Molecular Detection of Trypanosomes and Xenomonitoring of Host Range from the Feeding Patterns of Glossina Species Collected from Northern Guinea Savannah of Nigeria

Molecular Detection of Trypanosomes and Xenomonitoring of Host Range from the Feeding Patterns of Glossina Species Collected from Northern Guinea Savannah of Nigeria | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular Detection of Trypanosomes and Xenomonitoring of Host Range from the Feeding Patterns of Glossina Species Collected from Northern Guinea Savannah of Nigeria Grace Amarachi Amos, Djoukzoumka Signaboubo, Iliya Shehu Ndams, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3097302/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Trypanosomiasis is a vector-borne protozoan disease that is widespread in sub-Saharan Africa. In Nigeria, efforts to control trypanosomiasis include vector control, diagnosis, and treatment of the infection. These efforts exclude actions targeting reservoir hosts. This study was therefore undertaken to address these epidemiological and surveillance gaps. Methods For this purpose, Glossina species were trapped at Ijah Gbagyi and Yankari Games Resort. The hunger stage of the 220 dissected flies was categorised, blood meal was determined by COI and Cyt b gene tests. Trypanosomes were identified from samples taken from Glossina species flies. Trypanosomes were identified from the proboscis, salivary glands and midgut of tsetse flies from which the blood meal was obtained by amplifying the ITS1 rDNA gene. Results The results indicate a hunger stage of 2.72%, 34.09%, 63.18% for engorged, intermediate and starved flies respectively. The dominant host of Glossina palpalis palpalis was man, cattle, bird, squirrel, chimpanzee, bush pig and monitor lizard. Glossina morsitans submorsitans (man, bush pig, rat, buffalo, gazelle and guinea pig) and Glossina tachinoides (buffalo, warthog, antelope and guinea pig). Overall infection rates of Trypanosoma vivax (20.6%), Trypanosoma grayi (37.1%), Trypanosoma theleri (29.8%), Trypanosoma brucei spp. (3.1%) and Trypanosoma congolense (9.2%) were recorded. Conclusion These results suggest that wild animals acting as reservoir hosts are the source of the Trypanosoma species transmitted by Glossina . Glossina blood meal trypanosomes Wild animals Nigeria Figures Figure 1 Figure 2 Introduction Tsetse flies (Diptera: Glossinidea) are biological vectors of African trypanosomiasis (AT) in humans and animals. Trypanosomes are hemoflagellate protozoan parasites that cause sleeping sickness (human African trypanosomiasis, HAT) in humans and nagana (African animal trypanosomiasis, AAT) in animals. Trypanosomiasis is endemic in tsetse-infested areas of sub-Saharan Africa, putting an estimated 70 million humans and 60 million cattle at risk of infection [ 1 – 3 ]. The disease causes a decline in human and animal productivity, threatening food and nutritional security, social welfare, and economic stability, particularly in areas where pastoralism is the main economic activity [ 4 – 6 ]. Control of AT relies mainly on active surveillance, vector control and mass chemotherapy [ 7 , 8 ]. However, parasites are becoming increasingly resistant to trypanocidal drugs while new trypanocidal drugs are not available [ 9 ]. Vector control is therefore an important component of sustainable integrated AT control because of their importance in the infection cycle of African trypanosomiasis [ 10 ]. It is therefore important to fill the gap left by chemotherapy by interrupting the transmission cycle of trypanosomes. For this reason, vector control is widely applied in high potential livestock areas [ 11 , 12 ]. To complicate this control, wild animals support the life cycles of tsetse flies [ 13 – 15 ] as well as trypanosomes [ 16 , 17 ] and are therefore an important factor in the transmission dynamics of AT, especially in wild ecosystems. For example, certain species of trypanosomes have been associated with certain species of wild animals [ 18 – 20 ]. Wildlife parks that harbor tsetse species pose a risk to livestock and the general human population [ 21 – 23 ], so much so that there are reports of cross-transmission between livestock and wild hosts, employees, tourists and researchers visiting the parks due to the bite of infected tsetse flies, which over the years has made the control approach more difficult and complicated due to the reinvasion of tsetse cleared areas. The trophic predilections of tsetse flies are very diverse, especially in wild areas. Therefore, a single blood meal study area cannot be used to draw general conclusions about tsetse feeding behavior [ 13 ]. However, identification of tsetse blood meal sources in specific areas can provide plausible information on the wildlife species likely to be involved in AT transmission and can contribute to the search for sustainable solutions to strengthen vector control strategies, especially in wildlife-human-livestock interface areas that serve as hotspots for the emergence and re-emergence of AT. In Nigeria, molecular surveillance of trypanosome prevalence in wild-caught tsetse species has allowed the detection of DNA or parasites of human or animal health importance in a given area (known as "Molecular Xenomonitoring MX"), without dealing with reservoir host in a given area. Xenomonitoring has allowed the detection of AT outbreaks, so that control programs can be focused on areas that require immediate attention to stop the transmission of the disease. Molecular screening of tsetse flies in parks and remote rural areas of Nigeria has revealed the presence of different Trypanosoma species such as Trypanosoma vivax , Trypanosoma godfreyi , Trypanosoma brucei brucei , Trypanosoma simiae , Trypanosoma congolense forest and Trypanosoma congolense savannah , including Trypanosoma grayi and Trypanosoma theleri trypanosomes of crocodiles [ 12 , 19 , 23 – 25 ], however, the incidence of Trypanosoma brucei gambiense was not detected [ 23 , 26 ]. Over the years, control programs and efforts have been made for the treatment of AT and vector control [ 12 , 15 , 27 ] but no action has been taken so far against the reservoir host. Furthermore, the number of newly diagnosed cases of trypanosomiasis is decreasing, but the seriousness of the situation requires further research [ 28 ]. Yankari Games Resort and Ijah Gbagyi in Nigeria have been the subject of several research studies on the identification of vectors and [ 11 , 15 ], trypanosomes [ 11 , 12 ] but no study on the feeding performance of tsetse flies has being done to establish source of infection with Trypanosoma . This study was therefore undertaken to provide evident data that strengthens trypanosomiasis surveillance by xenomonitoring proboscis, salivary glands and guts of tsetse flies and to identify the trophic preferences by the analysis of blood meals of tsetse, this will enable detection of potential reservoir hosts of trypanosomes in Yankari Games Resort and Ijah Gbagyi Nigeria. Materials and Methods Study Areas Tsetse flies were collected at Ijah Gbagyi (9° 12′ 06 " N, 7° 12′ 14 ") and (9° 24′ 60 " N, 7° 20′ 45 " E) ( Fig. 1 a ) . Ijah Gbagyi covers an area of 222 km² located in Suleja Tafa L. G. A Niger State. The topography of Ijah Gbagyi has various elevation sites, with a wooded savannah vegetation area. It also has a large stream with clean flowing water that also harbour blackflies any season. It has a riverine forest biotope that forms a dense canopy shape. The fly’s collection site is associated with agricultural practices of mixed crop farming, plantations, shrubs, various fringing trees, grassland with some populations of wild animals and constant cattle grazing. Humans, cattle and various kinds of animals constantly visit the infested river. Yankari Games Resort (9° 45′ 16 " N, 9° 16′ 45 " N) and (10° 30′ 25 “E and 10° 37′ 51 "E) ( Fig. 1 b ) in Alkaleri L. G. A Bauchi state, covers an area of 2244 km². It has a grass savannah vegetation site, that has patches of low woodland with scattered shrubs and trees that enables tsetse dispersion during the wet seasons [ 15 ]. It is a national park that has the country’s richest wildlife oasis, and the most popular tourist destination in Nigeria, where wild animals such as buffalo, hippopotamus, roan, hartebeest, elephants, etc, run freely and are protected in their natural habitat, these wildlife serves as available blood meal to tsetse flies populations. Figure 1 : Sampling Points at Ijah Gbagyi ( a ) Yankari Games Resort ( b ) Entomological survey The survey was carried out during the dry season in February 2020, five bio conical traps [ 29 ] were positioned at about 100–150 meters apart for all the periods of fly collection. Trapped tsetse were collected after 24hrs of trapping, and transported in cool boxes to the base camps. The flies were counted and sorted into species, sex and further grouped into different hunger stages. For each trap point, the geographical coordinates were recorded using a Global Positioning System (GPS) (Garmin GPS map 64x), while the temperature and relative humidity of each trap point were recorded using a thermohygrometer (EasyLog TH; Lascar, Whiteparish, UK). Morphological identification of Tsetse species All tsetse flies caught were identified morphologically to species level using identification keys. The features include the markings on the hind leg, the shape of the abdominal segment and color of the thecal bulb of the proboscis for example; The Glossina morsitans submorsitans s pecies has a dark brown thecal bulb, the 4th and 5th tarsal segments of the hind legs are black, and the markings on the first segment of the abdomen is square shaped. For Glossina palpalis palpalis species, the thecal bulb is also dark brown, but all the tarsal segments of the hind legs are black and the first segment of the abdomen is square shaped while in Glossina tachinoides they are triangular [ 8 , 14 ]. Determination of Hunger Stage of trapped tsetse Hunger stages of the flies caught were categorized into gorged, intermediate and hungry. This was done to determine the amount of blood meal remaining in the abdomen. The flies were grouped into: Stage I: Gorged: when abdomen is distended with red or blue-black blood. Stage II: Intermediate: when abdomen is slightly concave and a quarter to two- thirds is opaque. Stage III: Hungry: when abdomen looks flattened and underside is wrinkled. Dissection of a non-teneral Tsetse Only live non-teneral flies were dissected in a drop of sterile saline solution using dissecting pins and forceps. For each fly, the forceps and dissecting pins were decontaminated by immersion in 3–5% sodium hypochlorite for approximately 10 minutes, followed by immersion in 70% ethanol and final immersion in normal saline between dissections. The wings were removed first with forceps, followed by legs, proboscis, salivary glands and gut according to the established procedure [ 15 ]. Storage of Dissected Organs The proboscis and salivary gland were preserved in 200 µl nucleic acid preservation agent (NAPA: 25 mM sodium citrate, 10 mM EDTA, 70 g ammonium sulfate/100 ml solution, pH 7.5), while the guts were preserved in 500 µl of NAPA in 1.5 mL cryotubes (30). The organs were kept in cold boxes in the field and at -20°C in the laboratory at the end of the survey for further analysis. DNA Extraction of the Organs The guts and salivary glands were removed from the preservative in the cryotubes and the DNA was extracted using DNeasy blood and tissue kit (Qiagen, Germany) following the manufacturer’s instructions. DNA from each proboscis were extracted using proteinase K as described by Signaboubo et al ., [ 31 ]. Briefly, each proboscis was removed from the cryotubes containing the preservative agent, and transferred into a new 1.5-ml micro tube containing 9.9 µl of proteinase K at 20 mg/m, with 45.1 µL of phosphate buffered saline in a total volume of 55 µl. Each tube was centrifuged at 13,400 rpm for 1 min and then incubated at 55°C for 1 hour and later vortexed and centrifuged, followed by a second incubation for 45 min at 85°C. Thereafter, each of the micro tube were vortexed and centrifuged at 10,000 rpm for 1 min [ 31 ]. The extracted DNA from each organ were collected and subsequently quantified using Nano drop Spectrophotometer (Thermo Fisher Scientific) 1000 apparatus at a wavelength of 260 and 280 Nano meter. The DNA extracts were then stored at − 20°C for further molecular analyses. Identification of origin of blood meals of tsetse flies (Amplification, Sequencing and Analysis) The identification of the origin of blood meals collected from the gut of tsetse flies was done using two set of primers; Muturi et al ., [ 32 ] and Omondi et al ., [ 33 ]. The first set was VF1d_t1: TGTAAAACGACGGCCAGTTCTCAACCA ACCACAARGAY ATYGG and VR1d_t1:CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCRAARAAYCA targeted for mammals, aves, reptiles and fishes. It amplifies a 648 bp region of the mitochondrial cytochrome oxidase c subunit 1 ( COI ) gene [ 32 ]. The amplification in the PCR machine was carried out in 12.5 µl final volume for screening of all gut samples for detection of the blood meal, and 50 µl final volume for all samples that showed amplification in the initial screening. The mixture contains 1X Dream Taq Green Buffer, 200 µM dNTPs, 1 unit of Taq DNA polymerase (Thermo Fisher Scientific), 2 µM of each primer (Sigma-Aldrich, Darmstadt, Germany) and 2 µl of tsetse gut DNA template: Cycling conditions were: Initial denaturation for 2 min at 94 ° C, followed by 40 cycles of denaturation at 94 ° C for 30 sec, annealing at 45 ° C for 45 sec, and primer extension at 72 ° C for 1 min followed by a final extension at 72 ° C for 10 min. For the second primer target, a 383 bp fragment of cytochrome b ( Cyt b ) gene was amplified with Cyt b Forward (CCCCTCAGAATGATATTTGTCCTCA) and Cyt b Reverse (CATCCAACATCTCAGCATGATGAAA) primers designed for vertebrate animals [ 33 ]. The PCR amplification was carried out in a final volume of 12.5 µl, with 0.5 µM concentrations of each primer (Sigma-Aldrich, Darmstadt, Germany), 1X Dream Taq Green Buffer, 100 µM dNTPs, 1 unit of Taq DNA polymerase (Thermo Fisher Scientific) and 2 µl of DNA template. The cycling conditions were as followed: Initial denaturation at 95°C for 1 min, then 35 cycles of denaturation at 95°C for 30 sec, annealing at 58°C for 20 sec, extension at 72°C for 30 sec followed by a final extension at 72°C for 7 min. DNA ladder (Thermo Fisher Scientific) alongside the PCR products were separated in 2% agarose gel stained with Stain-G (Serva, Heidelberg, Germany) in TAE- Buffer (40 mMTris, 10 mMNa-acetate, 1 mM EDTA, pH 8.0), the products were visualized under UV light and photographed in the gel documentation. Blood meal samples were subsequently purified using GeneJet DNA purification kit (Thermo Scientific, Dreieich, Germany) following the manufacturer’s instructions, and subsequently used for direct sequencing at a commercial company SeqLab, Göttingen, Germany. Molecular Xenomonitoring of different species of trypanosomes hosted by tsetse The trypanosome species and subspecies were identified from the proboscis, salivary gland and gut of each tsetse fly by amplifying the internal transcribed spacer 1 ( ITS1 ) fragment of the rDNA of trypanosomes designed by Adams et al ., [ 34 ] and Ngomtcho et al ., [ 30 ]. The nested PCR was done using the outer generic primers ITS1- Out-sense (5′-TGC AAT TAT TGG TCG CGC-3′) and ITS1 -Out-non-sense (5′-CTT TGC TGC GTT CTT-3′). After this amplification, specific identification of each trypanosome species or subspecies was performed by sequencing the amplified ITS1 DNA fragment and comparing the obtained sequences with those available in the Genbank by BLASTn algorithm. For the gut and salivary gland samples, 5 µl of template DNA was used in the first PCR reaction, and for both organs, the first reaction was diluted 1:300 and 1 µl of the dilution was used for the second PCR reaction. For the crude proboscis DNA samples, 1 µl was used as template in the first reaction, and the reaction product was diluted 1:200 and 1 µl of the dilution was used in the second reaction. The trypanosome PCR reactions Master Mix consisted of 200 µM of dNTPs, 2.5 µl of 10× DreamTaq Green Buffer, 2.5 U DreamTaq Polymerase (5U/µl) (Thermo Fisher Scientific) and 2 µM of each primer (Sigma-Aldrich, Darmstadt, Germany) in a final volume of 25 µl. The PCR cycling conditions for both reactions were as followed: initial denaturation at 95°C for 3 min; 30 cycles of 1 min at 94°C, annealing for 30 sec at 54°C, elongation for 30 sec at 72°C and a final elongation step for 5 min at 72°C. Amplicons were visualized on 2% TBE (Tris-Borate-EDTA buffer) agarose gels, ran at 100 V and stained with Stain-G (Serva, Heidelberg, Germany), 50 bp DNA ladder (Thermo Fisher Scientific) was used to estimate the band size of the amplicons [ 12 ]. All trypanosome positive samples were determined based on approximation of agarose gel electrophoresis according to the table below (Table 1 ). Table 1 Expected ITS 1 Amplicon sizes for Trypanosomes isolated from tsetse organs Trypanosoma species Amplicon Sizes (bp) Trypanosoma vivax 180–250 Trypanosoma godfreyi 240 Trypanosoma grayi 318 Trypanosoma theleri 320 Trypanosoma brucei spp. 426 Trypanosoma congolense 650 Adapted from [ 30 ] Data Analysis The sequences were subjected to BLASTN searches at the National Center for Biotechnology Information (NCBI) (GenBank). A Correlation and spatial distribution dependency of trypanosomes on host fed on was done using SPSS Version 20. Infection rates were calculated by dividing the number of infected tsetse flies by the total number of flies that had fed on a vertebrate host and expressed as percentages. Results The hunger stages of the flies show that out of the 220 tsetse flies, undigested blood meal of 6 (2.72%), 75 (34.09%) and 139 (63.18%) were gorged, intermediate and hungry flies, respectively (Table 2 ). Table 2 Species composition and hunger stages of Dissected Glossina species Ijah Gbagyi Yankari Games Resort G. p. palpalis G. m. submorsitans G. tachinoides Hunger Stages Male Female Male Female Male Female Total Engorged 1 (0.45) 2 (0.90) 1 (0.45) 2 (0.90) 6 (2.72) Intermediate 7 (3.18) 36 (16.36) 3 (1.36) 13 (5.90) 12 (0.05) 4 (1.81) 75 (34.09) Hungry 27 (12.27) 63 (28.63) 8 (3.63) 26 (11.81) 8 (3.63) 7 (3.18) 139 (63.18) Total 35 (15.90) 101 (45.90) 12 (5.45) 39 (17.72) 22 (10.00) 11 (5.00) 220 (100) Mean ± SE 11.67 ± 7.86 33.67 ± 27.65 4.00 ± 2.08 13.00 ± 7.5 7.33 ± 2.91 3.67 ± 2.03 p-value 0.276 0.197 0.195 0.225 0.128 0.212 The CO1 primer amplified only 9 samples out of the 220 gut dissected samples subjected to molecular analysis, while Cyt b primer which amplified the 383 bp gene amplicon for Mammals, Aves, Reptiles, Amphibians and fish DNA templates, was able to amplify 145 gut blood meal samples, but only 45 was successfully sequenced and identified with no mixed meal observed. Overall, 12 vertebrate host species was identified as blood meals source for the tsetse flies collected (Table 3 ). At Ijah Gbagyi, the G. p. palpalis species collected was shown to have obtained blood meal from 1 Bird ( Coracias garrulus ), 1 from Squirrel ( Xerus erythropus ), 23 from humans ( Homo sapiens ), 1 from Chimpanzee ( Pan paniscus ), 1 from Bushbuck ( Tragelaphus scriptus ), 1 from Monitor lizard ( Varanus niloticus ) and 2 from Cattle ( Bos indicus ). At Yankari Games Resort G. m. submorsitans and G. tachinoides were trapped. G. m. submorsitans indicated that 3 fed on Humans, 2 on bushbucks, 3 on Rats ( Rattus argentiventer ), ( Rattus norvegicus ), ( Praomys lukolelae ), 1 on Buffalo ( Syncerus caffer ), 1 on Gazelle ( Nanger soemmerringii ) and 1 on Waterbuck ( Kobus ellipsiprymnus ). Glossina tachinoides indicate that 1 had fed on Buffalo, 1 on Warthog ( Phacochoerus africanus ), 1 Antelope ( Hippotragus equinus ) and 1 on Waterbuck. Table 3 Host Preferences of Glossina at each Location and Distribution of Trypanosomes Host Species Ijah Gbagyi Yankari Games Resort Distribution of trypanosomes G. p. p G. m. s G. t Total (%) Proboscis Salivary gland Gut Bird (Centropus cupreicaudus) 1(3.22) 1(2.17) V V Squirrel ( Xerus erythropus ) 1(3.22) 1(2.17) G Human ( Homo sapiens ) 24(77.41) 3(27.27) 27 (57.78) G, V G,T,C , G,T,V,B Chimpanzee ( Pan paniscus ) 1(3.22) 1(2.17) G G.V Bushbuck ( Tragelaphus scriptus ) 1(3.22) 2(18.18) 3(6.52) V, T B,G,C V,T,G,B,C Monitor Lizard ( Varanus niloticus ) 1(3.22) 1(2.17) G Cattle ( Bos indicus ) 2(6.45) 2(4.34) V,G V,G Rat ( Rattus argentiventer ) 3(27.27) 3(6,67) V African Buffalo ( Syncerus caffer ) 1(9.09) 1(25) 2(4.34) V G Warthog ( Phacochoerus africanus ) 1(25) 1(2.17) Horse Antelope ( Hippotragus equinus ) 1(25) 1(2.17) V G Gazelle ( Nanger soemmerringii ) 1(9.09)2 1(2.17) G T,C Waterbuck (Kobus ellipsiprymnus ) 1(9.09) 1(25) 2(4.34) V C C Total 31 (67.39) 11(23.91) 4(8.69) 46 Total % infection rate of trypanosomes 14(29.78) 35(74.46) 32(68.05) Notes : G.m.s: Glossina morsitans submorsitans ; G. p.p: Glossina palpalis palpalis; G.t: Glossina tachinoides; V: Trypanosoma vivax; G: Trypanosoma grayi; T: Trypanosoma theleri; E: Trypanosoma evansi; B: Trypanosoma brucei species; C: Trypanosoma congolense. The total infection rate of 14(29.78%), 35(74.46%) and 32(68.05%) was observed in the proboscis, salivary gland and gut respectively. Overall infection rate of trypanosome species at both locations are; T. vivax (20.6%), T. grayi (37.1%), T. theleri (29.8%), T. grayi (3.1%) and T. congolense (9.2%). Trypanosome Infection rate of 23.3%, 80%, and 76.6% was detected in the proboscis, salivary gland and gut respectively at Ijah Gbagyi, while 40%, 66.6% and 93% infection rate was detected in the proboscis, salivary gland and gut at Yankari Games Resort (Table 3 ). Dependency of trypanosome species on host fed on revealed that there is no significant relationship (p = 0.165) between trypanosoma species and host fed on, which indicate no relationship (χ2 = 57.28, P > 0.05) at Ijah Gbagyi. Yankari Games Resort revealed a significant difference (p = 0.000) between host and trypanosoma species (χ2 = 59.30, p < 0.05) (Fig. 2 ) Discussion Although several studies have been undertaken in the Northern part of Nigeria in general and at Ijah Gbagyi and Yankari Games Resort areas in particular to generate data on tsetse fly fauna as well as trypanosome infections in humans and animals [ 12 , 15 , 24 , 27 ], the trophic preference of tsetse flies remains unknown in these tsetse-infested areas. This study was designed to fill this gap by identifying the feeding behaviour of tsetse flies and the trypanosomes that infect them, with the main aim of improving epidemiological knowledge of tsetse and trypanosome behaviour in these regions. Determination of the blood meal in tsetse flies using Cyt b amplification primers revealed that the amplicons of some of the PCR product sequences obtained were of insect and not vertebrate origin. This could mean that the Cyt b primer anchored better to insect DNA and not only to vertebrate DNA, specific primers suitable for detection of vertebrate DNA only will have to be designed. Rat and cattle obtained sequence could not be deposited to NCBI due to short length of the nucleotide sequence, while that of Chimpanzee was not the target gene sequence, but they were however included to get an overview of the feeding preference of tsetse in the research locations. We found no evidence of feeding on multiple host species in any of the analyzed tsetse, which is detectable by DNA sequence analysis [ 35 ]. This could suggest that tsetse frequently feed on a single host, or that in a mixture of more than one blood meal source where one blood meal is predominant, the PCR primer used masked the minor DNA while the more abundant host DNA was selected and preferentially amplified, or for the samples that were not detected, the host DNA was not in sufficient quantity to be amplified. The Ijah Gbagyi area has riparian forest vegetation, with some agricultural activities in this environment, due to the type of vegetation in this area and the presence of a clean river that attracts livestock keepers, farmers and animals to visit the river. The results of the report suggest that human settlements generally disturb the habitat of tsetse flies, but the palpalis group appears to be less affected than other groups due to its ability to adapt to peri-urban conditions. Therefore, G. p. palpalis finds this environment very vital for its survival. Due to the presence of a wild range of mammalian hosts that frequent the water source, including the presence of some wild animals, seven host species were identified as having been fed upon by G. p. palpalis species. The dominant host with the highest Cyt b detection was 23 humans (Homo sapiens), followed by 2 cattle ( Bos indicus) , while a bird ( Coracias garrulus ), a squirrel ( Xerus erythropus ), a chimpanzee ( Pan paniscus) , a bushpig ( Tragelaphus scriptus ), and a monitor lizard ( Varanus niloticus ) made up the remaining vertebrate species. These results suggest that G. p. palpalis feeds more on humans, which collaborates with the results of [ 23 , 37 ] who previously reported that G. palpalis feeds on humans and Farikou et al. [ 32 ] also reported that tsetse flies feed more on humans with results finding in two sleeping sickness outbreaks in Southern Cameroon. Karshima et al. [ 32 ] and Torr et al. [ 38 ] reported the preference of tsetse flies for cattle due to their large size, of all vertebrate hosts identified for feeding by G. p. palpalis, cattle are the second most frequent blood meal, this result may be attributed to their large size [ 23 , 37 – 39 ]. Host selection has also been attributed to host availability and is not necessarily based on a true preference, tsetse are opportunistic feeders and are able to adopt new hosts in the absence of their usual preferred host, the influence of host availability on tsetse feeding habits [ 39 , 40 ] has also been documented, which probably explains why G. p. palpalis is an opportunistic feeder, having fed on humans, birds, cattle, squirrels, chimpanzees, bush pigs and lizard, suggesting that this tsetse species has a wide range of host selection patterns [ 37 , 38 ]. The Yankari Games Resort is a national park with abundant wildlife species, which allows tsetse to have a diversity of mammalian hosts for their blood meal. Six different species of mammalian hosts were identified as sources of blood meal for G. m. submorsitans , namely: 3 humans ( Homo sapiens ), 2 bushbucks ( Tragelaphus scriptus ), 3 rats ( Rattus argentiventer, norvegicu and Praomys lukolelae ), 1 buffalo ( Syncerus caffer ), 1 gazelle ( Nanger soemmerringii ) and 1 waterbuck ( Kobus ellipsiprymnu s), respectively. While four different vertebrate hosts were identified for G. tachinoides species, namely: 1 buffalo ( Syncerus caffer ), 1 warthog ( Phacochoerus africanus ), 1 horse antelope ( Hippotragus equinus ) and 1 waterbuck ( Kobus ellipsiprymnus ) respectively. Cattle were not identified at the Yankari Games Resort, which may be due to the government's cattle grazing ban law, preventing herders from grazing their cattle in the national park. Surprisingly, the presence of the guinea pig ( Kobus ellipsiprymnus) in the blood meal of G. m. submorsitans and G. tachinoides was noted, although it has been shown that Glossina species do not feed on guinea pigs and zebra because of their foul odour to tsetse flies [ 40 , 41 ], suggesting that tsetse flies probably feed on them because of their availability and not because they are their preferred host. The African buffalo is also a preferred host for tsetse flies due to its large size and availability; G. m. submorsitans and G. tachinoides have been known to feed on it, which also confirms these results. Interestingly, the African buffalo has been documented as a key reservoir of animal trypanosomiasis, the presence of vertebrate blood meals in flies with trypanosome DNA indicates that wildlife are important in the transmission of AAT in this study areas. No trypanosomes associated with human disease were identified in either research area, but the high proportion of flies feeding on both humans and wildlife raises the risk of contact and transmission of AAT and HAT in both ecologies [ 41 , 42 ]. Knowing the preferred hosts for the blood meal may provide a more targeted approach to finding olfactory clues to improve the effectiveness of tsetse traps, which remains an active area of study that will be very useful in the control and elimination of trypanosomiasis. Although more data are needed to draw a general conclusion on the feeding patterns and preferences of tsetse flies in the two locations, our results suggest that the influx of people to Ijah Gbagyi for settlement and agriculture and to Yankari Games Resort for tourism may explain in part why humans were the most important sources of blood meals. Therefore, the fact that we observed humans, cattle, rats and bushbucks feeding from tsetse blood meal could mean that there are chemicals in the bodies of these vertebrates that can help advance the search for new host-derived cues to control tsetse flies. This knowledge is also useful for existing knowledge of host attractants such as those described in zebra and waterbuck against Glossina spp [ 40 – 42 , 43 44 ], to improve bait technology for tsetse flies, such as the use of odorants with a repellent effect that keeps arthropods away from the source, thus protecting animals from their bites and possible disease transmission, or the use of odorants that attract arthropods to an insecticide-treated target, thereby killing them and preventing contact between the fly and the host [ 10 ]. G. p. palpalis was the only tsetse species sampled in the Ijah Gbagyi area, while G. tachinoides and G. m. submorsitans were the only two species identified at the Yankari Game Resort, a result consistent with previous studies in which these tsetse species were predominant in both locations [ 15 ]. In these areas, the approach to tsetse control has been to reduce and eliminate tsetse, by deploying scent-baited traps and insecticide-impregnated targets to control tsetse in both locations by the Pan African Campaign for Tsetse and Trypanosomiasis Eradication (PATTEC) and the Nigerian Institute of Trypanosomiasis Research (NITR), but this approach did not work as expected. The physiological status of the tsetse population sampled indicated that 139 (63.18%) out of 220 tsetse flies were hungry and since hungry flies feed more often, they have greater chances of becoming infected. Extreme starvation in tsetse flies have been reported to lower the developmental barrier for a trypanosome infection and thus enhancing their ability to acquire trypanosome infection [ 8 ]. These tsetse species are vectors of both human and animal trypanosomiasis [ 12 , 15 , 27 , 31 , 36 ] and their widespread presence represents a persistent risk of HAT and AAT in these areas. In both locations, the presence of animal trypanosomes has been documented and has also been confirmed in this research work. We identified the presence of T. grayi and T. vivax in the proboscis. T. brucei spp, T. congolense, T. grayi, T. vivax and T. theleri i n the salivary gland, while T. brucei spp, T. congolense, T. grayi, T. vivax and T. theleri were observed in the gut at Ijah Gbagyi area. Similarly, T. vivax and T. theler i were identified in the proboscis, T. congolense, T. grayi, T. vivax and T. theleri in the salivary gland, while T. brucei spp , T. congolense , T. grayi, T. vivax and T. theleri were identified in the gut of all tsetse flies that have had a blood meal at the Yankari Games Resort. Infection with trypanosomes was highest in the gut, followed by the salivary glands, and the lowest infection status was found in the proboscis in both locations, this result corroborates that of [ 12 , 24 , 32 ] who reported a low infection status in the proboscis [ 12 , 24 , 32 ]. The high infection in the gut could be the result of remaining blood meals with trypanosome infections in the midgut of tsetse flies or the presence of mature and immature infections. Trypanosome life cycles differ between species, so after a blood meal on an infected host, the spread of trypanosomes in the fly's organs helps determine the trypanosome species [ 44 ]. Detection of T. vivax in the proboscis indicates the presence of an ongoing infection, which can therefore be transmitted to its feeding host during a blood meal. Detection of T. vivax in the salivary glands and intestine could be due to the presence of an undigested blood meal that fed on an infected host. These explanations are also valid for the presence of T. congolense in the salivary gland, since this parasite is only found in the gut and proboscis, or it could be an indication of a recent infection in which these parasites migrate to the proboscis to complete their development cycle. The presence of T. vivax and other trypanosome species indicates active transmission of trypanosome infection to humans and animals. The presence of T. grayi and T. theleri in proboscis samples could also indicate ongoing infection, as the life cycle of the parasite is expected to be limited to the midgut and hindgut [12, 45, 46]. DNA sequence matching with databases has been used for species identification, but a good result depends on the quality of the DNA and sequence representation in the database. A larger scale study is needed to include more hosts using methods such as PCR-RFLP, which will make sequencing unnecessary [ 32 ]. Conclusions This study revealed that the feeding preference of tsetse are humans, most of the tsetse that fed on a vertebrate host are likely the source of the species of trypanosomes detected, therefore the risk of transmitting tsetse borne infections between humans and other vertebrate hosts in this region is very high. Declarations Acknowledgments: The authors sincerely appreciate the Africa Centre of Excellence for Neglected Tropical Diseases and Forensic Biotechnology (ACE-NTDFB) Ahmadu Bello University for sponsoring training workshops on collection and dissection of tsetse flies. Also we thank all the staff in the Laboratory for Bio Molecular Interaction Bremen, the University of Bremen, Germany for their technical assistance and discussions provided during the laboratory work. We also thank the Nigerian Institute of Trypanosomiasis Research in Kaduna Nigeria for their support during the fly collection process for provision of equipment and access to the park. Our thanks also go to the Department of Zoology Ahmadu Bello University for administrative and technical support during the collection and analysis of this work. Authors’ contributions GAA, SK, ISN, GDC and DS contributed to the design of the Project. GAA, DS, GDC, MAMI, ACMT, SK and PB contributed in sample collection and laboratory analysis. YMM, GAA and DS analyzed the data. GAA, DS, ISN, MNS, ACMT and wrote the Manuscript. All authors read and approved the final manuscript. Funding This research was funded by Erasmus Mobility Fund and the Africa Centre of Excellence for Neglected Tropical Disease and Forensic Biotechnology ABU, funded by World Bank group (ACE-NTDFB). The funder had no role in data collection, decision to publish, or preparation of the manuscript. Availability of data and materials Data availability and materials : The datasets generated and analysed during this study are included in this publication. The cyst b and COI partial gene sequences generated have been deposited into GenBank under accession numbers OQ851474 to OQ851476 and OQ858943 to OQ858954. Ethics approval and consent to participate Approval to set traps and collect tsetse flies was obtained from the local and national authorities according to current legislation in Nigeria. Consent for publication Not applicable. Competing interests The authors declare no conflict of interest. References Desquesnes M, Dia ML. Mechanical transmission of Trypanosoma vivax in cattle by the African tabanid Atylotus fuscipes. Vet Parasitol [Internet]. 2004 Jan 5 [cited 2022 Nov 26];119(1):9–19. Available from: https://www.sciencedirect.com/science/article/pii/S0304401703004588 Odeniran PO, Ademola IO. A meta-analysis of the prevalence of African animal trypanosomiasis in Nigeria from 1960 to 2017. Parasit Vectors [Internet]. 2018 May 2 [cited 2022 Nov 9];11(1):280. Available from: https://doi.org/10.1186/s13071-018-2801-0 World Health Organization. Report of the third WHO stakeholders meeting on rhodesiense human African trypanosomiasis: Geneva, Switzerland, 10-11 April 2019 [Internet]. Geneva: World Health Organization; 2020 [cited 2022 Nov 9]. Available from: https://apps.who.int/iris/handle/10665/336659 Dede PM, Halid H, Omoogun GA, Uzoigwe NR, Njoku CI, Daniel AD, et al. Current Tsetse and Trypanosomosis Situation on Jos Plateau, Nigeria. Epizootiological Factors that May Enhance Disease Transmission and Spread. Rev D’Elevage Médecine Vét Pays Trop [Internet]. 2005 Jan 1 [cited 2022 Nov 26];(Volume 1-2). Available from: https://paperity.org/p/236252492/current-tsetse-and-trypanosomosis-situation-on-jos-plateau-nigeria-epizootiological Odeniran PO, Ademola IO, Jegede HO. A review of wildlife tourism and meta-analysis of parasitism in Africa’s national parks and game reserves. Parasitol Res [Internet]. 2018 Aug 1 [cited 2022 Nov 9];117(8):2359–78. Available from: https://doi.org/10.1007/s00436-018-5958-8 Yaro M, Munyard KA, Stear MJ, Groth DM. Combatting African Animal Trypanosomiasis (AAT) in livestock: The potential role of trypanotolerance. Vet Parasitol [Internet]. 2016 Jul 30 [cited 2022 Nov 25];225:43–52. Available from: https://www.sciencedirect.com/science/article/pii/S0304401716301571 Cecchi G, Paone M, Argilés Herrero R, Vreysen MJB, Mattioli RC. Developing a continental atlas of the distribution and trypanosomal infection of tsetse flies (Glossina species). Parasit Vectors. 2015 May 22;8:284. Davies (M.B.E.) H. Tsetse Flies in Nigeria: A Handbook for Junior Control Staff. Oxford University Press; 1977. 390 p. Jeremiah C, Katsayal UA, Nuhu A, Bola Anafi S, Adeojoh Ibrahim M, Dijie Nuhu H. Phytochemical Screening and Anti-Inflammatory Studies of Tapinanthus globiferus (A. Rich) Teigh. Leaves Three Extracts. Pharm Sci [Internet]. 2019 Jun 30 [cited 2022 Dec 30];25(2):124–31. Available from: https://ps.tbzmed.ac.ir/Abstract/PHARM_20949_20180729214501 Barrett MP. The elimination of human African trypanosomiasis is in sight: Report from the third WHO stakeholders meeting on elimination of gambiense human African trypanosomiasis. PLoS Negl Trop Dis [Internet]. 2018 Dec 6 [cited 2022 Nov 25];12(12):e0006925. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6283460/ Ahmed AB. A stake-holder based approach to tsetse fly control in central Nigeria. J Agric Ext Rural Dev [Internet]. 2010 Jan 1 [cited 2022 Nov 9]; Available from: https://www.academia.edu/24914797/A_stake_holder_based_approach_to_tsetse_fly_control_in_central_Nigeria Weber JS, Ngomtcho SCH, Shaida SS, Chechet GD, Gbem TT, Nok JA, et al. Genetic diversity of trypanosome species in tsetse flies (Glossina spp.) in Nigeria. Parasit Vectors [Internet]. 2019 Dec [cited 2021 Jan 8];12(1):481. Available from: https://parasitesandvectors.biomedcentral.com/articles/10.1186/s13071-019-3718-y Gooding RH. Genetic variation in tsetse flies and implications for trypanosomiasis. Parasitol Today [Internet]. 1992 Mar 1 [cited 2022 Nov 26];8(3):92–5. Available from: https://www.sciencedirect.com/science/article/pii/016947589290246X Pollock JN. Training Manual for Tsetse Control Personnel: Tsetse biology, systematics and distribution; techniques. FAO; 1982. 280 p. Shaida SS, Weber JS, Gbem TT, Ngomtcho SCH, Musa UB, Achukwi MD, et al. Diversity and phylogenetic relationships of Glossina populations in Nigeria and the Cameroonian border region. BMC Microbiol [Internet]. 2018 Nov [cited 2022 Nov 9];18(S1):180. Available from: https://bmcmicrobiol.biomedcentral.com/articles/10.1186/s12866-018-1293-6 Leak SGA. Tsetse Biology and Ecology: Their Role in the Epidemiology and Control of Trypanosomosis. ILRI (aka ILCA and ILRAD); 1999. 598 p. Service MW. Introduction to the order Diptera — mosquitoes, horseflies, houseflies, tsetse flies etc. In: Service MW, editor. A Guide to Medical Entomology [Internet]. London: Macmillan Education UK; 1980 [cited 2022 Nov 27]. p. 20–1. Available from: https://doi.org/10.1007/978-1-349-16334-2_3 Kasozi KI, Zirintunda G, Ssempijja F, Buyinza B, Alzahrani KJ, Matama K, et al. Epidemiology of Trypanosomiasis in Wildlife—Implications for Humans at the Wildlife Interface in Africa. Front Vet Sci [Internet]. 2021 [cited 2022 Nov 3];8. Available from: https://www.frontiersin.org/articles/10.3389/fvets.2021.621699 Omonona A, Abioye S, Odeniran P, Ademola I. Distribution of tsetse flies and its Trypanosoma species infection in Old Oyo National Park, Nigeria. Zoologist (The). 2020 Dec 18;18:33–8. Squarre D, Hayashida K, Gaithuma A, Chambaro H, Kawai N, Moonga L, et al. Diversity of trypanosomes in wildlife of the Kafue ecosystem, Zambia. Int J Parasitol Parasites Wildl [Internet]. 2020 Apr 23 [cited 2022 Nov 3];12:34–41. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7215119/ Auty H, Anderson NE, Picozzi K, Lembo T, Mubanga J, Hoare R, et al. Trypanosome Diversity in Wildlife Species from the Serengeti and Luangwa Valley Ecosystems. Ndung’u JM, editor. PLoS Negl Trop Dis [Internet]. 2012 Oct 18 [cited 2022 Nov 25];6(10):e1828. Available from: https://dx.plos.org/10.1371/journal.pntd.0001828 Diall O, Cecchi G, Wanda G, Argilés-Herrero R, Vreysen MJB, Cattoli G, et al. Developing a Progressive Control Pathway for African Animal Trypanosomosis. Trends Parasitol [Internet]. 2017 Jul 1 [cited 2022 Nov 25];33(7):499–509. Available from: https://www.sciencedirect.com/science/article/pii/S1471492217300636 Karshima SN, Lawal IA, Okubanjo OO. Feeding Patterns and Xenomonitoring of Trypanosomes among Tsetse Flies around the Gashaka-Gumti National Park in Nigeria. J Parasitol Res [Internet]. 2016 [cited 2022 Nov 27];2016:1–6. Available from: http://www.hindawi.com/journals/jpr/2016/1591037/ Isaac C, Ciosi M, Hamilton A, Scullion KM, Dede P, Igbinosa IB, et al. Molecular identification of different trypanosome species and subspecies in tsetse flies of northern Nigeria. Parasit Vectors [Internet]. 2016 May 23 [cited 2022 Nov 9];9(1):301. Available from: https://doi.org/10.1186/s13071-016-1585-3 Jonah A, Attahir A, Idowu FM, Usman BM, Tese TT, Rukayya G, et al. Molecular Identification Of Trypanosomes In Wild Tsetse Flies Captured From Kainji Lake National Park, Nigeria. Fudma J Sci [Internet]. 2020 Apr 18 [cited 2022 Nov 3];4(1):706–10. Available from: https://www.fjsadmin.fudutsinma.edu.ng/index.php/fjs/article/view/93 Alibu V, John, Enyaru CK, Matovu E, Malele I, Chisi J, et al. Molecular xenomonitoring of trypanosomes in tsetse flies. undefined [Internet]. 2015 [cited 2022 Nov 27]; Available from: https://www.semanticscholar.org/paper/Feeding-Patterns-and-Xenomonitoring-of-Trypanosomes-Karshima-Lawal/fee87f639d2c4e3cadcbac190edff1cfbbbf4c2f Abubakar A, Abdullahi RA, Ayakpat HN, Garba J, Muhammad H. Population Dynamics of Tsetse flies at Salt Lick B and Guruntun Areas of Yankari National Park Bauchi State Nigeria. Curr Res J Biol Sci [Internet]. 2016 [cited 2022 Nov 25];8(2):15–7. Available from: https://www.maxwellsci.com/jp/mspabstract.php?doi=crjbs.8.2690 Geiger A, Malele I, Abd-Alla AM, Njiokou F. Blood feeding tsetse flies as hosts and vectors of mammals-pre-adapted African Trypanosoma: current and expected research directions. BMC Microbiol [Internet]. 2018 Nov 23 [cited 2022 Nov 26];18(Suppl 1):162. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6251083/ Challier A, Laveissiere C. Un nouveau piège pour la capture des glossines (Glossina: Diptera, Muscidae): description et eassais sur le terrain. Ent méd et Parasitol. 1973 ; 11:251–62. Accessed: Nov. 28, 2022. [Online]. Available: https://typeset.io/papers/un-nouveau-piege-pour-la-capture-des-glossines-p-ossina-da-1gd4z6gwwi Ngomtcho SCH, Weber JS, Ngo Bum E, Gbem TT, Kelm S, Achukwi MD. Molecular screening of tsetse flies and cattle reveal different Trypanosoma species including T. grayi and T. theileri in northern Cameroon. Parasit Vectors [Internet]. 2017 Dec [cited 2020 Aug 21];10(1):631. Available from: https://parasitesandvectors.biomedcentral.com/articles/10.1186/s13071-017-2540-7 Signaboubo D, Payne VK, Moussa IMA, Hassane HM, Berger P, Kelm S, et al. Diversity of tsetse flies and trypanosome species circulating in the area of Lake Iro in southeastern Chad. Parasit Vectors [Internet]. 2021 [cited 2022 Nov 28];14(1):undefined-undefined. Available from: https://www.mendeley.com/catalogue/5b6e64c2-da16-3b1c-9475-eb6bf87b034e/ Muturi CN, Ouma JO, Malele II, Ngure RM, Rutto JJ, Mithöfer KM, et al. Tracking the Feeding Patterns of Tsetse Flies (Glossina Genus) by Analysis of Bloodmeals Using Mitochondrial Cytochromes Genes. Hansen I, editor. PLoS ONE [Internet]. 2011 Feb 28 [cited 2022 Nov 9];6(2):e17284. Available from: https://dx.plos.org/10.1371/journal.pone.0017284 Omondi D, Masiga DK, Ajamma YU, Fielding BC, Njoroge L, Villinger J. Unraveling Host-Vector-Arbovirus Interactions by Two-Gene High Resolution Melting Mosquito Bloodmeal Analysis in a Kenyan Wildlife-Livestock Interface. PLOS ONE [Internet]. 2015 Jul 31 [cited 2022 Nov 27];10(7):e0134375. Available from: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0134375 Adams ER, Malele II, Msangi AR, Gibson WC. Trypanosome identification in wild tsetse populations in Tanzania using generic primers to amplify the ribosomal RNA ITS-1 region. Acta Trop [Internet]. 2006 Nov [cited 2022 Nov 9];100(1–2):103–9. Available from: https://linkinghub.elsevier.com/retrieve/pii/S0001706X06001902 Simo G, Rayaisse JB. Challenges facing the elimination of sleeping sickness in west and central Africa: sustainable control of animal trypanosomiasis as an indispensable approach to achieve the goal. Parasit Vectors [Internet]. 2015 Dec 16 [cited 2022 Nov 26];8:640. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4681034/ Simo G, Njiokou F, Mbida Mbida JA, Njitchouang GR, Herder S, Asonganyi T, et al. Tsetse fly host preference from sleeping sickness foci in Cameroon: Epidemiological implications. Infect Genet Evol [Internet]. 2008 Jan 1 [cited 2022 Nov 27];8(1):34–9. Available from: https://www.sciencedirect.com/science/article/pii/S1567134807001372 Farikou O, Njiokou F, Simo G, Asonganyi T, Cuny G, Geiger A. Tsetse fly blood meal modification and trypanosome identification in two sleeping sickness foci in the forest of southern Cameroon. Acta Trop [Internet]. 2010 Oct [cited 2020 Aug 21];116(1):81–8. Available from: https://linkinghub.elsevier.com/retrieve/pii/S0001706X10001750 Torr SJ, Prior A, Wilson PJ, Schofield S. Is there safety in numbers? The effect of cattle herding on biting risk from tsetse flies. Med Vet Entomol [Internet]. 2007 [cited 2022 Nov 26];21(4):301–11. Available from: https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1365-2915.2007.00705.x Olaide OY, Tchouassi DP, Yusuf AA, Pirk CWW, Masiga DK, Saini RK, et al. Zebra skin odor repels the savannah tsetse fly, Glossina pallidipes (Diptera: Glossinidae). PLoS Negl Trop Dis [Internet]. 2019 Jun 10 [cited 2022 Nov 25];13(6):e0007460. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6586361/ Saini RK, Orindi BO, Mbahin N, Andoke JA, Muasa PN, Mbuvi DM, et al. Protecting cows in small holder farms in East Africa from tsetse flies by mimicking the odor profile of a non-host bovid. PLoS Negl Trop Dis [Internet]. 2017 Oct 17 [cited 2022 Nov 25];11(10):e0005977. Available from: https://journals.plos.org/plosntds/article?id=10.1371/journal.pntd.0005977 Makhulu EE, Villinger J, Adunga VO, Jeneby MM, Kimathi EM, Mararo E, et al. Tsetse blood-meal sources, endosymbionts and trypanosome-associations in the Maasai Mara National Reserve, a wildlife-human-livestock interface. PLoS Negl Trop Dis [Internet]. 2021 Jan 6 [cited 2022 Nov 25];15(1):e0008267. Available from: https://journals.plos.org/plosntds/article?id=10.1371/journal.pntd.0008267 Nyingilili H, Malele I, Nkwengulila G. Diversity of Blood Meal Hosts in Glossina Pallidipes and Its Role in the Epidemiology of Trypanosomiasis at a Localized Area in Serengeti National Park. 2016 Jan 1;2. Lehane M, Alfaroukh I, Bucheton B, Camara M, Harris A, Kaba D, et al. Tsetse Control and the Elimination of Gambian Sleeping Sickness. PLoS Negl Trop Dis [Internet]. 2016 Apr 29 [cited 2022 Nov 26];10(4):e0004437. Available from: https://journals.plos.org/plosntds/article?id=10.1371/journal.pntd.0004437 Ray Wilson’s Bird & Wildlife Photography: Arthropod Vectors of Human Diseases Tsetse Flies (Glossina morsitans & Glossina palpalis) [Internet]. [cited 2022 Nov 27]. Available from: http://www.raywilsonbirdphotography.co.uk/00001%20New%20website/Galleries/Invertebrates/vectors/Tsetse_Fly.html Hoare CA. Studies on Trypanosoma grayi. III. Life-Cycle in the Tsetse-fly and in the Crocodile. Parasitology [Internet]. 1931 Oct [cited 2022 Nov 25];23(4):449–84. Available from: https://www.cambridge.org/core/journals/parasitology/article/abs/studies-on-trypanosoma-grayi-iii-lifecycle-in-the-tsetsefly-and-in-the-crocodile/68A145AA700355165C8FF006C92D4F9A Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3097302","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":215593607,"identity":"ddede3e8-f581-4e6f-9986-5b02e1500866","order_by":0,"name":"Grace Amarachi Amos","email":"","orcid":"","institution":"Ahmadu Bello University Zaria","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Grace","middleName":"Amarachi","lastName":"Amos","suffix":""},{"id":215593608,"identity":"db23d309-ea6e-4e5a-9f08-9498769d6034","order_by":1,"name":"Djoukzoumka Signaboubo","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABCUlEQVRIiWNgGAWjYDCCAwcYGBsYJIAsHgYQSw4s+IAULcZgwQS8WsAKGeBaEsEcfFr4Dh4+Jjnjj4XddvazBx/z7rBJnx92+CHQFjs53QbsWiQPHEuT3NgmkbyzJy/ZmPdMWu7G22kGQC3JxmYHsGsxOHDGTPJhg0SywYEcM2netsO5G2cngLQcSNyGT8uDP0At59+AtaQbzk7/QFjLBjYJO4MbEFsS5KVz8NsC9Euy5cw2iQSDG++SDeeeSTPcIJ1TcCDBALdf+G4cPniz50+dvcH53IMP3u6wkZefnb75w4cKOzlcWhgkIBKQ6IA4FUziUA4C/BC19nAB+QbsCkfBKBgFo2DkAgBZhG1KZ8exJgAAAABJRU5ErkJggg==","orcid":"","institution":"Institut de Recherche en Elevage pour le Développement (IRED)","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Djoukzoumka","middleName":"","lastName":"Signaboubo","suffix":""},{"id":215593609,"identity":"c1bed72b-572b-4d84-93f8-55f710ab4b4f","order_by":2,"name":"Iliya Shehu Ndams","email":"","orcid":"","institution":"Ahmadu Bello University Zaria","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Iliya","middleName":"Shehu","lastName":"Ndams","suffix":""},{"id":215593610,"identity":"31e45edc-be8c-418b-ba48-6c6dac365334","order_by":3,"name":"Gloria Dada Chechet","email":"","orcid":"","institution":"Africa Centre of Excellence for Neglected Tropical Diseases \u0026 Forensic Biotechnology, Ahmadu Bello University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Gloria","middleName":"Dada","lastName":"Chechet","suffix":""},{"id":215593611,"identity":"3a168bcc-2d55-40b8-bcf1-e756d17e062f","order_by":4,"name":"Mohammed Nasir Shuaibu","email":"","orcid":"","institution":"Africa Centre of Excellence for Neglected Tropical Diseases \u0026 Forensic Biotechnology, Ahmadu Bello University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mohammed","middleName":"Nasir","lastName":"Shuaibu","suffix":""},{"id":215593613,"identity":"4482a4dd-1c47-4c34-ae47-8aeca90524ac","order_by":5,"name":"Mahamat Alhadj Moussa Ibrahim","email":"","orcid":"","institution":"University of N'Djamena","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Mahamat","middleName":"Alhadj Moussa","lastName":"Ibrahim","suffix":""},{"id":215593615,"identity":"2f21e385-f2b0-4ca1-b635-5a14ac9e5a74","order_by":6,"name":"Youssouf Mouliom Mfopit","email":"","orcid":"","institution":"Institute of Agricultural Research for development (IRAD)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Youssouf","middleName":"Mouliom","lastName":"Mfopit","suffix":""},{"id":215593618,"identity":"54de2030-3113-4acd-a5e6-5d3591f42585","order_by":7,"name":"Atoh Cedric Munu Tamuton","email":"","orcid":"","institution":"Africa Centre of Excellence for Neglected Tropical Diseases \u0026 Forensic Biotechnology, Ahmadu Bello University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Atoh","middleName":"Cedric Munu","lastName":"Tamuton","suffix":""},{"id":215593619,"identity":"edefe716-07f3-4991-bc22-4514c35fa0cc","order_by":8,"name":"Sørge Kelm","email":"","orcid":"","institution":"University of Bremen","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Sørge","middleName":"","lastName":"Kelm","suffix":""},{"id":215593622,"identity":"1a672336-e753-4ded-93f8-fe8b8228c7e8","order_by":9,"name":"Petra Berger","email":"","orcid":"","institution":"University of Bremen","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Petra","middleName":"","lastName":"Berger","suffix":""}],"badges":[],"createdAt":"2023-06-22 16:44:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3097302/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3097302/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":39810245,"identity":"b759915c-69aa-4d7f-a75a-0b77040e86d9","added_by":"auto","created_at":"2023-07-10 16:49:27","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":908249,"visible":true,"origin":"","legend":"\u003cp\u003eSampling Points at Ijah Gbagyi (a) Yankari Games Resort (b)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-3097302/v1/e8b913e626df5ba353c3237d.png"},{"id":39810244,"identity":"888f5f73-f986-4efe-83ab-7c47c33964ee","added_by":"auto","created_at":"2023-07-10 16:49:27","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":57209,"visible":true,"origin":"","legend":"\u003cp\u003eSpatial representation of trypanosomes and host preferences at (\u003cstrong\u003ea\u003c/strong\u003e) Ijah Gbagyi and (\u003cstrong\u003eb\u003c/strong\u003e)\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-3097302/v1/e04c646d351f282923562ae8.png"},{"id":52758378,"identity":"6b144161-9e90-4302-a8e8-38ea5511d738","added_by":"auto","created_at":"2024-03-15 12:13:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1081056,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3097302/v1/6c971de0-e4ee-404a-9a9d-4efe2148d6e2.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Molecular Detection of Trypanosomes and Xenomonitoring of Host Range from the Feeding Patterns of Glossina Species Collected from Northern Guinea Savannah of Nigeria","fulltext":[{"header":"Introduction","content":"\u003cp\u003eTsetse flies (Diptera: Glossinidea) are biological vectors of African trypanosomiasis (AT) in humans and animals. Trypanosomes are hemoflagellate protozoan parasites that cause sleeping sickness (human African trypanosomiasis, HAT) in humans and nagana (African animal trypanosomiasis, AAT) in animals. Trypanosomiasis is endemic in tsetse-infested areas of sub-Saharan Africa, putting an estimated 70\u0026nbsp;million humans and 60\u0026nbsp;million cattle at risk of infection [\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The disease causes a decline in human and animal productivity, threatening food and nutritional security, social welfare, and economic stability, particularly in areas where pastoralism is the main economic activity [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eControl of AT relies mainly on active surveillance, vector control and mass chemotherapy [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. However, parasites are becoming increasingly resistant to trypanocidal drugs while new trypanocidal drugs are not available [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Vector control is therefore an important component of sustainable integrated AT control because of their importance in the infection cycle of African trypanosomiasis [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. It is therefore important to fill the gap left by chemotherapy by interrupting the transmission cycle of trypanosomes. For this reason, vector control is widely applied in high potential livestock areas [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. To complicate this control, wild animals support the life cycles of tsetse flies [\u003cspan additionalcitationids=\"CR14\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] as well as trypanosomes [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] and are therefore an important factor in the transmission dynamics of AT, especially in wild ecosystems. For example, certain species of trypanosomes have been associated with certain species of wild animals [\u003cspan additionalcitationids=\"CR19\" citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Wildlife parks that harbor tsetse species pose a risk to livestock and the general human population [\u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], so much so that there are reports of cross-transmission between livestock and wild hosts, employees, tourists and researchers visiting the parks due to the bite of infected tsetse flies, which over the years has made the control approach more difficult and complicated due to the reinvasion of tsetse cleared areas.\u003c/p\u003e \u003cp\u003eThe trophic predilections of tsetse flies are very diverse, especially in wild areas. Therefore, a single blood meal study area cannot be used to draw general conclusions about tsetse feeding behavior [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. However, identification of tsetse blood meal sources in specific areas can provide plausible information on the wildlife species likely to be involved in AT transmission and can contribute to the search for sustainable solutions to strengthen vector control strategies, especially in wildlife-human-livestock interface areas that serve as hotspots for the emergence and re-emergence of AT.\u003c/p\u003e \u003cp\u003eIn Nigeria, molecular surveillance of trypanosome prevalence in wild-caught tsetse species has allowed the detection of DNA or parasites of human or animal health importance in a given area (known as \"Molecular Xenomonitoring MX\"), without dealing with reservoir host in a given area. Xenomonitoring has allowed the detection of AT outbreaks, so that control programs can be focused on areas that require immediate attention to stop the transmission of the disease. Molecular screening of tsetse flies in parks and remote rural areas of Nigeria has revealed the presence of different \u003cem\u003eTrypanosoma\u003c/em\u003e species such as \u003cem\u003eTrypanosoma vivax\u003c/em\u003e, \u003cem\u003eTrypanosoma godfreyi\u003c/em\u003e, \u003cem\u003eTrypanosoma brucei brucei\u003c/em\u003e, \u003cem\u003eTrypanosoma simiae\u003c/em\u003e, \u003cem\u003eTrypanosoma congolense forest\u003c/em\u003e and \u003cem\u003eTrypanosoma congolense savannah\u003c/em\u003e, including \u003cem\u003eTrypanosoma grayi\u003c/em\u003e and \u003cem\u003eTrypanosoma theleri\u003c/em\u003e trypanosomes of crocodiles [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan additionalcitationids=\"CR24\" citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], however, the incidence of \u003cem\u003eTrypanosoma brucei gambiense\u003c/em\u003e was not detected [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Over the years, control programs and efforts have been made for the treatment of AT and vector control [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e] but no action has been taken so far against the reservoir host. Furthermore, the number of newly diagnosed cases of trypanosomiasis is decreasing, but the seriousness of the situation requires further research [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Yankari Games Resort and Ijah Gbagyi in Nigeria have been the subject of several research studies on the identification of vectors and [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], trypanosomes [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] but no study on the feeding performance of tsetse flies has being done to establish source of infection with \u003cem\u003eTrypanosoma\u003c/em\u003e. This study was therefore undertaken to provide evident data that strengthens trypanosomiasis surveillance by xenomonitoring proboscis, salivary glands and guts of tsetse flies and to identify the trophic preferences by the analysis of blood meals of tsetse, this will enable detection of potential reservoir hosts of trypanosomes in Yankari Games Resort and Ijah Gbagyi Nigeria.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eStudy Areas\u003c/h2\u003e \u003cp\u003eTsetse flies were collected at Ijah Gbagyi (9\u0026deg; 12\u0026prime; 06 \" N, 7\u0026deg; 12\u0026prime; 14 \") and (9\u0026deg; 24\u0026prime; 60 \" N, 7\u0026deg; 20\u0026prime; 45 \" E) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea\u003cb\u003e)\u003c/b\u003e. Ijah Gbagyi covers an area of 222 km\u0026sup2; located in Suleja Tafa L. G. A Niger State. The topography of Ijah Gbagyi has various elevation sites, with a wooded savannah vegetation area. It also has a large stream with clean flowing water that also harbour blackflies any season. It has a riverine forest biotope that forms a dense canopy shape. The fly\u0026rsquo;s collection site is associated with agricultural practices of mixed crop farming, plantations, shrubs, various fringing trees, grassland with some populations of wild animals and constant cattle grazing. Humans, cattle and various kinds of animals constantly visit the infested river.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eYankari Games Resort (9\u0026deg; 45\u0026prime; 16 \" N, 9\u0026deg; 16\u0026prime; 45 \" N) and (10\u0026deg; 30\u0026prime; 25 \u0026ldquo;E and 10\u0026deg; 37\u0026prime; 51 \"E) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb\u003cb\u003e)\u003c/b\u003e in Alkaleri L. G. A Bauchi state, covers an area of 2244 km\u0026sup2;. It has a grass savannah vegetation site, that has patches of low woodland with scattered shrubs and trees that enables tsetse dispersion during the wet seasons [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. It is a national park that has the country\u0026rsquo;s richest wildlife oasis, and the most popular tourist destination in Nigeria, where wild animals such as buffalo, hippopotamus, roan, hartebeest, elephants, etc, run freely and are protected in their natural habitat, these wildlife serves as available blood meal to tsetse flies populations.\u003c/p\u003e \u003cp\u003eFigure \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e: Sampling Points at Ijah Gbagyi (\u003cb\u003ea\u003c/b\u003e) Yankari Games Resort (\u003cb\u003eb\u003c/b\u003e)\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eEntomological survey\u003c/h2\u003e \u003cp\u003eThe survey was carried out during the dry season in February 2020, five bio conical traps [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] were positioned at about 100\u0026ndash;150 meters apart for all the periods of fly collection. Trapped tsetse were collected after 24hrs of trapping, and transported in cool boxes to the base camps. The flies were counted and sorted into species, sex and further grouped into different hunger stages. For each trap point, the geographical coordinates were recorded using a Global Positioning System (GPS) (Garmin GPS map 64x), while the temperature and relative humidity of each trap point were recorded using a thermohygrometer (EasyLog TH; Lascar, Whiteparish, UK).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eMorphological identification of Tsetse species\u003c/h2\u003e \u003cp\u003eAll tsetse flies caught were identified morphologically to species level using identification keys. The features include the markings on the hind leg, the shape of the abdominal segment and color of the thecal bulb of the proboscis for example; The \u003cem\u003eGlossina morsitans submorsitans s\u003c/em\u003epecies has a dark brown thecal bulb, the 4th and 5th tarsal segments of the hind legs are black, and the markings on the first segment of the abdomen is square shaped. For \u003cem\u003eGlossina palpalis palpalis\u003c/em\u003e species, the thecal bulb is also dark brown, but all the tarsal segments of the hind legs are black and the first segment of the abdomen is square shaped while in \u003cem\u003eGlossina tachinoides\u003c/em\u003e they are triangular [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003eDetermination of Hunger Stage of trapped tsetse\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eHunger stages of the flies caught were categorized into gorged, intermediate and hungry. This was done to determine the amount of blood meal remaining in the abdomen. The flies were grouped into: Stage I: Gorged: when abdomen is distended with red or blue-black blood.\u003c/p\u003e \u003cp\u003eStage II: Intermediate: when abdomen is slightly concave and a quarter to two- thirds is opaque.\u003c/p\u003e \u003cp\u003eStage III: Hungry: when abdomen looks flattened and underside is wrinkled.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003eDissection of a non-teneral Tsetse\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eOnly live non-teneral flies were dissected in a drop of sterile saline solution using dissecting pins and forceps. For each fly, the forceps and dissecting pins were decontaminated by immersion in 3\u0026ndash;5% sodium hypochlorite for approximately 10 minutes, followed by immersion in 70% ethanol and final immersion in normal saline between dissections. The wings were removed first with forceps, followed by legs, proboscis, salivary glands and gut according to the established procedure [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e\u003cb\u003eStorage of Dissected Organs\u003c/b\u003e\u003c/h2\u003e \u003cp\u003eThe proboscis and salivary gland were preserved in 200 \u0026micro;l nucleic acid preservation agent (NAPA: 25 mM sodium citrate, 10 mM EDTA, 70 g ammonium sulfate/100 ml solution, pH 7.5), while the guts were preserved in 500 \u0026micro;l of NAPA in 1.5 mL cryotubes (30). The organs were kept in cold boxes in the field and at -20\u0026deg;C in the laboratory at the end of the survey for further analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eDNA Extraction of the Organs\u003c/h2\u003e \u003cp\u003eThe guts and salivary glands were removed from the preservative in the cryotubes and the DNA was extracted using DNeasy blood and tissue kit (Qiagen, Germany) following the manufacturer\u0026rsquo;s instructions. DNA from each proboscis were extracted using proteinase K as described by Signaboubo \u003cem\u003eet al\u003c/em\u003e., [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Briefly, each proboscis was removed from the cryotubes containing the preservative agent, and transferred into a new 1.5-ml micro tube containing 9.9 \u0026micro;l of proteinase K at 20 mg/m, with 45.1 \u0026micro;L of phosphate buffered saline in a total volume of 55 \u0026micro;l. Each tube was centrifuged at 13,400 rpm for 1 min and then incubated at 55\u0026deg;C for 1 hour and later vortexed and centrifuged, followed by a second incubation for 45 min at 85\u0026deg;C. Thereafter, each of the micro tube were vortexed and centrifuged at 10,000 rpm for 1 min [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The extracted DNA from each organ were collected and subsequently quantified using Nano drop Spectrophotometer (Thermo Fisher Scientific) 1000 apparatus at a wavelength of 260 and 280 Nano meter. The DNA extracts were then stored at \u0026minus;\u0026thinsp;20\u0026deg;C for further molecular analyses.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eIdentification of origin of blood meals of tsetse flies (Amplification, Sequencing and Analysis)\u003c/h2\u003e \u003cp\u003eThe identification of the origin of blood meals collected from the gut of tsetse flies was done using two set of primers; Muturi \u003cem\u003eet al\u003c/em\u003e., [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] and Omondi \u003cem\u003eet al\u003c/em\u003e., [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe first set was VF1d_t1: TGTAAAACGACGGCCAGTTCTCAACCA ACCACAARGAY ATYGG and VR1d_t1:CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCRAARAAYCA targeted for mammals, aves, reptiles and fishes. It amplifies a 648 bp region of the mitochondrial cytochrome oxidase c subunit 1 (\u003cem\u003eCOI\u003c/em\u003e) gene [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The amplification in the PCR machine was carried out in 12.5 \u0026micro;l final volume for screening of all gut samples for detection of the blood meal, and 50 \u0026micro;l final volume for all samples that showed amplification in the initial screening. The mixture contains 1X Dream Taq Green Buffer, 200 \u0026micro;M dNTPs, 1 unit of \u003cem\u003eTaq\u003c/em\u003e DNA polymerase (Thermo Fisher Scientific), 2 \u0026micro;M of each primer (Sigma-Aldrich, Darmstadt, Germany) and 2 \u0026micro;l of tsetse gut DNA template:\u003c/p\u003e \u003cp\u003eCycling conditions were: Initial denaturation for 2 min at 94\u003csup\u003e\u0026deg;\u003c/sup\u003eC, followed by 40 cycles of denaturation at 94\u003csup\u003e\u0026deg;\u003c/sup\u003eC for 30 sec, annealing at 45\u003csup\u003e\u0026deg;\u003c/sup\u003eC for 45 sec, and primer extension at 72\u003csup\u003e\u0026deg;\u003c/sup\u003eC for 1 min followed by a final extension at 72\u003csup\u003e\u0026deg;\u003c/sup\u003eC for 10 min.\u003c/p\u003e \u003cp\u003eFor the second primer target, a 383 bp fragment of cytochrome b (\u003cem\u003eCyt b\u003c/em\u003e) gene was amplified with \u003cem\u003eCyt b\u003c/em\u003e Forward (CCCCTCAGAATGATATTTGTCCTCA) and \u003cem\u003eCyt b\u003c/em\u003e Reverse (CATCCAACATCTCAGCATGATGAAA) primers designed for vertebrate animals [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The PCR amplification was carried out in a final volume of 12.5 \u0026micro;l, with 0.5 \u0026micro;M concentrations of each primer (Sigma-Aldrich, Darmstadt, Germany), 1X Dream Taq Green Buffer, 100 \u0026micro;M dNTPs, 1 unit of \u003cem\u003eTaq\u003c/em\u003e DNA polymerase (Thermo Fisher Scientific) and 2 \u0026micro;l of DNA template. The cycling conditions were as followed: Initial denaturation at 95\u0026deg;C for 1 min, then 35 cycles of denaturation at 95\u0026deg;C for 30 sec, annealing at 58\u0026deg;C for 20 sec, extension at 72\u0026deg;C for 30 sec followed by a final extension at 72\u0026deg;C for 7 min.\u003c/p\u003e \u003cp\u003eDNA ladder (Thermo Fisher Scientific) alongside the PCR products were separated in 2% agarose gel stained with Stain-G (Serva, Heidelberg, Germany) in TAE- Buffer (40 mMTris, 10 mMNa-acetate, 1 mM EDTA, pH 8.0), the products were visualized under UV light and photographed in the gel documentation. Blood meal samples were subsequently purified using GeneJet DNA purification kit (Thermo Scientific, Dreieich, Germany) following the manufacturer\u0026rsquo;s instructions, and subsequently used for direct sequencing at a commercial company SeqLab, G\u0026ouml;ttingen, Germany.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eMolecular Xenomonitoring of different species of trypanosomes hosted by tsetse\u003c/h2\u003e \u003cp\u003eThe trypanosome species and subspecies were identified from the proboscis, salivary gland and gut of each tsetse fly by amplifying the internal transcribed spacer 1 (\u003cem\u003eITS1\u003c/em\u003e) fragment of the rDNA of trypanosomes designed by Adams \u003cem\u003eet al\u003c/em\u003e., [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e] and Ngomtcho \u003cem\u003eet al\u003c/em\u003e., [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The nested PCR was done using the outer generic primers ITS1- Out-sense (5\u0026prime;-TGC AAT TAT TGG TCG CGC-3\u0026prime;) and \u003cem\u003eITS1\u003c/em\u003e-Out-non-sense (5\u0026prime;-CTT TGC TGC GTT CTT-3\u0026prime;). After this amplification, specific identification of each trypanosome species or subspecies was performed by sequencing the amplified \u003cem\u003eITS1\u003c/em\u003e DNA fragment and comparing the obtained sequences with those available in the Genbank by BLASTn algorithm.\u003c/p\u003e \u003cp\u003eFor the gut and salivary gland samples, 5 \u0026micro;l of template DNA was used in the first PCR reaction, and for both organs, the first reaction was diluted 1:300 and 1 \u0026micro;l of the dilution was used for the second PCR reaction. For the crude proboscis DNA samples, 1 \u0026micro;l was used as template in the first reaction, and the reaction product was diluted 1:200 and 1 \u0026micro;l of the dilution was used in the second reaction.\u003c/p\u003e \u003cp\u003eThe trypanosome PCR reactions Master Mix consisted of 200 \u0026micro;M of dNTPs, 2.5 \u0026micro;l of 10\u0026times; DreamTaq Green Buffer, 2.5 U DreamTaq Polymerase (5U/\u0026micro;l) (Thermo Fisher Scientific) and 2 \u0026micro;M of each primer (Sigma-Aldrich, Darmstadt, Germany) in a final volume of 25 \u0026micro;l. The PCR cycling conditions for both reactions were as followed: initial denaturation at 95\u0026deg;C for 3 min; 30 cycles of 1 min at 94\u0026deg;C, annealing for 30 sec at 54\u0026deg;C, elongation for 30 sec at 72\u0026deg;C and a final elongation step for 5 min at 72\u0026deg;C. Amplicons were visualized on 2% TBE (Tris-Borate-EDTA buffer) agarose gels, ran at 100 V and stained with Stain-G (Serva, Heidelberg, Germany), 50 bp DNA ladder (Thermo Fisher Scientific) was used to estimate the band size of the amplicons [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAll trypanosome positive samples were determined based on approximation of agarose gel electrophoresis according to the table below (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eExpected ITS\u003cem\u003e1\u003c/em\u003e Amplicon sizes for Trypanosomes isolated from tsetse organs\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTrypanosoma species\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmplicon Sizes (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrypanosoma vivax\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e180\u0026ndash;250\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrypanosoma godfreyi\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e240\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrypanosoma grayi\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e318\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrypanosoma theleri\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e320\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrypanosoma brucei spp.\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e426\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTrypanosoma congolense\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e650\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAdapted from [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eData Analysis\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe sequences were subjected to BLASTN searches at the National Center for Biotechnology Information (NCBI) (GenBank). A Correlation and spatial distribution dependency of trypanosomes on host fed on was done using SPSS Version 20. Infection rates were calculated by dividing the number of infected tsetse flies by the total number of flies that had fed on a vertebrate host and expressed as percentages.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eThe hunger stages of the flies show that out of the 220 tsetse flies, undigested blood meal of 6 (2.72%), 75 (34.09%) and 139 (63.18%) were gorged, intermediate and hungry flies, respectively (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSpecies composition and hunger stages of Dissected \u003cem\u003eGlossina\u003c/em\u003e species\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003eIjah Gbagyi\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"5\" nameend=\"c8\" namest=\"c4\"\u003e \u003cp\u003eYankari Games Resort\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e \u003cp\u003e\u003cem\u003eG. p. palpalis\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e\u003cem\u003eG. m. submorsitans\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"3\" nameend=\"c8\" namest=\"c6\"\u003e \u003cp\u003e\u003cem\u003eG. tachinoides\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHunger Stages\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eMale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eFemale\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEngorged\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1 (0.45)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2 (0.90)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1 (0.45)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e2 (0.90)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e6 (2.72)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eIntermediate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e7 (3.18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e36 (16.36)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e3 (1.36)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13 (5.90)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e12 (0.05)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e4 (1.81)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e75 (34.09)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHungry\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e27 (12.27)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e63 (28.63)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e8 (3.63)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e26 (11.81)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e8 (3.63)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e7 (3.18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e139 (63.18)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTotal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e35 (15.90)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e101 (45.90)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e12 (5.45)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e39 (17.72)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e22 (10.00)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e11 (5.00)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e220 (100)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e11.67\u0026thinsp;\u0026plusmn;\u0026thinsp;7.86\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e33.67\u0026thinsp;\u0026plusmn;\u0026thinsp;27.65\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4.00\u0026thinsp;\u0026plusmn;\u0026thinsp;2.08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e13.00\u0026thinsp;\u0026plusmn;\u0026thinsp;7.5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e7.33\u0026thinsp;\u0026plusmn;\u0026thinsp;2.91\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e3.67\u0026thinsp;\u0026plusmn;\u0026thinsp;2.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ep-value\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.276\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.197\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e0.195\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e0.225\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e0.128\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e0.212\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe \u003cem\u003eCO1\u003c/em\u003e primer amplified only 9 samples out of the 220 gut dissected samples subjected to molecular analysis, while \u003cem\u003eCyt b\u003c/em\u003e primer which amplified the 383 bp gene amplicon for Mammals, Aves, Reptiles, Amphibians and fish DNA templates, was able to amplify 145 gut blood meal samples, but only 45 was successfully sequenced and identified with no mixed meal observed. Overall, 12 vertebrate host species was identified as blood meals source for the tsetse flies collected (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAt Ijah Gbagyi, the \u003cem\u003eG. p. palpalis\u003c/em\u003e species collected was shown to have obtained blood meal from 1 Bird (\u003cem\u003eCoracias garrulus\u003c/em\u003e), 1 from Squirrel (\u003cem\u003eXerus erythropus\u003c/em\u003e), 23 from humans (\u003cem\u003eHomo sapiens\u003c/em\u003e), 1 from Chimpanzee (\u003cem\u003ePan paniscus\u003c/em\u003e), 1 from Bushbuck (\u003cem\u003eTragelaphus scriptus\u003c/em\u003e), 1 from Monitor lizard (\u003cem\u003eVaranus niloticus\u003c/em\u003e) and 2 from Cattle (\u003cem\u003eBos indicus\u003c/em\u003e).\u003c/p\u003e \u003cp\u003eAt Yankari Games Resort \u003cem\u003eG. m. submorsitans\u003c/em\u003e and \u003cem\u003eG. tachinoides\u003c/em\u003e were trapped. \u003cem\u003eG. m. submorsitans\u003c/em\u003e indicated that 3 fed on Humans, 2 on bushbucks, 3 on Rats (\u003cem\u003eRattus argentiventer\u003c/em\u003e), (\u003cem\u003eRattus norvegicus\u003c/em\u003e), (\u003cem\u003ePraomys lukolelae\u003c/em\u003e), 1 on Buffalo (\u003cem\u003eSyncerus caffer\u003c/em\u003e), 1 on Gazelle (\u003cem\u003eNanger soemmerringii\u003c/em\u003e) and 1 on Waterbuck (\u003cem\u003eKobus ellipsiprymnus\u003c/em\u003e). \u003cem\u003eGlossina tachinoides\u003c/em\u003e indicate that 1 had fed on Buffalo, 1 on Warthog (\u003cem\u003ePhacochoerus africanus\u003c/em\u003e), 1 Antelope (\u003cem\u003eHippotragus equinus\u003c/em\u003e) and 1 on Waterbuck.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eHost Preferences of \u003cem\u003eGlossina\u003c/em\u003e at each Location and Distribution of Trypanosomes\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"8\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003eHost Species\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eIjah Gbagyi\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e \u003cp\u003eYankari Games Resort\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c8\" namest=\"c6\"\u003e \u003cp\u003eDistribution of trypanosomes\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eG. p. p\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eG. m. s\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cb\u003eG. t\u003c/b\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eTotal (%)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eProboscis\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eSalivary gland\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c8\"\u003e \u003cp\u003eGut\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBird (Centropus cupreicaudus)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1(3.22)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1(2.17)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eV\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eV\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eSquirrel (\u003c/b\u003e\u003cb\u003eXerus erythropus\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1(3.22)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1(2.17)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eG\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHuman (\u003c/b\u003e\u003cb\u003eHomo sapiens\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e24(77.41)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3(27.27)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e27 (57.78)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eG, V\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eG,T,C\u003c/em\u003e,\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eG,T,V,B\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eChimpanzee (\u003c/b\u003e\u003cb\u003ePan paniscus\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1(3.22)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1(2.17)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eG\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eG.V\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eBushbuck (\u003c/b\u003e\u003cb\u003eTragelaphus scriptus\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1(3.22)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2(18.18)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3(6.52)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eV, T\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eB,G,C\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eV,T,G,B,C\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eMonitor Lizard (\u003c/b\u003e\u003cb\u003eVaranus niloticus\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1(3.22)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1(2.17)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eG\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eCattle (\u003c/b\u003e\u003cb\u003eBos indicus\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2(6.45)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2(4.34)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eV,G\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eV,G\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eRat (\u003c/b\u003e\u003cb\u003eRattus argentiventer\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3(27.27)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e3(6,67)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eV\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eAfrican Buffalo (\u003c/b\u003e\u003cb\u003eSyncerus caffer\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1(9.09)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1(25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2(4.34)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eV\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eG\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eWarthog (\u003c/b\u003e\u003cb\u003ePhacochoerus africanus\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1(25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1(2.17)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eHorse Antelope (\u003c/b\u003e\u003cb\u003eHippotragus equinus\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1(25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1(2.17)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eV\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eG\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGazelle (\u003c/b\u003e\u003cb\u003eNanger soemmerringii\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1(9.09)2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e1(2.17)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eG\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eT,C\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eWaterbuck\u003c/b\u003e \u003cb\u003e(Kobus ellipsiprymnus\u003c/b\u003e\u003cb\u003e)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1(9.09)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e1(25)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e2(4.34)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e\u003cem\u003eV\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e\u003cem\u003eC\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e\u003cem\u003eC\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eTotal\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e31 (67.39)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e11(23.91)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e4(8.69)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e46\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colspan=\"4\" nameend=\"c5\" namest=\"c2\"\u003e \u003cp\u003e\u003cb\u003eTotal % infection rate of trypanosomes\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e14(29.78)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e35(74.46)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c8\"\u003e \u003cp\u003e32(68.05)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e \u003cb\u003eNotes\u003c/b\u003e: \u003cem\u003eG.m.s: Glossina morsitans submorsitans\u003c/em\u003e; \u003cem\u003eG. p.p: Glossina palpalis palpalis; G.t: Glossina tachinoides; V: Trypanosoma vivax; G: Trypanosoma grayi; T: Trypanosoma theleri; E: Trypanosoma evansi; B: Trypanosoma brucei species; C: Trypanosoma congolense.\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe total infection rate of 14(29.78%), 35(74.46%) and 32(68.05%) was observed in the proboscis, salivary gland and gut respectively. Overall infection rate of trypanosome species at both locations are; \u003cem\u003eT. vivax\u003c/em\u003e (20.6%), \u003cem\u003eT. grayi\u003c/em\u003e (37.1%), \u003cem\u003eT. theleri\u003c/em\u003e (29.8%), \u003cem\u003eT. grayi\u003c/em\u003e (3.1%) and \u003cem\u003eT. congolense\u003c/em\u003e (9.2%). Trypanosome Infection rate of 23.3%, 80%, and 76.6% was detected in the proboscis, salivary gland and gut respectively at Ijah Gbagyi, while 40%, 66.6% and 93% infection rate was detected in the proboscis, salivary gland and gut at Yankari Games Resort (Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eDependency of trypanosome species on host fed on revealed that there is no significant relationship (p\u0026thinsp;=\u0026thinsp;0.165) between trypanosoma species and host fed on, which indicate no relationship (χ2\u0026thinsp;=\u0026thinsp;57.28, P\u0026thinsp;\u0026gt;\u0026thinsp;0.05) at Ijah Gbagyi. Yankari Games Resort revealed a significant difference (p\u0026thinsp;=\u0026thinsp;0.000) between host and trypanosoma species (χ2\u0026thinsp;=\u0026thinsp;59.30, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003e)\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAlthough several studies have been undertaken in the Northern part of Nigeria in general and at Ijah Gbagyi and Yankari Games Resort areas in particular to generate data on tsetse fly fauna as well as trypanosome infections in humans and animals [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], the trophic preference of tsetse flies remains unknown in these tsetse-infested areas. This study was designed to fill this gap by identifying the feeding behaviour of tsetse flies and the trypanosomes that infect them, with the main aim of improving epidemiological knowledge of tsetse and trypanosome behaviour in these regions.\u003c/p\u003e \u003cp\u003eDetermination of the blood meal in tsetse flies using \u003cem\u003eCyt b\u003c/em\u003e amplification primers revealed that the amplicons of some of the PCR product sequences obtained were of insect and not vertebrate origin. This could mean that the \u003cem\u003eCyt b\u003c/em\u003e primer anchored better to insect DNA and not only to vertebrate DNA, specific primers suitable for detection of vertebrate DNA only will have to be designed. Rat and cattle obtained sequence could not be deposited to NCBI due to short length of the nucleotide sequence, while that of Chimpanzee was not the target gene sequence, but they were however included to get an overview of the feeding preference of tsetse in the research locations. We found no evidence of feeding on multiple host species in any of the analyzed tsetse, which is detectable by DNA sequence analysis [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. This could suggest that tsetse frequently feed on a single host, or that in a mixture of more than one blood meal source where one blood meal is predominant, the PCR primer used masked the minor DNA while the more abundant host DNA was selected and preferentially amplified, or for the samples that were not detected, the host DNA was not in sufficient quantity to be amplified.\u003c/p\u003e \u003cp\u003eThe Ijah Gbagyi area has riparian forest vegetation, with some agricultural activities in this environment, due to the type of vegetation in this area and the presence of a clean river that attracts livestock keepers, farmers and animals to visit the river. The results of the report suggest that human settlements generally disturb the habitat of tsetse flies, but the \u003cem\u003epalpalis\u003c/em\u003e group appears to be less affected than other groups due to its ability to adapt to peri-urban conditions. Therefore, \u003cem\u003eG. p. palpalis\u003c/em\u003e finds this environment very vital for its survival. Due to the presence of a wild range of mammalian hosts that frequent the water source, including the presence of some wild animals, seven host species were identified as having been fed upon by \u003cem\u003eG. p. palpalis\u003c/em\u003e species. The dominant host with the highest \u003cem\u003eCyt b\u003c/em\u003e detection was 23 humans (Homo sapiens), followed by 2 cattle (\u003cem\u003eBos indicus)\u003c/em\u003e, while a bird (\u003cem\u003eCoracias garrulus\u003c/em\u003e), a squirrel (\u003cem\u003eXerus erythropus\u003c/em\u003e), a chimpanzee (\u003cem\u003ePan paniscus)\u003c/em\u003e, a bushpig (\u003cem\u003eTragelaphus scriptus\u003c/em\u003e), and a monitor lizard (\u003cem\u003eVaranus niloticus\u003c/em\u003e) made up the remaining vertebrate species.\u003c/p\u003e \u003cp\u003eThese results suggest that \u003cem\u003eG. p. palpalis\u003c/em\u003e feeds more on humans, which collaborates with the results of [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] who previously reported that \u003cem\u003eG. palpalis\u003c/em\u003e feeds on humans and Farikou et al. [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] also reported that tsetse flies feed more on humans with results finding in two sleeping sickness outbreaks in Southern Cameroon. Karshima et al. [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] and Torr et al. [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] reported the preference of tsetse flies for cattle due to their large size, of all vertebrate hosts identified for feeding by G. p. palpalis, cattle are the second most frequent blood meal, this result may be attributed to their large size [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan additionalcitationids=\"CR38\" citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHost selection has also been attributed to host availability and is not necessarily based on a true preference, tsetse are opportunistic feeders and are able to adopt new hosts in the absence of their usual preferred host, the influence of host availability on tsetse feeding habits [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] has also been documented, which probably explains why \u003cem\u003eG. p. palpalis\u003c/em\u003e is an opportunistic feeder, having fed on humans, birds, cattle, squirrels, chimpanzees, bush pigs and lizard, suggesting that this tsetse species has a wide range of host selection patterns [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe Yankari Games Resort is a national park with abundant wildlife species, which allows tsetse to have a diversity of mammalian hosts for their blood meal. Six different species of mammalian hosts were identified as sources of blood meal for \u003cem\u003eG. m. submorsitans\u003c/em\u003e, namely: 3 humans (\u003cem\u003eHomo sapiens\u003c/em\u003e), 2 bushbucks (\u003cem\u003eTragelaphus scriptus\u003c/em\u003e), 3 rats (\u003cem\u003eRattus argentiventer, norvegicu\u003c/em\u003e and \u003cem\u003ePraomys lukolelae\u003c/em\u003e), 1 buffalo (\u003cem\u003eSyncerus caffer\u003c/em\u003e), 1 gazelle (\u003cem\u003eNanger soemmerringii\u003c/em\u003e) and 1 waterbuck (\u003cem\u003eKobus ellipsiprymnu\u003c/em\u003es), respectively. While four different vertebrate hosts were identified for \u003cem\u003eG. tachinoides\u003c/em\u003e species, namely: 1 buffalo (\u003cem\u003eSyncerus caffer\u003c/em\u003e), 1 warthog (\u003cem\u003ePhacochoerus africanus\u003c/em\u003e), 1 horse antelope (\u003cem\u003eHippotragus equinus\u003c/em\u003e) and 1 waterbuck (\u003cem\u003eKobus ellipsiprymnus\u003c/em\u003e) respectively.\u003c/p\u003e \u003cp\u003eCattle were not identified at the Yankari Games Resort, which may be due to the government's cattle grazing ban law, preventing herders from grazing their cattle in the national park. Surprisingly, the presence of the guinea pig (\u003cem\u003eKobus ellipsiprymnus)\u003c/em\u003e in the blood meal of \u003cem\u003eG. m. submorsitans\u003c/em\u003e and \u003cem\u003eG. tachinoides\u003c/em\u003e was noted, although it has been shown that \u003cem\u003eGlossina\u003c/em\u003e species do not feed on guinea pigs and zebra because of their foul odour to tsetse flies [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], suggesting that tsetse flies probably feed on them because of their availability and not because they are their preferred host. The African buffalo is also a preferred host for tsetse flies due to its large size and availability; \u003cem\u003eG. m. submorsitans\u003c/em\u003e and \u003cem\u003eG. tachinoides\u003c/em\u003e have been known to feed on it, which also confirms these results. Interestingly, the African buffalo has been documented as a key reservoir of animal trypanosomiasis, the presence of vertebrate blood meals in flies with trypanosome DNA indicates that wildlife are important in the transmission of AAT in this study areas. No trypanosomes associated with human disease were identified in either research area, but the high proportion of flies feeding on both humans and wildlife raises the risk of contact and transmission of AAT and HAT in both ecologies [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eKnowing the preferred hosts for the blood meal may provide a more targeted approach to finding olfactory clues to improve the effectiveness of tsetse traps, which remains an active area of study that will be very useful in the control and elimination of trypanosomiasis. Although more data are needed to draw a general conclusion on the feeding patterns and preferences of tsetse flies in the two locations, our results suggest that the influx of people to Ijah Gbagyi for settlement and agriculture and to Yankari Games Resort for tourism may explain in part why humans were the most important sources of blood meals. Therefore, the fact that we observed humans, cattle, rats and bushbucks feeding from tsetse blood meal could mean that there are chemicals in the bodies of these vertebrates that can help advance the search for new host-derived cues to control tsetse flies. This knowledge is also useful for existing knowledge of host attractants such as those described in zebra and waterbuck against \u003cem\u003eGlossina\u003c/em\u003e spp [\u003cspan additionalcitationids=\"CR41\" citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e], to improve bait technology for tsetse flies, such as the use of odorants with a repellent effect that keeps arthropods away from the source, thus protecting animals from their bites and possible disease transmission, or the use of odorants that attract arthropods to an insecticide-treated target, thereby killing them and preventing contact between the fly and the host [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e \u003cem\u003eG. p. palpalis\u003c/em\u003e was the only tsetse species sampled in the Ijah Gbagyi area, while \u003cem\u003eG. tachinoides\u003c/em\u003e and \u003cem\u003eG. m. submorsitans\u003c/em\u003e were the only two species identified at the Yankari Game Resort, a result consistent with previous studies in which these tsetse species were predominant in both locations [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In these areas, the approach to tsetse control has been to reduce and eliminate tsetse, by deploying scent-baited traps and insecticide-impregnated targets to control tsetse in both locations by the Pan African Campaign for Tsetse and Trypanosomiasis Eradication (PATTEC) and the Nigerian Institute of Trypanosomiasis Research (NITR), but this approach did not work as expected.\u003c/p\u003e \u003cp\u003eThe physiological status of the tsetse population sampled indicated that 139 (63.18%) out of 220 tsetse flies were hungry and since hungry flies feed more often, they have greater chances of becoming infected. Extreme starvation in tsetse flies have been reported to lower the developmental barrier for a trypanosome infection and thus enhancing their ability to acquire trypanosome infection [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThese tsetse species are vectors of both human and animal trypanosomiasis [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] and their widespread presence represents a persistent risk of HAT and AAT in these areas. In both locations, the presence of animal trypanosomes has been documented and has also been confirmed in this research work. We identified the presence of \u003cem\u003eT. grayi\u003c/em\u003e and \u003cem\u003eT. vivax\u003c/em\u003e in the proboscis. \u003cem\u003eT. brucei spp, T. congolense, T. grayi, T. vivax\u003c/em\u003e and \u003cem\u003eT. theleri i\u003c/em\u003en the salivary gland, while \u003cem\u003eT. brucei spp, T. congolense, T. grayi, T. vivax\u003c/em\u003e and \u003cem\u003eT. theleri\u003c/em\u003e were observed in the gut at Ijah Gbagyi area. Similarly, \u003cem\u003eT. vivax\u003c/em\u003e and \u003cem\u003eT. theler\u003c/em\u003ei were identified in the proboscis, \u003cem\u003eT. congolense, T. grayi, T. vivax\u003c/em\u003e and \u003cem\u003eT. theleri\u003c/em\u003e in the salivary gland, while \u003cem\u003eT. brucei spp\u003c/em\u003e, \u003cem\u003eT. congolense\u003c/em\u003e, \u003cem\u003eT. grayi, T. vivax\u003c/em\u003e and \u003cem\u003eT. theleri\u003c/em\u003e were identified in the gut of all tsetse flies that have had a blood meal at the Yankari Games Resort.\u003c/p\u003e \u003cp\u003eInfection with trypanosomes was highest in the gut, followed by the salivary glands, and the lowest infection status was found in the proboscis in both locations, this result corroborates that of [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] who reported a low infection status in the proboscis [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. The high infection in the gut could be the result of remaining blood meals with trypanosome infections in the midgut of tsetse flies or the presence of mature and immature infections. Trypanosome life cycles differ between species, so after a blood meal on an infected host, the spread of trypanosomes in the fly's organs helps determine the trypanosome species [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Detection of \u003cem\u003eT. vivax\u003c/em\u003e in the proboscis indicates the presence of an ongoing infection, which can therefore be transmitted to its feeding host during a blood meal. Detection of \u003cem\u003eT. vivax\u003c/em\u003e in the salivary glands and intestine could be due to the presence of an undigested blood meal that fed on an infected host. These explanations are also valid for the presence of \u003cem\u003eT. congolense\u003c/em\u003e in the salivary gland, since this parasite is only found in the gut and proboscis, or it could be an indication of a recent infection in which these parasites migrate to the proboscis to complete their development cycle. The presence of \u003cem\u003eT. vivax\u003c/em\u003e and other trypanosome species indicates active transmission of trypanosome infection to humans and animals. The presence of \u003cem\u003eT. grayi\u003c/em\u003e and \u003cem\u003eT. theleri\u003c/em\u003e in proboscis samples could also indicate ongoing infection, as the life cycle of the parasite is expected to be limited to the midgut and hindgut \u003cb\u003e[12, 45, 46].\u003c/b\u003e\u003c/p\u003e \u003cp\u003eDNA sequence matching with databases has been used for species identification, but a good result depends on the quality of the DNA and sequence representation in the database. A larger scale study is needed to include more hosts using methods such as PCR-RFLP, which will make sequencing unnecessary [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThis study revealed that the feeding preference of tsetse are humans, most of the tsetse that fed on a vertebrate host are likely the source of the species of trypanosomes detected, therefore the risk of transmitting tsetse borne infections between humans and other vertebrate hosts in this region is very high.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe authors sincerely appreciate the Africa Centre of Excellence for Neglected Tropical Diseases and Forensic Biotechnology (ACE-NTDFB) Ahmadu Bello University for sponsoring training workshops on collection and dissection of tsetse flies. Also we thank all the staff in the Laboratory for Bio Molecular Interaction Bremen, the University of Bremen, Germany for their technical assistance and discussions provided during the laboratory work. We also thank the Nigerian Institute of Trypanosomiasis Research in Kaduna Nigeria for their support during the fly collection process for provision of equipment and access to the park. Our thanks also go to the Department of Zoology Ahmadu Bello University for administrative and technical support during the collection and analysis of this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGAA, SK, ISN, GDC and DS contributed to the design of the Project. GAA, DS, GDC, MAMI, ACMT, SK and PB contributed in sample collection and laboratory analysis. YMM, GAA and DS analyzed the data. GAA, DS, ISN, MNS, ACMT and wrote the Manuscript. All authors read and approved the final manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was funded by Erasmus Mobility Fund and the Africa Centre of Excellence for Neglected Tropical Disease and Forensic Biotechnology ABU, funded by World Bank group (ACE-NTDFB). The funder had no role in data collection, decision to publish, or preparation of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability and materials\u003c/strong\u003e:\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe datasets generated and analysed during this study are included in this publication. The \u003cem\u003ecyst b\u003c/em\u003e and COI partial gene sequences generated have been deposited into GenBank under accession numbers OQ851474 to OQ851476 and OQ858943 to OQ858954.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eApproval to set traps and collect tsetse flies was obtained from the local and national authorities according to current legislation in Nigeria.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eNot applicable.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;The authors declare no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eDesquesnes M, Dia ML. Mechanical transmission of Trypanosoma vivax in cattle by the African tabanid Atylotus fuscipes. Vet Parasitol [Internet]. 2004 Jan 5 [cited 2022 Nov 26];119(1):9\u0026ndash;19. Available from: https://www.sciencedirect.com/science/article/pii/S0304401703004588 \u003c/li\u003e\n\u003cli\u003eOdeniran PO, Ademola IO. A meta-analysis of the prevalence of African animal trypanosomiasis in Nigeria from 1960 to 2017. Parasit Vectors [Internet]. 2018 May 2 [cited 2022 Nov 9];11(1):280. Available from: https://doi.org/10.1186/s13071-018-2801-0 \u003c/li\u003e\n\u003cli\u003eWorld Health Organization. Report of the third WHO stakeholders meeting on rhodesiense human African trypanosomiasis: Geneva, Switzerland, 10-11 April 2019 [Internet]. Geneva: World Health Organization; 2020 [cited 2022 Nov 9]. Available from: https://apps.who.int/iris/handle/10665/336659 \u003c/li\u003e\n\u003cli\u003eDede PM, Halid H, Omoogun GA, Uzoigwe NR, Njoku CI, Daniel AD, et al. Current Tsetse and Trypanosomosis Situation on Jos Plateau, Nigeria. Epizootiological Factors that May Enhance Disease Transmission and Spread. Rev D\u0026rsquo;Elevage M\u0026eacute;decine V\u0026eacute;t Pays Trop [Internet]. 2005 Jan 1 [cited 2022 Nov 26];(Volume 1-2). Available from: https://paperity.org/p/236252492/current-tsetse-and-trypanosomosis-situation-on-jos-plateau-nigeria-epizootiological \u003c/li\u003e\n\u003cli\u003eOdeniran PO, Ademola IO, Jegede HO. A review of wildlife tourism and meta-analysis of parasitism in Africa\u0026rsquo;s national parks and game reserves. Parasitol Res [Internet]. 2018 Aug 1 [cited 2022 Nov 9];117(8):2359\u0026ndash;78. Available from: https://doi.org/10.1007/s00436-018-5958-8 \u003c/li\u003e\n\u003cli\u003eYaro M, Munyard KA, Stear MJ, Groth DM. Combatting African Animal Trypanosomiasis (AAT) in livestock: The potential role of trypanotolerance. Vet Parasitol [Internet]. 2016 Jul 30 [cited 2022 Nov 25];225:43\u0026ndash;52. Available from: https://www.sciencedirect.com/science/article/pii/S0304401716301571 \u003c/li\u003e\n\u003cli\u003eCecchi G, Paone M, Argil\u0026eacute;s Herrero R, Vreysen MJB, Mattioli RC. Developing a continental atlas of the distribution and trypanosomal infection of tsetse flies (Glossina species). Parasit Vectors. 2015 May 22;8:284. \u003c/li\u003e\n\u003cli\u003eDavies (M.B.E.) H. Tsetse Flies in Nigeria: A Handbook for Junior Control Staff. Oxford University Press; 1977. 390 p. \u003c/li\u003e\n\u003cli\u003eJeremiah C, Katsayal UA, Nuhu A, Bola Anafi S, Adeojoh Ibrahim M, Dijie Nuhu H. Phytochemical Screening and Anti-Inflammatory Studies of Tapinanthus globiferus (A. Rich) Teigh. Leaves Three Extracts. Pharm Sci [Internet]. 2019 Jun 30 [cited 2022 Dec 30];25(2):124\u0026ndash;31. Available from: https://ps.tbzmed.ac.ir/Abstract/PHARM_20949_20180729214501 \u003c/li\u003e\n\u003cli\u003eBarrett MP. The elimination of human African trypanosomiasis is in sight: Report from the third WHO stakeholders meeting on elimination of gambiense human African trypanosomiasis. PLoS Negl Trop Dis [Internet]. 2018 Dec 6 [cited 2022 Nov 25];12(12):e0006925. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6283460/ \u003c/li\u003e\n\u003cli\u003eAhmed AB. A stake-holder based approach to tsetse fly control in central Nigeria. J Agric Ext Rural Dev [Internet]. 2010 Jan 1 [cited 2022 Nov 9]; Available from: https://www.academia.edu/24914797/A_stake_holder_based_approach_to_tsetse_fly_control_in_central_Nigeria \u003c/li\u003e\n\u003cli\u003eWeber JS, Ngomtcho SCH, Shaida SS, Chechet GD, Gbem TT, Nok JA, et al. Genetic diversity of trypanosome species in tsetse flies (Glossina spp.) in Nigeria. Parasit Vectors [Internet]. 2019 Dec [cited 2021 Jan 8];12(1):481. Available from: https://parasitesandvectors.biomedcentral.com/articles/10.1186/s13071-019-3718-y \u003c/li\u003e\n\u003cli\u003eGooding RH. Genetic variation in tsetse flies and implications for trypanosomiasis. Parasitol Today [Internet]. 1992 Mar 1 [cited 2022 Nov 26];8(3):92\u0026ndash;5. Available from: https://www.sciencedirect.com/science/article/pii/016947589290246X \u003c/li\u003e\n\u003cli\u003ePollock JN. Training Manual for Tsetse Control Personnel: Tsetse biology, systematics and distribution; techniques. FAO; 1982. 280 p. \u003c/li\u003e\n\u003cli\u003eShaida SS, Weber JS, Gbem TT, Ngomtcho SCH, Musa UB, Achukwi MD, et al. Diversity and phylogenetic relationships of Glossina populations in Nigeria and the Cameroonian border region. BMC Microbiol [Internet]. 2018 Nov [cited 2022 Nov 9];18(S1):180. Available from: https://bmcmicrobiol.biomedcentral.com/articles/10.1186/s12866-018-1293-6 \u003c/li\u003e\n\u003cli\u003eLeak SGA. Tsetse Biology and Ecology: Their Role in the Epidemiology and Control of Trypanosomosis. ILRI (aka ILCA and ILRAD); 1999. 598 p. \u003c/li\u003e\n\u003cli\u003eService MW. Introduction to the order Diptera \u0026mdash; mosquitoes, horseflies, houseflies, tsetse flies etc. In: Service MW, editor. A Guide to Medical Entomology [Internet]. London: Macmillan Education UK; 1980 [cited 2022 Nov 27]. p. 20\u0026ndash;1. Available from: https://doi.org/10.1007/978-1-349-16334-2_3 \u003c/li\u003e\n\u003cli\u003eKasozi KI, Zirintunda G, Ssempijja F, Buyinza B, Alzahrani KJ, Matama K, et al. Epidemiology of Trypanosomiasis in Wildlife\u0026mdash;Implications for Humans at the Wildlife Interface in Africa. Front Vet Sci [Internet]. 2021 [cited 2022 Nov 3];8. Available from: https://www.frontiersin.org/articles/10.3389/fvets.2021.621699 \u003c/li\u003e\n\u003cli\u003eOmonona A, Abioye S, Odeniran P, Ademola I. Distribution of tsetse flies and its Trypanosoma species infection in Old Oyo National Park, Nigeria. Zoologist (The). 2020 Dec 18;18:33\u0026ndash;8. \u003c/li\u003e\n\u003cli\u003eSquarre D, Hayashida K, Gaithuma A, Chambaro H, Kawai N, Moonga L, et al. Diversity of trypanosomes in wildlife of the Kafue ecosystem, Zambia. Int J Parasitol Parasites Wildl [Internet]. 2020 Apr 23 [cited 2022 Nov 3];12:34\u0026ndash;41. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7215119/ \u003c/li\u003e\n\u003cli\u003eAuty H, Anderson NE, Picozzi K, Lembo T, Mubanga J, Hoare R, et al. Trypanosome Diversity in Wildlife Species from the Serengeti and Luangwa Valley Ecosystems. Ndung\u0026rsquo;u JM, editor. PLoS Negl Trop Dis [Internet]. 2012 Oct 18 [cited 2022 Nov 25];6(10):e1828. Available from: https://dx.plos.org/10.1371/journal.pntd.0001828 \u003c/li\u003e\n\u003cli\u003eDiall O, Cecchi G, Wanda G, Argil\u0026eacute;s-Herrero R, Vreysen MJB, Cattoli G, et al. Developing a Progressive Control Pathway for African Animal Trypanosomosis. Trends Parasitol [Internet]. 2017 Jul 1 [cited 2022 Nov 25];33(7):499\u0026ndash;509. Available from: https://www.sciencedirect.com/science/article/pii/S1471492217300636 \u003c/li\u003e\n\u003cli\u003eKarshima SN, Lawal IA, Okubanjo OO. Feeding Patterns and Xenomonitoring of Trypanosomes among Tsetse Flies around the Gashaka-Gumti National Park in Nigeria. J Parasitol Res [Internet]. 2016 [cited 2022 Nov 27];2016:1\u0026ndash;6. Available from: http://www.hindawi.com/journals/jpr/2016/1591037/ \u003c/li\u003e\n\u003cli\u003eIsaac C, Ciosi M, Hamilton A, Scullion KM, Dede P, Igbinosa IB, et al. Molecular identification of different trypanosome species and subspecies in tsetse flies of northern Nigeria. Parasit Vectors [Internet]. 2016 May 23 [cited 2022 Nov 9];9(1):301. Available from: https://doi.org/10.1186/s13071-016-1585-3 \u003c/li\u003e\n\u003cli\u003eJonah A, Attahir A, Idowu FM, Usman BM, Tese TT, Rukayya G, et al. Molecular Identification Of Trypanosomes In Wild Tsetse Flies Captured From Kainji Lake National Park, Nigeria. Fudma J Sci [Internet]. 2020 Apr 18 [cited 2022 Nov 3];4(1):706\u0026ndash;10. Available from: https://www.fjsadmin.fudutsinma.edu.ng/index.php/fjs/article/view/93 \u003c/li\u003e\n\u003cli\u003eAlibu V, John, Enyaru CK, Matovu E, Malele I, Chisi J, et al. Molecular xenomonitoring of trypanosomes in tsetse flies. undefined [Internet]. 2015 [cited 2022 Nov 27]; Available from: https://www.semanticscholar.org/paper/Feeding-Patterns-and-Xenomonitoring-of-Trypanosomes-Karshima-Lawal/fee87f639d2c4e3cadcbac190edff1cfbbbf4c2f \u003c/li\u003e\n\u003cli\u003eAbubakar A, Abdullahi RA, Ayakpat HN, Garba J, Muhammad H. Population Dynamics of Tsetse flies at Salt Lick B and Guruntun Areas of Yankari National Park Bauchi State Nigeria. Curr Res J Biol Sci [Internet]. 2016 [cited 2022 Nov 25];8(2):15\u0026ndash;7. Available from: https://www.maxwellsci.com/jp/mspabstract.php?doi=crjbs.8.2690 \u003c/li\u003e\n\u003cli\u003eGeiger A, Malele I, Abd-Alla AM, Njiokou F. Blood feeding tsetse flies as hosts and vectors of mammals-pre-adapted African Trypanosoma: current and expected research directions. BMC Microbiol [Internet]. 2018 Nov 23 [cited 2022 Nov 26];18(Suppl 1):162. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6251083/ \u003c/li\u003e\n\u003cli\u003eChallier A, Laveissiere C. Un nouveau pi\u0026egrave;ge pour la capture des glossines (Glossina: Diptera, Muscidae): description et eassais sur le terrain. Ent m\u0026eacute;d et Parasitol. \u003cstrong\u003e1973\u003c/strong\u003e; 11:251\u0026ndash;62. Accessed: Nov. 28, 2022. [Online]. Available: https://typeset.io/papers/un-nouveau-piege-pour-la-capture-des-glossines-p-ossina-da-1gd4z6gwwi \u003c/li\u003e\n\u003cli\u003eNgomtcho SCH, Weber JS, Ngo Bum E, Gbem TT, Kelm S, Achukwi MD. Molecular screening of tsetse flies and cattle reveal different Trypanosoma species including T. grayi and T. theileri in northern Cameroon. Parasit Vectors [Internet]. 2017 Dec [cited 2020 Aug 21];10(1):631. Available from: https://parasitesandvectors.biomedcentral.com/articles/10.1186/s13071-017-2540-7 \u003c/li\u003e\n\u003cli\u003eSignaboubo D, Payne VK, Moussa IMA, Hassane HM, Berger P, Kelm S, et al. Diversity of tsetse flies and trypanosome species circulating in the area of Lake Iro in southeastern Chad. Parasit Vectors [Internet]. 2021 [cited 2022 Nov 28];14(1):undefined-undefined. Available from: https://www.mendeley.com/catalogue/5b6e64c2-da16-3b1c-9475-eb6bf87b034e/ \u003c/li\u003e\n\u003cli\u003eMuturi CN, Ouma JO, Malele II, Ngure RM, Rutto JJ, Mith\u0026ouml;fer KM, et al. Tracking the Feeding Patterns of Tsetse Flies (Glossina Genus) by Analysis of Bloodmeals Using Mitochondrial Cytochromes Genes. Hansen I, editor. PLoS ONE [Internet]. 2011 Feb 28 [cited 2022 Nov 9];6(2):e17284. Available from: https://dx.plos.org/10.1371/journal.pone.0017284 \u003c/li\u003e\n\u003cli\u003eOmondi D, Masiga DK, Ajamma YU, Fielding BC, Njoroge L, Villinger J. Unraveling Host-Vector-Arbovirus Interactions by Two-Gene High Resolution Melting Mosquito Bloodmeal Analysis in a Kenyan Wildlife-Livestock Interface. PLOS ONE [Internet]. 2015 Jul 31 [cited 2022 Nov 27];10(7):e0134375. Available from: https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0134375 \u003c/li\u003e\n\u003cli\u003eAdams ER, Malele II, Msangi AR, Gibson WC. Trypanosome identification in wild tsetse populations in Tanzania using generic primers to amplify the ribosomal RNA ITS-1 region. Acta Trop [Internet]. 2006 Nov [cited 2022 Nov 9];100(1\u0026ndash;2):103\u0026ndash;9. Available from: https://linkinghub.elsevier.com/retrieve/pii/S0001706X06001902 \u003c/li\u003e\n\u003cli\u003eSimo G, Rayaisse JB. Challenges facing the elimination of sleeping sickness in west and central Africa: sustainable control of animal trypanosomiasis as an indispensable approach to achieve the goal. Parasit Vectors [Internet]. 2015 Dec 16 [cited 2022 Nov 26];8:640. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4681034/ \u003c/li\u003e\n\u003cli\u003eSimo G, Njiokou F, Mbida Mbida JA, Njitchouang GR, Herder S, Asonganyi T, et al. Tsetse fly host preference from sleeping sickness foci in Cameroon: Epidemiological implications. Infect Genet Evol [Internet]. 2008 Jan 1 [cited 2022 Nov 27];8(1):34\u0026ndash;9. Available from: https://www.sciencedirect.com/science/article/pii/S1567134807001372 \u003c/li\u003e\n\u003cli\u003eFarikou O, Njiokou F, Simo G, Asonganyi T, Cuny G, Geiger A. Tsetse fly blood meal modification and trypanosome identification in two sleeping sickness foci in the forest of southern Cameroon. Acta Trop [Internet]. 2010 Oct [cited 2020 Aug 21];116(1):81\u0026ndash;8. Available from: https://linkinghub.elsevier.com/retrieve/pii/S0001706X10001750 \u003c/li\u003e\n\u003cli\u003eTorr SJ, Prior A, Wilson PJ, Schofield S. Is there safety in numbers? The effect of cattle herding on biting risk from tsetse flies. Med Vet Entomol [Internet]. 2007 [cited 2022 Nov 26];21(4):301\u0026ndash;11. Available from: https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1365-2915.2007.00705.x \u003c/li\u003e\n\u003cli\u003eOlaide OY, Tchouassi DP, Yusuf AA, Pirk CWW, Masiga DK, Saini RK, et al. Zebra skin odor repels the savannah tsetse fly, Glossina pallidipes (Diptera: Glossinidae). PLoS Negl Trop Dis [Internet]. 2019 Jun 10 [cited 2022 Nov 25];13(6):e0007460. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6586361/ \u003c/li\u003e\n\u003cli\u003eSaini RK, Orindi BO, Mbahin N, Andoke JA, Muasa PN, Mbuvi DM, et al. Protecting cows in small holder farms in East Africa from tsetse flies by mimicking the odor profile of a non-host bovid. PLoS Negl Trop Dis [Internet]. 2017 Oct 17 [cited 2022 Nov 25];11(10):e0005977. Available from: https://journals.plos.org/plosntds/article?id=10.1371/journal.pntd.0005977 \u003c/li\u003e\n\u003cli\u003eMakhulu EE, Villinger J, Adunga VO, Jeneby MM, Kimathi EM, Mararo E, et al. Tsetse blood-meal sources, endosymbionts and trypanosome-associations in the Maasai Mara National Reserve, a wildlife-human-livestock interface. PLoS Negl Trop Dis [Internet]. 2021 Jan 6 [cited 2022 Nov 25];15(1):e0008267. Available from: https://journals.plos.org/plosntds/article?id=10.1371/journal.pntd.0008267 \u003c/li\u003e\n\u003cli\u003eNyingilili H, Malele I, Nkwengulila G. Diversity of Blood Meal Hosts in Glossina Pallidipes and Its Role in the Epidemiology of Trypanosomiasis at a Localized Area in Serengeti National Park. 2016 Jan 1;2. \u003c/li\u003e\n\u003cli\u003eLehane M, Alfaroukh I, Bucheton B, Camara M, Harris A, Kaba D, et al. Tsetse Control and the Elimination of Gambian Sleeping Sickness. PLoS Negl Trop Dis [Internet]. 2016 Apr 29 [cited 2022 Nov 26];10(4):e0004437. Available from: https://journals.plos.org/plosntds/article?id=10.1371/journal.pntd.0004437 \u003c/li\u003e\n\u003cli\u003eRay Wilson\u0026rsquo;s Bird \u0026amp; Wildlife Photography: Arthropod Vectors of Human Diseases Tsetse Flies (Glossina morsitans \u0026amp; Glossina palpalis) [Internet]. [cited 2022 Nov 27]. Available from: http://www.raywilsonbirdphotography.co.uk/00001%20New%20website/Galleries/Invertebrates/vectors/Tsetse_Fly.html \u003c/li\u003e\n\u003cli\u003eHoare CA. Studies on Trypanosoma grayi. III. Life-Cycle in the Tsetse-fly and in the Crocodile. Parasitology [Internet]. 1931 Oct [cited 2022 Nov 25];23(4):449\u0026ndash;84. Available from: https://www.cambridge.org/core/journals/parasitology/article/abs/studies-on-trypanosoma-grayi-iii-lifecycle-in-the-tsetsefly-and-in-the-crocodile/68A145AA700355165C8FF006C92D4F9A\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Glossina, blood meal, trypanosomes, Wild animals, Nigeria","lastPublishedDoi":"10.21203/rs.3.rs-3097302/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3097302/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eTrypanosomiasis is a vector-borne protozoan disease that is widespread in sub-Saharan Africa. In Nigeria, efforts to control trypanosomiasis include vector control, diagnosis, and treatment of the infection. These efforts exclude actions targeting reservoir hosts. This study was therefore undertaken to address these epidemiological and surveillance gaps.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eFor this purpose, \u003cem\u003eGlossina\u003c/em\u003e species were trapped at Ijah Gbagyi and Yankari Games Resort. The hunger stage of the 220 dissected flies was categorised, blood meal was determined by COI and \u003cem\u003eCyt b\u003c/em\u003e gene tests. Trypanosomes were identified from samples taken from \u003cem\u003eGlossina\u003c/em\u003e species flies. Trypanosomes were identified from the proboscis, salivary glands and midgut of tsetse flies from which the blood meal was obtained by amplifying the ITS1 rDNA gene.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eThe results indicate a hunger stage of 2.72%, 34.09%, 63.18% for engorged, intermediate and starved flies respectively. The dominant host of \u003cem\u003eGlossina palpalis palpalis\u003c/em\u003e was man, cattle, bird, squirrel, chimpanzee, bush pig and monitor lizard. \u003cem\u003eGlossina morsitans submorsitans\u003c/em\u003e (man, bush pig, rat, buffalo, gazelle and guinea pig) and \u003cem\u003eGlossina tachinoides\u003c/em\u003e (buffalo, warthog, antelope and guinea pig). Overall infection rates of \u003cem\u003eTrypanosoma vivax\u003c/em\u003e (20.6%), \u003cem\u003eTrypanosoma grayi\u003c/em\u003e (37.1%), \u003cem\u003eTrypanosoma theleri\u003c/em\u003e (29.8%), \u003cem\u003eTrypanosoma brucei\u003c/em\u003e spp. (3.1%) and \u003cem\u003eTrypanosoma congolense\u003c/em\u003e (9.2%) were recorded.\u003c/p\u003e\u003ch2\u003eConclusion\u003c/h2\u003e \u003cp\u003eThese results suggest that wild animals acting as reservoir hosts are the source of the Trypanosoma species transmitted by \u003cem\u003eGlossina\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Molecular Detection of Trypanosomes and Xenomonitoring of Host Range from the Feeding Patterns of Glossina Species Collected from Northern Guinea Savannah of Nigeria","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2023-07-10 16:49:22","doi":"10.21203/rs.3.rs-3097302/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f2f37cf4-900d-4fa9-96ee-ecd4e1a8f01e","owner":[],"postedDate":"July 10th, 2023","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-03-15T12:05:06+00:00","versionOfRecord":[],"versionCreatedAt":"2023-07-10 16:49:22","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3097302","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3097302","identity":"rs-3097302","version":["v1"]},"buildId":"ApUGefWb6u5IBVtyqm6d5","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}