Novel neurofilament light (Nefl) E397K mouse models of Charcot-Marie-Tooth type 2E (CMT2E) present early and chronic axonal neuropathy

Novel neurofilament light (Nefl) E397K mouse models of Charcot-Marie-Tooth type 2E (CMT2E) present early and chronic axonal neuropathy | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Novel neurofilament light ( Nefl ) E397K mouse models of Charcot-Marie-Tooth type 2E (CMT2E) present early and chronic axonal neuropathy Dennis O. Pérez-López , Audrey A. Shively , F. Javier Llorente Torres , Mohammed T. Abu-Salah , Michael L. Garcia , W. David Arnold , Monique A. Lorson , View ORCID Profile Christian L. Lorson doi: https://doi.org/10.1101/2025.02.02.636117 Dennis O. Pérez-López 1 Department of Veterinary Pathobiology, College of Veterinary Medicine, University of Missouri , Columbia, MO 65211, USA 2 Bond Life Sciences Center, University of Missouri , Columbia, MO 65211, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Audrey A. Shively 1 Department of Veterinary Pathobiology, College of Veterinary Medicine, University of Missouri , Columbia, MO 65211, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site F. Javier Llorente Torres 1 Department of Veterinary Pathobiology, College of Veterinary Medicine, University of Missouri , Columbia, MO 65211, USA 2 Bond Life Sciences Center, University of Missouri , Columbia, MO 65211, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Mohammed T. Abu-Salah 1 Department of Veterinary Pathobiology, College of Veterinary Medicine, University of Missouri , Columbia, MO 65211, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Michael L. Garcia 5 Department of Biological Sciences, College of Arts and Science, University of Missouri , Columbia, MO 65211, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site W. David Arnold 3 Physical Medicine and Rehabilitation, School of Medicine, University of Missouri , Columbia, MO 65211, USA 4 NextGen Precision Health, University of Missouri , Columbia, MO 65212, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Monique A. Lorson 1 Department of Veterinary Pathobiology, College of Veterinary Medicine, University of Missouri , Columbia, MO 65211, USA 2 Bond Life Sciences Center, University of Missouri , Columbia, MO 65211, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: lorsonc{at}missouri.edu Christian L. Lorson 1 Department of Veterinary Pathobiology, College of Veterinary Medicine, University of Missouri , Columbia, MO 65211, USA 2 Bond Life Sciences Center, University of Missouri , Columbia, MO 65211, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Christian L. Lorson For correspondence: lorsonc{at}missouri.edu Abstract Full Text Info/History Metrics Preview PDF Abstract Charcot-Marie-Tooth (CMT) is the most common hereditary peripheral neuropathy with an incidence of 1:2,500. CMT2 clinical symptoms include distal muscle weakness and atrophy, sensory loss, toe and foot deformities, with some patients presenting with reduced nerve conduction velocity. Mutations in the neurofilament light chain ( NEFL ) gene result in a specific form of CMT2 disease, CMT2E. NEFL encodes the protein, NF-L, one of the core intermediate filament proteins that contribute to the maintenance and stability of the axonal cytoskeleton. To better understand the underlying biology of CMT2E disease and advance the development of therapeutics, we generated a Nefl +/E397K mouse model. While the Nefl +/E397K mutation is inherited in a dominant manner, we also characterized Nefl E397K/E397K mice to determine whether disease onset, progression or severity would be impacted. Consistent with CMT2E, lifespan was not altered in these novel mouse models. A longitudinal electrophysiology study demonstrated significant in vivo functional abnormalities as early as P21 in distal latency, compound muscle action potential (CMAP) amplitude and negative area. A significant reduction in the sciatic nerve axon area, diameter, and G-ratio was also present as early as P21. Evidence of axon sprouting was observed with disease progression. Through the twelve months measured, disease became more evident in all assessments. Collectively, these results demonstrate an early and robust in vivo electrophysiological phenotype and axonal pathology, making Nefl +/E397K and Nefl E397K/E397K mice ideal for the evaluation of therapeutic approaches. Introduction Charcot-Marie-Tooth (CMT) is one of the most common inherited neurological disorders with an incidence of ∼1:2,500. Clinical classification of CMT is primarily based on patient electrophysiology measurements. There are eight classifications of CMT (1-7 and CMT-X). CMT1 and CMT2 are the most prevalent forms and are associated with deficiencies in myelination or axonal dysfunction and degeneration, respectively. CMT2 is a result of mutations in many genes. CMT2 clinical symptoms are characterized as slow but progressive with a wide spectrum of distal muscle weakness and atrophy, sensory loss, decreased deep-tendon reflexes, toe, and foot deformities, gait disturbances, with some patients presenting with reduced motor nerve conduction velocity (MNCV). CMT2E is caused by mutations in the neurofilament light chain ( NEFL ) gene and is primarily inherited in an autosomal dominant manner. CMT2E disease onset and severity are variable even within families with the same mutation ( 1 – 6 ). Neurofilaments, also known as intermediate filaments, contribute to the expansion and maintenance of axonal caliber, axon structure and transport. Mutations in neurofilaments lead to axonal dysfunction, characteristic of CMT2. In peripheral nerves, neurofilament light protein (NF-L) neurofilament heavy (NF-H), neurofilament medium (NF-M) and peripherin assembly to form intermediate filaments. In the central nervous system (CNS), intermediate filaments are composed of the core proteins NF-H, NF-M, NF-L, and alpha internexin ( 3 , 7 – 11 ). There are over 30 different mutations in NEFL that are distributed throughout the three functional domains (head, rod, tail). Homozygous recessive mutations in NEFL , while rare, have been reported; however, CMT2E is primarily associated with dominant mutations. The most prevalent NEFL mutation, E396K , is located within a highly conserved motif at carboxy terminal end of the rod domain. The rod domain is involved in dimerization and mutations, such as E396K , likely disrupt neurofilament assembly ( 12 ). Mutations in NEFL result in impaired axonal assembly, accumulation of neurofilaments, atrophied axons, and perturbed localization and transport of the mitochondria ( 13 – 15 ). There are several mouse models of Nefl that are associated with patient mutations ( Nefl N98S , Nefl P8R , Nefl L394P , h NEFL E396K and h NEFL P22S ) ( 14 , 16 – 21 ). Nefl N98S and Nefl P8R models have the orthologous mutation generated within the mouse genome while the Nefl L394P mouse has mutant mouse Nefl driven by the murine sarcoma virus promoter. h NEFL E396K and h NEFL P22S models each overexpress the human E396K or P22S transgenes, respectively, with wild type mouse Nefl expression present. Each model recapitulates many phenotypes associated with CMT2E disease to varying degrees. The Nefl N98S mouse presents with the earliest disease onset and most robust axon pathology (∼6 weeks) ( 16 , 22 ). As NEFL E396K is a predominant mutation, we wanted to examine disease biology in the context of the mouse genome where the orthologous mutation ( E397K ) is present. While NEFL mutations are predominantly dominant, we examined Nefl +/E397K and Nefl E397K/397K mice to determine whether disease onset or severity were altered. Here we report our electrophysiological findings, axonal pathology and neuromuscular junction innervation status for mouse models, Nefl +/E397K and Nefl E397K/397K . These models show a clinically relevant phenotype with a chronic axonopathy characterized by electrophysiological deficits. Importantly, these mouse models provide an important context for future therapeutic development. Results Generation of the Nefl E397K mouse models of CMT2E Mutations in the NEFL gene result in CMT2E, a slow progressive disease characterized by motor function deficits and axonal pathology. To better understand disease development and mechanistic pathways, we generated a Nefl +/E397K mouse model with an orthologous mutation that corresponds to the human NEFL-E396K mutation ( Fig. 1A ). While Nefl-E397K presents as a dominant mutation, we wanted to determine whether the Nefl E397K/E397K mouse would be more severe; therefore, Nefl +/E397K and Nefl E397K/E397K mice were analyzed. Mice were genotyped using quantitative PCR. Survival was monitored over 360 days with 100% survival for the Nefl +/E397K and the Nefl E397K/E397K mice ( Fig. 1B ), consistent with CMT2E patient outcomes. Weight was measured from P1-P360; there was statistical difference between wild type (mean 27.74 grams) and Nefl +/E397K mice (mean 28.72 grams, P <0.0001) as well as wild type and Nefl E397K/E397K mice (mean 25.69 grams, P <0.0001). From ∼P240, Nefl E397K/E397K mice trended towards weighing less ( Fig. 1C ). There were no sex-based differences for weight; all male mice gained weight at higher rates than females of the same genotype (not shown). Nefl +/E397K and the Nefl E397K/E397K mice were phenotypically indistinguishable compared to their wild type littermates at early time points; however, as disease progressed there were overt signs of hindlimb weakness ( Fig. 1D and not shown). Download figure Open in new tab Figure 1. Generation of the Nefl E397K mouse models of CMT2E. (A) Cartoon depicting the neurofilament light protein (NF-L). The glutamic acid to lysine (E397K) alteration with nucleotide changes GAA to AAA were generated using CRISPR Cas9. The wild type Nefl , Nefl +/E397K and Nefl E 397K/E397K sequences generated from tail DNA isolated from wild type and Nefl mutant mice. (B) Percent survival for wild type (black), Nefl +/E397K (teal) and Nefl E397K/E397K (orange) mice recorded from P0 to P360. (C) Weight in grams for wild type (black), Nefl +/E397K (teal) and Nefl E 397K/E397K (orange) mice recorded from P0 to P360. One way ANOVA with Tukey’s multiple comparison test was used to determine significance. (D) Images of wild type and Nefl mutant mice. Top images are of female mice at P120. Bottom images are of male mice at P360. N=number of animals evaluated, g= grams, P=postnatal day. Electrophysiology showed an early clinically relevant phenotype One of the hallmarks of CMT2E disease is the presence of distinct electrophysiological abnormalities, which can also be assessed in mice. While there is variability within the patient population, CMT2E patients have relatively preserved MNCV values with reduced amplitudes of sensory and CMAP responses. However, a subset of CMT2E patients have reduced MNCV that is attributed to a decrease in axon caliber and not myelination ( 2 , 23 , 24 ). An initial electrophysiology study was conducted on four cohorts of animals at three weeks, twelve weeks, six months and twelve months of age. At each time point, animals were sacrificed and tissues collected. Electrophysiological measurements quantitatively measured stimulation of the sciatic nerve and response of the gastrocnemius muscle. The in vivo axon caliber (distal latency), CMAP (peak-to-peak (P/P) amplitude) and activated muscle fibers by the stimuli (negative area) were measured. At three weeks, distal latency was significantly prolonged in Nefl +/E397K (0.7586ms, P =0.0026) and Nefl E397K/E397K (0.7963ms, P =0.0085) mice when compared to wild type (0.5271ms) ( Fig. 2A ). CMAP amplitude and negative area were also significantly different in the Nefl mutants when compared to the wild type cohort ( Fig. 2A ). At twelve weeks, the distal latency of Nefl +/E397K (0.7532ms, P =0.0008) and Nefl E397K/E397K (0.9213ms, P <0.0001) mice was prolonged compared to wild type mice (0.5208ms) with significant worsening in Nefl E397K/E397K mice ( Fig. 2B ). CMAP amplitude also remained significantly different between the Nefl mutants and the wild type cohort at twelve weeks ( Fig. 2B ). Interestingly, at twelve weeks there was improvement in the negative area of Nefl +/E397K mice but Nefl E397K/E397K mice remained significantly different from wild type mice ( Fig. 2B ). At six and twelve months, there remained significant differences between wild type and Nefl mutants in distal latency; however, CMAP amplitude and negative area values were similar between all cohorts ( Fig. 2C-D ). These results show that Nefl +/E397K and Nefl E397K/E397K mice have significant defects in distal latency starting at P21 and continuing throughout the study (P360). Download figure Open in new tab Figure 2. Electrophysiology showed an early clinically relevant phenotype. Distal latency, Peak to Peak (P-P) CMAP amplitude and negative area were measured following stimulation of the sciatic nerve and recordings from the gastrocnemius muscle. Wild type (black), Nefl +/E397K (teal) and Nefl E 397K/E397K (orange) mice were evaluated at three weeks, twelve weeks, six months, and twelve months. (A) Electrophysiology recordings at three weeks, wild type (N=17), Nefl +/E397K (N=23) and Nefl E 397K/E397K (N=8). Distal latency for wild type (mean=0.5271), Nefl +/E397K (mean=0.7586, P =0.0026) and Nefl E 397K/E397K (mean=0.7963, P =0.0085) mice. P-P CMAP amplitude for wild type (mean=68.13), Nefl +/E397K (mean=57.82, P =0.0037) and Nefl E 397K/E397K (mean=42.23, P <0.0001) mice. Negative area for wild type (mean=25.89), Nefl +/E397K (mean=22.30, P =0.0341) and Nefl E 397K/E397K (mean=19.65, P =0.0051) mice. (B) Electrophysiology recordings at twelve weeks, wild type (N=13), Nefl +/E397K (N=19) and Nefl E 397K/E397K (N=8). Distal latency for wild type (mean=0.5208), Nefl +/E397K (mean=0.7532, P =0.0008) and Nefl E 397K/E397K (mean=0.9213, P <0.0001) mice. P-P CMAP amplitude for wild type (mean=84.15), Nefl +/E397K (mean=71.43, P =0.0224) and Nefl E 397K/E397K (mean=59.93, P =0.0005) mice. Negative area for wild type (mean=31.63), Nefl +/E397K (mean=28.08, NS) and Nefl E397K/397K (mean=23.34, P =0.0240) mice. (C) Electrophysiology recordings at six months, wild type (N=16), Nefl +/E397K (N=23) and Nefl E 397K/E397K (N=15). Distal latency for wild type (mean=0.4338), Nefl +/E397K (mean=0.4983, NS) and Nefl E 397K/E397K (mean=0.5727, P =0.0007) mice. P-P CMAP amplitude and negative area were not statistically significant between genotypes. (D) Electrophysiology recordings at twelve months, wild type (N=10), Nefl +/E397K (N=8) and Nefl E 397K/E397K (N=9). Distal latency for wild type (mean=0.4920), Nefl +/E397K (mean=0.6900, P =0.0065) and Nefl E 397K/E397K (mean=0.7922, P <0.0001) mice. P-P CMAP amplitude and negative area were not statistically significant between genotypes. Statistical significance was determined used ordinary one-way ANOVA and Dunnett’s multiple comparisons test. Ms=milliseconds, mV=millivolts, CMAP= compound muscle action potential, NS=not significant, N=number of mice evaluated. The initial electrophysiology study showed prolonged distal latency from three weeks to twelve months in the Nefl mutants; however, CMAP amplitude and negative area differences improved from P21 to P360. To determine whether these changes reflected disease progression, a twelve-month longitudinal study was performed on a cohort of wild type, Nefl +/E397K and Nefl E397K/E397K mice. The longitudinal assessments showed that the Nefl E397K/E397K presented with prolonged distal latency as early as P21, while Nefl +/E397K distal latency became statistically different from wild type mice at P90 ( Fig. 3A ). The mean distal latency between wild type (0.4630ms) and Nefl +/E397K mice (0.6545ms) was statistically different ( P= 0.0002), as well as between Nefl E397K/E397K mice (0.8745ms, P <0.0001). There was also a statistical significance in distal latency between Nefl +/E397K and Nefl E397K/E397K mice ( P= 0.0010). Nefl E397K/E397K distal latency was statistically different from wild type mice throughout the study (P21-P360) suggesting, like some CMT2E patients, there is a reduction in axon caliber ( Fig. 3A ). Interestingly, P21-P60 Nefl E397K/E397K CMAP P-P amplitude values were statistically different from wild type mice; however, for the remainder of the study differences varied ( Fig. 3B ). There was statistical difference between the mean CMAP amplitude values for wild type (81.12mV) and Nefl +/E397K mice (76.41mV, P =0.0319) and Nefl E397K/E397K mice (66.39mV, P =0.0001). As well, there were CMAP P-P amplitude differences between Nefl +/E397K and Nefl E397K/E397K mice ( P= 0.0012). The same trends were observed for negative area measurements in Nefl E397K/E397K mice ( Fig. 3C ). There was no statistical difference between the mean negative area values for wild type (26.55) and Nefl +/E397K mice (26.51) and Nefl E397K/E397K mice (23.93). Importantly, results of the longitudinal study were consistent with the mixed cohort electrophysiology study; distal latency was severely impacted early in Nefl E397K/E397K mice with differences occurring later in Nefl +/E397K mice. In Nefl E397K/E397K and Nefl +/E397K mice, CMAP amplitude and negative area differences were apparent early; however, differences were not measured later in the disease. The subtle differences between the two studies were likely attributed to disease variation between the cohorts. Download figure Open in new tab Figure 3. Longitudinal electrophysiology study of wild type and Nefl mutant mice. Distal latency, Peak to Peak (P-P) CMAP amplitude and negative area were measured following stimulation of the sciatic nerve and recordings from the gastrocnemius muscle. Wild type (black, N=7), Nefl +/E397K (teal, N=4) and Nefl E 397K/E397K (orange, N=7) mice were evaluated at P21, P60, P90, P120, P150, P180, P210, P240, P270, P330 and P360 days. (A) Distal latency P *=0.0148-0.0395, P **=0.0040-0.084, P ***=0.0001-0.0007, P ****<0.0001. Wild type (mean=0.4630), Nefl +/E397K (mean=0.6545, P =0.0002), Nefl E 397K/E397K (mean=0.8745, P <0.0001), Nefl +/E397K mean compared to Nefl E 397K/E397K mean ( P =0.0010). (B) Peak-Peak CMAP amplitude P *=0.0229-0.0242, P **=0.0074, P ***=0.0010. Wild type (mean=81.12), Nefl +/E397K (mean=76.41, P =0.0319), Nefl E 397K/E397K (mean=66.49, P =0.0001), Nefl +/E397K mean compared to Nefl E 397K/E397K mean ( P =0.0012). (C) Negative area P *=0.0215-0.0445. Wild type (mean=26.55), Nefl +/E397K (mean=26.51, NS), Nefl E397K/397K (mean=23.93, NS), Nefl +/E397K mean compared to Nefl E 397K/E397K mean (NS). A mixed effects analysis with Dunnett’s multiple comparison test and one-way ANOVA with Tukey’s multiple comparison test were used to determine significance. Ms=milliseconds, mV=millivolts, CMAP=compound muscle action potential, NS=not significant, N=number of mice evaluated. To determine whether there was variability between individual mice in the longitudinal study, consistent with the CMT2E patient population, we analyzed the longitudinal electrophysiology data from P21 to P360 per mouse ( Supplemental Fig. 1A-C ). When measurements were followed for each mouse, there was little variability between P21 wild type mice in distal latency (0.560ms ±0.14); however, there was measurable variability between Nefl +/E397K (0.870ms ±0.495) and Nefl E397K/E397K mice (0.844ms ±0.306) ( Fig. 3A ). The variability between Nefl mutant mice diminished by P180 (wild type 0.444ms ±0.044; +/E397K 0.740ms ±0.119; E397K/E397K mice 0.731ms ±0.173); however, distal latency variability was increased in the Nefl mutants compared to wild type mice at all timepoints measured ( Supplemental Fig. 1A ). CMAP amplitude and negative area values demonstrated similar variation within cohorts for all genotypes; however, CMAP amplitude values for Nefl E397K/E397K mice trended lower at all timepoints when compared to wild type mice ( Supplemental Fig. 1B-C ). Download figure Open in new tab Supplemental Figure 1. Longitudinal study evaluated per mouse. Distal latency, Peak to Peak (P-P) CMAP amplitude and negative area were measured following stimulation of the sciatic nerve and recordings from the gastrocnemius muscle. Wild type (N=7), Nefl +/E397K (N=4) and Nefl E 397K/E397K (N=7) mice were evaluated at P21, P60, P90, P120, P150, P180, P210, P240, P270, P330 and P360 days. Each color represents one mouse (A) Distal latency. (B) P-P CMAP amplitude. (C) Negative area. Ms=milliseconds, mV=millivolts, CMAP=compound muscle action potential, N=number of mice evaluated. Nefl mutant mice showed chronic axonal neuropathy Our electrophysiology findings showed that there were measurable differences in Nefl mutants. To further quantify these deficits, we examined the histopathology of the sciatic nerve at P21, P84, P180, and P360 ( Fig. 4 , Table 1 ). Axon area, axon diameter and G-ratio (ratio of the inner axonal diameter to the total outer diameter) were measured. Cross-sectional images of the sciatic nerve showed significant changes in Nefl +/E397K and Nefl E397K/E397K mice at all time points analyzed. At P21, significant changes in axon area were apparent in Nefl +/E397K (0.0047μm 2 , P <0.0001) and Nefl E397K/E397K (0.0035μm 2 , P <0.0001) compared to wild type mice (0.0122μm 2 ) Fig. 4A-E , Table 1 ). Throughout the analyses, axon area was consistently smaller in Nefl +/E397K (P360, 0.0148μm 2 , P <0.0001) and Nefl E397K/E397K (P360, 0.0098μm 2 , P <0.0001) mice when compared to wild type mice (P360, 0.0314μm 2 ) ( Fig. 4A-E , Table 1 ). Axon diameter was also significantly reduced in Nefl +/E397K and Nefl E397K/E397K mice at all time points analyzed ( Fig. 4A-E Table 1 ). The G-ratio was also reduced in Nefl +/E397K (P360 0.5557, P <0.0001) and Nefl E397K/E397K mice (P360 0.5515, P <0.0001) compared to wild type mice (P360 0.6415). The differences in G-ratio are largely attributed to changes in axon area as we did not observe significant differences in myelination ( Fig. 4A-E , Table 1 and not shown ). From three weeks to twelve months, differences in axon area, diameter and G-ratio were more apparent in Nefl E397K/E397K mice as compared to Nefl +/E397K mice ( Fig. 4A-E , Table 1 ). The reduced axon number/field from twelve weeks to six months in Nefl mutants largely is not a result of increased number of axons with larger caliber but is attributed to loss of axons ( Fig. 4A-E , Table 1 ). From six months to twelve months, some regeneration is occurring. There is a substantial increase in the number of axons/field from six months to twelve months in Nefl E397K/E397K and Nefl +/E397K mice and those axons represent smaller axons (( Fig. 4A-E , Table 1 , Supplemental Fig. 2 ). Importantly, the chronic axonal neuropathy observed in Nefl E397K/E397K and Nefl +/E397K mice was consistent with the impaired distal latency measured by electrophysiology. Download figure Open in new tab Supplemental Figure 2. Axon area distribution per age group. The sciatic nerve was harvested from wild type, Nefl +/E397K , and Nefl E 397K/E397K mice at three weeks, twelve weeks, six months, and twelve months of age. N=number of mice evaluated. Three-week values in μm 2 1=0-1.4, 2=1.4-15.06, 3=15.06-28.71, 4=28.71-42.37, 5=42.37-56.02, 6=56.02-69.67, 7=69.97-83.33, 8=83.33-96.98, 9=96.98-110.64, 10=110.64-124.29, 11=124.29-137.94, 12=137.94-151.60, 13=151.60-165.25, 14=165.25-178.91, 15=178.91-192.56, 16=192.56-206.21, 17=206.21-219.87, 18=219.87-233.52, 19=233.52-247.17, 20=247.17-260.83, 21=260.83-274.48, 22=274.48-288.14, 23=288.14-301.79, 24=301.79-315.44, 25=315.44-329.10, 26=329.10-342.75, 27=>342.75. Twelve-week values in μm 2 1=0-6.87, 2=6.87-74.59, 3=74.59-142.32, 4=142.32-210.04, 5=210.04-277.77, 6=277.77-345.49, 7=345.59-413.22, 8=413.22-480.94, 9=480.94-548.67, 10=548.67-616.39, 11=616.39-648.12, 12=648.12-751.84, 13=751.84-819.57, 14=819.57-887.29, 15=887.29-955.05, 16=955.05-1022.74, 17=1022.74-1090.47, 18=1090.47-1158.19, 19=1158.19-1225.92, 20=1225.92-1293.64, 21=1293.64-1361.37, 22=1361.37-1429.09, 23=1429.09-1496.81, 24=1496.81-1564.54, 25=1564.54-1632.26, 26=1632.26-1699.99, 27=>1699.99. Six-month values in μm 2 1=0-3.59, 2=3.59-40.36, 3=40.36-77.13, 4=77.13-113.89, 5=113.89-150.66, 6=150.66-187.43, 7=187.43-224.20, 8=224.20-260.96, 9=260.96-297.73, 10=297.73-334.50, 11=334.50-371.27, 12=371.27-408.03, 13=408.03-444.80, 14=440.80-481.57, 15=481.57-518.34, 16=518.34-555.10, 17=555.10-591.87, 18=591.87-628.64, 19=628.64-665.41, 20=665.41-702.17, 21=702.17-738.94, 22=738.94-775.51, 23=775.51-812.48, 24=812.48-849.24, 25=849.24-886.01, 26=886.01-922.78, 27=>922.78. Twelve-month values in μm 2 1=0-3.59, 2=3.59-55.54, 3=55.54-107.50, 4=107.50-159.45, 5=159.45-211.40, 6=211.40-263.35, 7=263.35-315.31, 8=315.31-367.26, 9=367.26-419.21, 10=419.21-471.17, 11=471.17-523.12, 12=523.12-575.07, 13=575.07-627.02, 14=627.02-678.98, 15=678.98-730.93, 16=730.93-782.88, 17=782.88-834.84, 18=834.84-886.79, 19=886.79-938.74, 20=938.74-990.69, 21=990.69-1042.64, 22=1042.64-1094.50, 23=1094.50-1146.55, 24=1146.55-1198.51, 25=1198.51-1250.46, 26=1250.46-1302.41, 27=>1302.41. Download figure Open in new tab Figure 4A-D. Nefl mutant mice showed chronic axonal neuropathy. The sciatic nerve was harvested from wild type (black, N=16) Nefl +/E397K (teal, N=17) and Nefl E 397K/E397K (orange, N=16) mice at three weeks, twelve weeks, six months, and twelve months of age. (A) Three weeks axon area for wild type (0.0122μm 2 , 1141 axons), Nefl +/E397K (0.0047μm 2 , P <0.0001, 623 axons) and Nefl E 397K/E397K (0.0035μm 2 , P <0.0001, 724 axons) mice. Three weeks axon diameter for wild type (0.1196μm, 1141 axons), Nefl +/E397K (0.0750μm, P <0.0001, 623 axons) and Nefl E 397K/E397K (0.0624μm, P <0.0001, 724 axons) mice. Three weeks G-ratio for wild type (0.6338, 800 axons), Nefl +/E397K (0.4802, P <0.0001, 536 axons) and Nefl E 397K/E397K (0.4465, P <0.0001, 653 axons) mice. (B) Twelve weeks axon area for wild type (0.0280μm 2 , 759 axons), Nefl +/E397K (0.0150μm 2 , P <0.0001, 1090 axons) and Nefl E 397K/E397K (0.0110μm 2 , P <0.0001, 795 axons) mice. Twelve weeks axon diameter for wild type (0.1724μm, 759 axons), Nefl +/E397K (0.1281μm, P <0.0001, 1090 axons) and Nefl E 397K/E397K (0.1117μm, P <0.0001, 795 axons) mice. Twelve weeks G-ratio for wild type (0.6596, 653 axons), Nefl +/E397K (0.5981, P <0.0001, 992 axons) and Nefl E 397K/E397K (0.5578, P <0.0001, 644 axons) mice. (C) Six months axon area for wild type (0.0250μm 2 , 704 axons), Nefl +/E397K (0.0131μm 2 , P <0.0001, 553 axons) and Nefl E 397K/E397K (0.0076μm 2 , P <0.0001, 769 axons) mice. Six months axon diameter for wild type (0.1670μm, 704 axons), Nefl +/E397K (0.1215μm, P <0.0001, 553 axons) and Nefl E 397K/E397K (0.0915μm, P <0.0001, 769 axons) mice. Six months G-ratio for wild type (0.6386, 622 axons), Nefl +/E397K (0.5751, P <0.0001, 464 axons) and Nefl E 397K/E397K (0.5093, P <0.0001, 635 axons) mice. (D) Twelve months axon area for wild type (0.0314μm 2 , 542 axons), Nefl +/E397K (0.0148μm 2 , P <0.0001, 719 axons) and Nefl E 397K/E397K (0.0098μm 2 , P <0.0001, 627 axons) mice. Twelve months axon diameter for wild type (0.1802μm, 542 axons), Nefl +/E397K (0.1302μm, P <0.0001, 719 axons) and Nefl E 397K/E397K (0.1049μm, P <0.0001, 627 axons) mice. Twelve months G-ratio for wild type (0.6415, 480 axons), Nefl +/E397K (0.5557, P <0.0001, 636 axons) and Nefl E 397K/E397K (0.5515, P <0.0001, 465 axons) mice.Statistics were determined using one-way ANOVA with Dunnett’s multiple comparison test. N=number of mice evaluated. Download figure Open in new tab Figure 4E. Representative images of axons from wild type, Nefl +/E397K and Nefl E 397K/E397K mice at three weeks, twelve weeks, six months and twelve months of age following. View this table: View inline View popup Download powerpoint Table 1. Axon area, axon diameter, G-ratio and axon numbers. When we analyzed axonal area from three weeks to twelve months in Nefl +/E397K and Nefl E397K/E397K mice there was a distribution towards more smaller axon calibers with Nefl E397K/E397K demonstrating more smaller caliber axons than Nefl +/E397K mice ( Supplemental Fig. 2 ). These results are consistent with the electrophysiology studies and axonal pathology. Neuromuscular junction denervation was present as disease progressed in Nefl mutant mice To investigate whether neuromuscular junction (NMJ) innervation status was altered in Nefl mutant mice, biceps brachii, triceps brachii, gastrocnemius, and tibialis anterior (TA) muscles were analyzed at three weeks, twelve weeks, six months, and twelve months ( Fig. 5 and not shown). At three weeks, there were no significant differences between wild type and Nefl mutant mice in any of the muscles examined; however, at twelve weeks the percentage of fully innervated endplates decreased, and partially and fully denervated endplates increased with differences observed between the muscles ( Fig. 5B ). At twelve weeks, the most significant differences were observed in the TA muscle. TA fully innervated endplates in Nefl +/E397K mice were 88% with 12% partially innervated endplates. Nefl E397K/E397K mice had 73% fully innervated endplates ( P =0.0039) with 9% partially innervated and 18% fully denervated endplates in the TA muscle ( Fig. 5B ). The differences in innervation status between wild type and Nefl mutants became more apparent at twelve months across all muscles with the greatest differences observed in the TA muscle. TA fully innervated endplates in Nefl +/E397K mice were 70% ( P =0.0448) with 24% partially innervated endplates and 6% fully denervated endplates. Nefl E397K/E397K mice had 56% fully innervated endplates ( P =0.0013) with 32% partially innervated ( P =0.0239) and 12% fully denervated endplates in the TA muscle ( Fig. 5C-D ). Download figure Open in new tab Figure 5A-C: Neuromuscular junction denervation in Nefl mutant mice. The neuromuscular junction innervation status of wild type, Nefl +/E397K , and Nefl E 397K/E397K mice was analyzed at three weeks, twelve weeks, and twelve months of age in the biceps brachii, triceps brachii, gastrocnemius and tibialis anterior (TA) muscles. End plates with complete overlap with the terminal were considered fully innervated (black), end plates with partial overlap were considered partially innervated (blue), and end plates with missing overlapping terminal were considered denervated (yellow). (A) Three-week evaluation. (B) Twelve-week evaluation. Biceps brachii fully innervated endplates between wild type (100%) and Nefl E 397K/E397K mice (78%, P =0.0167). Biceps brachii fully innervated endplates between Nefl +/E397K and Nefl E 397K/E397K mice ( P =0.0227). Biceps brachii Nefl E397K/397K partially innervated endplates 4%, fully denervated endplates 18%. TA fully innervated endplates between wild type (99%) and Nefl E 397K/E397K mice (73%, P =0.0039). TA Nefl E 397K/E397K partially innervated endplates 9%, fully denervated endplates 18%. (C) Twelve months evaluation. Biceps brachii fully innervated endplates between wild type (96%) and Nefl +/E397K mice (66%, P =0.0155). Biceps brachii Nefl +/E397K partially innervated endplates 23%, fully denervated endplates 11%. Triceps brachii fully innervated endplates between wild type (100%) and Nefl +/E397K mice (73%, P =0.0138). Triceps brachii Nefl +/E397K partially innervated endplates 21%, fully denervated endplates 6%. Gastrocnemius fully innervated endplates between wild type (99%) and Nefl +/E397K mice (60%, P =0.0094). Gastrocnemius Nefl +/E397K partially innervated endplates 12%, fully denervated endplates 28%. TA fully innervated endplates between wild type (100%) and Nefl +/E397K mice (70%, P =0.0448). TA Nefl +/E397K partially innervated endplates 24%, fully denervated endplates 6%. TA fully innervated endplates between wild type (100%) and Nefl E 397K/E397K mice (56%, P =0.0013). TA Nefl E 397K/E397K partially innervated endplates (32%, P =0.0239), fully denervated endplates 12%. Four to seven animals were analyzed per muscle. Two-way ANOVA with Tukey’s multiple comparisons test determined statistical significance. Download figure Open in new tab Figure 5D: Neuromuscular junction denervation in Nefl mutant mice. Representative images for TA muscle at three weeks and twelve months. Anti-neurofilament heavy chain labelled the axon (green) and anti-synaptic vesicle 2 (SV2) (green) labelled the synaptic terminal. Acetylcholine receptors were labeled with Alexa Fluor 594-conjugated α-Bungarotoxin (magenta). Four to seven animals were analyzed per muscle. Total axon number per field and total NMJ numbers per field were also examined. In wild type mice, the total number of axons per field decreased as the axons grew in area; the total number of NMJs increased ( Fig. 6A-D , Table 1 ). In P21 Nefl mutants, there were more total axons per field than wild type mice as Nefl mutant axons were significantly smaller in area; however, total NMJ numbers per field was consistent with wild type mice ( Fig. 6A-D , Table 1 ). From P21 through P180 there was a consistent decrease in total axons/field in both Nefl mutants; however, during this same time there was an increase in total number of NMJ/field consistent with wild type mice ( Fig. 6A-D , Table 1 ). At P360, Nefl E397K/E397K axon area was 69% smaller and Nefl +/E397K axon area was 53% smaller than wild type with 33% and 30% more axons/field, respectively. At P360, the average total number of NMJ/field was 47 for wild type mice, 46 for Nefl +/E397K mice and 40 for Nefl E397K/E397K mice. Download figure Open in new tab Figure 6. Nefl mutants with comparison of axon numbers and NMJs. The total number of axons per 63X field (A, B) and the total neuromuscular junctions (NMJs) per 20X field (C, D) were quantified and compared. Wild type (black), Nefl +/E397K (teal), and Nefl E 397K/E397K (orange) mice were analyzed at three weeks, twelve weeks, six months, and twelve months of age. Axons of the sciatic nerve and NMJs associated with the gastrocnemius muscle were quantified. Wild type (P360=285 axons, 47=NMJ), Nefl +/E397K (P360=409 axons, 46=NMJ), and Nefl E 397K/E397K (P360=424 axons, 40=NMJ) mice. P=postnatal day, n=number of animals evaluated. Discussion Here we report two Nefl-E397K mouse models that present with early electrophysiology differences and axon pathology that persisted throughout the lifespan of the mice. Additionally, in the characterization of Nefl +/E397K or Nefl E397K/E397K mice we found that Nefl E397K/E397K mice demonstrate disease pathology earlier than Nefl +/E397K mice and in most instances disease pathology was more severe. Consistent with CMT2E patients, there was not a reduction in lifespan for Nefl +/E397K or Nefl E397K/E397K mice; however, weight for Nefl +/E397K mice trended upward while weight for Nefl E397K/E397K mice trended downward. These differences might be reflected by the mobility of the mice, any associated neuropathic pain and disease severity. Electrophysiology measurements recorded with individual cohorts or within the longitudinal study were consistent demonstrated significant differences as early as P21, revealing an early, quantifiable phenotype. Distal latency was significantly prolonged throughout the 360 days while P-P CMAP amplitude was consistently lower in the Nefl mutants. At three weeks, electrophysiology measurements (distal latency, P-P CMAP amplitude and negative area) demonstrated significant differences from wild type cohorts. A possible interpretation of these results would be that there was a decrease in the axon caliber (increased distal latency), reduced number of motor units activated (CMAP) and reduced activated muscle fiber (negative area). The distal latency was consistent with the significant decrease in axon area and diameter observed in Nefl +/E397K and Nefl E397K/E397K mice. At three weeks, there was no NMJ denervation present in the forelimb nor hindlimb muscles examined in Nefl mutants; however, there were more and smaller axons with fewer total NMJs consistent with the reduction in activated motor units. In our companion study, significantly reduced muscle fiber area in Nefl mutants further supports the electrophysiology findings. Interestingly, from three to twelve weeks distal latency was further prolonged in Nefl mutant mice with Nefl E397K/E397K more severe than Nefl +/E397K mice. There was some improvement in P-P CMAP amplitude and negative area at twelve weeks; however, both remained statistically different from the wild type cohort. Nefl mutant axonal growth continued, but axon area remained significantly smaller than wild type axons contributing to the prolonged distal latency. For Nefl E397K/E397K mice from three weeks to twelve weeks, there was a three-fold increase in axon area; however, axons were 39% the size of wild type axons. Nefl +/E397K mice presented with more, larger axons than Nefl E397K/E397K mice with increased number of total NMJs. Overall, NMJ innervation was largely preserved in Nefl +/E397K mice with increased partial and full denervated endplates observed in Nefl E397K/E397K mice. NMJ number/field were similar between wild type and Nefl E397K/E397K mice; however, Nefl E397K/E397K mice had more and smaller axons. The increased axon caliber, “maintenance” of NMJ innervation and potential for sprouting likely stabilized P-P CMAP and negative area in the Nefl mutants. From twelve weeks to six months, axon degeneration persisted in the Nefl mutants, most notably in Nefl E397K/E397K mice. Nefl +/E397K demonstrated a 13% reduction in axon caliber with a 16% reduction in the number of axons per field (smaller axons and fewer axons counted). Nefl E397K/E397K mice demonstrated a 31% reduction in axon caliber with a 55% reduction in the number of axons (much smaller axons and significantly fewer axons counted). Additionally, there was an increase in the absence of axons within the fields scored at six months indicating axon loss. Nefl E397K/E397K mice had 70% smaller axon area than wild type mice at six months and a 20% reduction in the number of axons. Notably, Nefl mutant mice increased total NMJs consistent with wild type mice suggesting compensatory mechanisms such as sprouting were occurring. Together, these results support the electrophysiology; distal latency was prolonged due to the small axons. P-P CMAP and negative area were largely preserved due to compensatory mechanisms that maintained NMJ innervation and facilitated sprouting as well as muscle fiber hypertrophy in Nefl mutant mice (companion manuscript). From six months to twelve months, axon caliber slightly increased in Nefl mutant mice; however, wild type mice demonstrated a decrease in the number of axons/field (consistent with increased caliber) while Nefl mutants demonstrated increased axon number ( Nefl +/E397K 13%, Nefl E397K/E397K 42%) suggesting regeneration was occurring. More, smaller axons were present at twelve months in comparison to six months in Nefl mutants. The increased but smaller axons resulted in significantly prolonged distal latency. While there was not a significant difference in P-P CMAP amplitude and negative area, Nefl mutants consistently had lower measurements than their wild type cohort. The maintenance of NMJ numbers could serve as a compensatory mechanism for the changes in NMJ innervation status. Materials and Methods Animals All experimental procedures were approved by the University of Missouri Animal Care and Use committee and were performed according to the guidelines set forth in the Guide for the Use and Care of Laboratory Animals. CRISPR/Cas9, Nefl - E397K sgRNA and repair template Nefl mice were generated on a C57BL/6 background using CRISPR technology at the University of Missouri Animal Modeling Core. An enhanced-specificity Cas9 (eSPCas9) protein was used to reduce off-target effects. Any predicted off-target site with less than a 2bp mismatch (including DNA or RNA bulges) or with less than 3bp mismatches if no mismatches are in the 12bp seed region of the sgRNA was PCR amplified and sequenced to ensure no erroneous edits were made. The sgRNA was ordered as chemically modified synthetic sgRNA (Synthego). The repair template was chemically synthesized as a 199bp single stranded DNA oligo (ssODN) (IDT). The ssODN was complementary to the non-target strand and contained symmetrical homology arms. sgRNA sequence: 5’-TCTTGGAAGGCGAAGAGACC-3’. Repair template sequence (sgRNA sequence disrupted by the desired mutation) 5’-GAGGAAAGTAATGAATGTGGGCTTAGAGCAATGAACACATCCAGCCTTGCTCTAACTGTAC TCTTCATTCCCTCTCCACCAGAAAACTCTTGGAAGGC A AAGAGACCAGACTCAGTTTCACC AGCGTGGGTAGCATAACCAGCGGCTACTCTCAGAGCTCGCAGGTCTTCGGCCGTTCTGCT TACAGTGGCTTGCAGAGC −3’. The boxed area represents the sgRNA target sequence, and the bold underlined letter indicates the mutation engineered in the DNA repair template. Zygote electroporation and embryo transfer A mix containing a final concentration of 3.0μM sgRNA, 2.0μM Cas9 protein (Sigma) and 1.6μM ssODN was made immediately prior to electroporation. CRISPR sgRNA/Cas9 RNP complexes were formed with incubation at room temperature for 10 minutes followed by the addition of the ssODN repair template. Zygotes were electroporated (NepaGene21) using a 1.5mm gap glass slide electrode under the following conditions: Poring pulse: 40V, 3.5ms length, 50ms interval, 10% decay rate, positive polarity (x4 pulses) Transfer pulse: 5V, 50ms length, 50ms interval, 40% decay rate, alternating polarity (x5 pulses). Electroporated zygotes were transferred to pseudo pregnant surrogate females. Genotyping Genotyping of neonatal pups was performed at postnatal day (P) 0. Genomic DNA isolation was performed using a protocol from Jacksons labs. C57BL/6- Nefl E397K mice were genotyped using a high-resolution melt analysis (EvaGreen qPCR precision melt supermix, Bio-Rad) and the primers 5’-CTTCATTCCCTCTCCACCAG-3’ and 5’-CACGCTGGTGAAACTGAG-3’. PCR conditions were 95°C denaturing for 2:00 minutes (m) followed by 39 cycles of 95°C denaturing for 10 seconds (s), 60°C annealing for 30s and 72°C extension for 30s, 95°C for 30s, 60°C for 1:00m, and melt curve 65°C to 95°C in increments of 0.2 every 10s. Melting temperature for the wild type, Nefl +/E397K , and Nefl E397K/E397K were 78.5 ± 0.03°C, 77.7 ± 0.03°C, and 77.2 ± 0.06°C, respectively. Electrophysiology studies Measurements of the right gastrocnemius muscle were recorded following stimulation of the sciatic nerve as previously described ( 25 ). Briefly, mice were anesthetized with isoflurane (2-5% for induction and 2-3% for maintenance) and placed on a warming mat set at 37°C. The right hindlimb was shaved and an active ring electrode was placed over the gastrocnemius muscle and a reference ring electrode was placed over the metatarsals of the right hind paw (Alpine Biomed, Skovlunde, Denmark). Spectra 360 electrode gel was applied to decrease impedance (Parker Laboratories, Fairfield, NJ). A common reference electrode was placed around the tail. Two 28-gauge monopolar needle electrodes (Teca, Oxford Instruments Medical, New York, NY) were placed on each side of the sciatic nerve in the region of the proximal thigh. A portable electrodiagnostic system (Cadwell Sierra Summit, Kennewick, WA) was used to stimulate the sciatic nerve (0.1ms pulse, 1–10mA intensity) and distal latency, compound muscle action potential amplitude, and negative area were recorded. Sciatic nerve dissection and processing Sciatic nerves were fixed with 8% glutaraldehyde in phosphate buffer and processed for resin (Poly/Bed® 812; #21844-1; Polysciences Inc.) embedding as previously described ( 17 , 26 ). After fixation, nerves were incubated in 2% osmium tetroxide in phosphate buffer followed by rinses in ascending ethanol concentrations (50%, 70%, 80%, 95%, and 100%) and propylene oxide. Samples were then incubated in a 1:1 propylene oxide: resin mixture for 1 hour, incubated in resin overnight, placed in a resin mold, and cured at 60°C for 8 hours. Semi-thin sections of 1μm were stained with alkaline toluidine blue, cover-slipped with Permount mounting medium (ThermoFisher Scientific), and visualized by light microscopy (Leica DM5500 B, Leica Microsystems Inc.). Image quantification was performed in a blind manner using the semi-automated MyelTracer software ( 27 ). Axon area, perimeter, diameter, and G-ratios were recorded. Neuromuscular junction (NMJ) immunohistochemistry Mice were perfused with 4% PFA. NMJ immunohistochemistry whole mount preparations were stained and analyzed as previously described ( 28 ). Muscles were incubated with primary antibodies anti-Neurofilament Heavy Chain (NF-H) (1:2000; AB5539, Chemicon, EMD Millipore) and anti-Synaptic Vesicle 2 (SV2) (1:200; YE269, Life Technologies) followed by Donkey anti-Chicken Alexa Fluor 488 (1:400; Jackson ImmunoResearch) and Goat anti-Rabbit Alexa Fluor 488 (1:200; Jackson ImmunoResearch) secondary antibodies to label the axon and synaptic terminal. Acetylcholine receptors were labeled with Alexa Fluor 594-conjugated α-Bungarotoxin (1:200; Life Technologies). NMJ analyses were performed blind on three randomly selected fields at 20X magnification (Leica DM5500 B, Leica Microsystems Inc.). Analyses were based on the overlap of the end plate and synaptic terminal. End plates with complete overlap with the terminal were considered fully innervated, end plates with partial overlap were considered partially innervated, and end plates with missing overlapping terminal were considered denervated using Fiji software (NIH). Representative images were obtained using a laser scanning confocal microscope at 40x magnification (Leica TCS SP8, Leica Microsystems Inc.). Statistical analyses Statistical analyses for each experimental protocol are noted within the figure legends. Funding This work was supported by the Charcot-Marie-Tooth Research Foundation (grant 00070082). DPL was supported by the MU Life Sciences Fellowship, National Institutes of Health Training grant T32 GM008396 and a Southeastern Conference (SEC) Scholar fellowship. MTA was funded by the IMSD/MARC program National Institutes of Health Training grant T34 GM136493. AAS was funded by the MU Cherng Summer Scholars program. Conflict of Interest Statement Ownership : CLL is co-founder and chief scientific officer of Shift Pharmaceuticals. MAL is associated with Shift by family relation. Income : CLL has received more than $10,000 in income per annum from Shift Pharmaceuticals. Research support : Research in the CLL and MAL labs have been supported by sub-awards from Shift Pharmaceuticals (as part of grants from the DOD, CMT Research Foundation, and the NIH). Intellectual property : an invention disclosure has been submitted covering the intellectual property related to this work. Author Contributions DPL: designed research studies, conducted experiments, acquired data, analyzed data, prepared manuscript, edited manuscript AS: conducted experiments, acquired data, analyzed data FLT: conducted experiments, acquired data, analyzed data MA: conducted experiments, acquired data, analyzed data WA: acquired data, analyzed data MAL: conducted experiments, acquired data, analyzed data, edited manuscript CLL: designed research studies, analyzed data, edited manuscript Acknowledgements We acknowledge the MU Animal Modeling Core, MU Genomics Technology Core, and MU Advanced Light Microscopy Core for assistance with these studies. References 1. ↵ Mersiyanova , I.V. , Perepelov , A.V. , Polyakov , A.V. , Sitnikov , V.F. , Dadali , E.L. , Oparin , R.B. , Petrin , A.N. and Evgrafov , O.V . ( 2000 ) A new variant of Charcot-Marie-Tooth disease type 2 is probably the result of a mutation in the neurofilament-light gene . Am. J. Hum. Genet ., 67 , 37 – 46 . OpenUrl CrossRef PubMed Web of Science 2. ↵ 2. Della Marina, A., Hentschel, A., Czech, A., Schara-Schmidt, U., Preusse, C., Laner, A., Abicht, A., Ruck, T., Weis, J., Choueiri, C., et al. ( 2024 ) Novel Genetic and Biochemical Insights into the Spectrum of NEFL-Associated Phenotypes . J. Neuromuscul. Dis ., 11 , 625 – 645 . OpenUrl CrossRef PubMed 3. ↵ Stone , E.J. , Kolb , S.J. and Brown , A . ( 2021 ) A review and analysis of the clinical literature on Charcot-Marie-Tooth disease caused by mutations in neurofilament protein L . Cytoskeleton (Hoboken ) , 78 , 97 – 110 . OpenUrl CrossRef PubMed 4. 4. De Jonghe , P. , Mersivanova , I. , Nelis , E. , Del Favero , J. , Martin , J.J. , Van Broeckhoven , C. , Evgrafov , O. and Timmerman , V. ( 2001 ) Further evidence that neurofilament light chain gene mutations can cause Charcot-Marie-Tooth disease type 2E . Ann. Neurol ., 49 , 245 – 249 . OpenUrl CrossRef PubMed Web of Science 5. 5. Jordanova , A. , De Jonghe , P. , Boerkoel , C.F. , Takashima , H. , De Vriendt , E. , Ceuterick , C. , Martin , J.J. , Butler , I.J. , Mancias , P. , Papasozomenos , S. , et al. ( 2003 ) Mutations in the neurofilament light chain gene (NEFL) cause early onset severe Charcot-Marie-Tooth disease . Brain , 126 , 590 – 597 . OpenUrl CrossRef PubMed Web of Science 6. ↵ Elbracht , M. , Senderek , J. , Schara , U. , Nolte , K. , Klopstock , T. , Roos , A. , Reimann , J. , Zerres , K. , Weis , J. and Rudnik-Schoneborn , S . ( 2014 ) Clinical and morphological variability of the E396K mutation in the neurofilament light chain gene in patients with Charcot-Marie-Tooth disease type 2E . Clin. Neuropathol ., 33 , 335 – 343 . OpenUrl CrossRef PubMed 7. ↵ Herrmann , H. and Aebi , U . ( 2016 ) Intermediate Filaments: Structure and Assembly . Cold Spring Harb. Perspect. Biol ., 8 . 8. Herrmann , H. , Strelkov , S.V. , Burkhard , P. and Aebi , U . ( 2009 ) Intermediate filaments: primary determinants of cell architecture and plasticity . J. Clin. Invest ., 119 , 1772 – 1783 . OpenUrl CrossRef PubMed Web of Science 9. Eriksson , J.E. , Dechat , T. , Grin , B. , Helfand , B. , Mendez , M. , Pallari , H.M. and Goldman , R.D . ( 2009 ) Introducing intermediate filaments: from discovery to disease . J. Clin. Invest ., 119 , 1763 – 1771 . OpenUrl CrossRef PubMed Web of Science 10. Liem , R.K. and Messing , A . ( 2009 ) Dysfunctions of neuronal and glial intermediate filaments in disease . J. Clin. Invest ., 119 , 1814 – 1824 . OpenUrl CrossRef PubMed Web of Science 11. ↵ Kotaich , F. , Caillol , D. and Bomont , P . ( 2023 ) Neurofilaments in health and Charcot-Marie-Tooth disease . Front. Cell Dev. Biol ., 11 , 1275155 . OpenUrl CrossRef PubMed 12. ↵ Pisciotta , C. , Bai , Y. , Brennan , K.M. , Wu , X. , Grider , T. , Feely , S. , Wang , S. , Moore , S. , Siskind , C. , Gonzalez , M. et al. ( 2015 ) Reduced neurofilament expression in cutaneous nerve fibers of patients with CMT2E . Neurology , 85 , 228 – 234 . OpenUrl CrossRef PubMed 13. ↵ Brownlees , J. , Ackerley , S. , Grierson , A.J. , Jacobsen , N.J. , Shea , K. , Anderton , B.H. , Leigh , P.N. , Shaw , C.E. and Miller , C.C . ( 2002 ) Charcot-Marie-Tooth disease neurofilament mutations disrupt neurofilament assembly and axonal transport . Hum. Mol. Genet ., 11 , 2837 – 2844 . OpenUrl CrossRef PubMed Web of Science 14. ↵ Lee , M.K. , Marszalek , J.R. and Cleveland , D.W . ( 1994 ) A mutant neurofilament subunit causes massive, selective motor neuron death: implications for the pathogenesis of human motor neuron disease . Neuron , 13 , 975 – 988 . OpenUrl CrossRef PubMed Web of Science 15. ↵ Perez-Olle , R. , Leung , C.L. and Liem , R.K . ( 2002 ) Effects of Charcot-Marie-Tooth-linked mutations of the neurofilament light subunit on intermediate filament formation . J. Cell Sci ., 115 , 4937 – 4946 . OpenUrl Abstract / FREE Full Text 16. ↵ 16. Adebola , A.A. , Di Castri , T. , He , C.Z. , Salvatierra , L.A. , Zhao , J. , Brown , K. , Lin , C.S. , Worman , H.J. and Liem , R.K. ( 2015 ) Neurofilament light polypeptide gene N98S mutation in mice leads to neurofilament network abnormalities and a Charcot-Marie-Tooth Type 2E phenotype . Hum. Mol. Genet ., 24 , 2163 – 2174 . OpenUrl CrossRef PubMed 17. ↵ Lancaster , E. , Li , J. , Hanania , T. , Liem , R. , Scheideler , M.A. and Scherer , S.S . ( 2018 ) Myelinated axons fail to develop properly in a genetically authentic mouse model of Charcot-Marie-Tooth disease type 2E . Exp. Neurol ., 308 , 13 – 25 . OpenUrl CrossRef PubMed 18. Shen , H. , Barry , D.M. , Dale , J.M. , Garcia , V.B. , Calcutt , N.A. and Garcia , M.L . ( 2011 ) Muscle pathology without severe nerve pathology in a new mouse model of Charcot-Marie-Tooth disease type 2E . Hum. Mol. Genet ., 20 , 2535 – 2548 . OpenUrl CrossRef PubMed Web of Science 19. Dale , J.M. , Villalon , E. , Shannon , S.G. , Barry , D.M. , Markey , R.M. , Garcia , V.B. and Garcia , M.L . ( 2012 ) Expressing hNF-LE397K results in abnormal gaiting in a transgenic model of CMT2E . Genes Brain Behav ., 11 , 360 – 365 . OpenUrl CrossRef PubMed 20. Dequen , F. , Filali , M. , Lariviere , R.C. , Perrot , R. , Hisanaga , S. and Julien , J.P . ( 2010 ) Reversal of neuropathy phenotypes in conditional mouse model of Charcot-Marie-Tooth disease type 2E . Hum. Mol. Genet ., 19 , 2616 – 2629 . OpenUrl CrossRef PubMed Web of Science 21. ↵ Filali , M. , Dequen , F. , Lalonde , R. and Julien , J.P . ( 2011 ) Sensorimotor and cognitive function of a NEFL(P22S) mutant model of Charcot-Marie-Tooth disease type 2E . Behav. Brain Res ., 219 , 175 – 180 . OpenUrl CrossRef PubMed Web of Science 22. ↵ Zhao , J. , Brown , K. and Liem , R.K.H . ( 2017 ) Abnormal neurofilament inclusions and segregations in dorsal root ganglia of a Charcot-Marie-Tooth type 2E mouse model . PLoS One , 12 , e0180038 . OpenUrl CrossRef PubMed 23. ↵ Miltenberger-Miltenyi , G. , Janecke , A.R. , Wanschitz , J.V. , Timmerman , V. , Windpassinger , C. , Auer-Grumbach , M. and Loscher , W.N . ( 2007 ) Clinical and electrophysiological features in Charcot-Marie-Tooth disease with mutations in the NEFL gene . Arch. Neurol ., 64 , 966 – 970 . OpenUrl CrossRef PubMed 24. ↵ 24. Bienfait , H.M. , Verhamme , C. , van Schaik , I.N. , Koelman , J.H. , de Visser , B.W. , de Haan , R.J. , Baas , F. , van Engelen , B.G. and de Visser , M. ( 2006 ) Comparison of CMT1A and CMT2: similarities and differences . J. Neurol ., 253 , 1572 – 1580 . OpenUrl CrossRef PubMed 25. ↵ Arnold , W.D. , Sheth , K.A. , Wier , C.G. , Kissel , J.T. , Burghes , A.H. and Kolb , S.J . ( 2015 ) Electrophysiological Motor Unit Number Estimation (MUNE) Measuring Compound Muscle Action Potential (CMAP) in Mouse Hindlimb Muscles . J. Vis. Exp . 26. ↵ Rich , K.A. , Pino , M.G. , Yalvac , M.E. , Fox , A. , Harris , H. , Balch , M.H.H. , Arnold , W.D. and Kolb , S.J . ( 2023 ) Impaired motor unit recovery and maintenance in a knock-in mouse model of ALS-associated Kif5a variant . Neurobiol. Dis ., 182 , 106148 . OpenUrl CrossRef PubMed 27. ↵ Kaiser , T. , Allen , H.M. , Kwon , O. , Barak , B. , Wang , J. , He , Z. , Jiang , M. and Feng , G . ( 2021 ) MyelTracer: A Semi-Automated Software for Myelin g-Ratio Quantification . eNeuro ., 8 . 28. ↵ 28. Smith , C.E. , Lorson , M.A. , Ricardez Hernandez , S.M. , Al Rawi , Z. , Mao , J. , Marquez , J. , Villalon , E. , Keilholz , A.N. , Smith , C.L. , Garro-Kacher , M.O. , et al. ( 2022 ) The Ighmbp2D564N mouse model is the first SMARD1 model to demonstrate respiratory defects . Hum. Mol. Genet ., 31 , 1293 – 1307 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted February 06, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Novel neurofilament light (Nefl) E397K mouse models of Charcot-Marie-Tooth type 2E (CMT2E) present early and chronic axonal neuropathy Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Novel neurofilament light ( Nefl ) E397K mouse models of Charcot-Marie-Tooth type 2E (CMT2E) present early and chronic axonal neuropathy Dennis O. Pérez-López , Audrey A. Shively , F. Javier Llorente Torres , Mohammed T. Abu-Salah , Michael L. Garcia , W. David Arnold , Monique A. Lorson , Christian L. Lorson bioRxiv 2025.02.02.636117; doi: https://doi.org/10.1101/2025.02.02.636117 Share This Article: Copy Citation Tools Novel neurofilament light ( Nefl ) E397K mouse models of Charcot-Marie-Tooth type 2E (CMT2E) present early and chronic axonal neuropathy Dennis O. Pérez-López , Audrey A. Shively , F. Javier Llorente Torres , Mohammed T. Abu-Salah , Michael L. Garcia , W. David Arnold , Monique A. Lorson , Christian L. Lorson bioRxiv 2025.02.02.636117; doi: https://doi.org/10.1101/2025.02.02.636117 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Neuroscience Subject Areas All Articles Animal Behavior and Cognition (7625) Biochemistry (17652) Bioengineering (13874) Bioinformatics (41890) Biophysics (21429) Cancer Biology (18567) Cell Biology (25467) Clinical Trials (138) Developmental Biology (13365) Ecology (19874) Epidemiology (2067) Evolutionary Biology (24294) Genetics (15591) Genomics (22478) Immunology (17717) Microbiology (40331) Molecular Biology (17153) Neuroscience (88496) Paleontology (666) Pathology (2828) Pharmacology and Toxicology (4817) Physiology (7635) Plant Biology (15114) Scientific Communication and Education (2044) Synthetic Biology (4286) Systems Biology (9817) Zoology (2268)