Modeling canine hemangiosarcoma progression using patient-derived 2.5D organoids and orthotopic xenografts | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Modeling canine hemangiosarcoma progression using patient-derived 2.5D organoids and orthotopic xenografts Tatsuya Usui, Yishan Liu, Haru Yamamoto, Mohamed Elbadawy, Amira Abugomaa, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8550766/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Dogs commonly suffer from hemangiosarcoma (HSA) similar to human angiosarcoma (AS). The lack of adequate insight into the pathogenesis of canine HSA leads to clinical treatment failure. Thus, developing relevant preclinical models is instrumental for understanding disease and discovering new treatment strategies. In this study, we successfully generated canine HSA 2.5D organoids from patient-derived tumor tissues. After confirming specific marker expression in the organoids, we performed drug-sensitivity tests and compared the transcriptional patterns of HSA with those of nodular hyperplasia (NH) organoids to explore the mechanisms underlying malignant tumor development. Genes upregulated in the HSA group, such as Phospholipase A and Acyltransferase ( PLAAT)3, were identified as potential biomarkers for HSA. Gene knockdown experiments using siRNA as well as the chemical inhibition of PLAAT3 suppressed the invasion of HSA 2.5D organoid cells, with mild inhibition of proliferation. Furthermore, we established an orthotopic xenograft mouse model via splenic injection of HSA 2.5D organoid cells. The developed xenograft metastasized to other organs, and associated tissue pathology corresponded to the characteristics of the original tissues. In conclusion, the established 2.5D HSA organoid and xenograft model may present a new experimental platform for exploring novel therapeutic targets for both canine HSA and human AS. Biological sciences/Cancer/Cancer models Health sciences/Oncology/Cancer/Sarcoma Biological sciences/Stem cells/Cancer stem cells Angiosarcoma Dog Hemangiosarcoma Organoid Orthotopic xenograft model PLAAT3 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Canine hemangiosarcoma (HSA) is a malignant endothelial cell-derived tumor, which accounts for a relatively low percentage (1.3–2.8%) of canine cancer cases 1 . As a highly invasive cancer, HSA often metastasizes to the liver and lungs through blood vessels 2,3 . Because HSA shares several pathological characteristics and molecular signatures with human angiosarcoma (AS) 4 , it is considered a more relevant preclinical model than rodent models for advancing AS research. Conventional therapies for HSA include surgery and chemotherapy with drugs such as doxorubicin. However, the median survival time after chemotherapy is six months, whereas that after surgery alone is two to three months 5 . Therefore, to better understand disease progression and develop new treatment options, a more suitable animal model is required to uncover the transcriptional profiles associated with cancer progression. Clinically, splenic masses in dogs are mostly benign tumors, including nodular hyperplasia (NH). Splenic NH is defined as the overgrowth of normal splenic components, forming a well-restricted proliferative lesion 6 . During new target development, a common method includes the comparison of the transcriptional patterns between cancerous and healthy tissues. Several sequencing studies comparing HSA with normal healthy tissues have reported various mutated genes such as TP53 and PIK3CA, which are implicated in DNA repair, and those associated with the PI3K/AKT/mTOR and MAPK/ERK pathways, which are involved in cell proliferation 7-9 . However, a comparison of HSA with healthy tissues may not completely reveal the characteristics of cancerous proliferation. Fast-proliferating NH may provide a reference for identifying the cause of malignant metastasis. Although the propensity for metastasis has been reported to be highly associated with lysosomal 10 and membrane dysfunction 11 , their roles in HSA remain unclear. Several currently established mouse models replicating the biological and molecular characteristics of HSA have been reported; however, these models are mainly based on the direct subcutaneous transplantation of patient tumor tissues into immunodeficient mice 12,13 . Therefore, these models cannot recapture the metastatic features of the original tumor within the liver or other organs. Given that high invasion and metastasis are key factors responsible for treatment failure and poor prognosis in dogs with HSA, a new reliable mouse model is urgently needed for mechanistic studies and drug development. In previous studies, we established a 2.5D organoid culture method using tumor tissues from dogs with bladder, breast, and lung cancers, which could recapitulate the characteristics of the original tumor tissues 14,15 . In the present study, we aimed to establish and characterize HSA 2.5D organoids and compare these with NH organoids. HSA markers CD31, vWF, and VEGF were validated, and gene expression profiles between HSA and NH organoids were examined along with transcriptional differences, particularly those related to metastasis and invasion such as lysosomal membrane-related pathways and genes such as phospholipase A and acyltransferase ( PLAAT)3 . Additionally, the effects of PLAAT3 knockdown and chemical inhibition in HSA cells on their invasion and proliferation were demonstrated. Finally, we attempted to establish an orthotopic xenograft model via splenic injection and successfully established 3D organoids using xenograft tumor tissues. Materials and Methods Sample collection and HSA 2.5D organoid culture All dog owners provided written informed consent for the present study, and all experimental procedures were carried out according to the guidelines of the Institutional Animal Care and Use Committee of Tokyo University of Agriculture and Technology (Approval number: 0020007). Sample information is presented in Table 1. Standard hepatectomy and/or splenectomy and mastectomy were performed with informed consent from the owner. Tissue sections used for primary culture were obtained from the same positions that were used in pathological diagnosis and immunohistochemistry (IHC) staining. The samples were immediately transferred to a cooled shipping medium and transported to our laboratory. HSA 2.5D organoids were generated using methods described in our previous study 14 . Culture conditions, medium type, supplements, growth factors, cell handling, and passages were identical. The culture medium comprised advanced DMEM including 50% Wnt, R-spondin, and Noggin conditioned medium; 100 µg/mL Primocin; 10 mM nicotinamide; 1% GlutaMax; and 1 mM N-Acetyl-L-cysteine (Thermo Fisher Scientific, Waltham, MA, USA); 500 nM A83-01 (Adooq Bioscience, Irvine, CA, USA); and 50 ng/mL mouse EGF (PeproTech, Rocky Hill, NJ, USA). All representative phase-contrast images of the cultured cells were captured using a light microscope (BX-52; Olympus, Tokyo, Japan). Table 1. Patient information. Group Sample No. Age Gender Breed Sample tissue site HSA BS23019 7 ♂ Labrador Retriever spleen HSA BS22032 12 ♀ Miniature Dachshund spleen HSA BS23014 11 ♂ Miniature Schnauzer spleen HSA BS23011 15 ♂ Miniature Dachshund spleen HSA BS23026 10 ♂ Mixed spleen HSA BS24008 11 ♀ Shetland Sheepdog spleen HSA BS24026 11 ♂ Miniature Dachshund pelvic lymph node HSA BS24028 13 ♂ Scottish Sheepdog spleen HSA BS24054 12 ♀ Golden Doodle spleen HSA BS24058 6 ♂ Standard Poodle spleen, left submandibular lymph node HSA BS24061 no info ♀ Mixed spleen HSA BS24063 14 ♂ Shiba Inu spleen HSA BS24069 14 ♂ Shiba Inu spleen HSA BS24073 5 ♀ Miniature Dachshund spleen, skin mass HSA BS24077 no info ♂ Mixed spleen NH BS23030 10 ♀ Shiba Inu Celiac lymph node NH BS23039 15 ♂ Miniature Dachshund spleen NH BS23033 12 ♂ Maltese spleen NH BS23021 11 ♂ Mixed spleen mass, spleen lymph node NH BS23032 8 ♀ Mixed spleen NH BS24054 12 ♀ Golden Doodle spleen Hematoxylin and Eosin (H&E) staining Paraffin sectioning and H&E staining were conducted according to standard procedures, as described previously 16 . All sections were stained with hematoxylin and eosin for 4 min and 30 s, respectively. Sections were observed and imaged using a light microscope (BX-52; Olympus, Tokyo, Japan). Immunohistochemical ( IHC ) staining IHC staining was performed on paraffin-embedded sections, 4 μm in thickness. The following antibodies were used: rabbit polyclonal CD31 antibody (GeneTex, catalog No. GTX130274; 1:500), polyclonal PDGFRβ antibody (SAB biotech, catalog No. #41327; 1:200), mouse monoclonal PLA2G16 (PLAAT3) antibody (OriGene, catalog No. TA506908S; 1:200), and rabbit polyclonal Von Willebrand factor antibody (abcam, ab6994; 1:200). Sections were deparaffinized with xylene and subsequently rehydrated with ethanol and distilled water. For antigen retrieval, sections were autoclaved at 121 °C with sodium citrate buffer for 5 min, followed by cooling at room temperature (RT). After washing, sections were quenched with 1% hydrogen peroxide for 30 min. Sections were incubated overnight at 4 °C with primary antibodies (CD31, 1:500; PDGFRβ, 1:200; PLAAT3, 1:200; vWF, 1:200; and VEGF, 1:200) diluted in 0.5% casein in a humid box. After washing with PBS, sections were incubated in an HRP system and stained using a Dako kit (K3468) following the manufacturer's protocol. After DAB staining, sections were counterstained with hematoxylin, dehydrated using ethanol and xylene, mounted with Polymount, dried, and examined. The sections were observed and imaged using a light microscope (BX-52; Olympus, Tokyo, Japan). Immunofluorescence (IF) staining Immunofluorescence staining of HSA 2.5D organoids was performed as previously described 14,15 . Immunofluorescent HSA 2.5D organoid cells (2 × 10 5 /well) were seeded onto round cover glasses in a 6-well plate. After reaching 80% confluence, cells were fixed in 4% PFA for 1 h at RT. Subsequently, the cover glasses were washed three times with PBS and blocked with 1.5% normal goat serum (diluted in PBS) for 30 min at RT, and subsequently incubated in a humid box overnight at 4° C with primary antibodies (CD31, 1:300; PLAAT3, 1:100; vWF, 1:200; and VEGF, 1:200) diluted in PBS. After washing with PBS, the slides were incubated with Hoechst (1:1000) and with a secondary antibody for 60 min at RT in the dark. Representative images were captured and analyzed. The secondary antibodies used were: Goat Anti-Rabbit IgG H&L (Alexa Fluor® 488) (ab150077) and Goat Anti-Mouse IgG H&L (Alexa Fluor® 488) (ab150113). All samples were observed under a fluorescence microscope (DAPI and FITC). Semi-quantitative analysis of fluorescence was performed using the ImageJ software. Cell viability screening Cytotoxicity activities were evaluated via the PrestoBlue™ Cell Viability assay. Cells (1×10 4 cells/well) were seeded in 96-well plates containing 2.5D medium. After 24 h, cells were treated with dimethyl sulfoxide (DMSO; vehicle), toceranib (Sigma Aldrich, America, MI, USA; at 2 μM, 4 μM, and 8 μM), carboplatin (FUJIFILM Wako Pure Chemical, Tokyo, Japan; at 1 μM, 10 μM, and 100 μM), cyclophosphamide (at 1 μM, 10 μM, and 100 μM ), or doxorubicin (Cayman Chemical, Ann Arbor, MI, USA; at 1 μM, 10 μM, and 100 μM ), and incubated at 37 °C for 72 h. Following incubation, 10 μM of PrestoBlue™ Cell Viability Reagent (Thermo Fisher Scientific) was added to each well, and the cells were incubated for an additional 3 h at 37 °C. Fluorescence (emission wavelength: 585 nm) was measured using a microplate reader (TECAN, Seestrasse, Switzerland). The chemical and company names were as follows: LEI110 (MCE, HY-125254), toceranib (Sigma, No. PZ0338), doxorubicin (Cayman Chemical, 25316-40-9), cyclophosphamide (TCI, 6055-19-2), and carboplatin (Fujifilm, 41575-94-4). RNA isolation and real-time polymerase chain reaction (PCR) Isolated RNA was converted to first-strand cDNA using the ReverTra Ace qPCR RT Kit (Toyobo Co., Ltd., Osaka, Japan) following the manufacturer’s protocol. Real-time PCR was performed using the QuantiTect SYBR I kit (Qiagen, Hilden, Netherlands) and StepOnePlus Real-Time PCR system (Applied Biosystems, Waltham, Massachusetts, USA). The ΔΔ Cq method was used to quantify the data. Each cDNA sample was amplified with primers and run in triplicate. The expression level of each gene was normalized to GAPDH levels in each sample. Primers (FASMAC Co., Kanagawa, Japan) used for canine genes MARVELD3, Huntingtin-interacting protein 1 (HIP1), PLAAT3, and GAPDH are listed in Table 2. Table 2. Primers for real-time PCR analysis Gene name Forward Rev erse Canine MARVELD3 CAGGGGTTACCGAAAAGTCA TTCATCGCTCACCAACAGAG Canine HIP1 CCAGCTTGCCAAAGACCAAC GAAGTGGCAGCCATCTCCTT Canine PLAAT3 ACACTGGGCCATCTACGTTG TTGCTTCTGCCGCTTGTTTC Canine GAPDH AACTCCCTCAAGATTGTCAGCAA CATGGATGACTTTGGCTAGAGGA RNA sequencing RNA was generated from the tumor tissues and harvested organoids using the NucleoSpin RNA kit (TAKARA, Tokyo, Japan), and converted to first-strand cDNA using the ReverTra Ace qPCR RT Kit (Toyobo Co., Ltd., Osaka, Japan) following the manufacturer's protocols. Ten samples (HSA: NH = 5:5) were collected from the clinic for sequencing. One microgram of the total RNA from each sample was used for library preparation. Poly(A) mRNA isolation was performed using Oligo(dT) beads. mRNA fragmentation was performed using divalent cations at high temperatures. Priming was performed using Random Primers. First-strand and second-strand cDNA were synthesized. The purified double-stranded cDNA was subsequently treated to repair both ends and to add a dA-tailing in one reaction, followed by a T-A ligation to add adaptors to both ends. Size selection of the adaptor-ligated DNA was performed using DNA Clean Beads. Each sample was then amplified by PCR using primers P5 and P7, and the PCR products were validated. Libraries with different indices were multiplexed and loaded onto an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2 × 150 paired-end (PE) configuration, according to the manufacturer’s instructions. Reference genome sequences and gene model annotation files of relative species used in this study were downloaded from genome websites, such as UCSC, NCBI, and ENSEMBL. Hisat2 (v2.2.1) was used to index the reference genome sequence and align clean data to the reference genome. Transcripts in FASTA format were converted from known GFF annotation files and appropriately indexed. Using the file as a reference gene file, the gene and isoform expression levels were estimated from the paired-end clean data using HTSeq (v0.6.1). Differential expression analysis was performed using the DESeq2 Bioconductor package, a model based on negative binomial distribution. Estimates of dispersion and logarithmic fold changes incorporated data-driven prior distributions. Padj was set at ≤ 0.05 to detect differentially expressed genes (DEGs). GOSeq (v1.34.1) was used to identify Gene Ontology (GO) terms that annotated a list of enriched genes with Padj ≤ 0.05. TopGO was used to plot the DAG. Gene expression was measured via read density and calculated as fragments per kilobase per million reads (FPKM). The formula was as follows: Orthotopic patient-derived xenograft mouse model Ten-week-old C.B-17/IcrHsd-Prkdc SCID mice were anesthetized via isoflurane inhalation and positioned on their right side. The area above the spleen was shaved, and the skin was sterilized using 80% ethanol. A subcostal incision (approximately 2 cm) was made below the ribs to access the peritoneal cavity, exposing the spleen. Primary cultured cells were gently resuspended and slowly injected into the spleen. Following injection, the site was gently compressed for 2 min using a cotton swab to prevent backflow. The spleen was then repositioned at its site in the abdominal cavity, and the peritoneum and skin layers were sutured. Ten weeks post-injection, mice were sacrificed and spleens with tumor masses were excised and examined. Screening for antiproliferative effects of anticancer agents Two 2.5D organoid cell lines, BS24026 and BS24077, were evaluated in a screening test. Cells were trypsinized and resuspended in culture medium for maintenance. Cells were suspended at 5×10 3 cells/well in a 384-well plate using the Braco automated liquid handling platform (Agilent Technologies, Santa Clara, CA, USA) and cultured in a CO 2 incubator overnight at 37 °C. The following day, after seeding, 214 anticancer agents (Selleck Chemicals, Houston, TX, USA) were added at a fixed concentration of 10 µM using the same handler. The anticancer agents used in this study are listed in Supplementary Table 1. After 144 h of incubation, the CCK-8 assay was performed according to the manufacturer's protocol to evaluate the proliferation suppression efficiency of each agent using a multimode Epoch multiplate reader (BioTeck, Winooki, VT, USA). To estimate the relative proliferation inhibition, the suppression efficiency relative to that of the control (DMSO) was calculated. The half-maximal inhibitory concentration (IC 50 ) values of the selected agents were calculated through dose-response experiments. The signal values were plotted from the normalized cell numbers against the tested drug concentrations using GraphPad Prism. This analysis was repeated twice. Cell proliferation assay HSA 2.5D organoid cells were seeded in 96-well plates at 1000 cells/100 µl medium/well. The number of living cells was detected via the PrestoBlue™ Cell Viability assay on days 1, 4, and 7, and analyzed by measuring the fluorescent intensity in each well using a Tecan microplate reader, as previously described 14 . Boyden chamber invasion assay Matrigel was diluted with serum-free medium (advanced DMEM) at a ratio of 1:1. For invasion assays, 50 μL of diluted gel was dropped in each Transwell® insert (8 μm PET membrane, Corning 3464). The gel was then fixed at 37 °C in a CO 2 incubator for 1 h. After fixation, the extra medium was aspirated into the insert. Cells were trypsinized and resuspended in serum-free DMEM. Next, 3×10 4 cells were resuspended in 300 μL serum-free media with treatment or vehicle and seeded into the upper chamber. Thereafter, 600 μL of culture medium with 10% FBS as a chemoattractant was added to the lower chambers. Cells were maintained overnight in an incubator at 37 °C with 5% CO 2 . After 24 h, the Transwell inserts were washed twice with PBS, and the cells were fixed with 4% PFA for 2 min and methanol for 20 min at RT. The cells on the upper side of the inserts were removed using cotton swabs, and the lower side of the membrane was stained with Giemsa solution for 15 min at RT. Invading and migrating cells were observed and imaged using an optical microscope (BX52, Olympus, Japan). PLAAT3 siRNA transfection HSA 2.5D organoid cells were seeded at a density of 10 5 cells/well in a 6-well plate. After 24 h of culture, cells were transfected with siRNA against PLAAT3 or negative control siRNA (Sequence (5'–3'): si 1, AGCACAUCACACAACAUUA and si 2, AAUGGUGGUUAUUCAGUUC) using Lipofectamine RNAiMAX (Invitrogen) following the manufacturer's protocol. After 72 h, the cells were harvested, and evaluations were performed via cell proliferation assay, cell invasion assay, and quantitative RT-PCR. Statistical analysis Data are shown as mean ± SEM. Statistical analysis was conducted using GraphPad Prism; the two-tailed Student’s t-test was used. P values < 0.05 were considered statistically significant. Results Generation of 2.5D organoids from dogs with HSA and nodular NH Primary cultured 2.5D organoids of HSA and NH were generated from patient spleen tissues after pathological confirmation (Fig. 1A). Histopathology of canine HSA samples post-surgery revealed a loss of normal vascular structure, which was associated with the formation of irregular, anastomosing vascular channels or sheets with enlarged hyperchromatic nuclei and prominent nucleoli, whereas NH samples presented with a well-organized structure with minimal atypia. HSA is generally characterized by relatively homogeneous populations of neoplastic endothelial cells, forming an invasive mass that is often poorly defined in adjacent tissues. NH usually appears as a well-restricted lesion, clearly separated from the adjacent normal tissue (Fig. 1B). IHC staining confirmed the expression of the angiosarcoma marker vWF, endothelial marker CD31, and VEGF in both HSA and NH 2.5D organoids, with a similar difference in expression levels in the primary tumor (Fig. 1B), which corresponded with the IF staining pattern in primary cultured HSA and NH 2.5D organoids (Fig. 1C). Establishment of an orthotopic xenograft mouse model using dog HSA 2.5D organoids Next, we established an orthotopic xenograft mouse model to simulate the pathology of HSA (Fig. 2A). Ten weeks after splenic injection with HSA 2.5D organoid cells in C.B-17/IcrHsd-Prkdc SCID mice, nine mice successfully developed orthotopic HSA in the spleen. Four out of nine mice showed liver metastasis, and three mice showed pancreatic metastasis (Fig. 2A, B, Supplemental Fig. 1A). H&E staining revealed an abnormal vessel-like cliff structure in the xenografted spleen tissues. Largely enlarged nuclei along with rapid and extensive infiltrating overgrowth of vascular endothelial cells were observed in the tumor masses inside and outside the spleen tissues (Fig. 2C). Moreover, IHC staining validated the expression of CD31, vWF, and PDGFRβ in the xenografted tumor tissues (Fig. 2C). To confirm drug sensitivity, we generated tumor cells from orthotopic xenograft tumor tissues using the 2.5D culture method (Supplementary Fig. 1B). Drug screening of orthotopic xenograft tumor-derived 2.5D organoids demonstrated a corresponding sensitivity to the original patient-derived 2.5D HSA organoids (Supplementary Fig. 1C). In addition, we successfully generated HSA 3D organoids using both tissue-generated cells and 2.5D orthotopic xenograft organoids (Fig. 3A, Supplementary Fig. 2). Primary cultured 3D organoids began to form on day 10 of culture, exhibiting hollow-like structures. Immunohistochemical expression of CD31 and vWF revealed endothelial features, whereas PDGFRβ expression confirmed the existence of pericyte cells in HSA 3D organoids (Fig. 3A), indicating the variety of cell types generated in HSA organoids. Furthermore, transmission electron microscopy (TEM) revealed a hollow luminal structure in HSA organoids (Fig. 3B). Atypical cells with enlarged, deformed nuclei containing multiple prominent nucleoli were arranged in an overlapping pattern, forming lumen-like structures. The cells exhibited slender cytoplasmic processes with deep interdigitation and relatively abundant microvilli on the luminal surface. The intercellular junctions included microvillous interdigitations and tight junctions along the free borders, whereas the abluminal side presented with pores. In some regions, the absence of a basement membrane resembled the sinusoidal capillaries of the liver or spleen. These atypical cells are rich in organelles, such as mitochondria, rough endoplasmic reticulum, free ribosomes, and the Golgi apparatus. Tonofilaments connected to desmosomes were present, and numerous pinocytic vesicles of variable sizes, some cystically dilated, were observed near the luminal surface. In a very small portion, granules resembling melanosomes were observed (Fig. 3C). Based on these features, the lesion was diagnosed as a well-differentiated vascular endothelial cell sarcoma. Drug sensitivity in HSA 2.5D organoids Carboplatin, doxorubicin, toceranib, and cyclophosphamide are commonly used chemotherapies for HSA in pet clinics. Therefore, we conducted drug sensitivity tests using HSA 2.5D organoids to determine the optimal postoperative chemotherapy for HSA. We treated five HSA organoid lines with toceranib, carboplatin, cyclophosphamide, and doxorubicin (Fig. 4A). HSA 2.5D organoids from different patients showed different sensitivities to toceranib, carboplatin, and doxorubicin (Fig. 4A), suggesting individual variability in the response to chemotherapy. To further explore the responses of the established HSA 2.5D organoid lines to different chemotherapeutics, we administered 200 conventional chemotherapeutics, including cytotoxic agents, tyrosine kinase inhibitors (CDK/mTOR/PI3K inhibitors, HDAC inhibitors, etc.), and molecular-targeted agents (ALK inhibitors, BCR-ABL inhibitors, EGFR/VEGF/multi-kinase inhibitors, etc.) to two of our successfully established HSA 2.5D organoid lines. Both HSA lines showed the highest sensitivity to ALK and HDAC inhibitors (Fig. 4B). We calculated IC50 values to evaluate the efficacy of the top three ALK and HDAC inhibitors. All six drug IC50s were below 1.5 µM in two HSA lines (Fig. 4C, D), which may be considered a relatively high sensitivity. These data suggest new options for post-surgical chemotherapy against canine HSA. Comparison of transcriptional profiles between HSA and NH 2.5D organoids RNA sequencing was conducted to compare expression profiles between NH and HSA 2.5D organoids (Fig. 5A, B, C). Gene set enrichment analysis of DEGs revealed that pathways related to autophagy, autophagic membrane, lysosomes, and lysosomal membrane were upregulated in HSA 2.5D organoids (Fig. 5D). Genes related to the cellular membrane, lysosomal membrane, and autophagy, such as HIP1 , PLAAT3 , and BNIP3 , were found to be upregulated in HSA 2.5D organoids compared to NH organoids (Fig. 5E). Additionally, we confirmed this upregulation in gene expression using quantitative real time PCR. mRNA expression levels of the lysosomal membrane-related gene PLAAT3 was found to be higher in the HSA groups, which was further quantified via IF staining (Fig. 5F). Furthermore, IHC staining showed higher expression of PLAAT3 in HSA tissues than in NH tissues (Fig. 5G). Effects of PLAAT3 inhibition on cell proliferation and invasion in HSA 2.5D organoids To further investigate the functional role of PLAAT3 in HSA, its pharmacological inhibition was performed using an inhibitor, LEI110, and the effects on cell proliferation and invasion in HSA 2.5 organoid were assessed. LEI110 showed varying inhibitory effects on several HSA 2.5D organoid lines (Fig. 6A). In the invasion assay, 10 and 20 μM of LEI110 treatment resulted in significantly fewer invasive cells in HSA 2.5D organoids than in the vehicle-treated cells, suggesting pharmacological inhibition of PLAAT3 via LEI110, thereby effectively inhibiting invasion ability (Fig. 6B). Given that chemically inhibiting PLAAT3 suppressed cell proliferation and invasion, we subsequently performed genetic knockdown using siRNA (Fig. 6C). The cell viability assay showed a relative inhibitory effect on knockdown cells on day 4 and a significant inhibitory effect on day 7 in each cell line (Fig. 6D). In the cell invasion assay, knockdown of PLAAT3 resulted in almost no invasion when compared with negative control siRNA treatment (Fig. 6E). Discussion CD31, CD34, and vWF are core endothelial markers commonly investigated in AS and HSA research 17 , and are valuable in AS diagnosis to confirm endothelial cell origin. However, in the case of canine HSA, CD31/vWF may not be reliable distinguishing markers of HSA and NH. Similarly, the majority of canine HSA cases exhibit positive expression of CD31/vWF, indicating endothelial derivation 18 . Although both markers were expressed in HSA and NH, their expression patterns differed, with CD31 and vWF demonstrating a more even distribution in the NH samples. In contrast, CD31 expression in HSA tissues exhibited diffuse positive staining around the vascular-like structures, whereas vWF demonstrated characteristics similar to those reported in canine vascular neoplasms; a few cases showed strong positivity, with most presenting as focal weak positive or negative 19 . In the samples assessed in the present study, the positive areas were predominantly concentrated within vascular-like structures and appeared negative or weakly positive in regions containing proliferative tumor cells. This observation aligns with research reporting that mature endothelial cells exhibit higher vWF expression than undifferentiated cells 20 . Active VEGF expression is observed in canine vascular tumors 21 such as HSA, as well as in breast cancers 22,23 . Not all studies have demonstrated a direct statistical association between inflammatory cells and other proangiogenic factors with a poorer prognosis; nevertheless, research indicates that a high expression of VEGF receptors correlates with heightened proliferative activity, with inflammatory cells potentially maintaining or amplifying these signals 21 . Although angiogenesis was less frequently observed in NH samples, VEGF expression (detected via IHC) in these lesions may be associated with local proliferation activities, such as regeneration and repair, rather than malignant vascularization. We found an upregulation of the lysosomal membrane markers in HSA samples, indicating lysosomal dysfunction, which is associated with various diseases, such as Alzheimer's disease and cancer. Active cancer cell proliferation is highly dependent on effective lysosomal function. In addition to our sequencing results, evidence from the case comparing canine hemangiosarcoma with normal granular cells showed lysosome-like ultrastructural proteinaceous accumulation within single membrane vesicles 24 , indicating the presence of active lysosomes. The upregulation of lysosomal membrane pathways leads to enhanced lysosomal trafficking and membrane permeability. Correspondingly, we found that lysosomal trafficking related to GLMP, GAA 25,26 , and PLAAT3 was upregulated. PLAAT3, which belongs to the PLAAT family, is known to exhibit phospholipase A2 activity, mediating lipid reprogramming and glycerophospholipid remodeling in cancer cells; PLAAT3 is consistently reported to be highly expressed and activated in various cancers. 27-30 PLAAT3 upregulation enables N-acyltransferase activity, resulting in membrane-associated protein dysfunction, cathepsin upregulation, and mislocalization, thereby promoting tumor invasion and migration 31 . Our PLAAT3 knockdown experiments using siRNA and PLAAT3 inhibitor treatment of HSA 2.5D organoids demonstrated significant inhibition of cell migration and invasion. Given that PLAAT3 is related to metastasis and membrane permeability, and is associated with increased drug sensitivity in human osteosarcoma, we carried out a combination treatment cell viability test; a higher sensitivity to each drug was observed upon co-treatment with a PLAAT3 inhibitor. Moreover, lipid accumulation in endothelial cells is related to angiogenesis and angiogenic sprouting 32,33 . PLAAT3 (also known as HRASLS3 , PLA2G16 , H-rev107, or AdPLA ), through the POR pathway via its PLA2 activity, is involved in lipid accumulation within liver cells 34 . PLAAT3 was found to be upregulated in our study, suggesting that it contributes to active angiogenesis in HSA vs NH. Although pharmacological inhibition and knockdown of PLAAT3 led to a mild reduction in cell proliferation, our findings suggest that PLAAT3 additionally contributes to angiogenesis; however, it may play a supportive rather than an essential role, such as in cell migration and invasion. Therefore, PLAAT3 is a potential pharmacological target and prognostic tool for HSA. Our study revealed upregulated genes in HSA 2.5D organoids, including PLAAT3 , HIP1, and MARVELD3, when compared with NH organoids. HIP1 is an endocytic protein with protein-trafficking properties within the cell, especially huntingtin binding in the brain. Although the pathogenesis of Huntington's disease may be attributable to the loss of this interaction 35 , HIP1 overexpression has been observed in prostate and colon cancer 36 , which aligns with our findings regarding increased HSA-associated expression. Studies of the prostate and colon suggest that HIP1 overexpression is a late episode in cancer progression, and may not be sufficient as a diagnostic marker; HIP1 can transform fibroblasts, and cells overexpressing HIP1 show upregulation of basic fibroblast growth factor (bFGF) 37 . bFGF was found to promote tumor vascularization and subsequent growth 38 . Therefore, HIP1 may play an oncogenic role in HSA, warranting further investigation. We observed the absence of a basement membrane along with pores at the intercellular junctions, both in organoids and canine HSA tissue. This may be due to changes in gene regulation. MARVELD3, a member of the TAMP family, which is associated with tight junctions and epithelial remodeling, is a regulator of epithelial cell proliferation, migration, and survival in human colon and pancreatic cancer; moreover, MARVELD3 was found to be upregulated in oral squamous cell carcinoma 39-41 . In our study, RT-PCR revealed a significant increase in the number of HSA cells; however, sequencing of FPKM suggested a non-significant upregulation. The changes in other TAMP family members, such as MARVELD1 and MARVELD2 , shared a similar pattern as seen in oral squamous cell carcinoma 39 : increased MARVELD1 in the patient group and equal MARVED2 transcriptional levels in both the patient and healthy groups. Although the findings of our study provide some insights, they should be interpreted with caution because of the limited sample size. Further research with a larger sample size is required to validate these results. Somatic mutations in PIK3CA and TP53 have been identified in both HAS and AS; however, in our samples, the FPKM values of these genes showed no significant changes. In this study, we successfully established nine orthotopic xenograft canine HSAs using splenic injection. The histopathological structure of the xenograft mass was similar to that of the original tumor tissue, with a vascular-like cleft formation and high nuclear atypia. In addition, IHC staining detected vWF 42 , canine endothelial cell marker CD31 43 , and angiogenesis-related VEGF 44 immunoreactivity in the xenograft tumor mass, sharing similar distribution patterns as canine HSA tumor tissues, indicating that our xenograft model could maintain the original endothelial features. Moreover, the morphology of the primary cultured cells simulated that of the original patient cells, and drug sensitivity testing showed a comparable drug sensitivity trend. In conclusion, our model preserved the morphological and innate characteristics of the original tissues. In human colorectal cancer 45,46 and renal cell carcinoma 47 , orthotopic models tend to display a greater tendency to metastasize to other organs than heterotopic transplanted models. Human osteosarcoma cases have reported a similar metastatic pattern in orthotopic models 48 . The use of patient-derived tissue flaps via subcutaneous transplantation in nude mice have helped establish HAS models 49 ; however, such models do not show liver metastasis, which is a central clinical feature. In our study, only four out of nine xenografts developed liver metastasis. This may be attributed to the limited duration (10 weeks) of tumor generation or the leak from the injection point, as three out of five cases without metastasis showed pancreatic seedings of the hemangiosarcoma mass. Being able to recapitulate the 3D structures and components of original tissues, organoids are useful models for evaluating the therapeutic potential of drugs. In the present study, we successfully generated HSA 3D organoids using xenograft tumor cells. Our generated organoids effectively maintained endothelial features, forming a complex, interconnected network of CD31-positive cells along with vWF-positive cells on the luminal side of the organoids. IHC staining demonstrated proper localization of pericytes as defined by PDGFRβ immunoreactivity, following a pattern of enveloping CD31-positive endothelial cells, suggesting diverse cell types in our cultured organoids. However, the functions of diverse cells require further exploration. The development of the xenograft mass into 3D organoids rather than primary tissue may be attributed to in vivo selection of more aggressive tumor cell clones during xenograft progression, leading to the generation of xenograft tumor cells having the capacity for 3D structure 50 . TEM indicated ultrastructural details in our cultured organoids that shared common features with canine HSA with vasoformation; a slit-like structure was observed in canine HSA, and our organoids appeared to have a luminal hollow structure resembling vascular lumina. They shared fragmentary basal laminae, which were partially absent in our organoids and resembled sinusoidal capillaries. Weibel-Palade bodies, which are considered human endothelium markers, found in both rat HSA and mouse AS cases 51-53 , were absent in our HSA organoids as well as in canines cases 24,54 . Our HSA organoids exhibited a relatively well-differentiated endothelial phenotype with complex junctions and lumen formation compared with that of canine tissues. However, to ensure the quality of research tools that can reflect the original patient tumor characteristics, further sequencing studies are necessary. Furthermore, the ability of the models to capture gene mutations and transcriptional profiles should be evaluated. Spontaneous HSA pathology is frequently associated with the coexistence of tumor cells and infiltrating inflammatory cells, which may increase the risk of contamination during direct genetic expression detection in clinical samples. Therefore, the xenograft model and primary cell culture method established in this present study may serve as potent tools to resolve this issue. In conclusion, we successfully generated patient-derived HSA 2.5D and orthotopic xenograft-derived 3D HSA organoid lines. We then compared the transcription patterns between HSA and NH 2.5D organoids, revealing an upregulation of the lysosomal membrane pathway and genes, including PLAAT3 . Our findings indicate PLAAT3 as a novel therapeutic target and prognostic tool for HSA. Declarations Acknowledgments We would like to thank Editage (www.editage.jp) for the English language editing. Author contributions M. E., K. S., and T. U. conceptualized the project and obtained funding. Y. L., H. Y, A. A., M. E., T. U., and K. S. designed the experiments. H. Y. (Haru Yamamoto), Y. L., Y. S., T. K., and M. K. performed the experiments. Y. L. performed data analysis. Y. L., M. E., T. U., and K. S. wrote the manuscript. M. K. edited the manuscript. All authors provided feedback on the manuscript draft. Competing interests The authors declare that they have no competing interests. Data availability The raw data from RNA sequencing of HSA and NH 2.5D organoids are available from the National Center for Biotechnology Information Sequence Read Archive (NCBI SRA) repository (BioProject ID: PRJNA1399620; BioSample accessions: SAMN54501156, SAMN54501157, SAMN54501158, SAMN54501159, SAMN54501160, SAMN54501161, SAMN54501162, SAMN54501163, SAMN54501164, SAMN54501165). Additional information regarding RNA sequencing data is available from the corresponding author upon reasonable request. Additional information Correspondence and requests for materials should be addressed to T.U. and M.E. Reprints and permissions information are available at www.nature.com/reprints. Publisher’s note: Springer Nature remains neutral regarding jurisdictional claims in published maps and institutional affiliations. References Aupperle-Lellbach, H. et al. Tumour incidence in dogs in Germany: a retrospective analysis of 109,616 histopathological diagnoses (2014–2019). J. Comp. Pathol. 198 , 33-55 (2022). https://doi.org/10.1016/j.jcpa.2022.07.009 Batschinski, K. et al. Canine visceral hemangiosarcoma treated with surgery alone or surgery and doxorubicin: 37 cases (2005-2014). Can. Vet. J. 59 , 967-972 (2018). Story, A. L. et al. Outcomes of 43 small breed dogs treated for splenic hemangiosarcoma. Vet. Surg. 49 , 1154-1163 (2020). https://doi.org/10.1111/vsu.13470 Suzuki, T. et al. Current understanding of comparative pathology and prospective research approaches for canine hemangiosarcoma. Res. Vet. Sci. 167 , 105120 (2024). https://doi.org/10.1016/j.rvsc.2023.105120 Thamm, D. & Vail, D. Withrow and MacEwen’s small animal clinical oncology. (2013). DOI: 10.1016/C2009-0-53135-2 Cole, P. A. Association of canine splenic hemangiosarcomas and hematomas with nodular lymphoid hyperplasia or siderotic nodules. J. Vet. Diagn. Invest. 24 , 759-762 (2012). https://doi.org/10.1177/1040638712447580 Megquier, K. et al. Comparative Genomics Reveals Shared Mutational Landscape in Canine Hemangiosarcoma and Human Angiosarcoma. Mol. Cancer. Res. 17 , 2410-2421 (2019). https://doi.org/10.1158/1541-7786.Mcr-19-0221 Wong, K. et al. Comparison of the oncogenomic landscape of canine and feline hemangiosarcoma shows novel parallels with human angiosarcoma. Dis. Model. Mech. 14 , dmm049044 (2021). https://doi.org/10.1242/dmm.049044 Wong, S. et al. Genomic landscapes of canine splenic angiosarcoma (hemangiosarcoma) contain extensive heterogeneity within and between patients. PLoS One 17 , e0264986 (2022). https://doi.org/10.1371/journal.pone.0264986 Pu, J. et al. Mechanisms and functions of lysosome positioning. J. Cell. Sci. 129 , 4329-4339 (2016). https://doi.org/10.1242/jcs.196287 Tian, B. et al. Basement membrane proteins play an active role in the invasive process of human hepatocellular carcinoma cells with high metastasis potential. J. Cancer. Res. Clin. Oncol. 131 , 80-86 (2005). https://doi.org/10.1007/s00432-004-0614-3 Kim, J. H. et al. Hemangiosarcoma Cells Promote Conserved Host-derived Hematopoietic Expansion. Cancer. Res. Commun. 4 , 1467-1480 (2024). https://doi.org/10.1158/2767-9764.Crc-23-0441 Kodama, A. et al. Establishment of canine hemangiosarcoma xenograft models expressing endothelial growth factors, their receptors, and angiogenesis-associated homeobox genes. BMC Cancer. 9 , 363 (2009). https://doi.org/10.1186/1471-2407-9-363 Abugomaa, A. et al. Establishment of 2.5D organoid culture model using 3D bladder cancer organoid culture. Sci. Rep. 10 , 9393 (2020). https://doi.org/10.1038/s41598-020-66229-w Abugomaa, A. et al. Establishment of a direct 2.5D organoid culture model using companion animal cancer tissues. Biomed. Pharmacother. 154 , 113597 (2022). https://doi.org/https://doi.org/10.1016/j.biopha.2022.113597 Liu, Y. et al. Salinomycin induces apoptosis and potentiates the antitumor effect of doxorubicin against feline mammary tumor 2.5D organoids. J. Vet. Med. Sci. 86 , 1256-1264 (2024). https://doi.org/10.1292/jvms.24-0344 Cao, J. et al . Angiosarcoma: a review of diagnosis and current treatment. Am. J. Cancer Res. 9 , 2303-2313 (2019). Lamerato-Kozicki, A. R. et al . Canine hemangiosarcoma originates from hematopoietic precursors with potential for endothelial differentiation. Exp. Hematol. 34 , 870-878 (2006). https://doi.org/10.1016/j.exphem.2006.04.013 Gamlem, H. & Nordstoga, K. Canine vascular neoplasia--histologic classification and inmunohistochemical analysis of 221 tumours and tumour-like lesions. APMIS Suppl. 2008 , 19-40 (2008). https://doi.org/10.1111/j.1600-0463.2008.125m3.x Nakhaei-Nejad, M. et al. Regulation of von Willebrand Factor Gene in Endothelial Cells That Are Programmed to Pluripotency and Differentiated Back to Endothelial Cells. Stem Cells. 37 , 542-554 (2019). https://doi.org/10.1002/stem.2978 Yonemaru, K. et al. Expression of vascular endothelial growth factor, basic fibroblast growth factor, and their receptors (flt-1, flk-1, and flg-1) in canine vascular tumors. Vet. Pathol. 43 , 971-980 (2006). https://doi.org/10.1354/vp.43-6-971 Carvalho, M. I. et al. A Comparative Approach of Tumor-Associated Inflammation in Mammary Cancer between Humans and Dogs. Biomed. Res. Int. 2016 , 4917387 (2016). https://doi.org/10.1155/2016/4917387 Carvalho, M. I. et al. High COX-2 expression is associated with increased angiogenesis, proliferation and tumoural inflammatory infiltrate in canine malignant mammary tumours: a multivariate survival study. Vet. Comp. Oncol. 15 , 619-631 (2017). https://doi.org/10.1111/vco.12206 Bolfa, P. et al. Cutaneous epithelioid hemangiosarcoma with granular cell differentiation in a dog: a case report and review of the literature. J. Vet. Diagn. Invest. 30 , 951-954 (2018). https://doi.org/10.1177/1040638718794785 Franchi, L. et al. Cytosolic double-stranded RNA activates the NLRP3 inflammasome via MAVS-induced membrane permeabilization and K+ efflux. J. Immunol. 193 , 4214-4222 (2014). https://doi.org/10.4049/jimmunol.1400582 Marze, N. et al. Engineering of a lysosomal-targeted GAA enzyme. Protein. Eng. Des. Sel. 38, gzaf001 (2025). https://doi.org/10.1093/protein/gzaf001 Jarrard, W. E. et al. Screening of urine identifies PLA2G16 as a field defect methylation biomarker for prostate cancer detection. PLoS One. 14 , e0218950 (2019). https://doi.org/10.1371/journal.pone.0218950 Shyu, R. Y. et al. H-rev107 regulates prostaglandin D2 synthase-mediated suppression of cellular invasion in testicular cancer cells. J. Biomed. Sci. 20 , 30 (2013). https://doi.org/10.1186/1423-0127-20-30 Uyama, T. et al. The PLAAT family as phospholipid-related enzymes. Prog. Lipid. Res. 98 , 101331 (2025). https://doi.org/10.1016/j.plipres.2025.101331 Xia, W. et al. PLA2G16 is a mutant p53/KLF5 transcriptional target and promotes glycolysis of pancreatic cancer. J. Cell. Mol. Med. 24 , 12642-12655 (2020). https://doi.org/10.1111/jcmm.15832 Mohamed, M. M. & Sloane, B. F. Cysteine cathepsins: multifunctional enzymes in cancer. Nat. Rev. Cancer. 6 , 764-775 (2006). https://doi.org/10.1038/nrc1949 Elmasri, H. et al. Endothelial cell-fatty acid binding protein 4 promotes angiogenesis: role of stem cell factor/c-kit pathway. Angiogenesis. 15 , 457-468 (2012). https://doi.org/10.1007/s10456-012-9274-0 Elmasri, H. et al. Fatty acid binding protein 4 is a target of VEGF and a regulator of cell proliferation in endothelial cells. FASEB J. 23 , 3865-3873 (2009). https://doi.org/10.1096/fj.09-134882 Tsai, F et al. H-rev107 Regulates Cytochrome P450 Reductase Activity and Increases Lipid Accumulation. PLoS One. 10 , e0138586 (2015). https://doi.org/10.1371/journal.pone.0138586 Kalchman, M. A. et al. HIP1, a human homologue of S. cerevisiae Sla2p, interacts with membrane-associated huntingtin in the brain. Nat. Genet. 16 , 44-53 (1997). https://doi.org/10.1038/ng0597-44 Rao, D. S. et al. Huntingtin-interacting protein 1 is overexpressed in prostate and colon cancer and is critical for cellular survival. J. Clin. Invest. 110 , 351-360 (2002). https://doi.org/10.1172/jci15529 Rao, D. S. et al. Altered receptor trafficking in Huntingtin Interacting Protein 1-transformed cells. Cancer Cell. 3 , 471-482 (2003). https://doi.org/10.1016/s1535-6108(03)00107-7 Yamamoto, T. et al. Expression of basic fibroblast growth factor and its receptor in angiosarcoma. J. Am. Acad. Dermatol. 41 , 127-129 (1999). https://doi.org/10.1016/s0190-9622(99)70422-6 Huang, K. et al. High expression of MARVELD3 as a potential prognostic biomarker for oral squamous cell carcinoma. Front. Genet. 13 , 1050402 (2022). https://doi.org/10.3389/fgene.2022.1050402 Kojima, T. et al. Downregulation of tight junction-associated MARVEL protein marvelD3 during epithelial-mesenchymal transition in human pancreatic cancer cells. Exp. Cell Res. 317 , 2288-2298 (2011). https://doi.org/10.1016/j.yexcr.2011.06.020 Li, Y. et al. Role of tight junction-associated MARVEL protein marvelD3 in migration and epithelial-mesenchymal transition of hepatocellular carcinoma. Cell. Adh. Migr. 15 , 249-260 (2021). https://doi.org/10.1080/19336918.2021.1958441 von Beust, B. R., Suter, M. M. & Summers, B. A. Factor VIII-related antigen in canine endothelial neoplasms: an immunohistochemical study. Vet. Pathol. 25 , 251-255 (1988). https://doi.org/10.1177/030098588802500401 Ferrer, L. et al. Immunohistochemical detection of CD31 antigen in normal and neoplastic canine endothelial cells. J. Comp. Pathol. 112 , 319-326 (1995). https://doi.org/10.1016/s0021-9975(05)80013-1 Melincovici, C. S. et al. Vascular endothelial growth factor (VEGF) - key factor in normal and pathological angiogenesis. Rom. J. Morphol. Embryol. 59 , 455-467 (2018). Morikawa, K. et al. Influence of organ environment on the growth, selection, and metastasis of human colon carcinoma cells in nude mice. Cancer Res. 48 , 6863-6871 (1988). Fidler, I. J. Orthotopic implantation of human colon carcinomas into nude mice provides a valuable model for the biology and therapy of metastasis. Cancer Metastasis Rev. 10 , 229-243 (1991). https://doi.org/10.1007/bf00050794 Naito, S. et al. Growth and metastasis of tumor cells isolated from a human renal cell carcinoma implanted into different organs of nude mice. Cancer Res. 46 , 4109-4115 (1986). Igarashi, K. et al. Patient-derived orthotopic xenograft models of sarcoma. Cancer Lett. 469 , 332-339 (2020). https://doi.org/https://doi.org/10.1016/j.canlet.2019.10.028 Kodama, A. et al. Establishment of canine hemangiosarcoma xenograft models expressing endothelial growth factors, their receptors, and angiogenesis-associated homeobox genes. BMC Cancer. 9 , 363 (2009). https://doi.org/10.1186/1471-2407-9-363 Hidalgo, M. et al. Patient-derived xenograft models: an emerging platform for translational cancer research. Cancer Discov. 4 , 998-1013 (2014). https://doi.org/10.1158/2159-8290.Cd-14-0001 Rothweiler, S. et al. Generation of a murine hepatic angiosarcoma cell line and reproducible mouse tumor model. Lab. Invest. 95 , 351-362 (2015). https://doi.org/10.1038/labinvest.2014.141 Shiraki, K. et al. Splenic hemangiosarcoma in a young sprague-dawley rat. J. Toxicol. Pathol. 25 , 273-276 (2012). https://doi.org/10.1293/tox.25.273 Yamane, R., Tanaka, M. & Kaneda, S. Spontaneous hemangiosarcoma in the spleen and liver of a young rat. J. Toxicol. Pathol. 35 , 89-93 (2022). https://doi.org/10.1293/tox.2021-0042 Madewell, B. R., Griffey, S. M. & Munn, R. J. Ultrastructure of canine vasoformative tumors. J. Vasc. Res. 29 , 50-55 (1992). https://doi.org/10.1159/000158932 Additional Declarations There is NO Competing Interest. Supplementary Files SupplementarytableDrugscreeninglist.xlsx Suolemental Table CommunicationsBiologySupplementaryfigure.1.1.26.docx Supplemental Figure Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8550766","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":592236418,"identity":"1d4c78c7-6e1b-48d4-a760-19e6fcafc3dd","order_by":0,"name":"Tatsuya Usui","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA60lEQVRIie3PMQrCMBSA4SeBdIl0TVDwCkpHa3uVlEBcPIBjRKiL4NrewtExIHQSncXFLk4Ouik4WAVFl7SjYP4lj5CPJAA22w/mKPekzzf/a5MbCdHQyVMlixG9D5cSz6ur5RcxRyiXLF1sghm4Gb1eoOUqOOxLSEbPq51IFcJsyqGTaOi3TSSkUcwSvBNtjTAlHGpzAEnNtwjcIHj9JOzGIaxAJPLqsQ4epFHcEpUTcqzlyUpwNkZetympSJYlfyHOAPRpGISuM8q3R9/vzSZTuTeRV5FCz7V4EiKyioDwY3aySsRms9n+pjslHkNE3MDyBQAAAABJRU5ErkJggg==","orcid":"","institution":"Tokyo University of Agriculture and Technology","correspondingAuthor":true,"prefix":"","firstName":"Tatsuya","middleName":"","lastName":"Usui","suffix":""},{"id":592236419,"identity":"7b15a801-b293-4bb8-90ef-3c4b83279da0","order_by":1,"name":"Yishan Liu","email":"","orcid":"","institution":"Tokyo University of Agriculture and Technology","correspondingAuthor":false,"prefix":"","firstName":"Yishan","middleName":"","lastName":"Liu","suffix":""},{"id":592236420,"identity":"a8f19df6-3b1a-41a2-aeba-ac88722c9fc4","order_by":2,"name":"Haru Yamamoto","email":"","orcid":"","institution":"Tokyo University of Agriculture and Technology","correspondingAuthor":false,"prefix":"","firstName":"Haru","middleName":"","lastName":"Yamamoto","suffix":""},{"id":592236421,"identity":"cacc65b4-6071-4af5-b556-6ea178fcd33d","order_by":3,"name":"Mohamed Elbadawy","email":"","orcid":"https://orcid.org/0000-0001-9368-1535","institution":"Tokyo University of Agriculture and Technology","correspondingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"","lastName":"Elbadawy","suffix":""},{"id":592236422,"identity":"87702c7e-a105-4b98-b63a-c6ab9241c338","order_by":4,"name":"Amira Abugomaa","email":"","orcid":"","institution":"Tokyo University of Agriculture and Technology","correspondingAuthor":false,"prefix":"","firstName":"Amira","middleName":"","lastName":"Abugomaa","suffix":""},{"id":592236423,"identity":"a447ca77-073d-4d22-a8e4-b03200396a8e","order_by":5,"name":"Masahiro Kaneda","email":"","orcid":"","institution":"Tokyo University of Agriculture and Technology","correspondingAuthor":false,"prefix":"","firstName":"Masahiro","middleName":"","lastName":"Kaneda","suffix":""},{"id":592236424,"identity":"fba9e410-b9ba-465f-afeb-e4bc855b0822","order_by":6,"name":"Yomogi Shiota","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yomogi","middleName":"","lastName":"Shiota","suffix":""},{"id":592236425,"identity":"2d21460d-423a-4c17-91de-d480cadcff92","order_by":7,"name":"Tadashi Kondo","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Tadashi","middleName":"","lastName":"Kondo","suffix":""},{"id":592236426,"identity":"a07a6b30-c6ae-4412-9c84-4807c448e077","order_by":8,"name":"Kazuaki Sasaki","email":"","orcid":"","institution":"Tokyo University of Agriculture and Technology","correspondingAuthor":false,"prefix":"","firstName":"Kazuaki","middleName":"","lastName":"Sasaki","suffix":""}],"badges":[],"createdAt":"2026-01-08 11:15:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8550766/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8550766/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":103504960,"identity":"c11ce9a9-e572-46ab-98cb-d78ed2254f20","added_by":"auto","created_at":"2026-02-26 13:22:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":847769,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGeneration of 2.5D organoids from dogs with hemangiosarcoma (HSA) and nodular hyperplasia (NH). \u003c/strong\u003eThe schema of the study procedure was created using Biorender (A). Histopathology and expression of vascular endothelial markers in HSA and NH tissues (B). The five representative cases of NH and HSA tissues were classified via hematoxylin and eosin (H\u0026amp;E) staining and stained with vascular endothelial markers (CD31, VEGF,and vWF). Scale bar =100 µm. Expression of vascular endothelial markers in 2.5D organoids of HAS and NH (C). After generating 2.5D organoids from each dog patient with HAS and NH, cells were incubated with CD31, vWF, and VEGF antibodies for immunofluorescence (IF) staining. Scale bar = 50 µm. Bright-field photos are shown. Scale bar = 200 µm.\u003c/p\u003e","description":"","filename":"Slide1.png","url":"https://assets-eu.researchsquare.com/files/rs-8550766/v1/59d73c98ec708fd3236275a2.png"},{"id":103505693,"identity":"592a0fe8-ec07-4baa-9a9a-3b9b301ada87","added_by":"auto","created_at":"2026-02-26 13:32:38","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":527658,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEstablishment of an orthotopic xenograft mouse model using canine HSA 2.5D organoids. \u003c/strong\u003eThe schema of the study procedure was created using Biorender (A). Following 10 weeks of 2.5D HSA organoid injection into the spleens of immunodeficient mice, each organ was harvested and subjected to histopathological analysis. The occurrence of primary and metastatic tumors in orthotopic xenografts of HSA 2.5D organoids is shown. HSA formation is depicted in yellow. The green and purple box indicate either liver metastasis or pancreatic seedlings. Light blue indicates no tumor formation in a specific position. Tumor mass photos are shown (B). Expression of vascular endothelial markers (CD31 and vWF) and a pericyte marker (PDGFRβ) in orthotopic xenograft tumor tissues (C). Scale bar = 100 µm.\u003c/p\u003e","description":"","filename":"Slide2.png","url":"https://assets-eu.researchsquare.com/files/rs-8550766/v1/566249831f4e600a52a7ba56.png"},{"id":103505285,"identity":"1e3eb564-0f55-4233-8eb1-36fd2973a659","added_by":"auto","created_at":"2026-02-26 13:29:22","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":633053,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGeneration of HSA 3D organoids from the orthotopic HSA xenograft model. \u003c/strong\u003eAfter isolating HSA 2.5D organoid-derived tumor tissues, cells were embedded into Matrigel and cultured with 3D organoid media. Representative images of H\u0026amp;E staining and immunohistochemical (IHC) staining of CD31, vWF, and PDGFRβ in HSA 3D organoids (A). Scale bar = 100 µm.\u003cstrong\u003e \u003c/strong\u003eThe ultrastructure of HSA 3D organoids was analyzed via transmission electron microscopy (TEM) (B). a: luminal structure; b: cells arranged in an overlapping pattern; c: microvillous; d: cells exhibiting deep interdigitations; e: terminal bar; f: basement membrane unclear (fu), Absent (fa); g: pinocytic vesicle. Scale bar = 20 µm (top left), 10 µm (top right), and 1 µm (bottom left, bottom right).\u003c/p\u003e","description":"","filename":"Slide3.png","url":"https://assets-eu.researchsquare.com/files/rs-8550766/v1/8d7cd84fb70667560ad0806e.png"},{"id":103504973,"identity":"23c5321a-d790-48da-9399-36e6988f2b54","added_by":"auto","created_at":"2026-02-26 13:22:20","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":239046,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDrug sensitivity in HSA 2.5D organoids.\u003c/strong\u003e HSA 2.5D organoid cells from each dog patient (BS24008, BS24054, BS24058, BS24069, and BS24073) were treated with toceranib, carboplatin, cyclophosphamide, or doxorubicin at gradient concentrations, and cell viability was evaluated via the PrestoBlue™ cell viability assay (A). Data are expressed as mean ± S.E.M.Drug screening tests using HSA 2.5D organoid cells (B). Two strains of HSA 2.5D organoids (BS24026 and BS24077) were treated with 214 anticancer reagents for 72 h, which were classifiedinto three categories based on their antiproliferative effects. Effects of HDAC inhibitors (romidepsin, vorinostat, and panobrigatinibinostat) on cell viability of 2.5D HSA organoid cells (C, n = 3). Effects of ALK inhibitors (brigatinib, crizontinib, and crizotinib) on cell viability of 2.5D HASorganoid cells (D, n = 3). Data are expressed as mean ± S.E.M.\u003c/p\u003e","description":"","filename":"Slide4.png","url":"https://assets-eu.researchsquare.com/files/rs-8550766/v1/0bcc47fc58824199fc2af736.png"},{"id":103504970,"identity":"077e752d-83f9-42a5-a2a9-44503d97b7c0","added_by":"auto","created_at":"2026-02-26 13:22:20","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":415763,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eComparison of transcriptional profiles between HSA and NH 2.5D organoids. \u003c/strong\u003eTranscriptomic analysis experiments were performed on NH and HSA 2.5D organoids (A). Comparison of gene expressions between NH and HAS 2.5D organoids presented as a volcano plot (B). Upregulated genes are shown in red, whereas downregulated genes are in blue.\u0026nbsp;Lysosomal membrane-related gene expressions between NH and HSA 2.5D organoids (C). Gene set enrichment analysis (GSEA) using RNA-sequencing data and normalized enrichment scores (NES) (D). FPKM scores of specific regulated genes and corresponding quantitative real-time PCR results (E). Data are expressed as mean ± S.E.M. n = 4. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 vs. NH, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.01 vs. NH. \u003cem\u003ePLAAT3\u003c/em\u003e expression was compared between HSA and NH 2.5D organoids using IF (F). Scale bar = 100 µm. Results are expressed as mean ± S.E.M. n = 4. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 vs. NH. \u003cem\u003ePLAAT3\u003c/em\u003e expression was compared between HSA and NH tissues using IHC (G). Scale bar = 100 µm.\u003c/p\u003e","description":"","filename":"Slide5.png","url":"https://assets-eu.researchsquare.com/files/rs-8550766/v1/196752377b24123e21f664a6.png"},{"id":103504923,"identity":"deed9d79-65a4-48dc-8c28-ae141f481c3f","added_by":"auto","created_at":"2026-02-26 13:22:08","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":415212,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffects of PLAAT3 inhibition on cell proliferation and invasion of HSA 2.5D organoids. \u003c/strong\u003eThe effects of the \u003cem\u003ePLAAT3\u003c/em\u003e inhibitor LEI110 on the cell viability of HSA 2.5D organoids were evaluated via the PrestoBlue™ Cell Viability assay (A). Results are expressed as mean ± S.E.M. The effects of LEI110 on the cell invasion of HSA 2.5D organoids via the cell invasion assay (B). Results are expressed as mean ± S.E.M., n = 6. \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.0005 vs. Vehicle, \u003csup\u003e****\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.00005 vs. Vehicle. The efficacy of \u003cem\u003ePLAAT3\u003c/em\u003e gene knockdown (C). Results are expressed as mean ± S.E.M., \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.005 vs. Si NC, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.0005 vs. Si NC. The effects of \u003cem\u003ePLAAT3\u003c/em\u003e gene knockdown on the proliferation (at day 4 and 7 after cell seeding) of HSA 2.5D organoids (BS24026 and BS24028) were evaluated via cell proliferation assay (D). Results are expressed as mean ± S.E.M., n = 6. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.05 vs. si NC, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.005 vs. si NC, \u003csup\u003e****\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.00005 vs. si NC. The effects of \u003cem\u003ePLAAT3\u003c/em\u003e gene knockdown on the cell invasion of HSA 2.5D organoids (E). Scale bar = 100 mm. Results are expressed as mean ± S.E.M., \u003csup\u003e****\u003c/sup\u003e\u003cem\u003eP \u003c/em\u003e\u0026lt; 0.00005 vs. Si NC.\u003c/p\u003e","description":"","filename":"Slide6.png","url":"https://assets-eu.researchsquare.com/files/rs-8550766/v1/6c6193ba6363482cecff80e6.png"},{"id":107707361,"identity":"8ca70391-1db6-4f76-992a-fa59b102f9f5","added_by":"auto","created_at":"2026-04-24 09:20:09","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3384329,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8550766/v1/1c6efd35-6515-49bc-95ac-968c6d9f71d1.pdf"},{"id":103504519,"identity":"832b5593-c835-44bb-8616-5246881f2f87","added_by":"auto","created_at":"2026-02-26 13:20:22","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":22554,"visible":true,"origin":"","legend":"Suolemental Table","description":"","filename":"SupplementarytableDrugscreeninglist.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8550766/v1/cf02f3c6910a917706e682fb.xlsx"},{"id":104397280,"identity":"e7a49572-55f2-4b03-98e0-849a7aee2f8c","added_by":"auto","created_at":"2026-03-11 11:45:58","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":1422466,"visible":true,"origin":"","legend":"Supplemental Figure","description":"","filename":"CommunicationsBiologySupplementaryfigure.1.1.26.docx","url":"https://assets-eu.researchsquare.com/files/rs-8550766/v1/7aad8999639e604c62f9b0b5.docx"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e Competing Interest.","formattedTitle":"Modeling canine hemangiosarcoma progression using patient-derived 2.5D organoids and orthotopic xenografts","fulltext":[{"header":"Introduction","content":"\u003cp\u003eCanine hemangiosarcoma (HSA) is a malignant endothelial cell-derived tumor, which accounts for a relatively low percentage (1.3\u0026ndash;2.8%) of canine cancer cases\u003csup\u003e\u0026nbsp;\u003c/sup\u003e\u003csup\u003e1\u003c/sup\u003e. As a highly invasive cancer, HSA often metastasizes to the liver and lungs through blood vessels \u003csup\u003e2,3\u003c/sup\u003e. Because HSA shares several pathological characteristics and molecular signatures with human angiosarcoma (AS) \u003csup\u003e4\u003c/sup\u003e, it is considered a more relevant preclinical model\u0026nbsp;than rodent models for advancing AS research.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Conventional therapies for HSA include surgery and chemotherapy with drugs such as doxorubicin. However, the median survival time after chemotherapy is six months, whereas that after surgery alone is two to three months \u003csup\u003e5\u003c/sup\u003e. Therefore, to better understand disease progression and develop new treatment options, a more suitable animal model is required to uncover the transcriptional profiles associated with cancer progression.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eClinically, splenic masses in dogs are mostly benign tumors, including nodular hyperplasia (NH). Splenic NH is defined as the overgrowth of normal splenic components, forming a well-restricted proliferative lesion \u003csup\u003e6\u003c/sup\u003e. During new target development, a common method includes the comparison of the transcriptional patterns between cancerous and healthy tissues. Several sequencing studies comparing HSA with normal healthy tissues have reported various mutated genes such as \u003cem\u003eTP53\u003c/em\u003e and \u003cem\u003ePIK3CA,\u003c/em\u003e which are implicated in DNA repair, and those associated with the PI3K/AKT/mTOR and MAPK/ERK pathways, which are involved in cell proliferation \u003csup\u003e7-9\u003c/sup\u003e. However, a comparison of HSA with healthy tissues may not completely reveal the characteristics of cancerous proliferation. Fast-proliferating NH may provide a reference for identifying the cause of malignant metastasis. Although the propensity for metastasis has been reported to be highly associated with lysosomal \u003csup\u003e10\u003c/sup\u003e and membrane dysfunction \u003csup\u003e11\u003c/sup\u003e, their roles in HSA remain unclear.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Several currently established mouse models replicating the biological and molecular characteristics of HSA have been reported; however, these models are mainly based on the direct subcutaneous transplantation of patient tumor tissues into immunodeficient mice \u003csup\u003e12,13\u003c/sup\u003e. Therefore, these models cannot recapture the metastatic features of the original tumor within the liver or other organs. Given that high invasion and metastasis are key factors responsible for treatment failure and poor prognosis in dogs with HSA, a new reliable mouse model is urgently needed for mechanistic studies and drug development.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn previous studies, we established a 2.5D organoid culture method using tumor tissues from dogs with bladder, breast, and lung cancers, which could recapitulate the characteristics of the original tumor tissues \u003csup\u003e14,15\u003c/sup\u003e. In the present study, we aimed to establish and characterize HSA 2.5D organoids and compare these with NH organoids. HSA markers CD31, vWF, and VEGF were validated, and gene expression profiles between HSA and NH organoids were examined along with transcriptional differences, particularly those related to metastasis and invasion such as lysosomal membrane-related pathways and genes such as phospholipase A and acyltransferase (\u003cem\u003ePLAAT)3\u003c/em\u003e. Additionally, the effects of \u003cem\u003ePLAAT3\u003c/em\u003e knockdown and chemical inhibition in HSA cells on their invasion and proliferation were demonstrated. Finally, we attempted to establish an orthotopic xenograft model via splenic injection and successfully established 3D organoids using xenograft tumor tissues.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cem\u003eSample collection and HSA 2.5D organoid culture\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAll dog owners provided written informed consent for the present study, and all experimental procedures were carried out according to the guidelines of the Institutional Animal Care and Use Committee of Tokyo University of Agriculture and Technology (Approval number: 0020007). Sample information is presented in Table 1. Standard hepatectomy and/or splenectomy and mastectomy were performed with informed consent from the owner. Tissue sections used for primary culture were obtained from the same positions that were used in pathological diagnosis and immunohistochemistry (IHC) staining.\u003c/p\u003e\n\u003cp\u003eThe samples were immediately transferred to a cooled shipping medium and transported to our laboratory. HSA 2.5D organoids were generated using methods described in our previous study \u003csup\u003e14\u003c/sup\u003e. Culture conditions, medium type, supplements, growth factors, cell handling, and passages were identical. The culture medium comprised advanced DMEM including 50% Wnt, R-spondin, and Noggin conditioned medium; 100 \u0026micro;g/mL Primocin; 10 mM nicotinamide; 1% GlutaMax; and 1 mM N-Acetyl-L-cysteine (Thermo Fisher Scientific, Waltham, MA, USA); 500 nM A83-01 (Adooq Bioscience, Irvine, CA, USA); and 50 ng/mL mouse EGF (PeproTech, Rocky Hill, NJ, USA). All representative phase-contrast images of the cultured cells were captured using a light microscope (BX-52; Olympus, Tokyo, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e Patient information.\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGroup\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSample No.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAge\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGender\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eBreed\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eSample tissue site\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS23019\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♂\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eLabrador Retriever\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS22032\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♀\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eMiniature Dachshund\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS23014\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♂\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eMiniature Schnauzer\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS23011\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♂\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eMiniature Dachshund\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS23026\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♂\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eMixed\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS24008\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♀\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eShetland Sheepdog\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS24026\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♂\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eMiniature Dachshund\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003epelvic lymph node\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS24028\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♂\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eScottish Sheepdog\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS24054\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♀\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eGolden Doodle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS24058\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♂\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eStandard Poodle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen, left submandibular\u0026nbsp;lymph node\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS24061\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003eno info\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♀\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eMixed\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS24063\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♂\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eShiba Inu\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS24069\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♂\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eShiba Inu\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS24073\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♀\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eMiniature Dachshund\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen, skin mass\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHSA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS24077\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003eno info\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♂\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eMixed\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS23030\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♀\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eShiba Inu\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003eCeliac\u0026nbsp;lymph node\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS23039\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e15\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♂\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eMiniature Dachshund\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS23033\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♂\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eMaltese\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS23021\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e11\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♂\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eMixed\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen mass, spleen\u0026nbsp;lymph node\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS23032\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♀\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eMixed\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 55px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNH\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 81px;\"\u003e\n \u003cp\u003eBS24054\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 53px;\"\u003e\n \u003cp\u003e12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003e♀\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eGolden Doodle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 170px;\"\u003e\n \u003cp\u003espleen\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cem\u003eHematoxylin and Eosin (H\u0026amp;E) staining\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eParaffin sectioning and H\u0026amp;E staining were conducted according to standard procedures, as described previously \u003csup\u003e16\u003c/sup\u003e. All sections were stained with hematoxylin and eosin for 4 min and 30 s, respectively. Sections were observed and imaged using a light microscope (BX-52; Olympus, Tokyo, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eImmunohistochemical (\u003c/em\u003e\u003cem\u003eIHC\u003c/em\u003e\u003cem\u003e)\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003cem\u003estaining\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eIHC staining was performed on paraffin-embedded sections, 4 \u0026mu;m in thickness. The following antibodies were used: rabbit polyclonal CD31 antibody (GeneTex, catalog No. GTX130274; 1:500), polyclonal PDGFR\u0026beta; antibody (SAB biotech, catalog No. #41327; 1:200), mouse monoclonal PLA2G16 (PLAAT3) antibody (OriGene, catalog No. TA506908S; 1:200), and rabbit polyclonal Von Willebrand factor antibody (abcam, ab6994; 1:200). Sections were deparaffinized with xylene and subsequently rehydrated with ethanol and distilled water. For antigen retrieval, sections were autoclaved at 121 \u0026deg;C with sodium citrate buffer for 5 min, followed by cooling at room temperature (RT). After washing, sections were quenched with 1% hydrogen peroxide for 30 min. Sections were incubated overnight at 4 \u0026deg;C with primary antibodies (CD31, 1:500; PDGFR\u0026beta;, 1:200; PLAAT3, 1:200; vWF, 1:200; and VEGF, 1:200) diluted in 0.5% casein in a humid box. After washing with PBS, sections were incubated in an HRP system and stained using a Dako kit (K3468) following the manufacturer\u0026apos;s protocol. After DAB staining, sections were counterstained with hematoxylin, dehydrated using ethanol and xylene, mounted with Polymount, dried, and examined. The sections were observed and imaged using a light microscope (BX-52; Olympus, Tokyo, Japan).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eImmunofluorescence (IF) staining\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eImmunofluorescence staining of HSA 2.5D organoids was performed as previously described \u003csup\u003e14,15\u003c/sup\u003e. Immunofluorescent HSA 2.5D organoid cells (2 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e/well) were seeded onto round cover glasses in a 6-well plate. After reaching 80% confluence, cells were fixed in 4% PFA for 1 h at RT. Subsequently, the cover glasses were washed three times with PBS and blocked with 1.5% normal goat serum (diluted in PBS) for 30 min at RT, and subsequently incubated in a humid box overnight at 4\u0026deg; C with primary antibodies (CD31, 1:300; PLAAT3, 1:100; vWF, 1:200; and VEGF, 1:200) diluted in PBS. After washing with PBS, the slides were incubated with Hoechst (1:1000) and with a secondary antibody for 60 min at RT in the dark. Representative images were captured and analyzed. The secondary antibodies used were: Goat Anti-Rabbit IgG H\u0026amp;L (Alexa Fluor\u0026reg; 488) (ab150077) and Goat Anti-Mouse IgG H\u0026amp;L (Alexa Fluor\u0026reg; 488) (ab150113). All samples were observed under a fluorescence microscope (DAPI and FITC). Semi-quantitative analysis of fluorescence was performed using the ImageJ software.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCell viability screening\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Cytotoxicity activities were evaluated via the PrestoBlue\u0026trade; Cell Viability assay. Cells (1\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells/well) were seeded in 96-well plates containing 2.5D medium. After 24 h, cells were treated with dimethyl sulfoxide (DMSO; vehicle), toceranib (Sigma Aldrich, America, MI, USA; at 2 \u0026mu;M, 4 \u0026mu;M, and 8 \u0026mu;M), carboplatin (FUJIFILM Wako Pure Chemical, Tokyo, Japan; at 1 \u0026mu;M, 10 \u0026mu;M, and 100 \u0026mu;M), cyclophosphamide (at 1 \u0026mu;M, 10 \u0026mu;M, and 100 \u0026mu;M ), or doxorubicin (Cayman Chemical, Ann Arbor, MI, USA; at 1 \u0026mu;M, 10 \u0026mu;M, and 100 \u0026mu;M ), and incubated at 37 \u0026deg;C for 72 h. Following incubation, 10 \u0026mu;M of PrestoBlue\u0026trade; Cell Viability Reagent (Thermo Fisher Scientific) was added to each well, and the cells were incubated for an additional 3 h at 37 \u0026deg;C. Fluorescence (emission wavelength: 585 nm) was measured using a microplate reader (TECAN, Seestrasse, Switzerland). The chemical and company names were as follows: LEI110 (MCE, HY-125254), toceranib (Sigma, No. PZ0338), doxorubicin (Cayman Chemical, 25316-40-9), cyclophosphamide (TCI, 6055-19-2), and carboplatin (Fujifilm, 41575-94-4).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eRNA isolation and real-time polymerase chain reaction (PCR)\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eIsolated RNA was converted to first-strand cDNA using the ReverTra Ace qPCR RT Kit (Toyobo Co., Ltd., Osaka, Japan) following the manufacturer\u0026rsquo;s protocol.\u0026nbsp;Real-time PCR was performed using\u0026nbsp;the QuantiTect SYBR I kit (Qiagen, Hilden, Netherlands) and StepOnePlus Real-Time PCR system (Applied Biosystems, Waltham, Massachusetts, USA). The \u003csup\u003e\u0026Delta;\u0026Delta;\u003c/sup\u003eCq method was used to quantify the data. Each cDNA sample was amplified with primers and run in triplicate. The expression level of each gene was normalized to \u003cem\u003eGAPDH\u003c/em\u003e levels in each sample.\u0026nbsp;Primers (FASMAC Co., Kanagawa, Japan) used for canine\u003cem\u003e\u0026nbsp;\u003c/em\u003egenes\u003cem\u003e\u0026nbsp;MARVELD3, Huntingtin-interacting protein 1 (HIP1), PLAAT3,\u003c/em\u003e and \u003cem\u003eGAPDH\u0026nbsp;\u003c/em\u003eare listed in Table 2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2.\u003c/strong\u003e Primers for real-time PCR analysis\u003c/p\u003e\n\u003ctable border=\"1\" cellspacing=\"0\" cellpadding=\"0\" width=\"642\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 150px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene name\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 246px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eForward\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 246px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRev\u003c/strong\u003e\u003cstrong\u003eerse\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 150px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCanine \u003cem\u003eMARVELD3\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 246px;\"\u003e\n \u003cp\u003eCAGGGGTTACCGAAAAGTCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 246px;\"\u003e\n \u003cp\u003eTTCATCGCTCACCAACAGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 150px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCanine \u003cem\u003eHIP1\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 246px;\"\u003e\n \u003cp\u003eCCAGCTTGCCAAAGACCAAC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 246px;\"\u003e\n \u003cp\u003eGAAGTGGCAGCCATCTCCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 150px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCanine \u003cem\u003ePLAAT3\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 246px;\"\u003e\n \u003cp\u003eACACTGGGCCATCTACGTTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 246px;\"\u003e\n \u003cp\u003eTTGCTTCTGCCGCTTGTTTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 150px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eCanine \u003cem\u003eGAPDH\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 246px;\"\u003e\n \u003cp\u003eAACTCCCTCAAGATTGTCAGCAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 246px;\"\u003e\n \u003cp\u003eCATGGATGACTTTGGCTAGAGGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cem\u003eRNA sequencing\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eRNA was generated from the tumor tissues and harvested organoids using the\u0026nbsp;NucleoSpin RNA kit (TAKARA, Tokyo, Japan), and converted to first-strand cDNA using the ReverTra Ace qPCR RT Kit (Toyobo Co., Ltd., Osaka, Japan) following the manufacturer\u0026apos;s protocols. Ten samples (HSA: NH = 5:5) were collected from the clinic for sequencing. One microgram of the total RNA from each sample was used for library preparation. Poly(A) mRNA isolation was performed using Oligo(dT) beads. mRNA fragmentation was performed using divalent cations at high temperatures. Priming was performed using Random Primers. First-strand and second-strand cDNA were synthesized. The purified double-stranded cDNA was subsequently treated to repair both ends and to add a dA-tailing in one reaction, followed by a T-A ligation to add adaptors to both ends. Size selection of the adaptor-ligated DNA was performed using DNA Clean Beads. Each sample was then amplified by PCR using primers P5 and P7, and the PCR products were validated. Libraries with different indices were multiplexed and loaded onto an Illumina HiSeq/ Illumina Novaseq/ MGI2000 instrument for sequencing using a 2 \u0026times; 150 paired-end (PE) configuration, according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Reference genome sequences and gene model annotation files of relative species used in this study were downloaded from genome websites, such as UCSC, NCBI, and ENSEMBL. Hisat2 (v2.2.1) was used to index the reference genome sequence and align clean data to the reference genome. Transcripts in FASTA format were converted from known GFF annotation files and appropriately indexed. Using the file as a reference gene file, the gene and isoform expression levels were estimated from the paired-end clean data using HTSeq (v0.6.1).\u003c/p\u003e\n\u003cp\u003eDifferential expression analysis was performed using the DESeq2 Bioconductor package, a model based on negative binomial distribution. Estimates of dispersion and logarithmic fold changes incorporated data-driven prior distributions. Padj was set at \u0026le; 0.05 to detect differentially expressed genes (DEGs). GOSeq (v1.34.1) was used to identify Gene Ontology (GO) terms that annotated a list of enriched genes with Padj \u0026le; 0.05. TopGO was used to plot the DAG. Gene expression was measured via read density and calculated as fragments per kilobase per million reads (FPKM). The formula was as follows:\u003c/p\u003e\n\u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAmgAAABeCAYAAACXU+jQAAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAAFiUAABYlAUlSJPAAACTxSURBVHhe7Z3fiyTV+f/f/b2Pfmpmr0wisjUBg4qQ1Liiu4IL2oNIMBjoMXgRMLhWmxvR/WGPuQjOqt1kDSxkfoQISwjpXgwIkhmnV3DAHkXdUaYxorBTTZDoVdV2NH/A+V6knsOpp8+p6t7dmekdnxc0zNSpqvP7nHedH88pKaUUBEEQBEEQhLHh//ELgiAIgiAIwt4iAk0QBEEQBGHMEIEmCIIgCIIwZohAEwRBEARBGDNEoAmCIAiCIIwZItAEQRAEQRDGDBFogiAIgiAIY4YINEEQBEEQhDFDBJogCIIgCMKYIQJNEARBEARhzBCBJgiCIAiCMGaIQBMEQRAEQRgzRKAJgiAIgiCMGSLQBEEQBEEQxgwRaIIgCIIgCGOGCDRBEARBEIQxQwSaIAiCIAjCmCECTRCEPaFUKulftVrlzoJBr9dDtVrFxMSETrNWq8VvEwRhHyECTRCEPSGOYwRBAAC48847ubOQ0u12dTpdunQJW1tbAIAf//jH7E5BEPYTJaWU4hcFQRB2g5mZGbTbbWxtbYlIs5AkCQ4dOoTLly/j8uXL3FkQhH2MjKAJwj6hWq2iVCohSRLudFW0Wi2USiWsrq5yp6vmo48+AmQEzcnbb7+NKIoQhiF3EnaJnapXglCECDRB2AckSYJWqwXf9zE5Ocmdr4pz584BAG699VbudFV0u130+32Uy2XuJKScOXMGAHDvvfdyJ2EX2Ml6JQhFiEAThOucJEnw29/+Fv1+X69VulYsLy+j3W7D8zwcPHiQO18Vn3/+OQDg6NGj3ElIRy43NzeBHRDHQjE7Wa8EYRhEoAnCdUyj0cCBAwewuLgIADh//nxmd6SNVquF6elpfc/U1BSWl5cz92xsbKBUKuGpp54CAPT7/cx7NzY2MvcDwOrqKmZmZvQ909PTaLVamJ2dRaPR4Lfj3XffBQDcfvvt3KkQ2tU4NTWl/atWq5lpqCRJMjsf+a7Hubk5HU5OkiRoNBqZ909PTw/Eu9Vq6Xump6e1/+b1mZkZ9Hq9zHN5JEmCUqmExx57TF/zfV/nFb+30WjoOJq7Yc0wzM7OZp6DkT50z8TEBKrVKlqtFiYmJvjtGbrdLmZnZ7W/U1NTaDQamJuby/i1sbGB2dlZ/f5ut6uvUxmcmJjQeUP5Smk+Nzen32Wj1WplytzU1FRmKn5jY0O7c//p+tTU1EC+jlqvGo1Gpk6V0nzn9UoQRkIJgnDdUy6XFQC1tbXFnTRxHKsgCJTneWppaUlfC8NQAdDXTOr1utPNhN4RhqGKokgp41kAamVlhT+igiBQAPT9w9JsNhUAValU9LOVSmUgnLVaTTWbTRXHsfI8T3mel3GjsNVqNX1dKaW2traU53nK933V6XSUUkpFUaTDS2lcr9dVrVZTcRzr93U6HRWGoQ4HpUEYhhk/hmFlZaXw2Uqlov2i8CkWPwCqXq9nnqM4ep6n8yaKIuX7vgKggiDI3G9C6R8EgU7/Tqcz4Fen01HlcllFUaTjUq/XVbPZVPV6XcVxrK97nqe2trb0/XEc67DYyrRZlpvNplJpnOhdqsD/MAxVHMc63L7vMx/+xzD1itLaLHtLS0sKBXknCEWIQBOEfYDZMbmgzoY6NCKKImcnNUwHlSdCqNOO4zhzPY5jp595kDjgflEYuBAhSEB2Oh3dWfN0UGm4SLjwOLv8VkYnXS6XM+8lAVAulzP3D4Ot488jCALl+75qNptaPJFoIaGpCuJI6chFK0HxCYJgIE9JINrEOKV5uVweeDeVEf5OKntm2BUTZzz89C6O6T/PP9czash6RWHnBEFgLWOCMCz2UikIwnXDMCLAHPWw4eqkXNcJEnee5w102HkijDrMSqXCnZyYwoL7RSNovDMnKP61Wi0z6sIhIcdFhCpIZxITvPOnkRTb+4rgI3ZFUF6Vy+WB9DGhONrELIlCV/rQqJYtnT3PU7CIcWUIP17+qPzY3umKv0uMkxi15Q89w8siPcPDpQry24TCz8MpCFeLu+UVBOG6wNVhmZCAsXW8ZidpMkwHlTd6Rs/b3Oi5YUeHlCF2KJ5bW1uq2WxqcZQngsw42tKAIJFhm3YlkWdLD3o3f47EUJ6fLmx54oLSGgVCgUSuLazKEJo2NxLVNjFDYtzmpoz38tE1l1Cn99lGr0yRHqfTlCS8fd+3xp/85/mQNyo6TL1Shqj1jKUDgnAtkE0CgnCd88knnwAA7rnnHu6kOX/+PADgrrvu4k744osvAGBgp9pnn30GFOyyfOeddwAADz/8MHfCW2+9BQC47777uJN+7rbbbuNOTt544w0AwMmTJ1EqlfDoo4/i3LlzOHr0KKIowunTp/kjGnMHqm3BPNKF4/1+H77vW3esfvrppwCAn/70p5nrtMC8XC4PPHfhwgXAke55mO8chvfffx8AEIZhrk25zz//XO9K5GFNkgTtdtsZ//feew8A8OCDD3InfPjhhwBg3XABAO12GwDw0EMPZa7TOx955JHMdXof94vyqN/v48CBAzhw4ADm5+fR7/exsLCA7e1ta/zJf573tFHFVkaHqVcAcPr0adTrdfT7fTz11FOYnp7WmxEE4WoQgSYI1zkkAlxH/5idha3j/cc//gFYOsP19XWgYJcldXw2MxB5opCeO3z4MHdyQs+kI//Y3t7G2toaTpw4YY2XSbVahed5QLpT0AYJUr5TkqD4cJtkJI64kO12u4iiyCl48nC90wUJXpvQMKH32oTU22+/DVjKAfHxxx8DlvgDwF/+8hfA4X+e2HSVXRJu999/f+Y6hb9er+tysLa2hoWFhQHxReT5T7tHbWXUFTYbJ06cQBRFqFQq2NzcxP333y+GbYWrRgSaIFzHkLHXPEOa//3vfwFHB0WGOAHgiSeeyLhRB2UTXxwuQJaXlxFFkdV+GglGPmK3U1SrVVy8eBGnTp0CjBFDzjfffAM4RNHGxoYWW3wUyDXS8sEHHwAAKpVK5vow0DvzxLEJnchgExo2brnllsz/SZLghRdeAIY41eGGG27I/L+xsaHFq03M5I3Ebm5uwvO8AT+p7N19992Z61eCy3+qO7bRxGHqFefgwYNotVool8vo9/vazp8gXCki0AThOobElznqQ/atCOo0qRM3ee2119Dv91Gr1QY6qX6/DzDxNTc3lxmBso1KdbtdPfpmEwwUZtsoTh6+7wNp/DjVajVj/2pmZgYbGxvartef//xnLaBoxJBDYojEkcn8/DwA4OzZs9zJOdLy5ZdfAgDuuOOOzPVhGEUcm2KC5yHnxhtvBAD861//ylx/+umntWAumnb+9ttv9d9JkuCZZ57RecOFFnJGYmlky1ZGyEAvf9/NN98MGGLapNvtYmZmhl92+v/VV18BjnI4TL1aXl7O/E/wKXBBuGL4ojRBEK4fzF2UURSpKLXXxRdD00JmWvAcx3HuAn9l7NhbWVlRcWovjd/LdwR2UttT3BxDvV7P3EP+xqkNsaKF2IptSKCdgisrKyoIAlWpVDK7B2khPIXfvE4LzJvN5sDGAto5SDsKoyjK3WCRtwvQ3CAQRZFOlyLonXzHoYtRbG6ZJlWi1N5YGIaq2WzqeK6srOh8NNOU/KG0pjjl7Z5UObs78xbhU95RPtEmgtjYyWvmUb1eV55h083E5b+5QYCXw2HqlZlexMrKivI8z1oeBGFURKAJwnXO0tKS7oTyREC9Xteii+61iQ6i0+no+8m+FieOY71DzvO8TGdL133fV/XUMCl/xvf9kXa+8ThUKhVrp0zh4WGmTtnzPFVLjcyakGCh9PQ8T1UqFWea5u0C3EqNwRblC4feyXc2uhh1p2iz2cyEi3Y9krggv23hJaFPcY4NY682oWUKQo5N4BAk3jzPywhylaYrPUvvtuWlKvA/Tu2pkTtPv6J6tbS0pMrlsr6nKCyCMCol9b/GTBAEQRgDqtUqFhcXsbS0hGPHjnHnXafb7eLRRx/FhQsXrFOoc3NzeOmll9DpdEba9CEIQj4i0ARBEMaIqakpRFGEKIqsgmi3mZiYwMTEBLa3t7kTkiTBj370I6e7IAhXzq5vEqADiof5mdABwq7fzMzMwGHIhO1Zc3HnRnowNH+fyerq6sA9eZjvnJiYkENzBUEohExz2Gyq7QW0AcFleoQ2mRw/fpw7CYJwtfA5z92A1g/YFpWaZ6ZxaDEq2LEgnU5HryWwrYNQ7FnbehFzbYW5XsaEFsnSz3YPQeHBiNbSBUH4bkJrojzLGZN7CbVl5hqtKIp0m2lrTwVBuHp2fQQNAH7yk58AFrs0MCxN27Yqm1uuzbUOhw8fxu9+9zsAwCuvvKKvm5jPPvfccxk3pEYYPc9Ds9nEiRMnrLZvaPs52TVy2blpNBqIokj//8ADD2TcBUEQTObm5nDgwAH4vo/19fUB8xJ7ydraGsIwxAsvvKBnBYIgQBRFWFlZwcLCAn9EEIRrwJ4ItGGMMNpsB+UZuDx06BBg2G7i0LM2W0HVahUfffQR1tfXndaokVqxDoJAC0wbvV4Pr7zyCsIwBBz+CYIgmJw+fRpKKbRarbESZwAwOTmpj1Ei6/2XL19Gq9UaMNorCMK1Y08EGhlhJFHFUUpZhRJZ5rYdReIazSJcz5KV8WG+Wj/55JOMUUM6dsSkVqvB930tMG1iUhAEQRAEIY9dF2jm8RrmNGKr1bJadDYhi9C20TU6zsMliOhZOisuSRLMzs7i4sWLWFtbKxRnSIXlnXfe6Rz5oyNP/vCHP+hDePlZcoIgCIIgCEXsukCjkS5TjPV6PVSr1UKBRsd/8KNBkiTB888/DwB6LRrHfHZjYwMzMzOYmJjA2tqadb0Zh4Tlbbfdps+iowOKiV/96lcIwxCHDx/Wo4RFx6ZwGo3GwG7RYX+CIAiCIOwPdl2g0cjS4uKiFha+76Pf7+vRLRu9Xk8fVkxruuig50OHDqHf76PZbFrXRNCzSNeEHTlyRB/SO4w4gyEsDx8+PHDmHlJhdfnyZbz44otIkkT7N6rhxhMnTuh1HqP+BEEQBEHYJ/BtnTsNHdMSRZG+RqY18raW0/En/Of7vgrDcOAYDhN+dAqZy/A8j9/qJAzDzPlq5vN0nAhtQ88zFbKX8LSTn/zkJz/5yU9+w/92k10dQaORJc/zMjsbb7jhBniel7sO7NNPPwUA1Ov1zKjR9vY2FhYWckeq6FnafXns2DE9aucybsu5cOFCZoNBEAR6x2i1WkW5XNYbG9577z3AYSpEEARBEAShiF0VaB9++CFg2Ul5+PBhXL58OXONQ2u67rnnHu5UiO3ZJ598EgBw7tw5fc0FTZGamxNoarTRaKDdbqNer2u3jz/+GABw77336mvjAJ8SlZ/85Cc/+clPfsP/dpNdFWg0spRnR8xGkiR6kX/eSJkN17NPPPEEAKDdbqPX6+nrNr744guAbU6g0bGTJ0+iXq9nRv/a7TaQY0YkD9kkIAiCIAjCrgo020jWMNDIW7lc5k6FuJ6dnJzUxmRfe+21jBvnvffeG5iWvfHGG4F00wGJPaSmNuj6sBsQTGSTgCAIgiAIuybQzJGsm266iTvnQiNvV2KRP+/ZY8eOAemO0iRJuLPmwoULA6Y9yBba2bNnM0KMjNe6DhcWBEEQBEEoYtcE2quvvqr//vrrrzNuefR6PSwuLuq/R6Ho2R/84AdAejyUaxRtdXUVm5ub2N7ezoi4hx56CEqpjFmPXq+HP/3pT0AqSPNEnyB8VyGj1MvLy9xJuMYsLy9jenp66M1QgiCMEXxb505Qr9cHtqrmmcUw4c+NYrqi6NlyuZxxr9VqGfdOp5P7PKfIP+H6h0yq0K9er/NbrnvCMMzE8VoRx7Eql8vK931tkmav4G2SafZHsbbB9/2M2/VGs9lUvu+rcrms4jjmzsI1pKhc7RfMOJL5qlGJokiFYThW9atSqahKpTK0Ptlprl3rKwjfEeI41vb8xqUiX2vIVuC1+siI41h5nqeCIHCKhCAIMg1/kfg1RVS5XB65MyT7iC57iCRUr7QDGifiOFZBECjP85zpL1wbisrVfoHq69LSEncqpNlsKs/zVBiG1nrL2wIu4kw3+pnEcTzgzt9nE2JxHKt6va48zxsYsNkLdm2KUxD2C5OTk/A8DwCsp0rsB374wx8C19CW38zMDADkHq22trYG3/f1/998803G3WR1dVXvlvY8D2tra9Z1pnNzcyiVSmg0GtxJL3HgZn+IW265Bcg5T3d6ehqlUklvDBpnJicnsba2Bhh5IewMReVqv0D1+O677+ZOuTQaDTz22GNYWFjAwsKCtd6abUEQBHqzH7GysqL/rlQq+uQeYnJyEltbW/r/TqejN9PFcYzjx4/j/PnzOHLkSKb+Tk5O4sSJE1hfX8fi4uKe1xURaIJwBWxubiIIAqfYuN755z//CVwjW36tVgubm5s4depUbnpNTk5iamoKlUoFMOwJcpIkweOPP65FMhmItnH+/HnAsosbAD777DMgx+zPJ598AjjO0+31evq4uFFN/+wVk5OTOHXqFDY3N2VN2g5SVK7GnV6vh1KphLm5Oe6UYXt7u9DAPGd1dVWbpsqrt9QWAMCzzz470G5Q+1Sr1dBqtawizwyXWUcnJydx7NgxbcXhb3/7m3Yj7rzzTrz55ptot9uF6bCj8CE1QRDyobWJYRhyp30DTR/aph9GhaaDh5laA1B4VFqtVtNTFDCOWBsVep5PcxCe5w1MnVzv0NQPnzIqotlsDlXeaZ1h3rF9+52icjXu0Dq6vHpFa3FHnf73fX/oaXaqf7wNoinkvPAppdTW1pYCkDmi0YTimReHa9kOXgn7q/URhF2A1mcVNRDXM57njdyJ26BGMq8RJOhecyMGh+5ZWVnRwu9KxQA9b4PC4BKJ1zMkIEZJN1oTlCfSaJ3bfq8bReSVq3Gn0+loYZRXPugjapT1ZySshlnbRfWct0G0dm1lZSVz3UaRf1QP8uJA8cwr9zvJ9VmKhCum0+nogul5nq6EnU5HN66e5+kGlnbaIO0wXYWdqNfrmQWelUpFNZtNFQSB/qKkhZjUkFHhNxdo0nXzSysv7PSl4/t+buWld5AfnuflLka3xYf8ymvACJ5+ZsdVq9V0OGyNhLnLiZ7naWKysrKSWTgfBIFqNpuqUqk447i1tZVJD9/3Va1W03G1wZ+h5yqVysCXJn2luvw3WVpaUl66sJrSnFMul/WGAOQsxKZw5aUtpZENV+PeYTu7XWWAl3Hyi4+qmGU3r0zz54hR8oIYJU8IU3zZOqtrIc6azWam/NrqMsWXp5cyRu9s+aaM+mSmFU8nWxuUd51TVK6U8S6zXeGjjs105y29i+q8eX2YjTFxHGfaEC9dmL+0tDQgfigsth8vK9RGdDqdgTbOlvZqxA8D+gg205nSf5jnlbHJx1YeTQHoak8Jz/Oc7cxOM9gCCvsWavSjKNJfBvV6XTWbTVWv11Ucx/o6VQS6PzZ2LtoqiNlALy0tqTiOVRzHulLCmOKqVCq606Rn6F7qiOg5ahjywl6r1VQcx7rSeY4hdKqwFNe8OBXFZ5gKS+/odDoqTqeWaETGbJxhmQ4hgWB2IOS3TXBQ3EJjVxR1xEhHnDjkRxAEGWFAz9j8iaJIeeluTPIniiIdH95hUIfJ42ejkopf5XiOwhtFkf6b7udQevN3EEVfxtQB2Rp3ehYWAanSxt9LRyDJbzONuAizlWkS4pQfvDOld46SFwS905V2Lsw6Yaabed2WXkXQ857xYWjWZRMSMhQH8yPCrFO8vJvlhdKlk44WmZ20q20ql8s6L6ls2uJaVK6obFC7oAwxQnGp1+u6TTOFEAkruifPH2X45XlephyaAo9jS1cblAaj9BGUN8NgiqsoilSlUsmU82GgsJjPRFGkhZ5ZFvKwtUW7xXCpJew7qCEpl8sDXzxUkQJmEiGvoLoaLarwgeOLkhpmaniJvOfMsPMGisLBG2jX15QrTq74mH6PAgmGMAz1L45j3TibUGfC40aNMv+azWuswcQxYaYvd6OOiaeJMvzi6buSTjlyXOlrw/d9HTezY1Jp+nnGaCe587QwobjbyBNgykgDWwNOaWcrAxRO+sAxceWrKijTrniMmhdEXviL4CLtWooznl6ueBPUAStjNJq/QxWUdVe7oHLaJlc9VAXlyhRnZjjy8oPeVy6XM+/Me0YVlEN6J2/3lRE328eZCdKPhjKzreeq70Xh5VDemj9bX+CC2lvXryh+Jnn5vdO4S7+wr6FCxwt9ZKz/4ZWMGmJe4c2vU07RFyX5xTsZqtCwNNCusCujgTArk6txoC8+j4245cWH3EatrBQGL51icGE2rLwzoRE0M18ov2z3UyNl66ypAeR5bLrZoLQv+sImXA02h+JB5YB3FCEzaJknIpUxAmPLQ5VTlpWRbp5jlJREta0MUIdv6/xc5VAZ8eV5RfGwlfVR84LIC8cwmKLMS6f8bIJkGFydX1H+KTYibhMiBJVn3saoHP+V0TbxuFE9tL0vr1y56kJeeaJneJtBz9jKmWJpw8kLvyuMJmbbzONpG7VSI5Y5s01TRlmw+eeC+h1eN1ZWVrTwtsXfRl4Z2WnsrbCw76GKyAupq2DndVr0Lt6QKaNw29yo0to6nzw3V9hdblzYdDodtZSuwfCMaRUiLz58ZGdYzA6YCykT3lhvbW2pprE2hzfI9F7egCsjDbkbXediQBn57GpIo3Raje7hDTFnmAZfGcKX0obKYb1e1+Gld5hfx6605OnIgaMsKyN9eB0geHkyobSxpUue8HeVOXqG56G6grwgRuksXZgfclfzHvNjJE6ndGk0zPf93A6Z0iZPnFHnbivrKkfI5NURlwhROeWKC84ondYm/8uOUx4ojblfeSN/RfWDRKTNjZ7Lg+oWL5NUJmxpNkqZo7pv3kvx5X66yBNVFBZbPtnIe9dOI3bQvqOQkU/zLFEYh8s/8sgjmetkKNBmfJHe9cADD3AnvP766wAwcNg8DHtBv/71r7mTdjMNlxIfffQRPM8bCDu5AcD3v/99fY1sYR05cgSlUgnPPPMM1tfXcfz4cVy6dGnAHk9efC5cuABcgYHad955BwAwPz8/YNPH5I033gAAnDx5EqVSCY8++ijOnTuHo0ePIooinD59OnM/vffhhx/OXAeAt956CwBw3333Za6///77QGrgkUP57DJQe/DgQayvryMIArTbbfi+bzUCOyrvvvsufN/XaXPDDTcAqS2yZ555BpVKRdsy+vzzz4HUgKUrLbvdLgDg9ttv507aMKWtTMJIH5cdq83NTcBSBjY2NtDv9+H7vtUu06effgo40pbKHC+L7777LmDJQ+xgXhSRJIkuO77vo91uo1qt8tsKofTq9/s4cOAADhw4gPn5efT7fSwsLGB7ezvXxhYZhL3rrruc91G62totALh48SJgKSdUBp588snM9V6vhyiKrHmcV64oHO12G6VSCUEQ4OzZs/A8D51Ox2rAmd5XLpcH/KJ2yOYX1WFb/UiSBJubm5m6RlCdsdkMNFlfXwcsbQ61va60Hhbqg44ePaqv/fKXvwRSm4rDnHFN7eI999zDnXQ70u/3dZzHFq7YhP1P3teMa4ieRo743H3el2beF5Uq2NVDbvwLkb5EbaMbtq/lvLjauJr45AHHlzCH7huWvPe6vvRdozWq4Muc00y3vCPn65L8so12mgRBkPk6NkcBaISFoC9aPppoQnG3jRIUfRHnjfpRGbCN7NLIgqusUZh4WuSV0bwROZNh8oKwjVAMizm92Ww2M/8PO7pBFOVDHuQvjbS5oHbE5oc5CsjLiasMuEaPVEF8XO/Lw/U+Wztnklc/8sJfNG1KUDnjaZbXduSVcY5r+YJZ7opw5ati+V5Ur1ROPuwGMoL2HYRGp8wvFIKso/MvUvpicx3rQVafTWq1GpB+ydmgd3K/er0ezp8/D8/zBkaxPvjgA8AxurG8vAxYvnqvhLz4jPqFSF9ptq/uawV/7/LyMqIogud5A24EjUAQ3W4Xi4uLgOPLnDM7O4s333wTML5YOVTGyPK3DfqqN8uB+XX/8ssvZ/4nv+644w59zcQc5eCjBDBOCOCjJgSNBPARMtNtenqaO+mjqWz1amNjQ4eJj/y66mO320W/30cQBM48JIbJC4LygvtXRJIkmJmZwebmJprNJmZnZzGZHiEVBAEWFxd3bQRvZmYG09PTePDBBxFFkXNU5T//+Q/gGEn5+9//DgAIw3CgnFA+81MiXKNHGKJcjQq9j4ed2kDbCLjJjTfemPk/SRI8//zzgKXNhRE3V71CWreoTPI0yxvVI1z5RFBbAEvaP/vsswCAM2fOZK5zqL21hRFG3g7bHucdObfTiED7DkIVkTckeUP0VGl4xf7e974HpMd+mJBYgkNMUUW3QULor3/960AFcw1Jk7gIggAnTpzQ12+66SbA0TBQQ9/r9fQ1V3zMo3HojMZhoQZ1GGFHU7q28FarVayurmau0XFHZhy63a7OY1te/t///R8A4N///re+liQJXn75ZS2mbQ3XxMRExh84RIwJTZfkiQaakuFHKgVBgCAIcOzYscx1mi7iApP4+uuvgZwPA+q0b731Vu4EpFMfLnH35ZdfApZ6AKM+UcdqMj8/DwA4e/Ysd3LWx6+++gpwiMEryQuC8qJoKsvEJs4IU6SdPHly6GOkbr75ZsDRAXa73YFzEEulkg4HALz44ou6bXn77bcz9xI0nUwimEiSBK+88go8z8Nzzz2XcTOFMYfOfLSVnbxyRfXp22+/5U5otVrW44RcyymoDOYJKVjS9emnn9btC69rMMJv1qtWq5Vpc/I+UPI+CElsUT/igtoC29KW2dlZeJ6Hzc3N3PNvqb21hTFJEj0df/z4ce5shY6c40J5V+BDasL+xzVEnTeUaw4ZN1PjpwRN3dCQ9NLSkgpTmz1Ih8yj1JYN3UMLfM0ha7oHlqlUgvwKmPFGj9mDMqHpBXonxcFzGKm9kvjk4ZqutUF5EBoGaWnnUaVSGcgzvsi5k9rWoikFSqd6va7vobSn90VRpMqpKQGzbJj5bE4tUxpHhoFKPm1nkjfdGBvGRV15bkLpk5eeFHdKQzPuyigPURSpTmqg2QwbjOmjpaWlTFkn/5uGfSazDPDpGbNMu8Lrqo+UTxSPWq2m6vX6VeVFnLOz10U8pCmNYe8jYmPHsple9XRXphkPcyef53k63nzxfRiGmeeidCOF7/v6Gcpzz7G5IG+qz1w2wMtOXrky66MZ9kpq34uHg+IVWKbSzalEqrtmGTSnQKPUPlkYhqppbDayQe+leC8tLQ3UDddSF1VQb1TB5hrF2gK+rIGg8pU3VUr3mGGMUxuf5GbLWxcUnr3AnlPCviXKWUdFFcjWwFPH5KVmIszKs7W1pRsu37D+HRlGEYPUqj1hNgZUaZB2Oq4KTGEP0vVK1LH5qf0sW4VWaeU076c48EaRGDY+tnSyYTbqw1BnFugrlYrTL96o2YSILX2ooQUTg6583traUmEYZvKqKGwECQ0zbASFkX6uvFdMnOXdb6YJxd2ExDmFn+cLpY3neaqWGgwlzLJhKwO2sjZMmbbVx9gQPL7v6/pzNXlhCsxRoA6+CEp7V93ikEihOPjpSRa8LpPA8S07O6kt8X3fKhxsfoSGQWeOKYA4VJaR1hvzHUXlyhQISMuPLbyqYPfulvEhxcUZYYbFzA/63waJPRhtCc8HCr/NT1fbQVCcXOKItwVgQpLXf5t4tb3DvD8MQ2vYXdB6TVs+7AYi0IQ9gSr6KFBl4R2uMP4E6YgF77SE3SMyTh4Q9h8k6F0ifRzaT99id3KcMUdF9wJZgybsOrQQ1LbGIw/afs3X6gjjD5k6qVQq1vV1ws6SGKYxKC+E/cXTTz+Nzc1N6xo4GOsff/GLX3CnXePs2bPo9/t49dVXudPYsbq6ina7jVqtZl1XtxuIQBN2HbJjZVvEmQct1nQ1QML4cvDgQVy6dAkAcOjQoaEXkgtXT6vVwqFDhwAAly5d2rPORthZaFOBLX83NjbQbrdRqVSs7rvFQw89hFqthpdeemms24But4vHH38cQRAM2J7cTUSgCbsOGYGkHYjDQrv3+PZx4fpgcnISFy9exPz8PM6cOTPWDfR+odVq4cyZM5ifn8fFixetO1OF/UEYhgCAubk5PUqdJAmWl5fxs5/9DEEQ4I9//CN7avc5ffo0ms0mHnvsMVSr1YHdyHtJkiRoNBq4//77MTs7qw0Z7xUl9b+Fg4Kwa8zMzKDdbsPzPJw6dSpjFsPFxsYGjhw5AqTmE86fP7+nX4KCIAjjRqPRwOuvv54xZ1Eul/Hzn/98wFzNXtPr9fD73/8eFy9e3HMhRFSrVVy+fBm/+c1vBuyw7QUi0ARBEARBEMYMmeIUBEEQBEEYM0SgCYIgCIIgjBki0ARBEARBEMYMEWiCIAiCIAhjhgg0QRAEQRCEMUMEmiAIgiAIwpghAk0QBEEQBGHMEIEmCIIgCIIwZohAEwRBEARBGDNEoAmCIAiCIIwZItAEQRAEQRDGDBFogiAIgiAIY4YINEEQBEEQhDFDBJogCIIgCMKYIQJNEARBEARhzBCBJgiCIAiCMGaIQBMEQRAEQRgzRKAJgiAIgiCMGSLQBEEQBEEQxoz/D7UlPdGbiATVAAAAAElFTkSuQmCC\" width=\"616\" height=\"94\"\u003e\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eOrthotopic patient-derived xenograft mouse model\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTen-week-old C.B-17/IcrHsd-Prkdc SCID mice were anesthetized via isoflurane inhalation and positioned on their right side. The area above the spleen was shaved, and the skin was sterilized using 80% ethanol. A subcostal incision (approximately 2 cm) was made below the ribs to access the peritoneal cavity, exposing the spleen. Primary cultured cells were gently resuspended and slowly injected into the spleen. Following injection, the site was gently compressed for 2 min using a cotton swab to prevent backflow. The spleen was then repositioned at its site in the abdominal cavity, and the peritoneum and skin layers were sutured. Ten weeks post-injection, mice were sacrificed and spleens with tumor masses were excised and examined.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eScreening for antiproliferative effects of anticancer agents\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTwo 2.5D organoid cell lines, BS24026 and BS24077, were evaluated in a screening test. Cells were trypsinized and resuspended in culture medium for maintenance. Cells were suspended at 5\u0026times;10\u003csup\u003e3\u003c/sup\u003e cells/well in a 384-well plate using the Braco automated liquid handling platform (Agilent Technologies, Santa Clara, CA, USA) and cultured in a CO\u003csub\u003e2\u003c/sub\u003e incubator overnight at 37 \u0026deg;C. The following day, after seeding, 214 anticancer agents (Selleck Chemicals, Houston, TX, USA) were added at a fixed concentration of 10 \u0026micro;M using the same handler. The anticancer agents used in this study are listed in Supplementary Table 1. After 144 h of incubation, the CCK-8 assay was performed according to the manufacturer\u0026apos;s protocol to evaluate the proliferation suppression efficiency of each agent using a multimode Epoch multiplate reader (BioTeck, Winooki, VT, USA). To estimate the relative proliferation inhibition, the suppression efficiency relative to that of the control (DMSO) was calculated. The half-maximal inhibitory concentration (IC\u003csub\u003e50\u003c/sub\u003e) values of the selected agents were calculated through dose-response experiments. The signal values were plotted from the normalized cell numbers against the tested drug concentrations using GraphPad Prism. This analysis was repeated twice.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCell proliferation assay\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;HSA 2.5D organoid cells were seeded in 96-well plates at 1000 cells/100 \u0026micro;l medium/well. The number of living cells was detected via the PrestoBlue\u0026trade; Cell Viability assay on days 1, 4, and 7, and analyzed by measuring the fluorescent intensity in each well using a Tecan microplate reader, as previously described \u003csup\u003e14\u003c/sup\u003e.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eBoyden chamber invasion assay\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eMatrigel was diluted with serum-free medium (advanced DMEM) at a ratio of 1:1. For invasion assays, 50 \u0026mu;L of diluted gel was dropped in each Transwell\u0026reg; insert (8 \u0026mu;m PET membrane, Corning 3464). The gel was then fixed at 37 \u0026deg;C in a CO\u003csub\u003e2\u003c/sub\u003e incubator for 1 h. After fixation, the extra medium was aspirated into the insert. Cells were trypsinized and resuspended in serum-free DMEM. Next, 3\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells were resuspended in 300 \u0026mu;L serum-free media with treatment or vehicle and seeded into the upper chamber. Thereafter, 600 \u0026mu;L of culture medium with 10% FBS as a chemoattractant was added to the lower chambers. Cells were maintained overnight in an incubator at 37 \u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e. After 24 h, the Transwell inserts were washed twice with PBS, and the cells were fixed with 4% PFA for 2 min and methanol for 20 min at RT. The cells on the upper side of the inserts were removed using cotton swabs, and the lower side of the membrane was stained with Giemsa solution for 15 min at RT. Invading and migrating cells were observed and imaged using an optical microscope (BX52, Olympus, Japan).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003ePLAAT3 siRNA transfection\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;HSA 2.5D organoid cells were seeded at a density of 10\u003csup\u003e5\u003c/sup\u003e cells/well in a 6-well plate. After 24 h of culture, cells were transfected with siRNA against \u003cem\u003ePLAAT3\u003c/em\u003e or negative control siRNA (Sequence (5\u0026apos;\u0026ndash;3\u0026apos;): si 1, AGCACAUCACACAACAUUA and si 2, AAUGGUGGUUAUUCAGUUC) using Lipofectamine RNAiMAX (Invitrogen) following the manufacturer\u0026apos;s protocol. After 72 h, the cells were harvested, and evaluations were performed via cell proliferation assay, cell invasion assay, and quantitative RT-PCR.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStatistical analysis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eData are shown as mean \u0026plusmn; SEM. Statistical analysis was conducted using GraphPad Prism; the two-tailed Student\u0026rsquo;s t-test was used. \u003cem\u003eP\u003c/em\u003e values \u0026thinsp;\u0026lt; 0.05 were considered statistically significant.\u003c/p\u003e"},{"header":"Results ","content":"\u003cp\u003e\u003cem\u003eGeneration of 2.5D organoids from dogs with HSA and nodular NH\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003ePrimary cultured 2.5D organoids of HSA and NH were generated from patient spleen tissues after pathological confirmation (Fig. 1A). Histopathology of canine HSA samples post-surgery revealed a loss of normal vascular structure, which was associated with the formation of irregular, anastomosing vascular channels or sheets with enlarged hyperchromatic nuclei and prominent nucleoli, whereas NH samples presented with a well-organized structure with minimal atypia. HSA is generally characterized by relatively homogeneous populations of neoplastic endothelial cells, forming an invasive mass that is often poorly defined in adjacent tissues. NH usually appears as a well-restricted lesion, clearly separated from the adjacent normal tissue (Fig. 1B). IHC staining confirmed the expression of the angiosarcoma marker vWF, endothelial marker CD31, and VEGF in both HSA and NH 2.5D organoids, with a similar difference in expression levels in the primary tumor (Fig. 1B), which corresponded with the IF staining pattern in primary cultured HSA and NH 2.5D organoids (Fig. 1C).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eEstablishment of an orthotopic xenograft mouse model using dog HSA 2.5D organoids\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eNext, we established an orthotopic xenograft mouse model to simulate the pathology of HSA (Fig. 2A). Ten weeks after splenic injection with HSA 2.5D organoid cells in C.B-17/IcrHsd-Prkdc SCID mice, nine mice successfully developed orthotopic HSA in the spleen. Four out of nine mice showed liver metastasis, and three mice showed pancreatic metastasis (Fig. 2A, B, Supplemental Fig. 1A). H\u0026amp;E staining revealed an abnormal vessel-like cliff structure in the xenografted spleen tissues. Largely enlarged nuclei along with rapid and extensive infiltrating overgrowth of vascular endothelial cells were observed in the tumor masses inside and outside the spleen tissues (Fig. 2C). Moreover, IHC staining validated the expression of CD31, vWF, and PDGFRβ in the xenografted tumor tissues (Fig. 2C). To confirm drug sensitivity, we generated tumor cells from orthotopic xenograft tumor tissues using the 2.5D culture method (Supplementary Fig. 1B). Drug screening of orthotopic xenograft tumor-derived 2.5D organoids demonstrated a corresponding sensitivity to the original patient-derived 2.5D HSA organoids (Supplementary Fig. 1C). In addition, we successfully generated HSA 3D organoids using both tissue-generated cells and 2.5D orthotopic xenograft organoids (Fig. 3A, Supplementary Fig. 2). Primary cultured 3D organoids began to form on day 10 of culture, exhibiting hollow-like structures. Immunohistochemical expression of CD31 and vWF revealed endothelial features, whereas PDGFRβ expression confirmed the existence of pericyte cells in HSA 3D organoids (Fig. 3A), indicating the variety of cell types generated in HSA organoids. Furthermore, transmission electron microscopy (TEM) revealed a hollow luminal structure in HSA organoids (Fig. 3B). Atypical cells with enlarged, deformed nuclei containing multiple prominent nucleoli were arranged in an overlapping pattern, forming lumen-like structures. The cells exhibited slender cytoplasmic processes with deep interdigitation and relatively abundant microvilli on the luminal surface. The intercellular junctions included microvillous interdigitations and tight junctions along the free borders, whereas the abluminal side presented with pores. In some regions, the absence of a basement membrane resembled the sinusoidal capillaries of the liver or spleen. These atypical cells are rich in organelles, such as mitochondria, rough endoplasmic reticulum, free ribosomes, and the Golgi apparatus. Tonofilaments connected to desmosomes were present, and numerous pinocytic vesicles of variable sizes, some cystically dilated, were observed near the luminal surface. In a very small portion, granules resembling melanosomes were observed (Fig. 3C). Based on these features, the lesion was diagnosed as a well-differentiated vascular endothelial cell sarcoma.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eDrug sensitivity in HSA 2.5D organoids\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eCarboplatin, doxorubicin, toceranib, and cyclophosphamide are commonly used chemotherapies for HSA in pet clinics. Therefore, we conducted drug sensitivity tests using HSA 2.5D organoids to determine the optimal postoperative chemotherapy for HSA. We treated five HSA organoid lines with toceranib, carboplatin, cyclophosphamide, and doxorubicin (Fig. 4A). HSA 2.5D organoids from different patients showed different sensitivities to toceranib, carboplatin, and doxorubicin (Fig. 4A), suggesting individual variability in the response to chemotherapy. To further explore the responses of the established HSA 2.5D organoid lines to different chemotherapeutics, we administered 200 conventional chemotherapeutics, including cytotoxic agents, tyrosine kinase inhibitors (CDK/mTOR/PI3K inhibitors, HDAC inhibitors, etc.), and molecular-targeted agents (ALK inhibitors, BCR-ABL inhibitors, EGFR/VEGF/multi-kinase inhibitors, etc.) to two of our successfully established HSA 2.5D organoid lines. Both HSA lines showed the highest sensitivity to ALK and HDAC inhibitors (Fig. 4B). We calculated IC50 values to evaluate the efficacy of the top three ALK and HDAC inhibitors. All six drug IC50s were below 1.5 µM in two HSA lines (Fig. 4C, D), which may be considered a relatively high sensitivity. These data suggest new options for post-surgical chemotherapy against canine HSA.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eComparison of transcriptional profiles between HSA and NH 2.5D organoids\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eRNA sequencing was conducted to compare expression profiles between NH and HSA 2.5D organoids (Fig. 5A, B, C). Gene set enrichment analysis of DEGs revealed that pathways related to autophagy, autophagic membrane, lysosomes, and lysosomal membrane were upregulated in HSA 2.5D organoids (Fig. 5D). Genes related to the cellular membrane, lysosomal membrane, and autophagy, such as \u003cem\u003eHIP1\u003c/em\u003e, \u003cem\u003ePLAAT3\u003c/em\u003e, and \u003cem\u003eBNIP3\u003c/em\u003e, were found to be upregulated in HSA 2.5D organoids compared to NH organoids (Fig. 5E). Additionally, we confirmed this upregulation in gene expression using quantitative real time PCR. mRNA expression levels of the lysosomal membrane-related gene \u003cem\u003ePLAAT3\u003c/em\u003e was found to be higher in the HSA groups, which was further quantified via IF staining (Fig. 5F). Furthermore, IHC staining showed higher expression of PLAAT3 in HSA tissues than in NH tissues (Fig. 5G).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eEffects of PLAAT3 inhibition on cell proliferation and invasion in HSA 2.5D organoids\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTo further investigate the functional role of\u0026nbsp;\u003cem\u003ePLAAT3\u003c/em\u003e in HSA,\u0026nbsp;its\u0026nbsp;pharmacological inhibition was\u0026nbsp;performed using an\u0026nbsp;inhibitor, LEI110,\u0026nbsp;and the effects on cell proliferation and invasion in\u0026nbsp;HSA 2.5 organoid were assessed. LEI110 showed varying inhibitory effects on several HSA 2.5D organoid lines (Fig. 6A). In the invasion assay, 10 and 20 μM of LEI110 treatment resulted in significantly fewer invasive cells\u0026nbsp;in HSA 2.5D organoids\u0026nbsp;than\u0026nbsp;in\u0026nbsp;the vehicle-treated cells, suggesting pharmacological inhibition of\u0026nbsp;\u003cem\u003ePLAAT3\u003c/em\u003e via LEI110,\u0026nbsp;thereby effectively inhibiting\u0026nbsp;invasion ability\u0026nbsp;(Fig. 6B). Given that chemically inhibiting \u003cem\u003ePLAAT3\u003c/em\u003e suppressed cell proliferation and invasion, we subsequently performed genetic knockdown using siRNA (Fig. 6C). The cell viability assay showed a relative inhibitory effect\u0026nbsp;on knockdown cells on day 4 and a significant inhibitory effect\u0026nbsp;on day 7 in each cell line (Fig. 6D).\u0026nbsp;In the cell invasion assay, knockdown\u0026nbsp;of \u003cem\u003ePLAAT3\u003c/em\u003e resulted in almost no invasion when compared with negative control siRNA treatment (Fig. 6E).\u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eCD31, CD34, and vWF are core endothelial markers commonly investigated in AS and HSA research \u003csup\u003e17\u003c/sup\u003e, and are valuable in AS diagnosis to confirm endothelial cell origin. However, in the case of canine HSA, CD31/vWF may not be reliable distinguishing markers of HSA and NH. Similarly, the majority of canine HSA cases exhibit positive expression of CD31/vWF, indicating endothelial derivation \u003csup\u003e18\u003c/sup\u003e. Although both markers were expressed in HSA and NH, their expression patterns differed, with CD31 and vWF demonstrating a more even distribution in the NH samples. In contrast, CD31 expression in HSA tissues exhibited diffuse positive staining around the vascular-like structures, whereas vWF demonstrated characteristics similar to those reported in canine vascular neoplasms; a few cases showed strong positivity, with most presenting as focal weak positive or negative \u003csup\u003e19\u003c/sup\u003e. In the samples assessed in the present study, the positive areas were predominantly concentrated within vascular-like structures and appeared negative or weakly positive in regions containing proliferative tumor cells. This observation aligns with research reporting that mature endothelial cells exhibit higher vWF expression than undifferentiated cells \u003csup\u003e20\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eActive VEGF expression is observed in canine vascular tumors \u003csup\u003e21\u003c/sup\u003e such as HSA, as well as in breast cancers \u003csup\u003e22,23\u003c/sup\u003e. Not all studies have demonstrated a direct statistical association between inflammatory cells and other proangiogenic factors with a poorer prognosis; nevertheless, research indicates that a high expression of VEGF receptors correlates with heightened proliferative activity, with inflammatory cells potentially maintaining or amplifying these signals \u003csup\u003e21\u003c/sup\u003e. Although angiogenesis was less frequently observed in NH samples, VEGF expression (detected via IHC) in these lesions may be associated with local proliferation activities, such as regeneration and repair, rather than malignant vascularization.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eWe found an upregulation of the lysosomal membrane markers in HSA samples, indicating lysosomal dysfunction, which is associated with various diseases, such as Alzheimer's disease and cancer. Active cancer cell proliferation is highly dependent on effective lysosomal function. In addition to our sequencing results, evidence from the case comparing canine hemangiosarcoma with normal granular cells showed lysosome-like ultrastructural proteinaceous accumulation within single membrane vesicles \u003csup\u003e24\u003c/sup\u003e, indicating the presence of active lysosomes.\u003c/p\u003e\n\u003cp\u003eThe upregulation of lysosomal membrane pathways leads to enhanced lysosomal trafficking and membrane permeability. Correspondingly, we found that lysosomal trafficking related to \u003cem\u003eGLMP, GAA\u003c/em\u003e \u003csup\u003e25,26\u003c/sup\u003e, and \u003cem\u003ePLAAT3\u003c/em\u003e was upregulated.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cem\u003ePLAAT3,\u0026nbsp;\u003c/em\u003ewhich belongs to the \u003cem\u003ePLAAT\u003c/em\u003e family, is known to exhibit phospholipase A2 activity, mediating lipid reprogramming and glycerophospholipid remodeling in cancer cells; \u003cem\u003ePLAAT3\u003c/em\u003e is consistently reported to be highly expressed and activated in various cancers. \u003csup\u003e27-30\u003c/sup\u003e \u003cem\u003ePLAAT3\u003c/em\u003e upregulation enables N-acyltransferase activity, resulting in membrane-associated\u0026nbsp;protein dysfunction, cathepsin upregulation, and mislocalization,\u0026nbsp;thereby promoting tumor invasion and migration\u0026nbsp;\u003csup\u003e31\u003c/sup\u003e. Our \u003cem\u003ePLAAT3\u003c/em\u003e knockdown experiments using siRNA and \u003cem\u003ePLAAT3\u003c/em\u003e inhibitor treatment of HSA 2.5D organoids demonstrated significant inhibition of cell migration and invasion. Given that\u0026nbsp;\u003cem\u003ePLAAT3\u003c/em\u003e is related to metastasis and membrane permeability, and is associated with increased drug sensitivity in human osteosarcoma, we carried out a combination treatment cell viability test; a higher sensitivity to each drug was observed upon co-treatment with a \u003cem\u003ePLAAT3\u003c/em\u003e inhibitor.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eMoreover, lipid accumulation in endothelial cells is related to angiogenesis and angiogenic sprouting \u003csup\u003e32,33\u003c/sup\u003e.\u0026nbsp;\u003cem\u003ePLAAT3\u003c/em\u003e (also known as \u003cem\u003eHRASLS3\u003c/em\u003e, \u003cem\u003ePLA2G16\u003c/em\u003e, \u003cem\u003eH-rev107,\u003c/em\u003e or \u003cem\u003eAdPLA\u003c/em\u003e), through the POR pathway via its PLA2 activity,\u0026nbsp;is involved in lipid accumulation within liver cells\u0026nbsp;\u003csup\u003e34\u003c/sup\u003e.\u0026nbsp;\u003cem\u003ePLAAT3\u003c/em\u003e was found to be upregulated in our study, suggesting that it contributes to active angiogenesis in HSA vs NH.\u0026nbsp;Although\u0026nbsp;pharmacological inhibition and knockdown of \u003cem\u003ePLAAT3\u003c/em\u003e led to a mild reduction in cell proliferation, our findings suggest that \u003cem\u003ePLAAT3\u003c/em\u003e additionally contributes to angiogenesis; however, it may play a supportive rather than an essential role, such as in cell migration and invasion. Therefore, \u003cem\u003ePLAAT3\u003c/em\u003e is a potential pharmacological target and prognostic tool for HSA.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eOur study revealed upregulated genes in HSA 2.5D organoids, including \u003cem\u003ePLAAT3\u003c/em\u003e, \u003cem\u003eHIP1,\u003c/em\u003e and \u003cem\u003eMARVELD3,\u0026nbsp;\u003c/em\u003ewhen compared with NH organoids. \u003cem\u003eHIP1\u0026nbsp;\u003c/em\u003eis an endocytic protein with protein-trafficking properties within the cell, especially huntingtin binding in the brain. Although the pathogenesis of Huntington's disease may be attributable to the loss of this interaction \u003csup\u003e35\u003c/sup\u003e, \u003cem\u003eHIP1\u003c/em\u003e overexpression has been observed in prostate and colon cancer \u003csup\u003e36\u003c/sup\u003e, which aligns with our findings regarding increased HSA-associated expression. Studies of the prostate and colon suggest that \u003cem\u003eHIP1\u003c/em\u003e overexpression is a late episode in cancer progression, and may not be sufficient as a diagnostic marker; \u003cem\u003eHIP1\u003c/em\u003e can transform fibroblasts, and cells overexpressing HIP1 show upregulation of basic fibroblast growth factor (bFGF) \u003csup\u003e37\u003c/sup\u003e. bFGF was found to promote tumor vascularization and subsequent growth \u003csup\u003e38\u003c/sup\u003e. Therefore, \u003cem\u003eHIP1\u003c/em\u003e may play an oncogenic role in HSA, warranting further investigation.\u003c/p\u003e\n\u003cp\u003eWe observed the absence of a basement membrane along with pores at the intercellular junctions, both in organoids and canine HSA tissue. This may be due to changes in gene regulation. \u003cem\u003eMARVELD3,\u0026nbsp;\u003c/em\u003ea member of the \u003cem\u003eTAMP\u003c/em\u003e family, which is associated with tight junctions and epithelial remodeling, is a regulator of epithelial cell proliferation, migration, and survival in human colon and pancreatic cancer; moreover, \u003cem\u003eMARVELD3\u003c/em\u003e was found to be upregulated in oral squamous cell carcinoma \u003csup\u003e39-41\u003c/sup\u003e. In our study, RT-PCR revealed a significant\u0026nbsp;increase in the number of HSA cells; however,\u0026nbsp;sequencing of FPKM suggested\u0026nbsp;a non-significant upregulation. The changes in other TAMP family members, such as \u003cem\u003eMARVELD1\u003c/em\u003e and \u003cem\u003eMARVELD2\u003c/em\u003e, shared a similar pattern as seen in oral squamous cell carcinoma \u003csup\u003e39\u003c/sup\u003e: increased \u003cem\u003eMARVELD1\u003c/em\u003e in the patient group and equal MARVED2 transcriptional levels in both the patient and healthy groups. Although the findings of our study\u0026nbsp;provide\u0026nbsp;some insights, they should be interpreted with caution because of the limited sample size. Further research with a larger sample size is required to validate these results.\u003c/p\u003e\n\u003cp\u003eSomatic mutations in \u003cem\u003ePIK3CA\u003c/em\u003e and \u003cem\u003eTP53\u003c/em\u003e have been identified in both HAS and AS; however, in our samples, the FPKM values of these genes showed no significant changes.\u003c/p\u003e\n\u003cp\u003eIn this study, we successfully established nine orthotopic xenograft canine HSAs using splenic injection. The histopathological structure of the xenograft mass was similar to that of the original tumor tissue, with a vascular-like cleft formation and high nuclear atypia. In addition, IHC staining detected vWF \u003csup\u003e42\u003c/sup\u003e, canine endothelial cell marker CD31 \u003csup\u003e43\u003c/sup\u003e, and angiogenesis-related VEGF \u003csup\u003e44\u003c/sup\u003e immunoreactivity in the xenograft tumor mass, sharing similar distribution patterns as canine HSA tumor tissues, indicating that our xenograft model could maintain the original endothelial features. Moreover, the morphology of the primary cultured cells simulated that of the original patient cells, and drug sensitivity testing showed a comparable drug sensitivity trend. In conclusion, our model preserved the morphological and innate characteristics of the original tissues.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIn human colorectal cancer \u003csup\u003e45,46\u003c/sup\u003e and renal cell carcinoma \u003csup\u003e47\u003c/sup\u003e, orthotopic models tend to display a greater tendency to metastasize to other organs than heterotopic transplanted models. Human osteosarcoma cases have reported a similar metastatic pattern in orthotopic models \u003csup\u003e48\u003c/sup\u003e. The use of patient-derived tissue flaps via subcutaneous transplantation in nude mice have helped establish HAS models \u003csup\u003e49\u003c/sup\u003e; however, such models do not show liver metastasis, which is a central clinical feature. In our study, only four out of nine xenografts developed liver metastasis. This may be attributed to the limited duration (10 weeks) of tumor generation or the leak from the injection point, as three out of five cases without metastasis showed pancreatic seedings of the hemangiosarcoma mass.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;Being able to recapitulate the 3D structures and components of original tissues, organoids are useful models for evaluating the therapeutic potential of drugs. In the present study, we successfully generated HSA 3D organoids using xenograft tumor cells. Our generated organoids effectively maintained endothelial features, forming a complex, interconnected network of CD31-positive cells along with vWF-positive cells on the luminal side of the organoids. IHC staining demonstrated proper localization of pericytes as defined by PDGFRβ immunoreactivity, following a pattern of enveloping CD31-positive endothelial cells, suggesting diverse cell types in our cultured organoids. However, the functions of diverse cells require further exploration. The development of the xenograft mass into 3D organoids rather than primary tissue may be attributed to \u003cem\u003ein vivo\u0026nbsp;\u003c/em\u003eselection of more aggressive tumor cell clones during xenograft progression, leading to the generation of xenograft tumor cells having the capacity for 3D structure \u003csup\u003e50\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eTEM indicated ultrastructural details in our cultured organoids that shared common features with canine HSA with vasoformation; a slit-like structure was observed in canine HSA, and our organoids appeared to have a luminal hollow structure resembling vascular lumina. They shared fragmentary basal laminae, which were partially absent in our organoids and resembled sinusoidal capillaries. Weibel-Palade bodies, which are considered human endothelium markers, found in both rat HSA and mouse AS cases \u003csup\u003e51-53\u003c/sup\u003e, were absent in our HSA organoids as well as in canines cases \u003csup\u003e24,54\u003c/sup\u003e. Our HSA organoids exhibited a relatively well-differentiated endothelial phenotype with complex junctions and lumen formation compared with that of canine tissues. However, to ensure the quality of research tools that can reflect the original patient tumor characteristics, further sequencing studies are necessary. Furthermore, the ability of the models to capture gene mutations and transcriptional profiles should be evaluated.\u003c/p\u003e\n\u003cp\u003eSpontaneous HSA pathology is frequently associated with the coexistence of tumor cells and infiltrating inflammatory cells, which may increase the risk of contamination during direct genetic expression detection in clinical samples. Therefore, the xenograft model and primary cell culture method established in this present study may serve as potent tools to resolve this issue.\u003c/p\u003e\n\u003cp\u003eIn conclusion, we successfully generated patient-derived HSA 2.5D and orthotopic xenograft-derived 3D HSA organoid lines. We then compared the transcription patterns between HSA and NH 2.5D organoids, revealing an upregulation of the lysosomal membrane pathway and genes, including \u003cem\u003ePLAAT3\u003c/em\u003e. Our findings indicate \u003cem\u003ePLAAT3\u003c/em\u003e as a novel therapeutic target and prognostic tool for HSA.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank Editage (www.editage.jp) for the English language editing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eM. E., K. S., and T. U. conceptualized the project and obtained funding. Y. L., H. Y, A. A., M. E., T. U., and K. S. designed the experiments. H. Y. (Haru Yamamoto), Y. L., Y. S., T. K., and M. K. performed the experiments. Y. L. performed data analysis. Y. L., M. E., T. U., and K. S. wrote the manuscript. M. K. edited the manuscript. All authors provided feedback on the manuscript draft.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe raw data from RNA sequencing of HSA and NH 2.5D organoids are available from the National Center for Biotechnology Information Sequence Read Archive (NCBI SRA) repository (BioProject ID: PRJNA1399620; BioSample accessions: SAMN54501156, SAMN54501157, SAMN54501158, SAMN54501159, SAMN54501160, SAMN54501161, SAMN54501162, SAMN54501163, SAMN54501164, SAMN54501165). Additional information regarding RNA sequencing data is available from the corresponding author upon reasonable request.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAdditional information\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCorrespondence and requests for materials should be addressed to T.U. and M.E.\u003c/p\u003e\n\u003cp\u003eReprints and permissions information\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003eare available at www.nature.com/reprints.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePublisher’s note:\u003c/strong\u003e Springer Nature remains neutral regarding jurisdictional claims in published maps and institutional affiliations.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cbr\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAupperle-Lellbach, H.\u003cem\u003e et al.\u003c/em\u003e Tumour incidence in dogs in Germany: a retrospective analysis of 109,616 histopathological diagnoses (2014\u0026ndash;2019). \u003cem\u003eJ. Comp. Pathol.\u003c/em\u003e \u003cstrong\u003e198\u003c/strong\u003e, 33-55 (2022). https://doi.org/10.1016/j.jcpa.2022.07.009\u003c/li\u003e\n\u003cli\u003eBatschinski, K.\u003cem\u003e et al.\u003c/em\u003e Canine visceral hemangiosarcoma treated with surgery alone or surgery and doxorubicin: 37 cases (2005-2014). \u003cem\u003eCan. Vet. J.\u003c/em\u003e \u003cstrong\u003e59\u003c/strong\u003e, 967-972 (2018). \u003c/li\u003e\n\u003cli\u003eStory, A. L.\u003cem\u003e et al.\u003c/em\u003e Outcomes of 43 small breed dogs treated for splenic hemangiosarcoma. \u003cem\u003eVet. Surg.\u003c/em\u003e \u003cstrong\u003e49\u003c/strong\u003e, 1154-1163 (2020). https://doi.org/10.1111/vsu.13470\u003c/li\u003e\n\u003cli\u003eSuzuki, T. \u003cem\u003eet al.\u003c/em\u003e Current understanding of comparative pathology and prospective research approaches for canine hemangiosarcoma. \u003cem\u003eRes. Vet. Sci.\u003c/em\u003e \u003cstrong\u003e167\u003c/strong\u003e, 105120 (2024). https://doi.org/10.1016/j.rvsc.2023.105120\u003c/li\u003e\n\u003cli\u003eThamm, D. \u0026amp; Vail, D. Withrow and MacEwen\u0026rsquo;s small animal clinical oncology. (2013). DOI: 10.1016/C2009-0-53135-2\u003c/li\u003e\n\u003cli\u003eCole, P. A. Association of canine splenic hemangiosarcomas and hematomas with nodular lymphoid hyperplasia or siderotic nodules. \u003cem\u003eJ. Vet. Diagn. Invest.\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 759-762 (2012). https://doi.org/10.1177/1040638712447580\u003c/li\u003e\n\u003cli\u003eMegquier, K.\u003cem\u003e et al.\u003c/em\u003e Comparative Genomics Reveals Shared Mutational Landscape in Canine Hemangiosarcoma and Human Angiosarcoma. \u003cem\u003eMol. Cancer. Res.\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 2410-2421 (2019). https://doi.org/10.1158/1541-7786.Mcr-19-0221\u003c/li\u003e\n\u003cli\u003eWong, K.\u003cem\u003e et al.\u003c/em\u003e Comparison of the oncogenomic landscape of canine and feline hemangiosarcoma shows novel parallels with human angiosarcoma. \u003cem\u003eDis. Model. Mech.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, dmm049044 (2021). https://doi.org/10.1242/dmm.049044\u003c/li\u003e\n\u003cli\u003eWong, S.\u003cem\u003e et al.\u003c/em\u003e Genomic landscapes of canine splenic angiosarcoma (hemangiosarcoma) contain extensive heterogeneity within and between patients. \u003cem\u003ePLoS One\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, e0264986 (2022). https://doi.org/10.1371/journal.pone.0264986\u003c/li\u003e\n\u003cli\u003ePu, J. \u003cem\u003eet al. \u003c/em\u003eMechanisms and functions of lysosome positioning. \u003cem\u003eJ. Cell. Sci.\u003c/em\u003e \u003cstrong\u003e129\u003c/strong\u003e, 4329-4339 (2016). https://doi.org/10.1242/jcs.196287\u003c/li\u003e\n\u003cli\u003eTian, B.\u003cem\u003e et al.\u003c/em\u003e Basement membrane proteins play an active role in the invasive process of human hepatocellular carcinoma cells with high metastasis potential. \u003cem\u003eJ. Cancer. Res. Clin. \u003c/em\u003e\u003cem\u003eOncol.\u003c/em\u003e \u003cstrong\u003e131\u003c/strong\u003e, 80-86 (2005). https://doi.org/10.1007/s00432-004-0614-3\u003c/li\u003e\n\u003cli\u003eKim, J. H.\u003cem\u003e et al.\u003c/em\u003e Hemangiosarcoma Cells Promote Conserved Host-derived Hematopoietic Expansion. \u003cem\u003eCancer. Res. Commun.\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 1467-1480 (2024). https://doi.org/10.1158/2767-9764.Crc-23-0441\u003c/li\u003e\n\u003cli\u003eKodama, A.\u003cem\u003e et al.\u003c/em\u003e Establishment of canine hemangiosarcoma xenograft models expressing endothelial growth factors, their receptors, and angiogenesis-associated homeobox genes. \u003cem\u003eBMC Cancer.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 363 (2009). https://doi.org/10.1186/1471-2407-9-363\u003c/li\u003e\n\u003cli\u003eAbugomaa, A.\u003cem\u003e et al.\u003c/em\u003e Establishment of 2.5D organoid culture model using 3D bladder cancer organoid culture. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 9393 (2020). https://doi.org/10.1038/s41598-020-66229-w\u003c/li\u003e\n\u003cli\u003eAbugomaa, A.\u003cem\u003e et al.\u003c/em\u003e Establishment of a direct 2.5D organoid culture model using companion animal cancer tissues. \u003cem\u003eBiomed. Pharmacother.\u003c/em\u003e \u003cstrong\u003e154\u003c/strong\u003e, 113597 (2022). https://doi.org/https://doi.org/10.1016/j.biopha.2022.113597\u003c/li\u003e\n\u003cli\u003eLiu, Y.\u003cem\u003e et al.\u003c/em\u003e Salinomycin induces apoptosis and potentiates the antitumor effect of doxorubicin against feline mammary tumor 2.5D organoids. \u003cem\u003eJ. Vet. Med. Sci.\u003c/em\u003e \u003cstrong\u003e86\u003c/strong\u003e, 1256-1264 (2024). https://doi.org/10.1292/jvms.24-0344\u003c/li\u003e\n\u003cli\u003eCao, J. \u003cem\u003eet al\u003c/em\u003e. Angiosarcoma: a review of diagnosis and current treatment. \u003cem\u003eAm. J. Cancer Res.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 2303-2313 (2019). \u003c/li\u003e\n\u003cli\u003eLamerato-Kozicki, A. R. \u003cem\u003eet al\u003c/em\u003e. Canine hemangiosarcoma originates from hematopoietic precursors with potential for endothelial differentiation. \u003cem\u003eExp. Hematol.\u003c/em\u003e \u003cstrong\u003e34\u003c/strong\u003e, 870-878 (2006). https://doi.org/10.1016/j.exphem.2006.04.013\u003c/li\u003e\n\u003cli\u003eGamlem, H. \u0026amp; Nordstoga, K. Canine vascular neoplasia--histologic classification and inmunohistochemical analysis of 221 tumours and tumour-like lesions. \u003cem\u003eAPMIS Suppl.\u003c/em\u003e \u003cstrong\u003e2008\u003c/strong\u003e, 19-40 (2008). https://doi.org/10.1111/j.1600-0463.2008.125m3.x\u003c/li\u003e\n\u003cli\u003eNakhaei-Nejad, M.\u003cem\u003e et al.\u003c/em\u003e Regulation of von Willebrand Factor Gene in Endothelial Cells That Are Programmed to Pluripotency and Differentiated Back to Endothelial Cells. \u003cem\u003eStem Cells.\u003c/em\u003e \u003cstrong\u003e37\u003c/strong\u003e, 542-554 (2019). https://doi.org/10.1002/stem.2978\u003c/li\u003e\n\u003cli\u003eYonemaru, K. \u003cem\u003eet al.\u003c/em\u003e Expression of vascular endothelial growth factor, basic fibroblast growth factor, and their receptors (flt-1, flk-1, and flg-1) in canine vascular tumors. \u003cem\u003eVet. Pathol.\u003c/em\u003e \u003cstrong\u003e43\u003c/strong\u003e, 971-980 (2006). https://doi.org/10.1354/vp.43-6-971\u003c/li\u003e\n\u003cli\u003eCarvalho, M. I.\u003cem\u003e et al.\u003c/em\u003e A Comparative Approach of Tumor-Associated Inflammation in Mammary Cancer between Humans and Dogs. \u003cem\u003eBiomed. Res. Int.\u003c/em\u003e \u003cstrong\u003e2016\u003c/strong\u003e, 4917387 (2016). https://doi.org/10.1155/2016/4917387\u003c/li\u003e\n\u003cli\u003eCarvalho, M. I.\u003cem\u003e et al.\u003c/em\u003e High COX-2 expression is associated with increased angiogenesis, proliferation and tumoural inflammatory infiltrate in canine malignant mammary tumours: a multivariate survival study. \u003cem\u003eVet. Comp. Oncol.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 619-631 (2017). https://doi.org/10.1111/vco.12206\u003c/li\u003e\n\u003cli\u003eBolfa, P. \u003cem\u003eet al.\u003c/em\u003e Cutaneous epithelioid hemangiosarcoma with granular cell differentiation in a dog: a case report and review of the literature. \u003cem\u003eJ. Vet. Diagn. Invest.\u003c/em\u003e \u003cstrong\u003e30\u003c/strong\u003e, 951-954 (2018). https://doi.org/10.1177/1040638718794785\u003c/li\u003e\n\u003cli\u003eFranchi, L.\u003cem\u003e et al.\u003c/em\u003e Cytosolic double-stranded RNA activates the NLRP3 inflammasome via MAVS-induced membrane permeabilization and K+ efflux. \u003cem\u003eJ. Immunol.\u003c/em\u003e \u003cstrong\u003e193\u003c/strong\u003e, 4214-4222 (2014). https://doi.org/10.4049/jimmunol.1400582\u003c/li\u003e\n\u003cli\u003eMarze, N.\u003cem\u003e et al.\u003c/em\u003e Engineering of a lysosomal-targeted GAA enzyme. \u003cem\u003eProtein. Eng. Des. Sel.\u003c/em\u003e \u003cstrong\u003e38, \u003c/strong\u003egzaf001 (2025). https://doi.org/10.1093/protein/gzaf001\u003c/li\u003e\n\u003cli\u003eJarrard, W. E.\u003cem\u003e et al.\u003c/em\u003e Screening of urine identifies PLA2G16 as a field defect methylation biomarker for prostate cancer detection. \u003cem\u003ePLoS One.\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, e0218950 (2019). https://doi.org/10.1371/journal.pone.0218950\u003c/li\u003e\n\u003cli\u003eShyu, R. Y.\u003cem\u003e et al.\u003c/em\u003e H-rev107 regulates prostaglandin D2 synthase-mediated suppression of cellular invasion in testicular cancer cells. \u003cem\u003eJ. Biomed. Sci.\u003c/em\u003e \u003cstrong\u003e20\u003c/strong\u003e, 30 (2013). https://doi.org/10.1186/1423-0127-20-30\u003c/li\u003e\n\u003cli\u003eUyama, T. \u003cem\u003eet al.\u003c/em\u003e The PLAAT family as phospholipid-related enzymes. \u003cem\u003eProg. Lipid. Res.\u003c/em\u003e \u003cstrong\u003e98\u003c/strong\u003e, 101331 (2025). https://doi.org/10.1016/j.plipres.2025.101331\u003c/li\u003e\n\u003cli\u003eXia, W. \u003cem\u003eet al.\u003c/em\u003e PLA2G16 is a mutant p53/KLF5 transcriptional target and promotes glycolysis of pancreatic cancer. \u003cem\u003eJ. Cell. Mol. Med.\u003c/em\u003e \u003cstrong\u003e24\u003c/strong\u003e, 12642-12655 (2020). https://doi.org/10.1111/jcmm.15832\u003c/li\u003e\n\u003cli\u003eMohamed, M. M. \u0026amp; Sloane, B. F. Cysteine cathepsins: multifunctional enzymes in cancer. \u003cem\u003eNat. Rev. Cancer.\u003c/em\u003e \u003cstrong\u003e6\u003c/strong\u003e, 764-775 (2006). https://doi.org/10.1038/nrc1949\u003c/li\u003e\n\u003cli\u003eElmasri, H.\u003cem\u003e et al.\u003c/em\u003e Endothelial cell-fatty acid binding protein 4 promotes angiogenesis: role of stem cell factor/c-kit pathway. \u003cem\u003eAngiogenesis.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 457-468 (2012). https://doi.org/10.1007/s10456-012-9274-0\u003c/li\u003e\n\u003cli\u003eElmasri, H.\u003cem\u003e et al.\u003c/em\u003e Fatty acid binding protein 4 is a target of VEGF and a regulator of cell proliferation in endothelial cells. \u003cem\u003eFASEB J.\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 3865-3873 (2009). https://doi.org/10.1096/fj.09-134882\u003c/li\u003e\n\u003cli\u003eTsai, F \u003cem\u003eet al.\u003c/em\u003e H-rev107 Regulates Cytochrome P450 Reductase Activity and Increases Lipid Accumulation. \u003cem\u003ePLoS One.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, e0138586 (2015). https://doi.org/10.1371/journal.pone.0138586\u003c/li\u003e\n\u003cli\u003eKalchman, M. A.\u003cem\u003e et al.\u003c/em\u003e HIP1, a human homologue of S. cerevisiae Sla2p, interacts with membrane-associated huntingtin in the brain. \u003cem\u003eNat. Genet.\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 44-53 (1997). https://doi.org/10.1038/ng0597-44\u003c/li\u003e\n\u003cli\u003eRao, D. S.\u003cem\u003e et al.\u003c/em\u003e Huntingtin-interacting protein 1 is overexpressed in prostate and colon cancer and is critical for cellular survival. \u003cem\u003eJ. Clin. Invest.\u003c/em\u003e \u003cstrong\u003e110\u003c/strong\u003e, 351-360 (2002). https://doi.org/10.1172/jci15529\u003c/li\u003e\n\u003cli\u003eRao, D. S.\u003cem\u003e et al.\u003c/em\u003e Altered receptor trafficking in Huntingtin Interacting Protein 1-transformed cells. \u003cem\u003eCancer Cell.\u003c/em\u003e \u003cstrong\u003e3\u003c/strong\u003e, 471-482 (2003). https://doi.org/10.1016/s1535-6108(03)00107-7\u003c/li\u003e\n\u003cli\u003eYamamoto, T. \u003cem\u003eet al. \u003c/em\u003eExpression of basic fibroblast growth factor and its receptor in angiosarcoma. \u003cem\u003eJ. Am. Acad. Dermatol.\u003c/em\u003e \u003cstrong\u003e41\u003c/strong\u003e, 127-129 (1999). https://doi.org/10.1016/s0190-9622(99)70422-6\u003c/li\u003e\n\u003cli\u003eHuang, K.\u003cem\u003e et al.\u003c/em\u003e High expression of MARVELD3 as a potential prognostic biomarker for oral squamous cell carcinoma. \u003cem\u003eFront. Genet.\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 1050402 (2022). https://doi.org/10.3389/fgene.2022.1050402\u003c/li\u003e\n\u003cli\u003eKojima, T.\u003cem\u003e et al.\u003c/em\u003e Downregulation of tight junction-associated MARVEL protein marvelD3 during epithelial-mesenchymal transition in human pancreatic cancer cells. \u003cem\u003eExp. Cell Res.\u003c/em\u003e \u003cstrong\u003e317\u003c/strong\u003e, 2288-2298 (2011). https://doi.org/10.1016/j.yexcr.2011.06.020\u003c/li\u003e\n\u003cli\u003eLi, Y.\u003cem\u003e et al.\u003c/em\u003e Role of tight junction-associated MARVEL protein marvelD3 in migration and epithelial-mesenchymal transition of hepatocellular carcinoma. \u003cem\u003eCell. Adh. Migr.\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 249-260 (2021). https://doi.org/10.1080/19336918.2021.1958441\u003c/li\u003e\n\u003cli\u003evon Beust, B. R., Suter, M. M. \u0026amp; Summers, B. A. Factor VIII-related antigen in canine endothelial neoplasms: an immunohistochemical study. \u003cem\u003eVet. Pathol.\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 251-255 (1988). https://doi.org/10.1177/030098588802500401\u003c/li\u003e\n\u003cli\u003eFerrer, L. \u003cem\u003eet al.\u003c/em\u003e Immunohistochemical detection of CD31 antigen in normal and neoplastic canine endothelial cells. \u003cem\u003eJ. Comp. Pathol.\u003c/em\u003e \u003cstrong\u003e112\u003c/strong\u003e, 319-326 (1995). https://doi.org/10.1016/s0021-9975(05)80013-1\u003c/li\u003e\n\u003cli\u003eMelincovici, C. S.\u003cem\u003e et al.\u003c/em\u003e Vascular endothelial growth factor (VEGF) - key factor in normal and pathological angiogenesis. \u003cem\u003eRom. J. Morphol. Embryol.\u003c/em\u003e \u003cstrong\u003e59\u003c/strong\u003e, 455-467 (2018). \u003c/li\u003e\n\u003cli\u003eMorikawa, K.\u003cem\u003e et al.\u003c/em\u003e Influence of organ environment on the growth, selection, and metastasis of human colon carcinoma cells in nude mice. \u003cem\u003eCancer Res.\u003c/em\u003e \u003cstrong\u003e48\u003c/strong\u003e, 6863-6871 (1988). \u003c/li\u003e\n\u003cli\u003eFidler, I. J. Orthotopic implantation of human colon carcinomas into nude mice provides a valuable model for the biology and therapy of metastasis. \u003cem\u003eCancer Metastasis Rev.\u003c/em\u003e \u003cstrong\u003e10\u003c/strong\u003e, 229-243 (1991). https://doi.org/10.1007/bf00050794\u003c/li\u003e\n\u003cli\u003eNaito, S. \u003cem\u003eet al.\u003c/em\u003e Growth and metastasis of tumor cells isolated from a human renal cell carcinoma implanted into different organs of nude mice. \u003cem\u003eCancer Res.\u003c/em\u003e \u003cstrong\u003e46\u003c/strong\u003e, 4109-4115 (1986). \u003c/li\u003e\n\u003cli\u003eIgarashi, K.\u003cem\u003e et al.\u003c/em\u003e Patient-derived orthotopic xenograft models of sarcoma. \u003cem\u003eCancer Lett.\u003c/em\u003e \u003cstrong\u003e469\u003c/strong\u003e, 332-339 (2020). https://doi.org/https://doi.org/10.1016/j.canlet.2019.10.028\u003c/li\u003e\n\u003cli\u003eKodama, A.\u003cem\u003e et al.\u003c/em\u003e Establishment of canine hemangiosarcoma xenograft models expressing endothelial growth factors, their receptors, and angiogenesis-associated homeobox genes. \u003cem\u003eBMC Cancer.\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 363 (2009). https://doi.org/10.1186/1471-2407-9-363\u003c/li\u003e\n\u003cli\u003eHidalgo, M.\u003cem\u003e et al.\u003c/em\u003e Patient-derived xenograft models: an emerging platform for translational cancer research. \u003cem\u003eCancer Discov.\u003c/em\u003e \u003cstrong\u003e4\u003c/strong\u003e, 998-1013 (2014). https://doi.org/10.1158/2159-8290.Cd-14-0001\u003c/li\u003e\n\u003cli\u003eRothweiler, S.\u003cem\u003e et al.\u003c/em\u003e Generation of a murine hepatic angiosarcoma cell line and reproducible mouse tumor model. \u003cem\u003eLab. Invest.\u003c/em\u003e \u003cstrong\u003e95\u003c/strong\u003e, 351-362 (2015). https://doi.org/10.1038/labinvest.2014.141\u003c/li\u003e\n\u003cli\u003eShiraki, K.\u003cem\u003e et al.\u003c/em\u003e Splenic hemangiosarcoma in a young sprague-dawley rat. \u003cem\u003eJ. Toxicol. Pathol.\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 273-276 (2012). https://doi.org/10.1293/tox.25.273\u003c/li\u003e\n\u003cli\u003eYamane, R., Tanaka, M. \u0026amp; Kaneda, S. Spontaneous hemangiosarcoma in the spleen and liver of a young rat. \u003cem\u003eJ. Toxicol. Pathol.\u003c/em\u003e \u003cstrong\u003e35\u003c/strong\u003e, 89-93 (2022). https://doi.org/10.1293/tox.2021-0042\u003c/li\u003e\n\u003cli\u003eMadewell, B. R., Griffey, S. M. \u0026amp; Munn, R. J. Ultrastructure of canine vasoformative tumors. \u003cem\u003eJ. Vasc. Res.\u003c/em\u003e\u003cstrong\u003e29\u003c/strong\u003e, 50-55 (1992). https://doi.org/10.1159/000158932\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Angiosarcoma, Dog, Hemangiosarcoma, Organoid, Orthotopic xenograft model, PLAAT3","lastPublishedDoi":"10.21203/rs.3.rs-8550766/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8550766/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDogs commonly suffer from hemangiosarcoma (HSA) similar to human angiosarcoma (AS). The lack of adequate insight into the pathogenesis of canine HSA leads to clinical treatment failure. Thus, developing relevant preclinical models is instrumental for understanding disease and discovering new treatment strategies. In this study, we successfully generated canine HSA 2.5D organoids from patient-derived tumor tissues. After confirming specific marker expression in the organoids, we performed drug-sensitivity tests and compared the transcriptional patterns of HSA with those of nodular hyperplasia (NH) organoids to explore the mechanisms underlying malignant tumor development. Genes upregulated in the HSA group, such as \u003cem\u003ePhospholipase A and Acyltransferase\u003c/em\u003e (\u003cem\u003ePLAAT)3,\u003c/em\u003ewere identified as potential biomarkers for HSA. Gene knockdown experiments using siRNA as well as the chemical inhibition of \u003cem\u003ePLAAT3\u003c/em\u003e suppressed the invasion of HSA 2.5D organoid cells, with mild inhibition of proliferation. Furthermore, we established an orthotopic xenograft mouse model via splenic injection of HSA 2.5D organoid cells. The developed xenograft metastasized to other organs, and associated tissue pathology corresponded to the characteristics of the original tissues. In conclusion, the established 2.5D HSA organoid and xenograft model may present a new experimental platform for exploring novel therapeutic targets for both canine HSA and human AS.\u003c/p\u003e","manuscriptTitle":"Modeling canine hemangiosarcoma progression using patient-derived 2.5D organoids and orthotopic xenografts","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-02-22 12:41:05","doi":"10.21203/rs.3.rs-8550766/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"0bafc672-465d-45d3-9ade-65a075198c44","owner":[],"postedDate":"February 22nd, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":63017512,"name":"Biological sciences/Cancer/Cancer models"},{"id":63017513,"name":"Health sciences/Oncology/Cancer/Sarcoma"},{"id":63017514,"name":"Biological sciences/Stem cells/Cancer stem cells"}],"tags":[],"updatedAt":"2026-04-23T12:15:54+00:00","versionOfRecord":[],"versionCreatedAt":"2026-02-22 12:41:05","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8550766","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8550766","identity":"rs-8550766","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.