Synthesis of Apolipoprotein a-i in Human Macrophages Enhances Their Migratory Activity

preprint OA: closed
Full text JSON View at publisher
Full text 149,338 characters · extracted from preprint-html · click to expand
Synthesis of Apolipoprotein a-i in Human Macrophages Enhances Their Migratory Activity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Synthesis of Apolipoprotein a-i in Human Macrophages Enhances Their Migratory Activity Ekaterina Nekrasova, Maria Serebriakova, Daria Kuzmina, Alexandra Burnusuz, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7904915/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Mar, 2026 Read the published version in Cell Biochemistry and Biophysics → Version 1 posted 14 You are reading this latest preprint version Abstract Apolipoprotein A-I (ApoA-I) is the major structural and functional protein of high density lipoprotein (HDL) particles. ApoA-I has antioxidant, anti-inflammatory and atheroprotective properties. Although the main sites of ApoA-I synthesis in humans are liver and small intestine, ApoA-I expression was also found in monocytes and macrophages. In the present study we demonstrate the involvement of macrophagal ApoA-I in the regulation of migratory activity of macrophages induced by C5a. Macrophagal ApoA-I enhances migration via ABCA1-independent mechanism. Exogenous and endogenous (synthesized by macrophages) ApoA-I has the different effects on the macrophage migration, activating the different targets. We have revealed the mechanism of ApoA-I-dependent stimulation of macrophage chemotaxis: endogenous ApoA-I decreases the synthesis and secretion of netrin-1 (an inhibitor of macrophage emigration from the atherosclerotic plaque into the lymph nodes) and also downregulates its receptor UNC5B. Moreover, the incubation of macrophages with netrin-1 reduced mRNA and membrane-associated protein levels of ApoA-I, that proved the existence of negative feedback loop between netrin-1 and ApoA-I in macrophages. ApoA1 ABCA1 migration chemotaxis netrin-1 oxLDL UNC5B macrophages atherosclerosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Introduction Atherosclerosis is a systemic chronic disorder of arterial walls characterized by an accumulation of lipid laden macrophages in the intima of vessels with following transformation into foam cells. The main mechanisms of the cholesterol excesses removal from atherosclerotic plaque are the reverse cholesterol transport through high density lipoprotein (HDL) to the liver for the excretion with bile, and the egress of cholesterol-engorged macrophages from atheroma to lymph nodes and afterwards to liver [1, 2]. The reverse transport is defined as a process of cholesterol transfer from the cell membrane to Apolipoprotein A-I (ApoA-I) via the interaction with ATP-binding cassette transporter A1 (ABCA1) to form an immature HDL particle, which then takes up cholesterol from cells through another ATP-binding cassette transporter G1 (ABCG1) to form a mature HDL particle [2]. Macrophage emigration may occurs in the initial stages of atherosclerosis but the rate of emigration decreases greatly during the manifestation of disease [1]. Perhaps there is a balance of stimuli between macrophage retention inside the inflammation focus within atherosclerotic lesion and their emigration from the plaque. Recent articles have defined some factors, increasing the macrophage retention in the atherosclerotic plaque: netrin-1, semaphorin 3A and 3E, the accumulation of cholesterol in macrophages, leading to a stress of endoplasmic reticulum [1, 3], and the stimulatory factors for macrophage chemotaxis to the lymph nodes: chemokines CCL19, CCL21, their chemokine receptor CCR7 etc. [3]. Apolipoprotein A-I (ApoA-I) is a major structural and functional protein of HDL particle [2, 4, 5]. Human and animal severe atherosclerosis and the increased risk of ischemic heart disease are associated with many mutations in ApoA-I gene [6]. Anti-atherogenic properties of ApoA-I are usually interpreted by its participation in the reverse cholesterol transport, and by its antioxidant and anti-inflammatory activities [5]. The main sites of synthesis of ApoA-I in mammals are liver and small intestine [4]. Earlier we have shown that ApoA-I protein also synthesizes in human monocytes and macrophages, where it stabilizes ABCA1, decreases TNFα production and reduces the lipopolysaccharide (LPS)-induced response by inhibiting the TLR4 synthesis [7]. Predominantly ApoA-I in macrophages is localized on the external side of plasma membrane with the formation of complexes with ABCA1 and lipid rafts [7]. Some functions of ApoA-I in macrophages (suppression of their pro-inflammatory activity, the enhance of oxidized low-density lipoprotein (oxLDL) uptake by macrophages) are realized through its interactions with the ABCA1 cassette transporter followed by initiation of several signaling cascades in the cells [7, 8]. Delivery of human ApoA-I gene to the macrophages isolated from wild type and ApoE(-/-) mice improved cholesterol efflux. Moreover, ex vivo delivery of human ApoA-I gene by lentivirus vector construction into hematopoietic progenitor cells with following transfer of transduced cells to ApoE(-/-) mice led to the reduction of atherosclerotic plaques on the aortic wall [9]. It proves that ApoA-I expression in macrophages has essential anti-atherogenic effect. External ApoA-I synthesized outside of monocytes and macrophages (ApoA-I dissociated from plasma HDL), has a negative impact on monocyte and macrophage migration [10, 11, 12, 13]. However, there are not data about the possible role of endogenous (synthesized in monocytes and macrophages) ApoA-I in the regulation of macrophage migratory activity, in particular, in the emigration of lipid-loaded macrophages from atherosclerotic plaques. Netrin-1 has been identified as secreted laminin-related protein, which binds to its receptor UNC5B and inhibits leukocyte migration [14, 15]. Netrin-1 increases arterial smooth muscle cell recruitment through the binding to another receptor neogenin, which ultimately leads to the formation of a fibrous capsule [15, 16]. Netrin-1 affects on macrophages in autocrine and paracrine manner (smooth muscle and endothelial cells also produce netrin-1) and inhibits their chemotaxis induced by some chemotropic proteins including the anaphylatoxin and chemoattractant C5a [17]. Monocytes and tissue macrophages secrete netrin-1 in very low concentrations, while lipid-laden macrophages in human and mouse atheromas produce netrin-1 in high dosages [15]. Under hypoxic conditions, which are typical for the advanced atherosclerotic lesion, macrophages increases netrin-1 and UNC5B production and are retained inside the plaque [16]. Chemokines are key mediators of chemotaxis [18]. Each subpopulation of macrophages requires the specific chemokines to move efficiently throughout the body [17, 18]. In this article the object of study was unpolarized resting macrophages (RM), which migrate better toward anaphylatoxin C5a compared to other chemokines, for example CCL19 and CCL21 [18]. The activation of cell movement is mediated by the binding C5a with its chemokine receptor C5aR1 [17]. Here we first time demonstrate the positive effect of endogenous ApoA-I on migration through ApoA-I-dependent downregulation of netrin-1 and UNC5B expression in macrophages. We have also shown the negative feedback loop between netrin-1 and ApoA-I production. The observed stimulatory role of endogenous ApoA-I in macrophage migration may be an important mechanism underlying the anti-atherogenic effect of ApoA-I synthesis in macrophages. 2. Materials & Methods 2.1. Materials and antibodies Recombinant human protein netrin-1 was purchased from R&D Systems, USA (Cat. No. 6419-N1). Human ApoA-I protein was received from Biovision, USA (Cat. No. 4693 − 1000). C5a was purchased from Cytokine, Russia (Cat. No. 20.59.52.190). Mouse monoclonal IgG1 antibodies against human CD68 (KP1) (Alexa Fluor647 labeled; Cat. No. sc-20060) and isotypic mouse antibodies IgG1 (Alexa Fluor647 labeled; Cat. No. sc-24636) were purchased from Santa Cruz Biotechnology, USA. Mouse monoclonal antibodies against human ApoA-I (Cat. No. 0650 − 0050) were purchased from Bio-Rad, USA. As secondary antibodies were used goat anti-mouse IgG (H + L) F(ab′) 2 antibodies Alexa Fluor647-labeled (Cat. No. 4410S), purchased from Cell Signaling, USA. Rabbit polyclonal antibodies against human UNC5B (Cat. No. ab104871), secondary goat anti-rabbit antibodies Rhodamine-labeled (Cat. No. ab7051-1) were received from Abcam, USA. Rabbit polyclonal antibodies against human ABCA1 (Cat. No. ab7360) were received from Abcam, USA. Goat anti-rabbit IgG antibodies conjugated with iFluor647 (Cat. No. HA1123, Huabio, China) were used as secondary antibodies. 2.2. Cell cultures and macrophage differentiation from peripheral blood monocytes We used primary macrophages isolated from human peripheral blood mononuclear cells (PBMC) from healthy donor blood. Preserved donor blood not suitable for transfusion was purchased from the Blood Transfusion Station (St. Petersburg, Russia). All donors have signed the informed consent for the use of their blood. To obtain primary macrophages, PBMC were isolated from blood by Ficoll density gradient centrifugation as described earlier [19]. Cells were differentiated into macrophages by the incubation at 37°C in the atmosphere of 5% CO 2 in the RPMI-1640 medium (Biolot, Russia) supplemented with 10% fetal calf serum (FCS, HyClone, USA) and gentamicin (Biolot, Russia) [40 µg/ml] for five days. In order to prove that after the differentiation and cultivation it remains the singular population of macrophages, we stained control cells by macrophage marker CD68 and used flow cytometry analysis (see supplementary data Fig. S1 ) according to this article [15]. 2.3. Small interfering RNA (siRNA)-mediated knockdown Scrambled control RNA oligonucleotides (Cat. No. sc-37007), siRNA against ApoA-I (Cat. No. sc-41177), siRNA against ABCA1 (Cat. No.sс-61902) were obtained from Santa Cruz Biotechnology, USA. Macrophages from PBMC were differentiated for 48 h. Then primary macrophages were transfected with siRNAs by the transfection reagent Dharmafect 4 (GE Dharmacon, Austria) in the accordance with manufacturer’s guideline. 24 h after transfection the medium was replaced with fresh RPMI-1640 supplemented with 10% FCS and gentamicin [40 µg/ml], and macrophage differentiation was prolonged for 24 or 48 h. 2.4. LDL isolation, purification and oxidation LDL were isolated from the human blood plasma obtained from the preserved donor blood. LDL were isolated, oxidized and measured protein concentration and the extent of LDL oxidation according to this protocol [19] oxLDL were stored at + 4 °С no longer than 2 weeks. 2.5. Migration assay Macrophages at 5th day of differentiation were harvested by collagenase accutase (Sigma-Aldrich, USA). Migration assay was performed in Transwell inserts of the 24-well culture plates using 5-µm polycarbonate membrane (Corning, USA) according to the method [15, 20]. To decrease the spontaneous migration induced by serum components (IP-10, CCL2 etc.) [21] and increase the specific chemotaxis we replaced 10% FCS on 2% lipoprotein deficient serum (LPDS) (Biowest, France). Macrophages were seeded in RPMI-1640 with 2% LPDS at a density of 1x10 5 cells in the upper chambers of Transwell inserts. The bottom chambers contained RPMI-1640 with 2% LPDS and C5a [10 nM] [17]. In some experiments cells were incubated with netrin-1 [250 ng/ml] [15] or preincubated with the exogenous ApoA-I protein [0.1 µg/ml] for 1 h, then cells were seeded at upper chambers. We added culture medium with 2% LPDS without chemokines at the bottom chambers to assess the spontaneous migration (control). Cells were incubated at 37°C in 5% CO 2 for 24 h. Macrophages from the upper and bottom chambers were harvested by accutase (1 h at 37°C), precipitated by the centrifugation (300 g, 5 min) and resuspended in 0.2 ml of Hanks solution (Biolot, Russia). The concentration of cells was calculated by a flow cytometer CytoFLEX V2-B4-R2 (Beckman Coulter, USA). Migration was presented as a chemotactic index calculated as a ratio of the number of migrating macrophages to the total number of cells (the sum of the numbers of macrophages in the upper and bottom chambers) of each Transwell inserts minus spontaneous migrating cell in percentages. 2.6. RNA isolation and RT-qPCR Total RNA was isolated from the cultured cells using ExtractRNA (Evrogen, Russia) according to the manufacturer’s instruction. RNA concentration and purity were evaluated using a Synergy 2 plate reader (BioTek, USA). The absence of RNA degradation was assessed by electrophoresis in 1% agarose gel, confirming the integrity of the 28S and 18S ribosomal RNA bands as described previously [19]. Reverse transcription (RT) was performed using the same amount of total RNA [1 µg] for all samples, oligo-dT primers, 3′primers specific for the ApoA-I, Abca1, Ntn1, Unc5b, Ccr7 genes (Evrogen, Russia). Quantitative polymerase chain reaction (qPCR) was performed using Taqman or SYBR Green I protocols in a CFX96 cycler (Bio-Rad, USA). All reagents for qPCR were from Syntol, Russia. Primers and fluorescent probes for the ApoA-I and reference genes Cyclophilin A, β-actin, RPLP0 and GAPDH were described previously [7, 22, 23, 24]. The following primers and probes for mRNA detection of interesting genes were designed with the Primer3 software [25]. Netrin-1 (Ntn1) mRNA: forward primer 5′_CCTGCAAAGCCTGTGATT_3′; reverse primer 5′_GCGCTACAGGGATCTTTATG_3′; and probe 5′_ROX-CAGAGCCGCTCTCCCATCGC-BHQ2 3′. Unc5b Forward primer 5′_CAAGCAGGCACTGATTCT_3′. Reverse primer 5′_CCGTTGCACTTGAAGTAGAT_3′ Сcr7 Forward primer 5′_CTCTCCTTGTCATTTTCCAGGTA_3′; Reverse primer 5′_GCCCACGAAACAAATGATG_3′. Abca1 Forward primer 5′_CTCCTGTGGTGTTTCTGGATG_3′. Reverse primer 5′_CTTGACAACACTTAGGGCACAA_3′. Probe 5′_ROX- AAGCCCGGCGGTTCTTGTGG-RTQ2_3′. The relative levels of mRNA of genes were calculated as results of measurement of mRNA levels for 4 reference genes. The relative values of mRNA level ApoA-I, Abca1, Ntn1, Unc5b, Ccr7 genes regarding the control in percentages were calculated using the formula: 2 (Δ Ct (control) – Δ Ct (experiment)) · 100%. The results were normalized by the geometric means of the mRNA levels of 4 reference genes (Cyclophilin A, β-actin, RPLP0 and GAPDH), as described before [26]. 2.7. Enzyme-linked immunosorbent assay (ELISA) Netrin-1 concentrations in culture supernatants were detected by sandwich ELISA kit (ELK Biotech, China) according to a manufacturer’s instruction. Optical density was measured at 450 nm using spectrophotometer Synergy 2 (BioTek, USA). 2.8. Flow cytometry Macrophages were detached from the plates by accutase (1 h at + 37º C), centrifuged and incubated in the blocking buffer (Hanks solution with 2% FCS) for 30 minutes at room temperature. Then cells were incubated with primary antibodies (antibodies against ApoA-I 1/200 dilution, UNC5B 1/100 dilution, ABCA1 1/50 dilution) in the blocking buffer for 1 h at room temperature on the shaker (ST3, ELMI, Latvia) 500 RPM. After that cells were washed for 3 times and incubated with secondary antibodies labeled with Alexa Fluor647 (1/1000 dilution) or labeled with Rhodamine (1/250 dilution) or labeled iFluor647 (1/1000 dilution) in the blocking buffer for 30 minutes at room temperature on the shaker. The cells incubated with the secondary antibodies but not with the primary antibodies (against ApoA-I, UNC5B, ABCA1) were used as a control of the immune staining specificity (isotype control). We also used cells for CD68 staining with anti-CD68 antibodies (1/50 dilution) labeled with Alexa Fluor647, and isotype control – cells incubated only with isotypic mouse antibodies labeled Alexa Fluor647 at the same dilution. Cells were washed for 3 times, diluted in 0.2 ml Hanks solution. Cells were analyzed on Epics Altra flow cytofluorimeter (Beckman Coulter, USA). Data were analyzed using program software FCSalyzer (Version 0.9.17, 2019, SourceForge, developed by Sven Mostböck, Vienna, Austria https://sourceforge.net/projects/fcsalyzer/ ). 2.9. Statistical analysis The results were presented as a means ± standard errors of the mean (s.e.m.) if the distribution was normal, and medians ± 95% confidence intervals if the distribution was different from the normal. Normality of distribution was verified with Kolmogorov-Smirnov test. Significance of differences between the groups was estimated using the unpaired two-tailed Student’s t-test or Mann-Whitney test. For multiple comparisons we used Dunnett’s test and Kruskal-Wallis followed by Dunn’s test. The differences between the groups were considered significant at p < 0.05. Statistical analysis was performed using GraphPad Prism8 software version 8.4.3, 2020, for Windows, San Diego, California, USA, www.graphpad.com 3. Results 3.1. Endogenous ApoA-I increases PBMC macrophage migration induced by C5a independently of ABCA1 In the previous studies we have shown that high level of ApoA-I in macrophages stimulates oxLDL uptake [19]. Taking into account the proven anti-atherogenic role of ApoA-I in macrophages [7, 19, 27, 28, 29] and the fact, that increased internalization of oxLDL by macrophages leads to the transformation of macrophages into foam cells [1] these results are contradictory. One possible solution to this contradiction is a putative positive effect of endogenous ApoA-I on the reverse cholesterol transport. However, it has been previously shown that ApoA-I synthesized in macrophages does not significantly contribute to reverse cholesterol transport [7]. Another resolution of this contradiction is a possible involvement of macrophagal ApoA-I in the stimulating migratory activity of macrophages. To test the last assumption we explored RNA interference assay. Transfection of PBMC macrophages by siRNA against human ApoA-I (siApoA-I) led to a significant decrease in ApoA-I mRNA level (Fig. 1 A), as well as the level of ApoA-I bound to the macrophage surface membrane (Fig. 1 B). Blocking of ApoA-I synthesis greatly reduced the macrophage movement toward C5a in Transwell migration assays (Fig. 1 D). These results suggest the stimulatory effect of endogenous ApoA-I on the macrophage migration toward C5a gradient. Considering the known role of ABCA1 as a receptor for the signaling properties of endogenous ApoA-I [7, 27] it was worth testing the possible role of ABCA1 in the ApoA-I-mediated stimulation of macrophage migratory activity. Figures 1 A and 1 C show the efficacy of ABCA1 knockdown: transfection of PBMC macrophages by siRNA against ABCA1 (siABCA1) resulted in a significant decrease in both ABCA1 mRNA and membrane protein levels. However, ABCA1 knockdown had no impact on the macrophage migration toward C5a (Fig. 1 D). Therefore, endogenous ApoA-I stimulates migratory activity of macrophages independently of ABCA1. 3.2. Exogenous ApoA-I reduces migratory activity of PBMC macrophages independently of endogenous ApoA-I Formerly published data indicate that exogenously added ApoA-I protein [10–50 µg/ml] reduces monocyte and macrophage chemotaxis [11, 12]. To compare the effects of exogenous and endogenous ApoA-I in our migration model we have used a lower concentration of exogenous ApoA-I protein compared with the data mentioned above [11, 12] based on the following argumentation. Outside the liver the amount of free ApoA-I is limited. In the arterial wall the sources of free ApoA-I are a local synthesis by macrophages and lymphocytes as well as the dissociation of free ApoA-I from HDL. However the level of local ApoA-I synthesis is significantly lower than in the liver [< 10 ng/ml], moreover macrophages secrete significant amounts of ApoA-I only in response to pro-inflammatory cytokines (TNFα and others) [7] HDL complex dissociates to release the free ApoA-I [it is about 75 µg/ml] [30]. Also free ApoA-I is rapidly destroyed by proteases, undergoes oxidation of methionine residues with the formation of amyloid structures [31]. Based on these estimates and consider the short lifespan of free ApoA-I, concentration 0.1 µg/ml seems to us as a physiological dosage of ApoA-I in atherosclerotic plaque. Furthermore ApoA-I peptide mimetic (L-4F) had the biological activity in the suppression of monocyte chemotaxis at concentration 0.01 µg/ml [32]. In accordance with published data [12] the addition of exogenous ApoA-I to PBMC macrophages diminished their migratory activity toward C5a (Fig. 2 ). We wanted to find out whether exogenous and endogenous ApoA-I proteins apply the same regulatory mechanism(s) for macrophage chemotaxis. To this end free ApoA-I was added to PBMC macrophages transfected by siRNA against ApoA-I. It was found, that the addition of exogenous ApoA-I to transfected cells resulted in further suppression of macrophage migratory activity. Therefore, exogenous and endogenous ApoA-I act on macrophage migration through the different mechanisms and, as a result, they have the opposite effects: exogenous ApoA-I downregulates macrophage mobility while endogenous ApoA-I upregulates it. 3.3. CCR7 is not a target for endogenous ApoA-I in the upregulation of macrophage migratory activity Chemokine receptor CCR7 is a key factor in macrophage emigration and its expression is increased in CD68 + cells capable for chemotaxis from atheroma to lymph nodes [1]. It is plausible to suggest a presumptive mechanism by which endogenous ApoA-I influences on macrophage motility via the upregulation of CCR7 receptor expression. To check this assumption CCR7 mRNA level was assessed by RT-qPCR in PBMC macrophages transfected by siRNA against ApoA-I. Surprisingly, ApoA-I knockdown resulted in the increase of CCR7 mRNA level (Fig. 3 ), suggesting a suppressive role of endogenous ApoA-I in the regulation of CCR7 expression. This effect was ABCA1 independent, since ABCA1 knockdown did not effect on CCR7 mRNA level (Fig. 3 ). These data suggest that endogenous ApoA-I stimulates migratory activity of macrophages via some other mechanism, independent of CCR7. 3.4. Endogenous ApoA-I downregulates netrin-1 production in macrophages Another hypothesis describing the mechanism of stimulatory effect of endogenous ApoA-I on the macrophage migratory activity based on the suppose, that ApoA-I might repress expression of some migration-inhibitory molecules for macrophages. One of these factors is netrin-1 [33]. To check the possible effect of endogenous ApoA-I on netrin-1 expression in macrophages we have applied RNA interference approach. Knockdown of ApoA-I resulted in an increasing netrin-1 mRNA level (Fig. 4 A). Under the same conditions the blocking ABCA1 synthesis had no impact on the netrin-1 mRNA level (Fig. 4 A). Moreover, increasing netrin-1 mRNA level in the PBMC macrophages, transfected by siRNA against ApoA-I, was accompanied by the upregulation of netrin-1 secretion in transfected macrophages (Fig. 4 B). Hence, endogenous ApoA-I suppresses Ntn1 gene encoding netrin-1 that results in downregulation of netrin-1 secretion. Furthermore, this effect of ApoA-I is independent of ABCA1. Taking together, these data support the netrin-1-dependent mechanism of stimulatory effect of endogenous ApoA-I on migratory activity of macrophages. 3.5. Netrin-1 and ApoA-I knockdown mutually block their effects on the migratory activity of macrophages Netrin-1 is capable to decrease the cellular migration mediated by C5a on murine macrophage models: cellular line RAW264.7 and macrophages isolated from the red bone marrow of C57BL/6J mice [17]. In our experiments on human PBMC macrophages netrin-1 also decreased C5a-induced migration (Fig. 5 ). However, netrin-1 treatment on PBMC macrophages transfected by siRNA against ApoA-I did not result in further reduction of macrophage migratory activity (Fig. 5 ). These data support the key role of ApoA-I-mediated downregulation of Ntn1 gene encoding netrin-1 in the stimulatory effect of endogenous ApoA-I on migratory activity of macrophages. 3.6. Endogenous ApoA-I does not affect on UNC5B mRNA level, but suppresses UNC5B surface level in macrophages Netrin-1 acts as a ligand for UNC5B receptor. The binding of netrin-1 with UNC5B on the plasma membrane of macrophages immobilizes them and prevents the emigration into the lymph system [20, 33]. So we tested whether a decline of endogenous ApoA-I level could lead to an increase not only netrin-1 production, but also UNC5B protein level on the macrophage cytoplasmic membrane. For this we measured UNC5B mRNA level and protein amount on the cellular membrane of PBMC macrophages transfected by siRNA against ApoA-I. Knockdown of ApoA-I did not alter UNC5B mRNA level (Fig. 6 A), but increased UNC5B protein content on the cytoplasmic membrane (Fig. 6 B). Therefore, endogenous ApoA-I interferes with netrin-1 signaling not only by suppression of its synthesis in macrophages, but also by reducing the sensitivity of macrophages to netrin-1. 3.7. Netrin-1 suppresses ApoA-I synthesis in macrophages Earlier we have shown that synthesis of ApoA-I in macrophages is induced by several pro- and anti-inflammatory stimuli: oxLDL [19], insulin [28], hypoxia [34], TNFα [29]. So we checked whether the treatment of macrophages with netrin-1 could regulate ApoA-I gene expression in macrophages. We have demonstrated before that the netrin-1 stimulation [50 ng/ml] for 48 h is required for the increase of netrin-1 and UNC5B mRNA count and UNC5B protein content on cell surface of human macrophages [26], which suggests the existence a positive feedback loop driving the escalation of netrin-1 production by macrophages. Under the same conditions (netrin-1 treatment in concentration 50 ng/ml to macrophages on the third day of differentiation followed by the incubation for 48 h) a decrease in both the mRNA level (Fig. 7 A) and the level of surface membrane bound ApoA-I (Fig. 7 B) in macrophages was observed. Therefore, netrin-1 and ApoA-I are negative mediators for each other in macrophages. In the preceding study the incubation of macrophages with oxLDL for 24 h enhanced ApoA-I expression on the transcriptional and translational levels [19]. On the other hand, oxLDL also stimulates netrin-1 and UNC5B synthesis in macrophages [15, 20]. In this article we studied the impact of the combined administration by netrin-1 for 48 h [50 ng/ml] and oxLDL for 24 h [100 µg/ml] on ApoA-I surface membrane protein content in macrophages. It was found that netrin-1 did not involve in oxLDL-mediated ApoA-I elevation (Fig. 7 B). The obtained results show that the effects of netrin-1 and oxLDL are summed up, and their multidirectional signaling pathways do not overlap and function independently. 4. Discussion The very important problem of atherogenesis is oxLDL accumulation in macrophages inside the arterial walls. One of the processes providing the cholesterol removal from the walls of blood vessels is the cholesterol-laden macrophage egress from the atheroma to the lymphatic system [2]. The role of macrophage emigration in the pathogenesis of atherosclerosis is remain unclear. Stimuli for macrophage emigration from atherosclerotic plaque to the peripheral lymph nodes are not fully known. In literature it was noticed that anti-atherogenic properties of exogenous ApoA-I are associated with its effect on monocyte and macrophage migratory activity [12]. In experiments with the exogenous ApoA-I addition [11, 12, 13] or HDL treatment [10, 11] with acute exposure (20–60 min) or for 24 h to monocytes and macrophages it occurs the chemotaxis suppression. ApoA-I significantly decreases migration induced by CCL2, CCL5, C5a [10, 12]. The mechanism of this suppression is based on the ApoA-I-mediated depletion of cholesterol from cytoplasmic membrane and, as a result, a decrease in lipid rafts [11]. Thus exogenous ApoA-I suppresses monocyte-macrophage chemotaxis and decreases the chronic inflammation. This ability of exogenous ApoA-I prevents the manifestation of disease but does not promote the regression of atherosclerotic vascular lesion. Infiltrated macrophages in the arterial walls continue to actively and uncontrollably uptake oxLDL, transforming into the immobilized foam cells. They participate in the plaque instability due to the secretion of proteases and cytotoxic factors [1, 3]. In our hands exogenous ApoA-I also repressed PBMC migration (Fig. 2 ), which is consistent with literature data (described above). Double gene knockout mice Abca1-/-Abcg1-/- shows the significant impairment in macrophage migration [35]. Nevertheless, knockout of one of these genes Abca1-/- or Abcg1-/- did not significant effect on the migrational regulation that is explained by the overlapping functions of these genes and mutual compensation [35]. Evidently the external treatment of ApoA-I inhibits macrophage movement through the binding with its receptor ABCA1 and then with ABCG1 that lead to the cholesterol pool removal on the outer side plasma membrane. In this article we showed for a first time the participation of endogenous ApoA-I in the regulation of human macrophage migration activity. To prove the role of local ApoA-I synthesis in the regulation of macrophage migration we used ApoA-I silencing approach. Blocking of ApoA-I synthesis led to the decrease of macrophage migration along the C5a chemokine gradient, suggesting the positive role of endogenous ApoA-I in the migration activity of macrophages (Fig. 1 D). Perhaps there are the different mechanisms of exogenous and endogenous ApoA-I influence on macrophage motility. Earlier we have shown that endogenously synthesized macrophagal ApoA-I did not make a significant contribution in reverse cholesterol transport [7], so high level of endogenous ApoA-I synthesis did not lead to the depletion of lipid rafts within cytoplasmic membrane of macrophages – the central process underlying the negative effects of exogenous ApoA-I on macrophage and monocyte migration activities [12, 13]. Moreover, we showed that endogenous ApoA-I enhances macrophage migration ABCA1-independently (Fig. 1 D) in contrast to the exogenous ApoA-I protein, which affects on macrophage and monocyte migration in ABCA1-dependent manner [35]. Hence, ABCA1 do not involved in ApoA-I mediated activation of macrophage mobility. It is well known, that chemokine receptor CCR7 is an important factor for leukocyte homing [15]. We assumed that ApoA-I and ABCA1 might be capable to increase CCR7 expression thereby stimulating macrophage migration. However, our data showed that endogenous ApoA-I represses, while ABCA1 does not influence on CCR7 expression (Fig. 3 ). Therefore, macrophagal ApoA-I regulates their chemotaxis by some another mechanism. Recent studies have also shown that CCR7 activity in macrophages is regulated by the redistribution of the cellular CCR7 pool between cytoplasmic (functionally active CCR7) and intracellular (inactive CCR7) membranes rather than by its expression level [18]. In particular, CCR7 is localized exclusively on the cell surface of pro-inflammatory M1 macrophages, in contrast to anti-inflammatory M2 macrophages, where CCR7 is retained in the membranes of endoplasmic reticulum and does not respond to the chemotactic stimuli from CCL19 or CCL21 chemokines [18]. Moreover subcutaneous ApoA-I injections in ApoE-deficient mice resulted in a decrease in M1 and an increase in M2 macrophages in atheroma, leading to disease resolution [36]. Taken together these data indicate that the CCR7 receptor is not a target for endogenous ApoA-I in activating macrophage migratory activity. Yet another potential target of ApoA-I-mediated stimulation of macrophage migratory activity is netrin-1. In a mouse model of thioglycolate-induced peritonitis netrin-1 promoted macrophage retention in the peritoneum [37]. Deletion of netrin-1 in macrophages of Ldlr –/– mice induced macrophage emigration and reduced the atherosclerotic lesions [15]. By binding to the UNC5B receptor netrin-1 suppresses chemokine-induced activation of Rac1, which is required for actin polymerization in macrophages [15]. These data suggest pro-atherogenic properties of netrin-1 inside atherosclerotic plaque. Despite this, there is evidence in the literature that high level of netrin-1 in blood plasma has an inverse correlation with the development of atherosclerosis (total volume and mass of plaques), inflammation of arterial walls [38] and arterial calcification [38, 39] dyslipidemia [40]. Low level of plasma netrin-1 was associated with the initiation and progression of human atherosclerosis [38]. The concentration of netrin-1 in the plasma of healthy patients was higher than in patients with coronary artery disease and acute myocardial infarction [38]. Analysis the intracellular level of netrin-1 and UNC5B in macrophages revealed lower levels of these molecules in healthy patients than in patients with coronary artery disease and acute myocardial infarction [40]. Finally, the accumulation of macrophages in the coronary plaque was positively correlated with netrin-1 concentration in macrophages in vivo measured by optical coherence tomography [40]. Authors think that decrease of plasma netrin-1 concentration weakens its inhibitory effect on monocyte infiltration. Monocytes begin better penetrate into the vascular intima, increasing the formation of atherosclerotic plaques [38]. On the other hand, high level of netrin-1 within atherosclerotic lesions results in the inhibition of macrophage emigration and promote plaque growth [15]. Thus, the role of netrin-1 in atherogenesis is controversial and depends on the localization of netrin-1, which coincides with the contradictory effects of exogenous and endogenous ApoA-I on the migratory activity of macrophages. In our experiments we showed that the suppression of ApoA-I synthesis led to the activation of Ntn1 gene expression and the increase in netrin-1 secretion by macrophages (Fig. 4 ). Considering that netrin-1 inhibited macrophage migration in vitro (Fig. 5 ), it can be concluded that the stimulatory effect of endogenous ApoA-I on the macrophage migration is mediated, at least in part, by ApoA-I-dependent suppression of Ntn1 gene. In support of this suggestion, ABCA1 is not involved in either ApoA-I-mediated activation of macrophage migration or ApoA-I-mediated downregulation of Ntn1 gene (Fig. 1 D, 4 A). Blocking ApoA-I synthesis in macrophages not only resulted in increased synthesis and secretion of netrin-1 by macrophages, but also increased the UNC5B receptor level on the surface macrophage membrane enhancing it sensitivity to netrin-1. Interestingly, in contrast to the gene encoding netrin-1, the gene encoding UNC5B receptor is not activated by endogenous ApoA-I in macrophages. Therefore, ApoA-I is involved only in the translation regulation of UNC5B and (or) redistribution of UNC5B between the cytoplasmic and intracellular membranes. The molecular mechanisms underlying ApoA-I involvement in the regulation of netrin-1 and UNC5B expression remain unknown and require further investigations. It is known, that transcriptional factors HIF-1α [16] и NF-κB [20] upregulate netrin-1 and UNC5B expression in macrophages. Considering the pronounced anti-inflammatory properties of endogenous ApoA-I in human macrophages [4, 7, 27], it is possible to offer that endogenous ApoA-I suppresses pro-inflammatory signaling pathways associated with the activation of the transcription factor NF-κB. Moreover, pro-inflammatory stimuli as well as the conditions characteristic of atherosclerotic plaque (hypoxia, high concentration of oxLDL) induce ApoA-I synthesis in macrophages [19, 34] and almost the same conditions activate netrin-1 and UNC5B expression [16, 20]. In the context of atherogenesis, this means that endogenous ApoA-I not only protects macrophages from hyperactivation in response to weak pro-inflammatory stimuli [7] but it can also limits the inhibitory effect of netrin-1 and UNC5B on macrophage migration. Besides the suppressive effect of endogenous ApoA-I on the synthesis of netrin-1 in macrophages we found the opposite effect: netrin-1 represses ApoA-I expression at the mRNA and protein level (Fig. 7 ). This suppression does not interfere with oxLDL-mediated stimulation of ApoA-I level on the macrophage surface which depends on the interactions between oxLDL and TLR4 [19]. This proves that the signaling pathways initiated by oxLDL and netrin-1 treatment on the regulation of ApoA-I protein production in macrophages are independent. However, further research is needed to elucidate the signaling cascades and transcription factors involved in the suppression of ApoA-I expression in macrophages by netrin-1. Perhaps the unstable equilibrium exists in atherosclerotic plaque where any external events can change the delicate dynamic balance between pro-atherogenic netrin-1 and anti-atherogenic ApoA-I. The fluctuations of these molecules and many others will influence on the development or regression of atherosclerotic lesions. 5. Conclusions In summary, our results demonstrate the different regulatory mechanisms of exogenous and endogenous ApoA-I action on macrophage migration activity. Exogenous ApoA-I synthesized in hepatocytes and enterocytes attenuates macrophage chemotaxis in ABCA1- and ABCG1-dependent manner, whereas endogenous ApoA-I synthesized by macrophages enhances chemotaxis in ABCA1- and, apparently, ABCG1-independent manner. We have established the mechanism of this process: endogenous ApoA-I suppresses the synthesis of the migration inhibitor for immune cells netrin-1 and its receptor UNC5B. In addition, we report the existence of a negative feedback loop between netrin-1 and ApoA-I production. Further studies will be able to clarify some details of the molecular and cellular mechanisms underlying the observed reciprocal regulation of ApoA-I and netrin-1 in human macrophages. Abbreviations ApoA1, apolipoprotein A-I; ABCA1, ATP-binding cassette transporter A1; ABCG1, ATP-binding cassette transporter G1; CCL2, CCL5, CCL19, CCL21, C-C motif chemokine ligand 2, 5, 19, 21; CCR7, C-C chemokine receptor type 7; C5a, complement component 5a; ELISA, enzyme-linked immunosorbent assay; FCS, fetal calf serum; HDL, high density lipoprotein; HIF-1α, hypoxia-inducible factor 1-alpha; IP-10, interferon gamma-induced protein 10; LPDS, lipoprotein deficient serum; LPS, lipopolysaccharide; NF-κB, nuclear factor kappa B; OxLDL, oxidized low-density lipoprotein; PBMC, peripheral blood mononuclear cells; PMA, phorbol 12-myristate 13-acetate; RM, resting macrophages; RT-qPCR, reverse transcription and quantitative polymerase chain reaction; siRNA, small interfering RNA; TLR4, toll-like receptor 4 ; TNFα, tumor necrosis factor-alpha; UNC5B, Unc-5 netrin receptor B. Declarations Authors Contributions The authors declare that all data were generated in-house and that no paper mill was used. Ethics declarations. The authors declare no conflict of interest. All procedures with the participation of human subjects were performed in accordance with the ethical standards of the Institutional and National Ethics Committees and the Helsinki Declaration of 1964 and its following revisions. Declaration of Competing Interest The authors declare that they have no conflicts of interest with the contents of this article. Data availability Data will be made available on request. Acknowledgements We thank PhD V.S. Shavva (Karolinska Institute, Stockholm, Sweden) for training methods, Dr. D.A. Tanyanskiy and PhD I.V. Kudriavtsev (Institute of Experimental Medicine, St. Petersburg, Russia) for helpful critical discussion, A.D. Kostromitina (Institute of Experimental Medicine, St. Petersburg, Russia) for the access and assistance with flow cytometer. CRediT authorship contribution statement Nekrasova E.V.: Data curation, Formal analysis, Methodology, Investigation, Writing – original draft, Writing – review & editing, Project administration. Serebryakova M.K.: Investigation, Methodology, Resources. Kuzmina D.O., Burnusuz A.V.: Investigation, Methodology. Larionova E.E.: Investigation, Methodology, Formal analysis. Gorbunov N.P.: Methodology, Resources. Orlov S.V.: Formal analysis, Supervision, Conceptualization, Funding acquisition, Project administration, Writing – review and editing. Funding information. This work was supported by the Russian Science Foundation (project no. 24-25-00181). References Moore, K., Sheedy, F., Fisher, E. (2013). Macrophages in atherosclerosis: a dynamic balance. Nature Reviews Immunology, 13, 709–721. https://doi.org/10.1038/nri3520 Ouimet, M., Barrett, T.J., Fisher, E.A. (2019). HDL and Reverse Cholesterol Transport. Circulation Research, 124 (10) 1505–1518. https://doi.org/10.1161/CIRCRESAHA.119.312617. Kang, H., Li, X., Xiong, K., Song, Z., Tian, J., Wen, Y., Sun, A., Deng, X. (2021). The Entry and Egress of Monocytes in Atherosclerosis: A Biochemical and Biomechanical Driven Process. Cardiovascular Therapeutics, 2021, 6642927. https://doi.org/10.1155/2021/6642927 Shah, P.K., Kaul, S., Nilsson, J., Cercek, B. (2001). Exploiting the vascular protective effects of high-density lipoprotein and its apolipoproteins: an idea whose time for testing is coming. Circulation, 104 (19), 2376-2383. https://doi.org/10.1161/hc4401.098467 Haase, C.L., Frikke-Schmidt, R., Nordestgaard, B.G., Kateifides, A.K., Kardassis, D., Nielsen, L.B., Andersen, C.B., Køber, L., Johnsen, A.H., Grande, P., Zannis, V.I., Tybjaerg-Hansen, A. (2011). Mutation in APOA1 predicts increased risk of ischaemic heart disease and total mortality without low HDL cholesterol levels. Journal of International Medicine, 270 (2), 136-146. https://doi.org/10.1111/j.1365-2796.2011.02381.x Arciello, A., Piccoli, R., Monti, D.M. (2016). Apolipoprotein A-I: the dual face of a protein. FEBS letters, 590 (23), 4171–4179. https://doi.org/10.1002/1873-3468.12468 Mogilenko, D.A., Orlov, S.V., Trulioff, A.S., Ivanov, A.V., Nagumanov, V.K., Kudriavtsev, I.V., Shavva, V.S., Tanyanskiy, D.A., Perevozchikov, A.P. (2012). Endogenous apolipoprotein A-I stabilizes ATP-binding cassette transporter A1 and modulates Toll-like receptor 4 signaling in human macrophages. FASEB Journal, 26 (5), 2019-2030. https://doi.org/10.1096/fj.11-193946 Nekrasova, E., Nikitin, A., Mogilenko, D., Shavva, V., Kudriavtsev, I., Orlov, S. (2019). The endogenous Apolipoprotein A-I enhances the uptake of oxidated low density lipoprotein by macrophages. 87th EAS Congress, 287, E103-E103. https://doi.org/10.1016/j.atherosclerosis.2019.06.299 Su, Y.R., Blakemore, J.L., Zhang, Y., Linton, M.F., Fazio, S. (2008). Lentiviral transduction of apoAI into hematopoietic progenitor cells and macrophages: applications to cell therapy of atherosclerosis. Arteriosclerosis, Thrombosis, and Vascular Biology, 28 (8), 1439-1446. https://doi.org/10.1161/ATVBAHA.107.160093 Bursill, C.A., Castro, M.L., Beattie, D.T., Nakhla, S., van der Vorst, E., Heather, A.K., Barter, P.J., Rye, K.A. (2010). High-density lipoproteins suppress chemokines and chemokine receptors in vitro and in vivo. Arteriosclerosis, thrombosis, and vascular biology, 30 (9), 1773-1778. https://doi.org/10.1161/ATVBAHA.110.211342 Diederich, W., Orsó, E., Drobnik, W., Schmitz, G. (2001). Apolipoprotein AI and HDL3 inhibit spreading of primary human monocytes through a mechanism that involves cholesterol depletion and regulation of CDC42. Atherosclerosis, 159 (2), 313-324. https://doi:10.1016/s0021-9150(01)00518-4 Iqbal, A.J., Barrett, T.J., Taylor, L., McNeill, E., Manmadhan, A., Recio, C., Carmineri, A., Brodermann, M.H., White, G.E., Cooper, D., DiDonato, J.A., Zamanian-Daryoush, M., Hazen, S.L., Channon, K.M., Greaves, D.R., Fisher, E.A. (2016). Acute exposure to apolipoprotein A1 inhibits macrophage chemotaxis in vitro and monocyte recruitment in vivo. Elife, 5, e15190. https://doi.org/10.7554/eLife.15190 Wang, L., Chen, W.Z., Wu, M.P. (2010). Apolipoprotein A-I inhibits chemotaxis, adhesion, activation of THP-1 cells and improves the plasma HDL inflammatory index. Cytokine, 49 (2), 194–200. https://doi.org/10.1016/j.cyto.2009.08.008 Claro V., Ferro, A. (2020). Netrin-1: Focus on its role in cardiovascular physiology and atherosclerosis. JRSM Cardiovascular Disiase, 9, 2048004020959574. https://doi.org/10.1177/2048004020959574 van Gils, J.M., Derby, M.C., Fernandes, L.R., Ramkhelawon, B., Ray, T.D., Rayner, K.J., Parathath, S., Distel, E., Feig, J.L., Alvarez-Leite, J.I., Rayner, A.J., McDonald, T.O., O'Brien, K.D., Stuart, L.M., Fisher, E.A., Lacy-Hulbert, A., Moore, K.J. (2012). The neuroimmune guidance cue netrin-1 promotes atherosclerosis by inhibiting the emigration of macrophages from plaques. Nature Immunology, 13 (2), 136-143. https://doi:10.1038/ni.2205 Ramkhelawon, B., Yang, Y., van Gils, J.M., Hewing, B., Rayner, K.J., Parathath, S., Guo, L., Oldebeken, S., Feig, J.L., Fisher, E.A., Moore, K.J. (2013). Hypoxia induces netrin-1 and Unc5b in atherosclerotic plaques: mechanism for macrophage retention and survival. Arteriosclerosis, Thrombosis, and Vascular Biology, 33 (6), 1180-1188. https://doi:10.1161/ATVBAHA.112.301008 Xuan, W., Qu, Q., Zheng, B., Xiong, S., Fan, G.H. (2015). The chemotaxis of M1 and M2 macrophages is regulated by different chemokines. Journal of Leukocyte Biology, 97 (1), 61-69. https://doi.org/10.1189/jlb.1A0314-170R Taylor, L., Brodermann, M.H., McCaffary, D., Iqbal, A.J., Greaves, D.R. (2016). Netrin-1 Reduces Monocyte and Macrophage Chemotaxis towards the Complement Component C5a. PLoS ONE, 11 (8), e0160685. https://doi:10.1371/journal.pone.0160685 Nekrasova, E.V., Larionova, E.E., Danko, K., Kuzmina, D.O., Shavva, V.S., Kudriavtsev, I.V., Orlov, S.V. (2021). Regulation of Apolipoprotein A-I Gene Expression in Human Macrophages by Oxidized Low-Density Lipoprotein. Biochemistry (Moscow), 86 (10), 1201-1213. https://doi:10.1134/S0006297921100047 Yang, X., Zhang, J., Chen, L., Yuan, Z., Qin, X., Wu, Q., Shen, D., He, H., Yu, C. (2018). The role of UNC5b in ox-LDL inhibiting migration of RAW264.7 macrophages and the involvement of CCR7. Biochemical and Biophysical Research Communications, 505 (3), 637-643. https://doi:10.1016/j.bbrc.2018.09.178 Dolde, X., Karreman, C., Wiechers, M., Schildknecht, S., Leist, M. (2021). Profiling of Human Neural Crest Chemoattractant Activity as a Replacement of Fetal Bovine Serum for In Vitro Chemotaxis Assays. International Journal of Molecular Sciences, 22 (18), 10079. https://doi.org/10.3390/ijms221810079 Mogilenko, D.A., Dizhe, E.B., Shavva, V.S., Lapikov, I.A., Orlov, S.V., Perevozchikov, A.P. (2009). Role of the nuclear receptors HNF4 alpha, PPAR alpha, and LXRs in the TNF alpha-mediated inhibition of human apolipoprotein A-I gene expression in HepG2 cells. Biochemistry, 48 (50), 11950–11960. https://doi: 10.1021/bi9015742. Shavva, V.S., Mogilenko, D.A., Bogomolova, A.M., Nikitin, A.A., Dizhe, E.B., Efremov, A.M., Oleinikova, G.N., Perevozchikov, A.P., Orlov, S.V. (2016). PPARγ represses apolipoprotein A-I gene but impedes TNF alpha_mediated ApoA_I downregulation in HepG2 cells. Journal of Cellular Biochemistry, 117 (9), 2010-2022. https://doi: 10.1002/jcb.25498. Shavva, V.S., Bogomolova, A.M., Nikitin, A.A., Dizhe, E.B., Tanyanskiy, D.A., Efremov, A.M., Oleinikova, G.N., Perevozchikov, A.P., Orlov, S.V. (2017). Insulin-mediated downregulation of apolipoprotein A-I gene in human hepatoma cell line HepG2: the role of interaction between FOXO1 and LXRβ transcription factors. Journal of Cellular Biochemistry, 118 (2), 382-396. https://doi: 10.1002/jcb.25651. Kõressaar, T., Lepamets, M., Kaplinski, L., Raime, K., Andreson, R., Remm, M. (2018). Primer3_masker: integrating masking of template sequence with primer design software. Bioinformatics, 34 (11), 1937-1938. https://doi:10.1093/bioinformatics/bty036 Nekrasova, E.V., Orlov, S.V. (2025). Netrin-1 upregulates its own gene expression and unc5b gene, but downregulates ccl19 gene expression in human macrophages THP-1 cell line. Medical Immunology (Russia), 27 (4), 301-308. https://doi: 10.15789/1563-0625-NUI-3151 Chen, W., Wu, Y., Lu, Q., Wang, S., Xing, D. (2020). Endogenous ApoA-I expression in macrophages: A potential target for protection against atherosclerosis. Clinica Chimica Acta , 505, 55–59. https://doi: 10.1016/j.cca.2020.02.025 Nekrasova, E.V., Danko, K.V., Shavva, V.S., Dizhe, E.B., Oleinikova, G.N., Orlov, S.V. (2020). Effect of the insulin on the apolipoprotein A-I gene expression in human macrophages. Medical Academic J ournal, 20 (1), 65-74. https://doi.org/10.17816/MAJ16437 Shavva, V.S., Mogilenko, D.A., Nekrasova, E.V., Trulioff, A.S., Kudriavtsev, I.V., Larionova, E.E., Babina, A.V., Dizhe, E.B., Missyul, B.V., Orlov, S.V. (2018). Tumor necrosis factor α stimulates endogenous apolipoprotein A-I expression and secretion by human monocytes and macrophages: role of MAP-kinases, NF-κB, and nuclear receptors PPARα and LXRs. Molecular and Cellular Biochemistry, 448 (1-2), 211-223. https://doi:10.1007/s11010-018-3327-7 Neary, R.H., Gowland, E. (1987). Stability of free apolipoprotein A-I concentration in serum, and its measurement in normal and hyperlipidemic subjects. Clinical Chemistry, 33, 1163-1169 Witkowski, A., Carta, S., Lu, R., Yokoyama, S., Rubartelli, A., Cavigiolio, G. (2019). Oxidation of methionine residues in human apolipoprotein A-I generates a potent pro-inflammatory molecule. Journal of Biological Chemistry, 294 (10), 3634-3646. https://doi: 10.1074/jbc.RA118.005663. Van Lenten, B.J., Wagner, A.C., Jung, C.L., Ruchala, P., Waring, A.J., Lehrer, R.I., Watson, A.D., Hama, S., Navab, M., Anantharamaiah, G.M., Fogelman, A.M. (2008). Anti-inflammatory apoA-I-mimetic peptides bind oxidized lipids with much higher affinity than human apoA-I. Journal of Lipid Research, 49 (11), 2302-2311. https://doi: 10.1194/jlr.M800075-JLR200. Ziegon, L., Schlegel, M. (2021). Netrin-1: A Modulator of Macrophage Driven Acute and Chronic Inflammation. International Journal of Molecular Sciences, 23 (1), 275. https://doi.org/10.3390/ijms23010275 Bogomolova, A.M., Shavva, V.S., Nikitin, A.A., Nekrasova, E.V., Dizhe, E.B., Larionova, E.E., Kudriavtsev, I.V., Orlov, S.V. (2019). Hypoxia as a Factor Involved in the Regulation of the apoA-1, ABCA1, and Complement C3 Gene Expression in Human Macrophages. Biochemistry (Moscow). 84 (5), 529-539. https://doi:10.1134/S0006297919050079 Pagler, T.A., Wang, M., Mondal, M., Murphy, A.J., Westerterp, M., Moore, K.J., Maxfield, F.R., Tall, A.R. (2011). Deletion of ABCA1 and ABCG1 impairs macrophage migration because of increased Rac1 signaling. Circulation Research, 108 (2), 194-200. https://doi:10.1161/CIRCRESAHA.110.228619 Hewing, B., Parathath, S., Barrett, T., Chung, W.K., Astudillo, Y.M., Hamada, T., Ramkhelawon, B., Tallant, T.C., Yusufishaq, M.S., Didonato, J.A., Huang, Y., Buffa, J., Berisha, S.Z., Smith, J.D., Hazen, S.L., Fisher, E.A. (2014). Effects of native and myeloperoxidase-modified apolipoprotein a-I on reverse cholesterol transport and atherosclerosis in mice. Arteriosclerosis, Thrombosis, and Vascular Biology, 34 (4), 779–789 . https://doi.org/10.1161/ATVBAHA.113.303044 Ramkhelawon, B., Hennessy, E.J., Ménager, M., Ray, T.D., Sheedy, F.J., Hutchison, S., Wanschel, A., Oldebeken, S., Geoffrion, M., Spiro, W., Miller, G., McPherson, R., Rayner, K.J., Moore, K.J. (2014). Netrin-1 promotes adipose tissue macrophage retention and insulin resistance in obesity. Nature Medicine, 20 (4), 377-384. https://doi:10.1038/nm.3467 Bruikman, C., Vreeken, D., Hoogeveen, R., Bom, M., Danad, I., Pinto-Sietsma, S., Zonneveld, A., Knaapen, P., Hovingh, K., Stroes, E., Gils, J. (2020). Netrin-1 and the Grade of Atherosclerosis Are Inversely Correlated in Humans. Arteriosclerosis, thrombosis, and vascular biology, 40 (2), 462-472. https://doi:10.1161/ATVBAHA.119.313624 Muñoz, J.C., Martín, R., Alonso, C., Gutiérrez, B., Nieto, M.L. (2017). Relation between serum levels of chemotaxis-related factors and the presence of coronary artery calcification as expression of subclinical atherosclerosis. Clinical Biochemistry, 50 (18), 1048-1055. https://doi:10.1016/j.clinbiochem.2017.08.012 Fiorelli, S., Cosentino, N., Porro, B., Fabbiocchi, F., Niccoli, G., Fracassi, F., Capra, N., Barbieri, S., Crea, F., Marenzi, G. (2021). Netrin-1 in Atherosclerosis: Relationship between Human Macrophage Intracellular Levels and In Vivo Plaque Morphology. Biomedicines, 9 (2), 168. https://doi.org/10. 3390/biomedicines9020168 Additional Declarations No competing interests reported. Supplementary Files FigS1.pdf graphicalabstract.tif Graphical abstract. Hypothetic scheme illustrating the role of exogenous and endogenous Apolipoprotein A-I (ApoA-I) in the regulation of migratory activity of macrophages Cite Share Download PDF Status: Published Journal Publication published 19 Mar, 2026 Read the published version in Cell Biochemistry and Biophysics → Version 1 posted Editorial decision: Revision requested 17 Nov, 2025 Reviews received at journal 17 Nov, 2025 Reviews received at journal 07 Nov, 2025 Reviews received at journal 03 Nov, 2025 Reviewers agreed at journal 28 Oct, 2025 Reviewers agreed at journal 24 Oct, 2025 Reviews received at journal 23 Oct, 2025 Reviewers agreed at journal 22 Oct, 2025 Reviewers agreed at journal 21 Oct, 2025 Reviewers agreed at journal 21 Oct, 2025 Reviewers invited by journal 21 Oct, 2025 Editor assigned by journal 21 Oct, 2025 Submission checks completed at journal 21 Oct, 2025 First submitted to journal 20 Oct, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7904915","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":536265207,"identity":"76c008af-a72d-46cb-b22c-f81c2bdae5fe","order_by":0,"name":"Ekaterina Nekrasova","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA3UlEQVRIiWNgGAWjYFACNijN3tgApg2I18JzkGQtEgkMxGkxZ29L+/Djj01i/8zHjY9uMNTlmTPwPpPAp8Wy59jhmb1taYkzbic2G+cwHC62bGA3w6vF4EZ6MwNvw2FjhtuJbdI5DAcSNxxgY8Ov5f7zZsY/fw4by9882P47h6GOCC032A4z87AdljO4wdjGnMPATISWM2nJzLJtaXKGZxKbpXMMgH5pZmO2wKvl+DFjxjd/bHjkjh9/+DmnAhhi7G2MN/BpQTeBIYGBmQT1YJBAqoZRMApGwSgY/gAA+gtG9/UTXFMAAAAASUVORK5CYII=","orcid":"","institution":"Institute of Experimental Medicine","correspondingAuthor":true,"prefix":"","firstName":"Ekaterina","middleName":"","lastName":"Nekrasova","suffix":""},{"id":536265208,"identity":"a686c274-86ac-40ed-98ff-ed1c56663f1b","order_by":1,"name":"Maria Serebriakova","email":"","orcid":"","institution":"Herzen University","correspondingAuthor":false,"prefix":"","firstName":"Maria","middleName":"","lastName":"Serebriakova","suffix":""},{"id":536265209,"identity":"a02079e4-d921-47bb-82fc-977e28283f68","order_by":2,"name":"Daria Kuzmina","email":"","orcid":"","institution":"Saint-Petersburg State University","correspondingAuthor":false,"prefix":"","firstName":"Daria","middleName":"","lastName":"Kuzmina","suffix":""},{"id":536265210,"identity":"3b6f0219-a095-4e41-a1be-860c3ea38ab9","order_by":3,"name":"Alexandra Burnusuz","email":"","orcid":"","institution":"Institute of Experimental Medicine","correspondingAuthor":false,"prefix":"","firstName":"Alexandra","middleName":"","lastName":"Burnusuz","suffix":""},{"id":536265211,"identity":"71f6bbf0-dd28-4895-a38b-c70e0358bf2b","order_by":4,"name":"Ekaterina Larionova","email":"","orcid":"","institution":"Institute of Experimental Medicine","correspondingAuthor":false,"prefix":"","firstName":"Ekaterina","middleName":"","lastName":"Larionova","suffix":""},{"id":536265212,"identity":"afc70024-de75-4a66-84f7-5ff746c8cfcd","order_by":5,"name":"Nikolay Gorbunov","email":"","orcid":"","institution":"Saint Petersburg Pasteur Institute","correspondingAuthor":false,"prefix":"","firstName":"Nikolay","middleName":"","lastName":"Gorbunov","suffix":""},{"id":536265213,"identity":"71eedcbd-fefd-46bd-958f-eada55e39592","order_by":6,"name":"Sergey Orlov","email":"","orcid":"","institution":"Institute of Experimental Medicine","correspondingAuthor":false,"prefix":"","firstName":"Sergey","middleName":"","lastName":"Orlov","suffix":""}],"badges":[],"createdAt":"2025-10-20 10:53:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7904915/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7904915/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s12013-026-02046-8","type":"published","date":"2026-03-19T15:59:18+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":94878164,"identity":"4c7d7634-f958-45e8-98d5-6db2718cc5ff","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1866833,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/1264f1fc92b9428dff561687.docx"},{"id":94986438,"identity":"7a41e7ab-54b4-4997-ab77-2ee23122e052","added_by":"auto","created_at":"2025-11-03 07:00:19","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6672975,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/ebd261ada64e3c9d5a8d7c68.tif"},{"id":94878163,"identity":"197ae20b-718a-42b4-8850-deec60c0b5ba","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5072590,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/e7a5bc1edc9ef02c06d0c161.tif"},{"id":94987000,"identity":"074c2a01-1664-40ed-ba6c-c684a18b15fc","added_by":"auto","created_at":"2025-11-03 07:01:04","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3528750,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/c3f5fedd93bd1c7fd32eaccb.tif"},{"id":94986731,"identity":"89773b3b-5ccc-4aad-9609-caff2c4b7d13","added_by":"auto","created_at":"2025-11-03 07:00:41","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3621923,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/ec40ef6d3947a47bb8dc2dc6.tif"},{"id":94878161,"identity":"2a222433-3a17-459e-9f42-213ff475f180","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4572476,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/d5103d7133a0beade00944bb.tif"},{"id":94878177,"identity":"144cfe50-cf69-4f69-8cdb-904c2fa9a844","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3338633,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/3d17e7c8c17cf08cc7161e2c.tif"},{"id":94878167,"identity":"ef3e6e1b-0571-40a7-8550-af54d278f84f","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4228146,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/6e8f52623faae7794a580532.tif"},{"id":94878181,"identity":"2d348696-2119-46b4-8409-77da8f25f7fb","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"json","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8395,"visible":true,"origin":"","legend":"","description":"","filename":"c24f23af53d44cf4b8020d85c470b95b.json","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/8eebfc81495de610adcfb93e.json"},{"id":94878172,"identity":"fb58c3e3-cca0-43ea-8154-1577ae9b6b62","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"pdf","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":478793,"visible":true,"origin":"","legend":"","description":"","filename":"FigS1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/df2108e196bf4c07d0584104.pdf"},{"id":94878190,"identity":"4b44a241-5e5d-4543-82c4-83eaaff38660","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"xml","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":105158,"visible":true,"origin":"","legend":"","description":"","filename":"c24f23af53d44cf4b8020d85c470b95b1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/b5ebe34427d6b4a08a6b0019.xml"},{"id":94987009,"identity":"4eb6451f-c4a0-449a-99b9-41f056838f50","added_by":"auto","created_at":"2025-11-03 07:01:06","extension":"tif","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6672975,"visible":true,"origin":"","legend":"","description":"","filename":"Figure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/cb60746f69b400d9457e21e1.tif"},{"id":94878200,"identity":"7ed67223-ad04-4e6c-b35d-ac9e3ff69a9a","added_by":"auto","created_at":"2025-10-31 16:19:20","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5072590,"visible":true,"origin":"","legend":"","description":"","filename":"Figure2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/f79a4c5167b3a1e946a83fa2.tif"},{"id":94878175,"identity":"525b3a70-f92c-4af8-9dbb-dcf690cd0b53","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"tif","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3528750,"visible":true,"origin":"","legend":"","description":"","filename":"Figure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/9d1146d96354ba0690e0d571.tif"},{"id":94986081,"identity":"14a94444-fe06-4290-bedb-baf533485e58","added_by":"auto","created_at":"2025-11-03 06:59:46","extension":"tif","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3621923,"visible":true,"origin":"","legend":"","description":"","filename":"Figure4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/d62321cda467a7a4d6d47e6c.tif"},{"id":94986850,"identity":"4cb1f949-160e-41f7-a4bc-547376e377f0","added_by":"auto","created_at":"2025-11-03 07:00:52","extension":"tif","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4572476,"visible":true,"origin":"","legend":"","description":"","filename":"Figure5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/8244f91fb9a1cc9e273959c7.tif"},{"id":94878197,"identity":"c5712af0-e628-44e0-bbef-730e76a5e2a1","added_by":"auto","created_at":"2025-10-31 16:19:20","extension":"tif","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3338633,"visible":true,"origin":"","legend":"","description":"","filename":"Figure6.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/78f8e20cee0e7f1b89f9a12d.tif"},{"id":94878189,"identity":"e1d58bae-3d70-4ae1-a544-d2d22602f898","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"tif","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":4228146,"visible":true,"origin":"","legend":"","description":"","filename":"Figure7.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/def024e193e5f1611f92d1fd.tif"},{"id":94878173,"identity":"a3b821ae-3344-4524-b7e5-3f9c30b75a85","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"jpeg","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":395394,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/bf2a889ba457aa161d6b1cb5.jpeg"},{"id":94878182,"identity":"60ffd8fc-b005-4536-ab87-a3ca32e8a296","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"jpeg","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":292726,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/80d2ec19b1bdc4bca98f3168.jpeg"},{"id":94987214,"identity":"53c71391-2503-45bf-829c-5549ae2f44a6","added_by":"auto","created_at":"2025-11-03 07:01:30","extension":"jpeg","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":178596,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/85ece7729c39f2303c35e954.jpeg"},{"id":94986561,"identity":"6813c6e5-e0a9-499a-803c-c3a9c46a101b","added_by":"auto","created_at":"2025-11-03 07:00:26","extension":"jpeg","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":194124,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/43ecd34a9b66b4a771e14ecc.jpeg"},{"id":94878179,"identity":"875617cf-8c99-40ac-9fff-eefd4de56349","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"jpeg","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":232186,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/d45683677bb64f8a624e1ce8.jpeg"},{"id":94878183,"identity":"c59274a9-b83d-4983-ace9-908909e465af","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"jpeg","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":187346,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/3c93372be9514099ee919aef.jpeg"},{"id":94878202,"identity":"ea736642-1f91-4350-8d30-c3b00eb2441f","added_by":"auto","created_at":"2025-10-31 16:19:20","extension":"jpeg","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":179190,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/ea6980dcc2f73757b3d3ead0.jpeg"},{"id":94986405,"identity":"b3792104-2adb-4924-94a0-b1e9a02f8efb","added_by":"auto","created_at":"2025-11-03 07:00:17","extension":"jpeg","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":139690,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage8.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/43dd182248387bf4b435388e.jpeg"},{"id":94878194,"identity":"1371c721-e073-44ea-bf24-692e2f28b808","added_by":"auto","created_at":"2025-10-31 16:19:20","extension":"tif","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":674001,"visible":true,"origin":"","legend":"","description":"","filename":"graphicalabstract.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/22643890cf7c410833380d20.tif"},{"id":94878205,"identity":"65e244a6-6335-48d9-b835-bdf2442876c8","added_by":"auto","created_at":"2025-10-31 16:19:20","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":799834,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/e41b333f8cf7bcfec3d96893.png"},{"id":94878186,"identity":"57dae73c-55e6-465f-971c-b810fb898727","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":764665,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/6b69c5ab86504c5dc992b697.png"},{"id":94987193,"identity":"f7646f40-df39-436d-b87b-1dc0ebf788a2","added_by":"auto","created_at":"2025-11-03 07:01:27","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":549187,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/2915c33670691dd6c0d5529d.png"},{"id":94878206,"identity":"6c82c8c1-635d-4e6a-abf2-8406843ede89","added_by":"auto","created_at":"2025-10-31 16:19:20","extension":"png","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1359222,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/1a5f9818a7125b5b20199145.png"},{"id":94987046,"identity":"bec95277-339f-4e47-9046-8887ffa23b3e","added_by":"auto","created_at":"2025-11-03 07:01:10","extension":"png","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":691911,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/66684bf20cde374824aa77bc.png"},{"id":94878184,"identity":"da392dbc-b05d-40d8-9c21-a5ccc678d971","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"png","order_by":33,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":513002,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/02d87d06d379472f633f0b77.png"},{"id":94986865,"identity":"ca544285-5a15-4ea0-a739-8afa13207894","added_by":"auto","created_at":"2025-11-03 07:00:54","extension":"png","order_by":34,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":412491,"visible":true,"origin":"","legend":"","description":"","filename":"OnlineFigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/e72d8f9f9f5d6deeea30eed3.png"},{"id":94878198,"identity":"a88ae11b-ab7e-41ac-a933-a161613c76d4","added_by":"auto","created_at":"2025-10-31 16:19:20","extension":"png","order_by":35,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":41158,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/77e20b3b4a34d40c1dc27c43.png"},{"id":94878192,"identity":"c9dd4141-6eec-4da2-a2c3-070ff0b3fcb1","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"png","order_by":36,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":35145,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/c08bddd59e0fc7ccb96898ba.png"},{"id":94987220,"identity":"173d6d2f-11b2-4085-8ea8-5294890bf550","added_by":"auto","created_at":"2025-11-03 07:01:30","extension":"png","order_by":37,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":18128,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/88488cb470ef41208c775d29.png"},{"id":94878178,"identity":"4e2d0890-a8ff-4c36-ad0b-6b737c97aea5","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"png","order_by":38,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19743,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/54ddf147d586ef9d9352de40.png"},{"id":94878193,"identity":"e517aefa-66e0-4127-b2fa-7d96882de16a","added_by":"auto","created_at":"2025-10-31 16:19:20","extension":"png","order_by":39,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":27214,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/aafd2434161a29389e8cf34e.png"},{"id":94878203,"identity":"239e7070-8c84-41c6-97b0-3c6dae264e5b","added_by":"auto","created_at":"2025-10-31 16:19:20","extension":"png","order_by":40,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20694,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/cbc215438edd9923be4dcb1a.png"},{"id":94878210,"identity":"43cfdfb1-ab80-454f-8b9f-e1b7f3192cfa","added_by":"auto","created_at":"2025-10-31 16:19:20","extension":"png","order_by":41,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19944,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/7326aa853df9ddd3a79d387a.png"},{"id":94986808,"identity":"91aed00f-4b11-4a17-9687-32c8f2b58a08","added_by":"auto","created_at":"2025-11-03 07:00:49","extension":"png","order_by":42,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":21275,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage8.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/0c971c0185443beebb012ba3.png"},{"id":94878204,"identity":"34be54c1-4719-409a-bc42-a72620148526","added_by":"auto","created_at":"2025-10-31 16:19:20","extension":"png","order_by":43,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":80235,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinegraphicalabstract.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/1cba05ab0fdb53fdeb577166.png"},{"id":94878207,"identity":"6c02dd75-ee3e-405f-ba06-0d7926cd0d99","added_by":"auto","created_at":"2025-10-31 16:19:20","extension":"xml","order_by":44,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":101561,"visible":true,"origin":"","legend":"","description":"","filename":"c24f23af53d44cf4b8020d85c470b95b1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/8a25b7e00d499b96087b7a43.xml"},{"id":94878187,"identity":"4e01753e-6a9b-4ad5-b846-2c6f16f404e0","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"html","order_by":45,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":112180,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/84f8a3e1b6e9cdeacadf0cdf.html"},{"id":94986975,"identity":"81db2e02-ede2-47ce-9b93-0e7e9c1b765e","added_by":"auto","created_at":"2025-11-03 07:01:03","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":12591553,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/bd5ff67bc5b9e4ff5e772b60.png"},{"id":94986434,"identity":"8c5f69b7-c5d4-475e-99bb-563c76e00bb8","added_by":"auto","created_at":"2025-11-03 07:00:19","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":7977194,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/9cdfb71f7b651243c37e3b40.png"},{"id":94986229,"identity":"6596e732-617a-4a70-8bcc-12826553051f","added_by":"auto","created_at":"2025-11-03 07:00:05","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":4773562,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/5126637b8d5bc03bd6ada772.png"},{"id":94986136,"identity":"78c07b6d-b912-4894-82ec-f8baeda9bae7","added_by":"auto","created_at":"2025-11-03 06:59:55","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":6495672,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/5f850ce3ad8f2ec47599f688.png"},{"id":94878169,"identity":"5d0fc95e-f4ff-47aa-90bb-ec7789054cba","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":6714468,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/15bb93494ea31cdf575756a2.png"},{"id":94878180,"identity":"c214706e-b535-40cf-92a2-e59e48549a77","added_by":"auto","created_at":"2025-10-31 16:19:19","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":4912407,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u0026nbsp;\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/e5dd9763dc20fd688a150a98.png"},{"id":94987215,"identity":"36112cca-18ec-4628-abb0-b00ac5705cd7","added_by":"auto","created_at":"2025-11-03 07:01:30","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":6004743,"visible":true,"origin":"","legend":"\u003cp\u003eNetrin-1 decreases ApoA-I mRNA and cytoplasmic membrane protein levels in macrophages. The macrophages were administrated with netrin-1 [50 ng/ml] from 3rd to 5th days of differentiation (A, B) and oxLDL [100 \u003cem\u003eμg/ml] \u003c/em\u003efrom 4th to 5th days (B): A) RT-qPCR. Y-axis values point out the relative levels of ApoA-I mRNA (100% in control unstimulated macrophages). The data represent as \u003cem\u003emeans ±\u003c/em\u003e s.e.m. (error bars), n=3\u003cem\u003e, * p\u003c/em\u003e\u0026lt;0.05 \u003cem\u003e(\u003c/em\u003eunpaired Student’s t-test\u003cem\u003e). B) flow cytometry assay: grey line (isotype) corresponds to the isotype control (the cells were stained by second antibodies labeled with Alexa Flour647 only without the addition of specific antibodies against ApoA-I); black line (Control) corresponds to the distribution of untreated control cells; red line (Netrin-1) - the cells treated by netrin-1 [50 ng/ml] for 48 h; green line (oxLDL) – the cells incubated with oxLDL [\u003c/em\u003e100 \u003cem\u003eμg/ml] for 24 h; the yellow line (Netrin-1+oxLDL)– the cells incubated with netrin-1 [50 ng/ml] for 48 h and oxLDL [100 μg/ml] for 24 h. The diagram shows medians of the relative levels of surface ApoA-I protein with 95 confidence intervals (error bars), n=4, in arbitrary units, AU. Statistical analyses of differences between groups were performed using Kruskal-Wallis’s and Dunn’s test, * p\u0026lt;0.05.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/5dd7c11a60f4db5e96f6e18d.png"},{"id":105223440,"identity":"de521d4f-6d45-4f89-be4b-2b80cc80963f","added_by":"auto","created_at":"2026-03-23 16:06:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":51021797,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/da8056d1-e90e-4fc8-808d-b7df52ede4ba.pdf"},{"id":94878158,"identity":"f7eacc7f-1ffc-41a1-973d-cddd625b020a","added_by":"auto","created_at":"2025-10-31 16:19:18","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":478793,"visible":true,"origin":"","legend":"","description":"","filename":"FigS1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/fd8054970dc27a4e2f5d8af6.pdf"},{"id":94878157,"identity":"17f5e17d-6f03-4971-9ffb-ca9e83e81a9e","added_by":"auto","created_at":"2025-10-31 16:19:18","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":674001,"visible":true,"origin":"","legend":"\u003cp\u003eGraphical abstract. Hypothetic scheme illustrating the role of exogenous and endogenous Apolipoprotein A-I (ApoA-I) in the regulation of migratory activity of macrophages\u003c/p\u003e","description":"","filename":"graphicalabstract.tif","url":"https://assets-eu.researchsquare.com/files/rs-7904915/v1/ae06d98fa64538fda6c2ba9a.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"\u003cp\u003eSynthesis of Apolipoprotein a-i in Human Macrophages Enhances Their Migratory Activity\u003c/p\u003e","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eAtherosclerosis is a systemic chronic disorder of arterial walls characterized by an accumulation of lipid laden macrophages in the intima of vessels with following transformation into foam cells. The main mechanisms of the cholesterol excesses removal from atherosclerotic plaque are the reverse cholesterol transport through high density lipoprotein (HDL) to the liver for the excretion with bile, and the egress of cholesterol-engorged macrophages from atheroma to lymph nodes and afterwards to liver [1, 2]. The reverse transport is defined as a process of cholesterol transfer from the cell membrane to Apolipoprotein A-I (ApoA-I) via the interaction with ATP-binding cassette transporter A1 (ABCA1) to form an immature HDL particle, which then takes up cholesterol from cells through another ATP-binding cassette transporter G1 (ABCG1) to form a mature HDL particle [2]. Macrophage emigration may occurs in the initial stages of atherosclerosis but the rate of emigration decreases greatly during the manifestation of disease [1]. Perhaps there is a balance of stimuli between macrophage retention inside the inflammation focus within atherosclerotic lesion and their emigration from the plaque. Recent articles have defined some factors, increasing the macrophage retention in the atherosclerotic plaque: netrin-1, semaphorin 3A and 3E, the accumulation of cholesterol in macrophages, leading to a stress of endoplasmic reticulum [1, 3], and the stimulatory factors for macrophage chemotaxis to the lymph nodes: chemokines CCL19, CCL21, their chemokine receptor CCR7 etc. [3].\u003c/p\u003e\u003cp\u003eApolipoprotein A-I (ApoA-I) is a major structural and functional protein of HDL particle [2, 4, 5]. Human and animal severe atherosclerosis and the increased risk of ischemic heart disease are associated with many mutations in ApoA-I gene [6]. Anti-atherogenic properties of ApoA-I are usually interpreted by its participation in the reverse cholesterol transport, and by its antioxidant and anti-inflammatory activities [5]. The main sites of synthesis of ApoA-I in mammals are liver and small intestine [4]. Earlier we have shown that ApoA-I protein also synthesizes in human monocytes and macrophages, where it stabilizes ABCA1, decreases TNFα production and reduces the lipopolysaccharide (LPS)-induced response by inhibiting the TLR4 synthesis [7]. Predominantly ApoA-I in macrophages is localized on the external side of plasma membrane with the formation of complexes with ABCA1 and lipid rafts [7]. Some functions of ApoA-I in macrophages (suppression of their pro-inflammatory activity, the enhance of oxidized low-density lipoprotein (oxLDL) uptake by macrophages) are realized through its interactions with the ABCA1 cassette transporter followed by initiation of several signaling cascades in the cells [7, 8]. Delivery of human ApoA-I gene to the macrophages isolated from wild type and ApoE(-/-) mice improved cholesterol efflux. Moreover, ex vivo delivery of human ApoA-I gene by lentivirus vector construction into hematopoietic progenitor cells with following transfer of transduced cells to ApoE(-/-) mice led to the reduction of atherosclerotic plaques on the aortic wall [9]. It proves that ApoA-I expression in macrophages has essential anti-atherogenic effect.\u003c/p\u003e\u003cp\u003eExternal ApoA-I synthesized outside of monocytes and macrophages (ApoA-I dissociated from plasma HDL), has a negative impact on monocyte and macrophage migration [10, 11, 12, 13]. However, there are not data about the possible role of endogenous (synthesized in monocytes and macrophages) ApoA-I in the regulation of macrophage migratory activity, in particular, in the emigration of lipid-loaded macrophages from atherosclerotic plaques.\u003c/p\u003e\u003cp\u003eNetrin-1 has been identified as secreted laminin-related protein, which binds to its receptor UNC5B and inhibits leukocyte migration [14, 15]. Netrin-1 increases arterial smooth muscle cell recruitment through the binding to another receptor neogenin, which ultimately leads to the formation of a fibrous capsule [15, 16]. Netrin-1 affects on macrophages in autocrine and paracrine manner (smooth muscle and endothelial cells also produce netrin-1) and inhibits their chemotaxis induced by some chemotropic proteins including the anaphylatoxin and chemoattractant C5a [17]. Monocytes and tissue macrophages secrete netrin-1 in very low concentrations, while lipid-laden macrophages in human and mouse atheromas produce netrin-1 in high dosages [15]. Under hypoxic conditions, which are typical for the advanced atherosclerotic lesion, macrophages increases netrin-1 and UNC5B production and are retained inside the plaque [16].\u003c/p\u003e\u003cp\u003eChemokines are key mediators of chemotaxis [18]. Each subpopulation of macrophages requires the specific chemokines to move efficiently throughout the body [17, 18]. In this article the object of study was unpolarized resting macrophages (RM), which migrate better toward anaphylatoxin C5a compared to other chemokines, for example CCL19 and CCL21 [18]. The activation of cell movement is mediated by the binding C5a with its chemokine receptor C5aR1 [17].\u003c/p\u003e\u003cp\u003eHere we first time demonstrate the positive effect of endogenous ApoA-I on migration through ApoA-I-dependent downregulation of netrin-1 and UNC5B expression in macrophages. We have also shown the negative feedback loop between netrin-1 and ApoA-I production. The observed stimulatory role of endogenous ApoA-I in macrophage migration may be an important mechanism underlying the anti-atherogenic effect of ApoA-I synthesis in macrophages.\u003c/p\u003e"},{"header":"2. Materials \u0026 Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1. Materials and antibodies\u003c/h2\u003e\u003cp\u003eRecombinant human protein netrin-1 was purchased from R\u0026amp;D Systems, USA (Cat. No. 6419-N1). Human ApoA-I protein was received from Biovision, USA (Cat. No. 4693\u0026thinsp;\u0026minus;\u0026thinsp;1000). C5a was purchased from Cytokine, Russia (Cat. No. 20.59.52.190). Mouse monoclonal IgG1 antibodies against human CD68 (KP1) (Alexa Fluor647 labeled; Cat. No. sc-20060) and isotypic mouse antibodies IgG1 (Alexa Fluor647 labeled; Cat. No. sc-24636) were purchased from Santa Cruz Biotechnology, USA. Mouse monoclonal antibodies against human ApoA-I (Cat. No. 0650\u0026thinsp;\u0026minus;\u0026thinsp;0050) were purchased from Bio-Rad, USA. As secondary antibodies were used goat anti-mouse IgG (H\u0026thinsp;+\u0026thinsp;L) F(ab\u0026prime;)\u003csub\u003e2\u003c/sub\u003e antibodies Alexa Fluor647-labeled (Cat. No. 4410S), purchased from Cell Signaling, USA. Rabbit polyclonal antibodies against human UNC5B (Cat. No. ab104871), secondary goat anti-rabbit antibodies Rhodamine-labeled (Cat. No. ab7051-1) were received from Abcam, USA. Rabbit polyclonal antibodies against human ABCA1 (Cat. No. ab7360) were received from Abcam, USA. Goat anti-rabbit IgG antibodies conjugated with iFluor647 (Cat. No. HA1123, Huabio, China) were used as secondary antibodies.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\u003ch2\u003e2.2. Cell cultures and macrophage differentiation from peripheral blood monocytes\u003c/h2\u003e\u003cp\u003eWe used primary macrophages isolated from human peripheral blood mononuclear cells (PBMC) from healthy donor blood. Preserved donor blood not suitable for transfusion was purchased from the Blood Transfusion Station (St. Petersburg, Russia). All donors have signed the informed consent for the use of their blood. To obtain primary macrophages, PBMC were isolated from blood by Ficoll density gradient centrifugation as described earlier [19]. Cells were differentiated into macrophages by the incubation at 37\u0026deg;C in the atmosphere of 5% CO\u003csub\u003e2\u003c/sub\u003e in the RPMI-1640 medium (Biolot, Russia) supplemented with 10% fetal calf serum (FCS, HyClone, USA) and gentamicin (Biolot, Russia) [40 \u0026micro;g/ml] for five days. In order to prove that after the differentiation and cultivation it remains the singular population of macrophages, we stained control cells by macrophage marker CD68 and used flow cytometry analysis (see supplementary data Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e) according to this article [15].\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\u003ch2\u003e2.3. Small interfering RNA (siRNA)-mediated knockdown\u003c/h2\u003e\u003cp\u003eScrambled control RNA oligonucleotides (Cat. No. sc-37007), siRNA against ApoA-I (Cat. No. sc-41177), siRNA against ABCA1 (Cat. No.sс-61902) were obtained from Santa Cruz Biotechnology, USA. Macrophages from PBMC were differentiated for 48 h. Then primary macrophages were transfected with siRNAs by the transfection reagent Dharmafect 4 (GE Dharmacon, Austria) in the accordance with manufacturer\u0026rsquo;s guideline. 24 h after transfection the medium was replaced with fresh RPMI-1640 supplemented with 10% FCS and gentamicin [40 \u0026micro;g/ml], and macrophage differentiation was prolonged for 24 or 48 h.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\u003ch2\u003e2.4. LDL isolation, purification and oxidation\u003c/h2\u003e\u003cp\u003eLDL were isolated from the human blood plasma obtained from the preserved donor blood. LDL were isolated, oxidized and measured protein concentration and the extent of LDL oxidation according to this protocol [19] oxLDL were stored at +\u0026thinsp;4 \u0026deg;С no longer than 2 weeks.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section2\"\u003e\u003ch2\u003e2.5. Migration assay\u003c/h2\u003e\u003cp\u003eMacrophages at 5th day of differentiation were harvested by collagenase accutase (Sigma-Aldrich, USA). Migration assay was performed in Transwell inserts of the 24-well culture plates using 5-\u0026micro;m polycarbonate membrane (Corning, USA) according to the method [15, 20]. To decrease the spontaneous migration induced by serum components (IP-10, CCL2 etc.) [21] and increase the specific chemotaxis we replaced 10% FCS on 2% lipoprotein deficient serum (LPDS) (Biowest, France). Macrophages were seeded in RPMI-1640 with 2% LPDS at a density of 1x10\u003csup\u003e5\u003c/sup\u003e cells in the upper chambers of Transwell inserts. The bottom chambers contained RPMI-1640 with 2% LPDS and C5a [10 nM] [17]. In some experiments cells were incubated with netrin-1 [250 ng/ml] [15] or preincubated with the exogenous ApoA-I protein [0.1 \u0026micro;g/ml] for 1 h, then cells were seeded at upper chambers. We added culture medium with 2% LPDS without chemokines at the bottom chambers to assess the spontaneous migration (control). Cells were incubated at 37\u0026deg;C in 5% CO\u003csub\u003e2\u003c/sub\u003e for 24 h. Macrophages from the upper and bottom chambers were harvested by accutase (1 h at 37\u0026deg;C), precipitated by the centrifugation (300 g, 5 min) and resuspended in 0.2 ml of Hanks solution (Biolot, Russia). The concentration of cells was calculated by a flow cytometer CytoFLEX V2-B4-R2 (Beckman Coulter, USA). Migration was presented as a chemotactic index calculated as a ratio of the number of migrating macrophages to the total number of cells (the sum of the numbers of macrophages in the upper and bottom chambers) of each Transwell inserts minus spontaneous migrating cell in percentages.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.6. RNA isolation and RT-qPCR\u003c/h2\u003e\u003cp\u003eTotal RNA was isolated from the cultured cells using ExtractRNA (Evrogen, Russia) according to the manufacturer\u0026rsquo;s instruction. RNA concentration and purity were evaluated using a Synergy 2 plate reader (BioTek, USA). The absence of RNA degradation was assessed by electrophoresis in 1% agarose gel, confirming the integrity of the 28S and 18S ribosomal RNA bands as described previously [19]. Reverse transcription (RT) was performed using the same amount of total RNA [1 \u0026micro;g] for all samples, oligo-dT primers, 3\u0026prime;primers specific for the ApoA-I, Abca1, Ntn1, Unc5b, Ccr7 genes (Evrogen, Russia). Quantitative polymerase chain reaction (qPCR) was performed using Taqman or SYBR Green I protocols in a CFX96 cycler (Bio-Rad, USA). All reagents for qPCR were from Syntol, Russia. Primers and fluorescent probes for the ApoA-I and reference genes Cyclophilin A, β-actin, RPLP0 and GAPDH were described previously [7, 22, 23, 24]. The following primers and probes for mRNA detection of interesting genes were designed with the Primer3 software [25].\u003c/p\u003e\u003cp\u003eNetrin-1 (Ntn1) mRNA: forward primer 5\u0026prime;_CCTGCAAAGCCTGTGATT_3\u0026prime;; reverse primer 5\u0026prime;_GCGCTACAGGGATCTTTATG_3\u0026prime;; and probe 5\u0026prime;_ROX-CAGAGCCGCTCTCCCATCGC-BHQ2 3\u0026prime;.\u003c/p\u003e\u003cp\u003eUnc5b Forward primer 5\u0026prime;_CAAGCAGGCACTGATTCT_3\u0026prime;. Reverse primer 5\u0026prime;_CCGTTGCACTTGAAGTAGAT_3\u0026prime;\u003c/p\u003e\u003cp\u003eСcr7 Forward primer 5\u0026prime;_CTCTCCTTGTCATTTTCCAGGTA_3\u0026prime;; Reverse primer 5\u0026prime;_GCCCACGAAACAAATGATG_3\u0026prime;.\u003c/p\u003e\u003cp\u003eAbca1 Forward primer 5\u0026prime;_CTCCTGTGGTGTTTCTGGATG_3\u0026prime;. Reverse primer 5\u0026prime;_CTTGACAACACTTAGGGCACAA_3\u0026prime;. Probe 5\u0026prime;_ROX- AAGCCCGGCGGTTCTTGTGG-RTQ2_3\u0026prime;.\u003c/p\u003e\u003cp\u003eThe relative levels of mRNA of genes were calculated as results of measurement of mRNA levels for 4 reference genes. The relative values of mRNA level ApoA-I, Abca1, Ntn1, Unc5b, Ccr7 genes regarding the control in percentages were calculated using the formula:\u003c/p\u003e\u003c/div\u003e\u003cdiv class=\"Heading\"\u003e2 \u003csup\u003e(Δ\u003cem\u003eCt\u003c/em\u003e (control) \u0026ndash; Δ\u003cem\u003eCt\u003c/em\u003e (experiment))\u003c/sup\u003e \u0026middot; 100%.\u003c/div\u003e\u003cp\u003eThe results were normalized by the geometric means of the mRNA levels of 4 reference genes (Cyclophilin A, β-actin, RPLP0 and GAPDH), as described before [26].\u003c/p\u003e\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003e2.7. Enzyme-linked immunosorbent assay (ELISA)\u003c/h2\u003e\u003cp\u003eNetrin-1 concentrations in culture supernatants were detected by sandwich ELISA kit (ELK Biotech, China) according to a manufacturer\u0026rsquo;s instruction. Optical density was measured at 450 nm using spectrophotometer Synergy 2 (BioTek, USA).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003e2.8. Flow cytometry\u003c/h2\u003e\u003cp\u003eMacrophages were detached from the plates by accutase (1 h at +\u0026thinsp;37\u0026ordm; C), centrifuged and incubated in the blocking buffer (Hanks solution with 2% FCS) for 30 minutes at room temperature. Then cells were incubated with primary antibodies (antibodies against ApoA-I 1/200 dilution, UNC5B 1/100 dilution, ABCA1 1/50 dilution) in the blocking buffer for 1 h at room temperature on the shaker (ST3, ELMI, Latvia) 500 RPM. After that cells were washed for 3 times and incubated with secondary antibodies labeled with Alexa Fluor647 (1/1000 dilution) or labeled with Rhodamine (1/250 dilution) or labeled iFluor647 (1/1000 dilution) in the blocking buffer for 30 minutes at room temperature on the shaker. The cells incubated with the secondary antibodies but not with the primary antibodies (against ApoA-I, UNC5B, ABCA1) were used as a control of the immune staining specificity (isotype control). We also used cells for CD68 staining with anti-CD68 antibodies (1/50 dilution) labeled with Alexa Fluor647, and isotype control \u0026ndash; cells incubated only with isotypic mouse antibodies labeled Alexa Fluor647 at the same dilution. Cells were washed for 3 times, diluted in 0.2 ml Hanks solution. Cells were analyzed on Epics Altra flow cytofluorimeter (Beckman Coulter, USA). Data were analyzed using program software FCSalyzer (Version 0.9.17, 2019, SourceForge, developed by Sven Mostb\u0026ouml;ck, Vienna, Austria \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://sourceforge.net/projects/fcsalyzer/\u003c/span\u003e\u003cspan address=\"https://sourceforge.net/projects/fcsalyzer/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003e2.9. Statistical analysis\u003c/h2\u003e\u003cp\u003eThe results were presented as a means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard errors of the mean (s.e.m.) if the distribution was normal, and medians\u0026thinsp;\u0026plusmn;\u0026thinsp;95% confidence intervals if the distribution was different from the normal. Normality of distribution was verified with Kolmogorov-Smirnov test. Significance of differences between the groups was estimated using the unpaired two-tailed Student\u0026rsquo;s t-test or Mann-Whitney test. For multiple comparisons we used Dunnett\u0026rsquo;s test and Kruskal-Wallis followed by Dunn\u0026rsquo;s test. The differences between the groups were considered significant at \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Statistical analysis was performed using GraphPad Prism8 software version 8.4.3, 2020, for Windows, San Diego, California, USA, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ewww.graphpad.com\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e3.1. Endogenous ApoA-I increases PBMC macrophage migration induced by C5a independently of ABCA1\u003c/h2\u003e\u003cp\u003eIn the previous studies we have shown that high level of ApoA-I in macrophages stimulates oxLDL uptake [19]. Taking into account the proven anti-atherogenic role of ApoA-I in macrophages [7, 19, 27, 28, 29] and the fact, that increased internalization of oxLDL by macrophages leads to the transformation of macrophages into foam cells [1] these results are contradictory. One possible solution to this contradiction is a putative positive effect of endogenous ApoA-I on the reverse cholesterol transport. However, it has been previously shown that ApoA-I synthesized in macrophages does not significantly contribute to reverse cholesterol transport [7]. Another resolution of this contradiction is a possible involvement of macrophagal ApoA-I in the stimulating migratory activity of macrophages. To test the last assumption we explored RNA interference assay. Transfection of PBMC macrophages by siRNA against human ApoA-I (siApoA-I) led to a significant decrease in ApoA-I mRNA level (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA), as well as the level of ApoA-I bound to the macrophage surface membrane (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Blocking of ApoA-I synthesis greatly reduced the macrophage movement toward C5a in Transwell migration assays (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). These results suggest the stimulatory effect of endogenous ApoA-I on the macrophage migration toward C5a gradient. Considering the known role of ABCA1 as a receptor for the signaling properties of endogenous ApoA-I [7, 27] it was worth testing the possible role of ABCA1 in the ApoA-I-mediated stimulation of macrophage migratory activity. Figures\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC show the efficacy of ABCA1 knockdown: transfection of PBMC macrophages by siRNA against ABCA1 (siABCA1) resulted in a significant decrease in both ABCA1 mRNA and membrane protein levels. However, ABCA1 knockdown had no impact on the macrophage migration toward C5a (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Therefore, endogenous ApoA-I stimulates migratory activity of macrophages independently of ABCA1.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003e3.2. Exogenous ApoA-I reduces migratory activity of PBMC macrophages independently of endogenous ApoA-I\u003c/h2\u003e\u003cp\u003eFormerly published data indicate that exogenously added ApoA-I protein [10\u0026ndash;50 \u0026micro;g/ml] reduces monocyte and macrophage chemotaxis [11, 12]. To compare the effects of exogenous and endogenous ApoA-I in our migration model we have used a lower concentration of exogenous ApoA-I protein compared with the data mentioned above [11, 12] based on the following argumentation. Outside the liver the amount of free ApoA-I is limited. In the arterial wall the sources of free ApoA-I are a local synthesis by macrophages and lymphocytes as well as the dissociation of free ApoA-I from HDL. However the level of local ApoA-I synthesis is significantly lower than in the liver [\u0026lt;\u0026thinsp;10 ng/ml], moreover macrophages secrete significant amounts of ApoA-I only in response to pro-inflammatory cytokines (TNFα and others) [7] HDL complex dissociates to release the free ApoA-I [it is about 75 \u0026micro;g/ml] [30]. Also free ApoA-I is rapidly destroyed by proteases, undergoes oxidation of methionine residues with the formation of amyloid structures [31]. Based on these estimates and consider the short lifespan of free ApoA-I, concentration 0.1 \u0026micro;g/ml seems to us as a physiological dosage of ApoA-I in atherosclerotic plaque. Furthermore ApoA-I peptide mimetic (L-4F) had the biological activity in the suppression of monocyte chemotaxis at concentration 0.01 \u0026micro;g/ml [32].\u003c/p\u003e\u003cp\u003eIn accordance with published data [12] the addition of exogenous ApoA-I to PBMC macrophages diminished their migratory activity toward C5a (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). We wanted to find out whether exogenous and endogenous ApoA-I proteins apply the same regulatory mechanism(s) for macrophage chemotaxis. To this end free ApoA-I was added to PBMC macrophages transfected by siRNA against ApoA-I. It was found, that the addition of exogenous ApoA-I to transfected cells resulted in further suppression of macrophage migratory activity. Therefore, exogenous and endogenous ApoA-I act on macrophage migration through the different mechanisms and, as a result, they have the opposite effects: exogenous ApoA-I downregulates macrophage mobility while endogenous ApoA-I upregulates it.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.3. CCR7 is not a target for endogenous ApoA-I in the upregulation of macrophage migratory activity\u003c/h2\u003e\u003cp\u003eChemokine receptor CCR7 is a key factor in macrophage emigration and its expression is increased in CD68\u003csup\u003e+\u003c/sup\u003e cells capable for chemotaxis from atheroma to lymph nodes [1]. It is plausible to suggest a presumptive mechanism by which endogenous ApoA-I influences on macrophage motility via the upregulation of CCR7 receptor expression. To check this assumption CCR7 mRNA level was assessed by RT-qPCR in PBMC macrophages transfected by siRNA against ApoA-I. Surprisingly, ApoA-I knockdown resulted in the increase of CCR7 mRNA level (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e), suggesting a suppressive role of endogenous ApoA-I in the regulation of CCR7 expression. This effect was ABCA1 independent, since ABCA1 knockdown did not effect on CCR7 mRNA level (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). These data suggest that endogenous ApoA-I stimulates migratory activity of macrophages via some other mechanism, independent of CCR7.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003e3.4. Endogenous ApoA-I downregulates netrin-1 production in macrophages\u003c/h2\u003e\u003cp\u003eAnother hypothesis describing the mechanism of stimulatory effect of endogenous ApoA-I on the macrophage migratory activity based on the suppose, that ApoA-I might repress expression of some migration-inhibitory molecules for macrophages. One of these factors is netrin-1 [33]. To check the possible effect of endogenous ApoA-I on netrin-1 expression in macrophages we have applied RNA interference approach. Knockdown of ApoA-I resulted in an increasing netrin-1 mRNA level (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Under the same conditions the blocking ABCA1 synthesis had no impact on the netrin-1 mRNA level (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Moreover, increasing netrin-1 mRNA level in the PBMC macrophages, transfected by siRNA against ApoA-I, was accompanied by the upregulation of netrin-1 secretion in transfected macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). Hence, endogenous ApoA-I suppresses Ntn1 gene encoding netrin-1 that results in downregulation of netrin-1 secretion. Furthermore, this effect of ApoA-I is independent of ABCA1. Taking together, these data support the netrin-1-dependent mechanism of stimulatory effect of endogenous ApoA-I on migratory activity of macrophages.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003e3.5. Netrin-1 and ApoA-I knockdown mutually block their effects on the migratory activity of macrophages\u003c/h2\u003e\u003cp\u003eNetrin-1 is capable to decrease the cellular migration mediated by C5a on murine macrophage models: cellular line RAW264.7 and macrophages isolated from the red bone marrow of C57BL/6J mice [17]. In our experiments on human PBMC macrophages netrin-1 also decreased C5a-induced migration (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). However, netrin-1 treatment on PBMC macrophages transfected by siRNA against ApoA-I did not result in further reduction of macrophage migratory activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). These data support the key role of ApoA-I-mediated downregulation of Ntn1 gene encoding netrin-1 in the stimulatory effect of endogenous ApoA-I on migratory activity of macrophages.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e3.6. Endogenous ApoA-I does not affect on UNC5B mRNA level, but suppresses UNC5B surface level in macrophages\u003c/p\u003e\u003cp\u003eNetrin-1 acts as a ligand for UNC5B receptor. The binding of netrin-1 with UNC5B on the plasma membrane of macrophages immobilizes them and prevents the emigration into the lymph system [20, 33]. So we tested whether a decline of endogenous ApoA-I level could lead to an increase not only netrin-1 production, but also UNC5B protein level on the macrophage cytoplasmic membrane. For this we measured UNC5B mRNA level and protein amount on the cellular membrane of PBMC macrophages transfected by siRNA against ApoA-I. Knockdown of ApoA-I did not alter UNC5B mRNA level (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA), but increased UNC5B protein content on the cytoplasmic membrane (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Therefore, endogenous ApoA-I interferes with netrin-1 signaling not only by suppression of its synthesis in macrophages, but also by reducing the sensitivity of macrophages to netrin-1.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e3.7. Netrin-1 suppresses ApoA-I synthesis in macrophages\u003c/h2\u003e\u003cp\u003eEarlier we have shown that synthesis of ApoA-I in macrophages is induced by several pro- and anti-inflammatory stimuli: oxLDL [19], insulin [28], hypoxia [34], TNFα [29]. So we checked whether the treatment of macrophages with netrin-1 could regulate ApoA-I gene expression in macrophages. We have demonstrated before that the netrin-1 stimulation [50 ng/ml] for 48 h is required for the increase of netrin-1 and UNC5B mRNA count and UNC5B protein content on cell surface of human macrophages [26], which suggests the existence a positive feedback loop driving the escalation of netrin-1 production by macrophages. Under the same conditions (netrin-1 treatment in concentration 50 ng/ml to macrophages on the third day of differentiation followed by the incubation for 48 h) a decrease in both the mRNA level (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA) and the level of surface membrane bound ApoA-I (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB) in macrophages was observed. Therefore, netrin-1 and ApoA-I are negative mediators for each other in macrophages.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn the preceding study the incubation of macrophages with oxLDL for 24 h enhanced ApoA-I expression on the transcriptional and translational levels [19]. On the other hand, oxLDL also stimulates netrin-1 and UNC5B synthesis in macrophages [15, 20]. In this article we studied the impact of the combined administration by netrin-1 for 48 h [50 ng/ml] and oxLDL for 24 h [100 \u0026micro;g/ml] on ApoA-I surface membrane protein content in macrophages. It was found that netrin-1 did not involve in oxLDL-mediated ApoA-I elevation (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). The obtained results show that the effects of netrin-1 and oxLDL are summed up, and their multidirectional signaling pathways do not overlap and function independently.\u003c/p\u003e\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe very important problem of atherogenesis is oxLDL accumulation in macrophages inside the arterial walls. One of the processes providing the cholesterol removal from the walls of blood vessels is the cholesterol-laden macrophage egress from the atheroma to the lymphatic system [2]. The role of macrophage emigration in the pathogenesis of atherosclerosis is remain unclear. Stimuli for macrophage emigration from atherosclerotic plaque to the peripheral lymph nodes are not fully known. In literature it was noticed that anti-atherogenic properties of exogenous ApoA-I are associated with its effect on monocyte and macrophage migratory activity [12]. In experiments with the exogenous ApoA-I addition [11, 12, 13] or HDL treatment [10, 11] with acute exposure (20\u0026ndash;60 min) or for 24 h to monocytes and macrophages it occurs the chemotaxis suppression. ApoA-I significantly decreases migration induced by CCL2, CCL5, C5a [10, 12]. The mechanism of this suppression is based on the ApoA-I-mediated depletion of cholesterol from cytoplasmic membrane and, as a result, a decrease in lipid rafts [11]. Thus exogenous ApoA-I suppresses monocyte-macrophage chemotaxis and decreases the chronic inflammation. This ability of exogenous ApoA-I prevents the manifestation of disease but does not promote the regression of atherosclerotic vascular lesion. Infiltrated macrophages in the arterial walls continue to actively and uncontrollably uptake oxLDL, transforming into the immobilized foam cells. They participate in the plaque instability due to the secretion of proteases and cytotoxic factors [1, 3].\u003c/p\u003e\u003cp\u003eIn our hands exogenous ApoA-I also repressed PBMC migration (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), which is consistent with literature data (described above). Double gene knockout mice Abca1-/-Abcg1-/- shows the significant impairment in macrophage migration [35]. Nevertheless, knockout of one of these genes Abca1-/- or Abcg1-/- did not significant effect on the migrational regulation that is explained by the overlapping functions of these genes and mutual compensation [35]. Evidently the external treatment of ApoA-I inhibits macrophage movement through the binding with its receptor ABCA1 and then with ABCG1 that lead to the cholesterol pool removal on the outer side plasma membrane.\u003c/p\u003e\u003cp\u003eIn this article we showed for a first time the participation of endogenous ApoA-I in the regulation of human macrophage migration activity. To prove the role of local ApoA-I synthesis in the regulation of macrophage migration we used ApoA-I silencing approach. Blocking of ApoA-I synthesis led to the decrease of macrophage migration along the C5a chemokine gradient, suggesting the positive role of endogenous ApoA-I in the migration activity of macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Perhaps there are the different mechanisms of exogenous and endogenous ApoA-I influence on macrophage motility. Earlier we have shown that endogenously synthesized macrophagal ApoA-I did not make a significant contribution in reverse cholesterol transport [7], so high level of endogenous ApoA-I synthesis did not lead to the depletion of lipid rafts within cytoplasmic membrane of macrophages \u0026ndash; the central process underlying the negative effects of exogenous ApoA-I on macrophage and monocyte migration activities [12, 13]. Moreover, we showed that endogenous ApoA-I enhances macrophage migration ABCA1-independently (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD) in contrast to the exogenous ApoA-I protein, which affects on macrophage and monocyte migration in ABCA1-dependent manner [35]. Hence, ABCA1 do not involved in ApoA-I mediated activation of macrophage mobility.\u003c/p\u003e\u003cp\u003eIt is well known, that chemokine receptor CCR7 is an important factor for leukocyte homing [15]. We assumed that ApoA-I and ABCA1 might be capable to increase CCR7 expression thereby stimulating macrophage migration. However, our data showed that endogenous ApoA-I represses, while ABCA1 does not influence on CCR7 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Therefore, macrophagal ApoA-I regulates their chemotaxis by some another mechanism. Recent studies have also shown that CCR7 activity in macrophages is regulated by the redistribution of the cellular CCR7 pool between cytoplasmic (functionally active CCR7) and intracellular (inactive CCR7) membranes rather than by its expression level [18]. In particular, CCR7 is localized exclusively on the cell surface of pro-inflammatory M1 macrophages, in contrast to anti-inflammatory M2 macrophages, where CCR7 is retained in the membranes of endoplasmic reticulum and does not respond to the chemotactic stimuli from CCL19 or CCL21 chemokines [18]. Moreover subcutaneous ApoA-I injections in ApoE-deficient mice resulted in a decrease in M1 and an increase in M2 macrophages in atheroma, leading to disease resolution [36]. Taken together these data indicate that the CCR7 receptor is not a target for endogenous ApoA-I in activating macrophage migratory activity.\u003c/p\u003e\u003cp\u003eYet another potential target of ApoA-I-mediated stimulation of macrophage migratory activity is netrin-1. In a mouse model of thioglycolate-induced peritonitis netrin-1 promoted macrophage retention in the peritoneum [37]. Deletion of netrin-1 in macrophages of Ldlr\u003csup\u003e\u0026ndash;/\u0026ndash;\u003c/sup\u003e mice induced macrophage emigration and reduced the atherosclerotic lesions [15]. By binding to the UNC5B receptor netrin-1 suppresses chemokine-induced activation of Rac1, which is required for actin polymerization in macrophages [15]. These data suggest pro-atherogenic properties of netrin-1 inside atherosclerotic plaque. Despite this, there is evidence in the literature that high level of netrin-1 in blood plasma has an inverse correlation with the development of atherosclerosis (total volume and mass of plaques), inflammation of arterial walls [38] and arterial calcification [38, 39] dyslipidemia [40]. Low level of plasma netrin-1 was associated with the initiation and progression of human atherosclerosis [38]. The concentration of netrin-1 in the plasma of healthy patients was higher than in patients with coronary artery disease and acute myocardial infarction [38]. Analysis the intracellular level of netrin-1 and UNC5B in macrophages revealed lower levels of these molecules in healthy patients than in patients with coronary artery disease and acute myocardial infarction [40]. Finally, the accumulation of macrophages in the coronary plaque was positively correlated with netrin-1 concentration in macrophages in vivo measured by optical coherence tomography [40]. Authors think that decrease of plasma netrin-1 concentration weakens its inhibitory effect on monocyte infiltration. Monocytes begin better penetrate into the vascular intima, increasing the formation of atherosclerotic plaques [38]. On the other hand, high level of netrin-1 within atherosclerotic lesions results in the inhibition of macrophage emigration and promote plaque growth [15]. Thus, the role of netrin-1 in atherogenesis is controversial and depends on the localization of netrin-1, which coincides with the contradictory effects of exogenous and endogenous ApoA-I on the migratory activity of macrophages. In our experiments we showed that the suppression of ApoA-I synthesis led to the activation of Ntn1 gene expression and the increase in netrin-1 secretion by macrophages (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Considering that netrin-1 inhibited macrophage migration in vitro (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), it can be concluded that the stimulatory effect of endogenous ApoA-I on the macrophage migration is mediated, at least in part, by ApoA-I-dependent suppression of Ntn1 gene. In support of this suggestion, ABCA1 is not involved in either ApoA-I-mediated activation of macrophage migration or ApoA-I-mediated downregulation of Ntn1 gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA).\u003c/p\u003e\u003cp\u003eBlocking ApoA-I synthesis in macrophages not only resulted in increased synthesis and secretion of netrin-1 by macrophages, but also increased the UNC5B receptor level on the surface macrophage membrane enhancing it sensitivity to netrin-1. Interestingly, in contrast to the gene encoding netrin-1, the gene encoding UNC5B receptor is not activated by endogenous ApoA-I in macrophages. Therefore, ApoA-I is involved only in the translation regulation of UNC5B and (or) redistribution of UNC5B between the cytoplasmic and intracellular membranes. The molecular mechanisms underlying ApoA-I involvement in the regulation of netrin-1 and UNC5B expression remain unknown and require further investigations. It is known, that transcriptional factors HIF-1α [16] и NF-κB [20] upregulate netrin-1 and UNC5B expression in macrophages. Considering the pronounced anti-inflammatory properties of endogenous ApoA-I in human macrophages [4, 7, 27], it is possible to offer that endogenous ApoA-I suppresses pro-inflammatory signaling pathways associated with the activation of the transcription factor NF-κB. Moreover, pro-inflammatory stimuli as well as the conditions characteristic of atherosclerotic plaque (hypoxia, high concentration of oxLDL) induce ApoA-I synthesis in macrophages [19, 34] and almost the same conditions activate netrin-1 and UNC5B expression [16, 20]. In the context of atherogenesis, this means that endogenous ApoA-I not only protects macrophages from hyperactivation in response to weak pro-inflammatory stimuli [7] but it can also limits the inhibitory effect of netrin-1 and UNC5B on macrophage migration.\u003c/p\u003e\u003cp\u003eBesides the suppressive effect of endogenous ApoA-I on the synthesis of netrin-1 in macrophages we found the opposite effect: netrin-1 represses ApoA-I expression at the mRNA and protein level (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). This suppression does not interfere with oxLDL-mediated stimulation of ApoA-I level on the macrophage surface which depends on the interactions between oxLDL and TLR4 [19]. This proves that the signaling pathways initiated by oxLDL and netrin-1 treatment on the regulation of ApoA-I protein production in macrophages are independent. However, further research is needed to elucidate the signaling cascades and transcription factors involved in the suppression of ApoA-I expression in macrophages by netrin-1. Perhaps the unstable equilibrium exists in atherosclerotic plaque where any external events can change the delicate dynamic balance between pro-atherogenic netrin-1 and anti-atherogenic ApoA-I. The fluctuations of these molecules and many others will influence on the development or regression of atherosclerotic lesions.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eIn summary, our results demonstrate the different regulatory mechanisms of exogenous and endogenous ApoA-I action on macrophage migration activity. Exogenous ApoA-I synthesized in hepatocytes and enterocytes attenuates macrophage chemotaxis in ABCA1- and ABCG1-dependent manner, whereas endogenous ApoA-I synthesized by macrophages enhances chemotaxis in ABCA1- and, apparently, ABCG1-independent manner. We have established the mechanism of this process: endogenous ApoA-I suppresses the synthesis of the migration inhibitor for immune cells netrin-1 and its receptor UNC5B. In addition, we report the existence of a negative feedback loop between netrin-1 and ApoA-I production. Further studies will be able to clarify some details of the molecular and cellular mechanisms underlying the observed reciprocal regulation of ApoA-I and netrin-1 in human macrophages.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eApoA1, apolipoprotein A-I; ABCA1, ATP-binding cassette transporter A1; ABCG1, ATP-binding cassette transporter G1; CCL2, CCL5, CCL19, CCL21, C-C motif chemokine ligand 2, 5, 19, 21; CCR7, C-C chemokine receptor type 7; C5a, complement component 5a; ELISA, enzyme-linked immunosorbent assay; FCS, fetal calf serum; HDL, high density lipoprotein; HIF-1\u0026alpha;,\u0026nbsp;hypoxia-inducible factor 1-alpha; IP-10, interferon gamma-induced \u003cem\u003eprotein\u003c/em\u003e\u003cem\u003e\u0026nbsp;\u003cem\u003e10;\u0026nbsp;\u003c/em\u003e\u003c/em\u003eLPDS, lipoprotein deficient serum; LPS, lipopolysaccharide;\u0026nbsp;NF-\u0026kappa;B, nuclear factor kappa B; OxLDL, oxidized low-density lipoprotein; PBMC, peripheral blood mononuclear cells; PMA, phorbol 12-myristate 13-acetate; RM, resting macrophages; RT-qPCR, reverse transcription and quantitative polymerase chain reaction; siRNA, small interfering RNA; TLR4, toll-like receptor 4\u003cem\u003e;\u0026nbsp;\u003c/em\u003eTNF\u0026alpha;, tumor necrosis factor-alpha; UNC5B, Unc-5 netrin receptor B.\u003c/p\u003e\n"},{"header":"Declarations","content":"\u003cp\u003eAuthors Contributions\u003c/p\u003e\n\u003cp\u003eThe authors declare that all data were generated in-house and that no paper mill was used.\u003c/p\u003e\n\u003cp\u003eEthics declarations.\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest. All procedures with the participation of human subjects were performed in accordance with the ethical standards of the Institutional and National Ethics Committees and the Helsinki Declaration of 1964 and its following revisions.\u003c/p\u003e\n\u003cp\u003eDeclaration of Competing Interest\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no conflicts of interest with the contents of this article.\u003c/p\u003e\n\u003cp\u003eData availability\u003c/p\u003e\n\u003cp\u003eData will be made available on request.\u003c/p\u003e\n\u003cp\u003eAcknowledgements\u003c/p\u003e\n\u003cp\u003eWe thank PhD V.S. Shavva (Karolinska Institute, Stockholm, Sweden) for training methods,\u003c/p\u003e\n\u003cp\u003eDr. D.A. Tanyanskiy and PhD I.V. Kudriavtsev (Institute of Experimental Medicine, St. Petersburg, Russia) for helpful critical discussion, A.D. Kostromitina (Institute of Experimental Medicine, St. Petersburg, Russia) for the access and assistance with flow cytometer.\u003c/p\u003e\n\u003cp\u003eCRediT authorship contribution statement\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNekrasova E.V.:\u003c/strong\u003e Data curation, Formal analysis, Methodology, Investigation, Writing \u0026ndash; original draft, Writing \u0026ndash; review \u0026amp; editing, Project administration. Serebryakova M.K.: Investigation, Methodology, Resources. Kuzmina D.O., Burnusuz A.V.: Investigation, Methodology. Larionova E.E.: Investigation, Methodology, Formal analysis. Gorbunov N.P.: Methodology, Resources. Orlov S.V.:\u003csup\u003e\u0026nbsp;\u003c/sup\u003eFormal analysis, Supervision, Conceptualization, Funding acquisition, Project administration, Writing \u0026ndash; review and editing.\u003c/p\u003e\n\u003cp\u003eFunding information.\u003c/p\u003e\n\u003cp\u003eThis work was supported by the Russian Science Foundation (project no. 24-25-00181).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMoore, K., Sheedy, F., Fisher, E. (2013). Macrophages in atherosclerosis: a dynamic balance. Nature Reviews Immunology, 13, 709\u0026ndash;721. https://doi.org/10.1038/nri3520\u003c/li\u003e\n\u003cli\u003eOuimet, M., Barrett, T.J., Fisher, E.A. (2019). HDL and Reverse Cholesterol Transport. Circulation Research, 124 (10) 1505\u0026ndash;1518. https://doi.org/10.1161/CIRCRESAHA.119.312617.\u003c/li\u003e\n\u003cli\u003eKang, H., Li, X., Xiong, K., Song, Z., Tian, J., Wen, Y., Sun, A., Deng, X. (2021). The Entry and Egress of Monocytes in Atherosclerosis: A Biochemical and Biomechanical Driven Process. Cardiovascular Therapeutics, 2021, 6642927. https://doi.org/10.1155/2021/6642927\u003c/li\u003e\n\u003cli\u003eShah, P.K., Kaul, S., Nilsson, J., Cercek, B. (2001). Exploiting the vascular protective effects of high-density lipoprotein and its apolipoproteins: an idea whose time for testing is coming. Circulation, 104 (19), 2376-2383. https://doi.org/10.1161/hc4401.098467\u003c/li\u003e\n\u003cli\u003eHaase, C.L., Frikke-Schmidt, R., Nordestgaard, B.G., Kateifides, A.K., Kardassis, D., Nielsen, L.B., Andersen, C.B., K\u0026oslash;ber, L., Johnsen, A.H., Grande, P., Zannis, V.I., Tybjaerg-Hansen, A. (2011). Mutation in APOA1 predicts increased risk of ischaemic heart disease and total mortality without low HDL cholesterol levels. Journal of International Medicine, 270 (2), 136-146. https://doi.org/10.1111/j.1365-2796.2011.02381.x\u003c/li\u003e\n\u003cli\u003eArciello, A., Piccoli, R., Monti, D.M. (2016). Apolipoprotein A-I: the dual face of a protein. FEBS letters, 590 (23), 4171\u0026ndash;4179. https://doi.org/10.1002/1873-3468.12468\u003c/li\u003e\n\u003cli\u003eMogilenko, D.A., Orlov, S.V., Trulioff, A.S., Ivanov, A.V., Nagumanov, V.K., Kudriavtsev, I.V., Shavva, V.S., Tanyanskiy, D.A., Perevozchikov, A.P. (2012). Endogenous apolipoprotein A-I stabilizes ATP-binding cassette transporter A1 and modulates Toll-like receptor 4 signaling in human macrophages. FASEB Journal, 26 (5), 2019-2030. https://doi.org/10.1096/fj.11-193946\u003c/li\u003e\n\u003cli\u003eNekrasova, E., Nikitin, A., Mogilenko, D., Shavva, V., Kudriavtsev, I., Orlov, S. (2019). The endogenous Apolipoprotein A-I enhances the uptake of oxidated low density lipoprotein by macrophages. 87th EAS Congress, 287, E103-E103. https://doi.org/10.1016/j.atherosclerosis.2019.06.299\u003c/li\u003e\n\u003cli\u003eSu, Y.R., Blakemore, J.L., Zhang, Y., Linton, M.F., Fazio, S. (2008). Lentiviral transduction of apoAI into hematopoietic progenitor cells and macrophages: applications to cell therapy of atherosclerosis. Arteriosclerosis, Thrombosis, and Vascular Biology, 28 (8), 1439-1446. https://doi.org/10.1161/ATVBAHA.107.160093\u003c/li\u003e\n\u003cli\u003eBursill, C.A., Castro, M.L., Beattie, D.T., Nakhla, S., van der Vorst, E., Heather, A.K., Barter, P.J., Rye, K.A. (2010). High-density lipoproteins suppress chemokines and chemokine receptors in vitro and in vivo. Arteriosclerosis, thrombosis, and vascular biology, 30 (9), 1773-1778. https://doi.org/10.1161/ATVBAHA.110.211342\u003c/li\u003e\n\u003cli\u003eDiederich, W., Ors\u0026oacute;, E., Drobnik, W., Schmitz, G. (2001). Apolipoprotein AI and HDL3 inhibit spreading of primary human monocytes through a mechanism that involves cholesterol depletion and regulation of CDC42. Atherosclerosis, 159 (2), 313-324. https://doi:10.1016/s0021-9150(01)00518-4\u003c/li\u003e\n\u003cli\u003eIqbal, A.J., Barrett, T.J., Taylor, L., McNeill, E., Manmadhan, A., Recio, C., Carmineri, A., Brodermann, M.H., White, G.E., Cooper, D., DiDonato, J.A., Zamanian-Daryoush, M., Hazen, S.L., Channon, K.M., Greaves, D.R., Fisher, E.A. (2016). Acute exposure to apolipoprotein A1 inhibits macrophage chemotaxis in vitro and monocyte recruitment in vivo. Elife, 5, e15190. https://doi.org/10.7554/eLife.15190\u003c/li\u003e\n\u003cli\u003eWang, L., Chen, W.Z., Wu, M.P. (2010). Apolipoprotein A-I inhibits chemotaxis, adhesion, activation of THP-1 cells and improves the plasma HDL inflammatory index. Cytokine, 49 (2), 194\u0026ndash;200. https://doi.org/10.1016/j.cyto.2009.08.008\u003c/li\u003e\n\u003cli\u003eClaro V., Ferro, A. (2020). Netrin-1: Focus on its role in cardiovascular physiology and atherosclerosis. JRSM Cardiovascular Disiase, 9, 2048004020959574. https://doi.org/10.1177/2048004020959574\u003c/li\u003e\n\u003cli\u003evan Gils, J.M., Derby, M.C., Fernandes, L.R., Ramkhelawon, B., Ray, T.D., Rayner, K.J., Parathath, S., Distel, E., Feig, J.L., Alvarez-Leite, J.I., Rayner, A.J., McDonald, T.O., O\u0026apos;Brien, K.D., Stuart, L.M., Fisher, E.A., Lacy-Hulbert, A., Moore, K.J. (2012). The neuroimmune guidance cue netrin-1 promotes atherosclerosis by inhibiting the emigration of macrophages from plaques. Nature Immunology, 13 (2), 136-143. https://doi:10.1038/ni.2205\u003c/li\u003e\n\u003cli\u003eRamkhelawon, B., Yang, Y., van Gils, J.M., Hewing, B., Rayner, K.J., Parathath, S., Guo, L., Oldebeken, S., Feig, J.L., Fisher, E.A., Moore, K.J. (2013). Hypoxia induces netrin-1 and Unc5b in atherosclerotic plaques: mechanism for macrophage retention and survival. Arteriosclerosis, Thrombosis, and Vascular Biology, 33 (6), 1180-1188. https://doi:10.1161/ATVBAHA.112.301008\u003c/li\u003e\n\u003cli\u003eXuan, W., Qu, Q., Zheng, B., Xiong, S., Fan, G.H. (2015). The chemotaxis of M1 and M2 macrophages is regulated by different chemokines. Journal of Leukocyte Biology, 97 (1), 61-69. https://doi.org/10.1189/jlb.1A0314-170R\u003c/li\u003e\n\u003cli\u003eTaylor, L., Brodermann, M.H., McCaffary, D., Iqbal, A.J., Greaves, D.R. (2016). Netrin-1 Reduces Monocyte and Macrophage Chemotaxis towards the Complement Component C5a. PLoS ONE, 11 (8), e0160685. https://doi:10.1371/journal.pone.0160685\u003c/li\u003e\n\u003cli\u003eNekrasova, E.V., Larionova, E.E., Danko, K., Kuzmina, D.O., Shavva, V.S., Kudriavtsev, I.V., Orlov, S.V. (2021). Regulation of Apolipoprotein A-I Gene Expression in Human Macrophages by Oxidized Low-Density Lipoprotein. Biochemistry (Moscow), 86 (10), 1201-1213. https://doi:10.1134/S0006297921100047\u003c/li\u003e\n\u003cli\u003eYang, X., Zhang, J., Chen, L., Yuan, Z., Qin, X., Wu, Q., Shen, D., He, H., Yu, C. (2018). The role of UNC5b in ox-LDL inhibiting migration of RAW264.7 macrophages and the involvement of CCR7. Biochemical and Biophysical Research Communications, 505 (3), 637-643. https://doi:10.1016/j.bbrc.2018.09.178\u003c/li\u003e\n\u003cli\u003eDolde, X., Karreman, C., Wiechers, M., Schildknecht, S., Leist, M. (2021). Profiling of Human Neural Crest Chemoattractant Activity as a Replacement of Fetal Bovine Serum for In Vitro Chemotaxis Assays. International Journal of Molecular Sciences, 22 (18), 10079. https://doi.org/10.3390/ijms221810079\u003c/li\u003e\n\u003cli\u003eMogilenko, D.A., Dizhe, E.B., Shavva, V.S., Lapikov, I.A., Orlov, S.V., Perevozchikov, A.P. (2009). Role of the nuclear receptors HNF4 alpha, PPAR alpha, and LXRs in the TNF alpha-mediated inhibition of human apolipoprotein A-I gene expression in HepG2 cells. Biochemistry, 48 (50), 11950\u0026ndash;11960. https://doi: 10.1021/bi9015742.\u003c/li\u003e\n\u003cli\u003eShavva, V.S., Mogilenko, D.A., Bogomolova, A.M., Nikitin, A.A., Dizhe, E.B., Efremov, A.M., Oleinikova, G.N., Perevozchikov, A.P., Orlov, S.V. (2016). PPAR\u0026gamma; represses apolipoprotein A-I gene but impedes TNF alpha_mediated ApoA_I downregulation in HepG2 cells. Journal of Cellular Biochemistry, 117 (9), 2010-2022. https://doi: 10.1002/jcb.25498.\u003c/li\u003e\n\u003cli\u003eShavva, V.S., Bogomolova, A.M., Nikitin, A.A., Dizhe, E.B., Tanyanskiy, D.A., Efremov, A.M., Oleinikova, G.N., Perevozchikov, A.P., Orlov, S.V. (2017). Insulin-mediated downregulation of apolipoprotein A-I gene in human hepatoma cell line HepG2: the role of interaction between FOXO1 and LXR\u0026beta; transcription factors. Journal of Cellular Biochemistry, 118 (2), 382-396. https://doi: 10.1002/jcb.25651.\u003c/li\u003e\n\u003cli\u003eK\u0026otilde;ressaar, T., Lepamets, M., Kaplinski, L., Raime, K., Andreson, R., Remm, M. (2018). Primer3_masker: integrating masking of template sequence with primer design software. Bioinformatics, 34 (11), 1937-1938. https://doi:10.1093/bioinformatics/bty036\u003c/li\u003e\n\u003cli\u003eNekrasova, E.V., Orlov, S.V. (2025). Netrin-1 upregulates its own gene expression and unc5b gene, but downregulates ccl19 gene expression in human macrophages THP-1 cell line. Medical Immunology (Russia), 27 (4), 301-308. https://doi: 10.15789/1563-0625-NUI-3151\u003c/li\u003e\n\u003cli\u003eChen, W., Wu, Y., Lu, Q., Wang, S., Xing, D. (2020). Endogenous ApoA-I expression in macrophages: A potential target for protection against atherosclerosis. \u003cem\u003eClinica Chimica Acta\u003c/em\u003e, 505, 55\u0026ndash;59. https://doi: 10.1016/j.cca.2020.02.025\u003c/li\u003e\n\u003cli\u003eNekrasova, E.V., Danko, K.V., Shavva, V.S., Dizhe, E.B., Oleinikova, G.N., Orlov, S.V. (2020). Effect of the insulin on the apolipoprotein A-I gene expression in human macrophages. Medical Academic J\u003cem\u003eournal,\u003c/em\u003e 20 (1), 65-74. https://doi.org/10.17816/MAJ16437\u003c/li\u003e\n\u003cli\u003eShavva, V.S., Mogilenko, D.A., Nekrasova, E.V., Trulioff, A.S., Kudriavtsev, I.V., Larionova, E.E., Babina, A.V., Dizhe, E.B., Missyul, B.V., Orlov, S.V. (2018). Tumor necrosis factor \u0026alpha; stimulates endogenous apolipoprotein A-I expression and secretion by human monocytes and macrophages: role of MAP-kinases, NF-\u0026kappa;B, and nuclear receptors PPAR\u0026alpha; and LXRs. Molecular and Cellular Biochemistry, 448 (1-2), 211-223. https://doi:10.1007/s11010-018-3327-7\u003c/li\u003e\n\u003cli\u003eNeary, R.H., Gowland, E. (1987). Stability of free apolipoprotein A-I concentration in serum, and its measurement in normal and hyperlipidemic subjects. Clinical Chemistry, 33, 1163-1169\u003c/li\u003e\n\u003cli\u003eWitkowski, A., Carta, S., Lu, R., Yokoyama, S., Rubartelli, A., Cavigiolio, G. (2019). Oxidation of methionine residues in human apolipoprotein A-I generates a potent pro-inflammatory molecule. Journal of Biological Chemistry, 294 (10), 3634-3646. https://doi: 10.1074/jbc.RA118.005663.\u003c/li\u003e\n\u003cli\u003eVan Lenten, B.J., Wagner, A.C., Jung, C.L., Ruchala, P., Waring, A.J., Lehrer, R.I., Watson, A.D., Hama, S., Navab, M., Anantharamaiah, G.M., Fogelman, A.M. (2008). Anti-inflammatory apoA-I-mimetic peptides bind oxidized lipids with much higher affinity than human apoA-I. Journal of Lipid Research, 49 (11), 2302-2311. https://doi: 10.1194/jlr.M800075-JLR200.\u003c/li\u003e\n\u003cli\u003eZiegon, L., Schlegel, M. (2021). Netrin-1: A Modulator of Macrophage Driven Acute and Chronic Inflammation. International Journal of Molecular Sciences, 23 (1), 275. https://doi.org/10.3390/ijms23010275\u003c/li\u003e\n\u003cli\u003eBogomolova, A.M., Shavva, V.S., Nikitin, A.A., Nekrasova, E.V., Dizhe, E.B., Larionova, E.E., Kudriavtsev, I.V., Orlov, S.V. (2019). Hypoxia as a Factor Involved in the Regulation of the apoA-1, ABCA1, and Complement C3 Gene Expression in Human Macrophages. Biochemistry (Moscow). 84 (5), 529-539. https://doi:10.1134/S0006297919050079\u003c/li\u003e\n\u003cli\u003ePagler, T.A., Wang, M., Mondal, M., Murphy, A.J., Westerterp, M., Moore, K.J., Maxfield, F.R., Tall, A.R. (2011). Deletion of ABCA1 and ABCG1 impairs macrophage migration because of increased Rac1 signaling. Circulation Research, 108 (2), 194-200. https://doi:10.1161/CIRCRESAHA.110.228619\u003c/li\u003e\n\u003cli\u003e\u003ccite\u003eHewing, B., Parathath, S., Barrett, T., Chung, W.K., Astudillo, Y.M., Hamada, T., \u003c/cite\u003eRamkhelawon, B., Tallant, T.C., Yusufishaq, M.S., Didonato, J.A., Huang, Y., Buffa, J., Berisha, S.Z., Smith, J.D., Hazen, S.L., Fisher, E.A. (2014). \u003ccite\u003eEffects of native and myeloperoxidase-modified apolipoprotein a-I on reverse cholesterol transport and atherosclerosis in mice.\u003c/cite\u003e Arteriosclerosis, Thrombosis, and Vascular Biology,\u003ccite\u003e 34 (4), 779\u0026ndash;789\u003c/cite\u003e\u003ccite\u003e. \u003c/cite\u003ehttps://doi.org/10.1161/ATVBAHA.113.303044\u003c/li\u003e\n\u003cli\u003eRamkhelawon, B., Hennessy, E.J., M\u0026eacute;nager, M., Ray, T.D., Sheedy, F.J., Hutchison, S., Wanschel, A., Oldebeken, S., Geoffrion, M., Spiro, W., Miller, G., McPherson, R., Rayner, K.J., Moore, K.J. (2014). Netrin-1 promotes adipose tissue macrophage retention and insulin resistance in obesity. Nature Medicine, 20 (4), 377-384. https://doi:10.1038/nm.3467\u003c/li\u003e\n\u003cli\u003eBruikman, C., Vreeken, D., Hoogeveen, R., Bom, M., Danad, I., Pinto-Sietsma, S., Zonneveld, A., Knaapen, P., Hovingh, K., Stroes, E., Gils, J. (2020). Netrin-1 and the Grade of Atherosclerosis Are Inversely Correlated in Humans. Arteriosclerosis, thrombosis, and vascular biology, 40 (2), 462-472. https://doi:10.1161/ATVBAHA.119.313624\u003c/li\u003e\n\u003cli\u003eMu\u0026ntilde;oz, J.C., Mart\u0026iacute;n, R., Alonso, C., Guti\u0026eacute;rrez, B., Nieto, M.L. (2017). Relation between serum levels of chemotaxis-related factors and the presence of coronary artery calcification as expression of subclinical atherosclerosis. Clinical Biochemistry, 50 (18), 1048-1055. https://doi:10.1016/j.clinbiochem.2017.08.012\u003c/li\u003e\n\u003cli\u003eFiorelli, S., Cosentino, N., Porro, B., Fabbiocchi, F., Niccoli, G., Fracassi, F., Capra, N., Barbieri, S., Crea, F., Marenzi, G. (2021). Netrin-1 in Atherosclerosis: Relationship between Human Macrophage Intracellular Levels and In Vivo Plaque Morphology. Biomedicines, 9 (2), 168. https://doi.org/10. 3390/biomedicines9020168\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"cell-biochemistry-and-biophysics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cbbi","sideBox":"Learn more about [Cell Biochemistry and Biophysics](http://link.springer.com/journal/12013)","snPcode":"12013","submissionUrl":"https://submission.nature.com/new-submission/12013/3","title":"Cell Biochemistry and Biophysics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"ApoA1, ABCA1, migration, chemotaxis, netrin-1, oxLDL, UNC5B, macrophages, atherosclerosis","lastPublishedDoi":"10.21203/rs.3.rs-7904915/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7904915/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eApolipoprotein A-I (ApoA-I) is the major structural and functional protein of high density lipoprotein (HDL) particles. ApoA-I has antioxidant, anti-inflammatory and atheroprotective properties. Although the main sites of ApoA-I synthesis in humans are liver and small intestine, ApoA-I expression was also found in monocytes and macrophages. In the present study we demonstrate the involvement of macrophagal ApoA-I in the regulation of migratory activity of macrophages induced by C5a. Macrophagal ApoA-I enhances migration via ABCA1-independent mechanism. Exogenous and endogenous (synthesized by macrophages) ApoA-I has the different effects on the macrophage migration, activating the different targets. We have revealed the mechanism of ApoA-I-dependent stimulation of macrophage chemotaxis: endogenous ApoA-I decreases the synthesis and secretion of netrin-1 (an inhibitor of macrophage emigration from the atherosclerotic plaque into the lymph nodes) and also downregulates its receptor UNC5B. Moreover, the incubation of macrophages with netrin-1 reduced mRNA and membrane-associated protein levels of ApoA-I, that proved the existence of negative feedback loop between netrin-1 and ApoA-I in macrophages.\u003c/p\u003e","manuscriptTitle":"Synthesis of Apolipoprotein a-i in Human Macrophages Enhances Their Migratory Activity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-31 16:19:13","doi":"10.21203/rs.3.rs-7904915/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-11-17T19:32:32+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-17T07:09:18+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-07T14:03:31+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-11-03T18:43:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"79365325719764118590509402184875999632","date":"2025-10-28T13:33:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"208709610608738576360823114539925376407","date":"2025-10-24T13:49:57+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-23T18:42:54+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"59932592763058269528837306190423720138","date":"2025-10-23T01:48:57+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"13344347617868135684594210737646902447","date":"2025-10-22T03:30:23+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"24353841901321791798036047083576880567","date":"2025-10-21T18:05:32+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-21T17:37:45+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-21T13:54:18+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-21T13:52:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Biochemistry and Biophysics","date":"2025-10-20T10:46:50+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"cell-biochemistry-and-biophysics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"cbbi","sideBox":"Learn more about [Cell Biochemistry and Biophysics](http://link.springer.com/journal/12013)","snPcode":"12013","submissionUrl":"https://submission.nature.com/new-submission/12013/3","title":"Cell Biochemistry and Biophysics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"eaab7418-33f8-4692-8d2c-dd44317bb167","owner":[],"postedDate":"October 31st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-23T16:02:58+00:00","versionOfRecord":{"articleIdentity":"rs-7904915","link":"https://doi.org/10.1007/s12013-026-02046-8","journal":{"identity":"cell-biochemistry-and-biophysics","isVorOnly":false,"title":"Cell Biochemistry and Biophysics"},"publishedOn":"2026-03-19 15:59:18","publishedOnDateReadable":"March 19th, 2026"},"versionCreatedAt":"2025-10-31 16:19:13","video":"","vorDoi":"10.1007/s12013-026-02046-8","vorDoiUrl":"https://doi.org/10.1007/s12013-026-02046-8","workflowStages":[]},"version":"v1","identity":"rs-7904915","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7904915","identity":"rs-7904915","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00