Salama Y, Takahashi S, Osada T, Hattori K. The multifaceted role of plasminogen in inflammation. Cell Signal. 2020;75:109761. https://doi.org/10.1016/j.cellsig.2020.109761\u003c/li\u003e\n\u003cli\u003eCox G, Crossley J, Xing Z. Macrophage engulfment of apoptotic neutrophils contributes to the resolution of acute pulmonary inflammation in vivo. Am J Respir Cell Mol Biol. 1995;12:232-7. https://doi.org/10.1165/ajrcmb.12.2.7865221\u003c/li\u003e\n\u003cli\u003ePerucci LO, Juliana PV. Miles LA, Sousa LP. \u003c/strong\u003eCrosstalk between the plasminogen/plasmin system and inflammation resolution. J Thromb Haemost. 2023;21:2666-78. \u003c/strong\u003ehttps://doi.org/10.1016/j.jtha.2023.07.013\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003eHeegard CE, White JH, Zavizion B, Turner JD, Politis I. Production of various forms of plasminogen activator and plasminogen activator inhibitor by cultured mammary epithelial cells. J Dairy Sci. 1994;77:2949-58. \u003c/strong\u003ehttps://doi.org/10.3168/jds.S0022-0302(94)77236-2\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003eZhang M, Dongying C, Zhen Z, Ao J, Xiaohan Y, Gao X. Annexin A2 positively regulates milk synthesis and proliferation of bovine mammary epithelial cells through the mTOR signaling pathway. J Cell Physiol. 2018;233:2464-2475. \u003c/strong\u003ehttps://doi.org/10.1002/jcp.26123\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003eGao J, Li T,Lu Z, Wang X, Zhao X, Ma Y. Proteomic analyses of mammary glands provide insight into the immunity and metabolism pathways associated with clinical mastitis in meat sheep. Animals. 2019;9:309. \u003c/strong\u003ehttps://doi.org/10.3390/ani9060309\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003eF\u0026uuml;ller D, Liu C, Ko Y, Alkhoder AA, Desai SR, Almuwaqqat Z, et al. Soluble urokinase Plasminogen Activator Receptor (suPAR) mediates the effect of a lower education level on adverse outcomes in patients with coronary artery disease. \u003c/strong\u003eEur J Prev Cardiol. 2024;31:521-8. https://doi.org/10.1093/eurjpc/zwad311\u003c/li\u003e\n\u003cli\u003eThuno M, Macho B, Eugen-Olsen J. suPAR: The molecular crystal ball. \u003c/strong\u003eDis Markers. 2009;27:157-72. https://doi.org/10.3233/DMA-2009-0657\u003c/li\u003e\n\u003cli\u003eObeagu EI. The dynamic role of soluble urokinase plasminogen activator receptor (suPAR) in monitoring coagulation dysfunction during COVID-19 progression: a review. \u003c/strong\u003eAnn Med Surg (Lond). 2024;87:635-40. https://doi.org/10.1097/MS9.0000000000002791\u003c/li\u003e\n\u003cli\u003eDonohue J, Gruen D, Iyanna N, Lorence J, Brown J, Guyette F, et al. Mechanism matters: mortality and endothelial cell damage marker differences between blunt and penetrating traumatic injuries across three prehospital clinical trials. \u003c/strong\u003eSci Rep. 2024;14:2747. https://doi.org/10.1038/s41598-024-53398-1\u003c/li\u003e\n\u003cli\u003eZhang GW, Lai SJ, Yoshimura Y, Isobe N. Messenger RNA expression and immunolocalization of psoriasin in the goat mammary gland and its milk concentration after an intramammary infusion of lipopolysaccharide. \u003c/strong\u003eVet J. 2014;202:89-93. https://doi.org/10.1016/j.tvjl.2014.06.013\u003c/li\u003e\n\u003cli\u003ePurba FY, Nii T, Yoshimura Y, Isobe N. Short communication: Production of antimicrobial peptide S100A8 in the goat mammary gland and effect of intramammary infusion of lipopolysaccharide on S100A8 concentration in milk. \u003c/strong\u003eJ Dairy Sci. 2019;102:4674-81. https://doi.org/10.3168/jds.2018-15396\u003c/li\u003e\n\u003cli\u003eIsobe N, Nakamura J, Nakano H, Yoshimura Y. Existence of functional lingual antimicrobial peptide in bovine milk. \u003c/strong\u003eJ Dairy Sci. 2009;92:2691-5. https://doi.org/10.3168/jds.2008-1940 \u003c/li\u003e\n\u003cli\u003eMarufah NL, Nii T, Suzuki N, Jaisue J, Isobe N. Interleukin 1 Receptor Antagonist (IL-1ra) production and expression dynamics in mammary glands after lipopolysaccharide infusion\u003c/strong\u003e Anim Sci J. 2025;96:e70047. https://doi.org/10.1111/asj.70047\u003c/li\u003e\n\u003cli\u003eNii T, Shinkoda T, Isobe N, Yoshimura Y. Intravaginal injection of Lactobacillus johnsonii may modulates oviductal microbiota and mucosal barrier function of laying hens. \u003c/strong\u003ePoult Sci. 2023;102:102699. https://doi.org/10.1016/j.psj.2023.102699\u003c/li\u003e\n\u003cli\u003eChaneton L, Bont\u0026aacute; M, Pol M, Tirante L, Bussmann LE. Milk lactoferrin in heifers: Influence of health status and stage of lactation. \u003c/strong\u003e J Dairy Sci. 2013;96:4977-82. https://doi.org/10.3168/jds.2012-6028\u003c/li\u003e\n\u003cli\u003eHovinen M, Simojoki H, P\u0026ouml;s\u0026ouml; R, Suolaniemi J, Kalmus P, Suojala L, et al. N-acetyl -\u0026beta;-D-glucosaminidase activity in cow milk as an indicator of mastitis. \u003c/strong\u003e J Dairy Res. 2016;83:219-27. https://doi.org/10.1017/S0022029916000224\u003c/li\u003e\n\u003cli\u003eYamasaki A, Yoshimura Y, Isobe N. Changes in the concentrations of somatic cell counts, lingual antimicrobial peptide and lactoperoxidase activity in milk at periovulatory period in dairy cows. \u003c/strong\u003e Anim Sci J. 2017;88:484-8. https://doi.org/10.1111/asj.12644\u003c/li\u003e\n\u003cli\u003eAddis M, Tedde V, Puggioni GMG, Pisanu S, Casula A, Locatelli C, et al. Evaluation of milk cathelicidin for detection of bovine mastitis. \u003c/strong\u003eJ Dairy Sci. 2016;99:8250-8. https://doi.org/10.3168/jds.2016-11407\u003c/li\u003e\n\u003cli\u003eKawai K, Akamatsu H, Obayashi T, Nagahata H, Higuchi H, Iwano H, et al. Relationship between concentration of lingual antimicrobial peptide and somatic cell count in milk of dairy cows. \u003c/strong\u003eVet Immunol Immunopathol. 2013;153:298-301. https://doi.org/10.1016/j.vetimm.2013.03.002\u003c/li\u003e\n\u003cli\u003eSong C, Zhou X, Dong Q, Fan R, Wu G, Ji B, et al. Regulation of inflammatory response in human chondrocytes by lentiviral mediated RNA interference against S100A10. Inflamm. Res. 2012;61:1219\u0026ndash;27. \u003c/strong\u003ehttps://doi.org/10.1007/s00011-012-0519-6\u003c/strong\u003e\u003c/li\u003e\n\u003cli\u003eMadureira PA, O\u0026apos;Connell PA, Surette AP, Miller VA, Waisman DM. The biochemistry and regulation of s100a10: a multifunctional plasminogen receptor involved in oncogenesis. \u003c/strong\u003eJ Biomed Biotechnol. 2012; https://doi.org/10.1155/2012/353687\u003c/li\u003e\n\u003cli\u003e\u003c/strong\u003eAĭsina RB, Mukhametova LI. Structure and function of plasminogen/plasmin system. \u003c/strong\u003eBioorg Khim. 2014;40:642-57. https://doi.org/10.1134/s1068162014060028\u003c/li\u003e\n\u003cli\u003eSaiki Y, Horii A. Multiple functions of S100A10, an important cancer promoter. \u003c/strong\u003ePathol Int. 2019;69:629-36. https://doi.org/10.1111/pin.12861\u003c/li\u003e\n\u003cli\u003e\u003c/strong\u003eMai J, Waisman DM, Sloane BF. Cell surface complex of cathepsin B/annexin II tetramer in malignant progression. Biochim Biophys Acta. 2000;1477:215-30. https://doi.org/10.1016/s0167-4838(99)00274-5\u003c/li\u003e\n\u003cli\u003e\u003c/strong\u003eO\u0026apos;Connell PA, Surette AP, Liwski RS, Svenningsson P, Waisman DM. S100A10 regulates plasminogen-dependent macrophage invasion. Blood. 2010;116:1136-46. https://doi.org/10.1182/blood-2010-01-264754\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Antimicrobial protein, plasmin, milk, mastitis, inflammation","lastPublishedDoi":"10.21203/rs.3.rs-7626449/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7626449/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eS100A10 is a calcium-binding protein associated with plasmin production in milk. However, the relationship of S100A10 production with inflammation and plasmin production in the mammary glands remains unclear. The present study was undertaken to identify the production of the S100A10 calcium-binding protein in the mammary glands of goats and its concentration in milk after intramammary lipopolysaccharide (LPS) infusion. In milk, the expression of the S100A10 protein was measured by ELISA, whereas that of the \u003cem\u003eS100A10\u003c/em\u003e mRNA in the somatic cells (SCs) was determined using RT-PCR. S100A10 localization was observed in the mammary epithelial cells and in the leukocytes in milk using immunohistochemistry and immunocytochemistry. S100A10 concentration in milk was dramatically increased after intramammary LPS infusion compared to that before infusion. The mRNA expression of plasminogen activator-related molecules was observed in the SCs in milk, wherein the expression of \u003cem\u003ePLAU\u003c/em\u003e and \u003cem\u003ePLAUR\u003c/em\u003e increased significantly after intramammary LPS infusion compared to that before infusion. Immune-positive cells of S100A10 were observed in the macrophages and neutrophils in milk as well as in the mammary tissue. These results suggest that S100A10 is produced in the mammary glands, and its production is related to inflammation and plasmin production.\u003c/p\u003e","manuscriptTitle":"Production of S100A10 in the mammary glands of goats","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-29 16:28:02","doi":"10.21203/rs.3.rs-7626449/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0cb6e9c6-ca4a-49d3-8cc1-540ea9cd8150","owner":[],"postedDate":"September 29th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-10-08T15:38:20+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-29 16:28:02","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7626449","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7626449","identity":"rs-7626449","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}