Novel mechanism of neuronal hypoxia response: HIF-1α/STOML2 mediated PINK1-dependent mitophagy activation against neuronal injury | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Novel mechanism of neuronal hypoxia response: HIF-1α/STOML2 mediated PINK1-dependent mitophagy activation against neuronal injury Jia Liu, Yuning Li, Mengyuan Guo, Zhengming Tian, Qianqian Shao, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6626715/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Feb, 2026 Read the published version in Cell Death Discovery → Version 1 posted 9 You are reading this latest preprint version Abstract Hypoxic stress contributes to brain disorders by causing neuronal injury, making it crucial to understand neuronal hypoxic response mechanisms for disease resistance. In the early stage of stress, neurons initiate a series of compensatory pathways to resist cell damage, but the underlying mechanisms have not been fully elucidated. In this study, we found that hypoxia transiently activates PTEN-induced kinase 1 (PINK1)-dependent mitophagy in the early stage before cell damage and neurological dysfunction. When PINK1-dependent mitophagy is inhibited, neuronal injury begins to exacerbate. Under hypoxia, overexpression of PINK1 can resist neuronal injury, while knockdown of PINK1 aggravates neuronal injury, revealing that PINK1-dependent mitophagy plays a key role in neuronal compensatory hypoxia response. Mechanistically, in the early stage of hypoxia, the nuclear translocation of HIF-1α increases, mediating the transcription of its downstream target molecule STOML2. STOML2 translocates to the outer mitochondrial membrane and participates in the cleavage of PGAM5. These processes initiate PINK1-dependent mitophagy. Knockdown of HIF-1α, STOML2, or PGAM5 inhibits mitophagy and worsens hypoxia-induced dysfunction, highlighting this pathway’s importance. Intermittent hypoxia, a conditioning strategy, stimulates endogenous protection. Notably, it activates the HIF-1α/STOML2 axis, inducing PINK1-dependent mitophagy and protecting neurons. In conclusion, our study reveals a new "self-protection" mechanism of neurons against hypoxic stress and discovers that intermittent hypoxia can effectively activate this pathway to resist neuronal injury, providing new insights into the mechanisms and interventions of hypoxia-related nerve injury. Biological sciences/Neuroscience/Cellular neuroscience Biological sciences/Cell biology/Autophagy/Mitophagy Hypoxia Mitophagy PINK1 HIF-1α Intermittent hypoxia Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Hypoxia is implicated in a variety of central nervous system (CNS) disorders, such as stroke and Parkinson’s disease, suggesting that hypoxia may act as a co-factor in neurological injury 1 . One of the primary mechanisms by which hypoxia induces damage is through the disruption of mitochondrial function 2 . Mitochondria, the cell’s energy powerhouse, are responsible for oxidative phosphorylation, the process that produces ATP (adenosine triphosphate), the cell’s main energy currency 3 . The efficiency of this process is critical for maintaining cellular homeostasis, particularly in energy-demanding tissues like the brain 4 , 5 . Under hypoxic conditions, mitochondrial dysfunction is commonly observed and has been implicated as a central pathogenic factor in several neurological disorders 6 . Dysfunctional mitochondria lead to the accumulation of reactive oxygen species (ROS), changes in mitochondrial dynamics, and eventually, cellular apoptosis 7 , 8 . The accumulation of these damaged mitochondria contributes to neuronal injury in hypoxic environments. Therefore, understanding how hypoxia disrupts mitochondrial function and exploring the cellular mechanisms that mitigate this damage could reveal novel therapeutic targets for hypoxia-related neurological injuries. One critical mechanism for mitigating mitochondrial dysfunction is mitophagy, a selective form of autophagy that plays a crucial role in maintaining mitochondrial quality control by targeting and degrading dysfunctional or damaged mitochondria 9 . Although macroautophagy has similar functions, mitophagy is more specific and effective in dealing with dysfunctional mitochondria 10 . Mitophagy is essential for the proper maintenance of cellular homeostasis, particularly in high-energy-demanding tissues such as neurons and muscles, where the proper functioning of mitochondria is critical for survival 11 , 12 . Currently, a literature review summarizes the factors affecting mitophagy, among which hypoxia is an important way to activate mitophagy 13 . Studies have shown that FUNDC1 (FUN14 domain-containing protein 1) is the classical mitophagy receptor in response to hypoxia 14 , 15 . However, after conducting more literature searches, we found that not only FUNDC1 but also a variety of other factors can mediate the activation of mitophagy under hypoxic stress. For example, PINK1 (PTEN-induced kinase 1), PINK1 is a classical mitophagy receptor 16 . Hypoxia has been shown to promote PINK1-dependent mitophagy 17 . Although it is known that hypoxia promotes PINK1 accumulation and mitophagy activation, the exact mechanisms remain unclear. Understanding these mechanisms could lead to the identification of novel therapeutic targets for treating diseases related to mitochondrial dysfunction under hypoxic stress. In this study, we found that early-stage hypoxia activates PINK1-dependent mitophagy through the HIF-1α/STOML2/PGAM5 pathway, providing neuroprotection against hypoxic damage. To further investigate this, we performed knockdown experiments targeting these molecules. Additionally, we observed that intermittent hypoxia (IH) may also exert neuroprotective effects by activating this mitophagy pathway, offering promising clinical applications in the treatment of neurodegenerative diseases and conditions involving mitochondrial dysfunction. Results Mitophagy undergoes transient compensatory activation in the early hypoxic stage to resist cell damage Adult C57BL mice were continuously exposed to 13% O₂, the oxygen concentration found on the Tibetan Plateau, for 0, 1, 3, and 7 days (Con, H1d, H3d, H7d). And we identify the H1d and H3d as early stages of hypoxia, while H7d as long-term hypoxic treatment. They subsequently underwent behavioral and postmortem histological analyses to assess neurological damage (Fig. 1 A). To evaluate cognitive function, we performed the Novel Object Test, which evaluate novel object exploration and spatial exploration, respectively. Behavioral analysis revealed that while H1d and H3d mice maintained normal cognitive performance, H7d mice exhibited significant cognitive decline, indicating that prolonged hypoxia impairs cognitive function (Fig. 1 B–C). Histological analysis of hippocampal neurons using Nissl staining revealed that neuronal arrangements in the Con, H1d, and H3d groups were orderly, whereas H7d mice exhibited disorganized hippocampal neuronal structures (Fig. 1 D). Quantification of Nissl-positive cells, which represent viable neurons, further confirmed a significant decrease exclusively in the H7d group (Fig. 1 E). These findings align with previous reports of cognitive impairment associated with prolonged hypoxia, suggesting that hypoxia-induced neuronal damage does not occur immediately. Instead, certain protective mechanisms may allow neurons to withstand early-stage hypoxic conditions. To investigate whether mitophagy contributes to hypoxia resistance, we first assessed LC3-I and LC3-II levels in mitochondrial fractions via western blot analysis (Fig. 1 F). The conversion of LC3-I to LC3-II serves as a marker of mitophagy activation. An increase in LC3-II/I ratio indicates mitophagy activation, which was significantly elevated in H1d and H3d groups (Fig. 1 G). This suggests that mitophagy may play a crucial role in protecting against hypoxia-induced cognitive impairment. In summary, mitophagy is activated during the early stages of hypoxia (1–3 days) and may play a critical role in protecting against hypoxia-induced cognitive impairment. To evaluate neuronal responses to hypoxia, we utilized the SH-SY5Y cell line and cultured the cells in 1% O₂. Cell viability was assessed using the CCK-8 assay, which revealed a significant increase in proliferation in the H1h and H2h groups, whereas a significant decline was observed in the H4h group (Fig. 1 H). Cytotoxicity was assessed using the LDH assay, which showed a significant increase in LDH release exclusively in the H4h group (Fig. 1 I). Apoptosis rates were evaluated using PI/Hoechst staining, with analysis revealing a marked increase in the PI/Hoechst ratio in the H4h group (Fig. 1 J–K). These results are consistent with findings in mice, further supporting that hypoxia-induced neuronal damage occurs at a later phase of hypoxic exposure. To assess mitochondrial integrity, cells were stained with mito-tracker dye and analyzed by flow cytometry. The number of mito-tracker-positive (healthy) mitochondria was significantly reduced in the H4h group, indicating mitochondrial damage. To determine whether mitophagy protects against hypoxia-induced damage, we assessed LC3-II/I levels via western blot analysis (Fig. 1 N) and found a significant increase in LC3-II/I in the H2h group (Fig. 1 O). Furthermore, to confirm the functional role of mitophagy, we inhibited mitophagy using mdivi-1. After mdivi-1 treatment, cell viability significantly decreased in the H2h group, suggesting that blocking mitophagy accelerates hypoxia-induced neuronal damage. Moreover, LDH release was significantly increased in H2h as well as H4h, further indicating that mitophagy is critical for neuronal survival under hypoxia. In summary, mitophagy is activated in neurons under hypoxic conditions and plays a protective role in preventing hypoxia-induced damage. PINK1-dependent mitophagy is an indispensable pathway for neurons to resist cell damage induced by hypoxia To identify key mediators of hypoxia-induced mitophagy, we examined whether PINK1 (PTEN-induced kinase 1) regulates mitophagy activation. As a classical mitophagy receptor 16 , PINK1 has been implicated in hypoxia-induced mitophagy, though the precise activation mechanism remains unclear. To address this, we isolated mitochondrial fractions and analyzed PINK1 levels. Western blot analysis revealed a significant increase in mitochondrial PINK1 expression in H1d and H3d mice (Fig. 2 A–B) and H2h cells (Fig. 2 C–D), confirming hypoxia-induced PINK1 upregulation. These findings suggest that PINK1-dependent mitophagy plays a crucial role in hypoxic adaptation. To validate PINK1’s role, mice were administered lentiviral constructs targeting PINK1 and exposed to hypoxia for 3 days before undergoing behavioral and histological analysis (Fig. 2 E). EGFP labeling confirmed successful viral transduction (Fig. 2 F). As expected, iPINK1-H3d mice exhibited cognitive decline, while H3d and vector-H3d mice showed no significant impairment (Fig. 2 G–H). Consistently, Nissl staining revealed significant neuronal damage in iPINK1-H3d mice, whereas H3d and vector-H3d groups maintained hippocampal integrity (Fig. 2 I–J). These findings indicate that PINK1 protects against hypoxia-induced neuronal damage. To confirm the role of PINK1 in mitophagy activation, we performed a western blot analysis to assess its expression in mitochondrial fractions (Fig. 2 K–L). The results showed that PINK1 was significantly upregulated in H3d but was reduced upon inhibition. Next, to determine whether PINK1 mediates hypoxia-induced mitophagy, we analyzed LC3 expression via western blot (Fig. 2 M). Results demonstrated that mitophagy activation, indicated by increased LC3-II/I ratios, was abolished in iPINK1-H3d mice, confirming that hypoxia-induced mitophagy is PINK1-dependent (Fig. 2 N). Meanwhile, after injection of PINK1 overexpressing lentivirus, we found that the increase in mitophagy level would not be inhibited (Figure S1 ), further suggesting that early hypoxia did activate PINK1-dependent mitophagy. Full-length PGAM5 mediates PINK1-dependent mitophagy under hypoxia Early hypoxia activates PINK1-dependent mitophagy to mitigate neuronal injury. However, the mechanism by which PINK1 is stabilized on the outer mitochondrial membrane (OMM) and its functional role remains unclear. Our early research showed that PGAM5 and STOML2 significantly increased after Hypoxia. These two factors are associated with mitophagy 18 . PGAM5 is a serine/threon ine phosphatase on mitochondria 19 , and previous studies suggest that full-length PGAM5 (L-PGAM5) facilitates PINK1 stabilization on the OMM 20 , 21 . To explore the role of L-PGAM5 in early hypoxia-induced mitophagy, we isolated mitochondrial proteins from hippocampal tissues and SH-SY5Y cells for western blot analysis. Results showed a significant increase in mitochondrial L-PGAM5 levels after 3 days of hypoxia in mice (Fig. 3 A-B) and after 1–2 hours of hypoxia in cells (Fig. 3 C-D). To determine whether PINK1 residency on mitochondria is necessary for mitophagy activation, we knocked down PGAM5 in the hippocampus via lentiviral injection (LV-Pgam5-RNAi) using stereotactic surgery and allowed three weeks for viral expression before hypoxia exposure (Fig. 3 E). EGFP labeling confirmed successful viral transduction (Fig. 3 F). As expected, iPGAM5-H3d mice exhibited cognitive decline, whereas H3d and vector-H3d mice showed no significant impairment (Fig. 3 G–H). Nissl staining further revealed significant neuronal damage in iPGAM5-H3d mice, while hippocampal integrity was preserved in H3d and vector-H3d groups (Fig. 3 I–J). These findings suggest that PGAM5 protects against hypoxia-induced neuronal damage. Next, we performed western blot analysis of mitochondrial proteins to confirm PGAM5 knockdown efficiency (Fig. 3 K). L-PGAM5 levels were significantly reduced in the iPGAM5-H3d group, confirming successful knockdown (Fig. 3 L). To investigate whether L-PGAM5 acts upstream of PINK1-dependent mitophagy, we examined mitochondrial PINK1 and LC3 levels in PGAM5-knockdown mice. PGAM5 depletion reversed the hypoxia-induced increase in mitochondrial PINK1 (Fig. 3 M-N) and abolished mitophagy activation (Fig. 3 O-P) in the early stages of hypoxia. These findings indicate that L-PGAM5 upregulation during early hypoxia is crucial for PINK1 stabilization and mitophagy activation (Fig. 3 Q). Increased STOML2 on mitochondria upregulates full-length PGAM5 level Our experimental results confirm that early hypoxia increases mitochondrial L-PGAM5, which activates PINK1-dependent mitophagy to protect against hypoxic injury. However, the mechanism by which L-PGAM5 is stabilized on mitochondria remains unclear. Previous studies suggest that STOML2, which increased significantly after hypoxia, is widely recognized for its role in mitochondrial biogenesis and inner membrane organization during cancer growing 22 – 25 , such as gastric cancer. However, the role of STOML2 in the nervous system is currently unknown. STOML2 has been implicated in PGAM5 cleavage regulation 26 , suggesting a potential upstream role in mitophagy activation. To investigate STOML2’s role, we examined its mitochondrial levels under early hypoxia using western blot. Results showed a significant increase in mitochondrial STOML2 in H3d mice (Fig. 4 A-B) and in SH-SY5Y cells after 2 hours of hypoxia (H2h) (Fig. 4 C-D), suggesting that STOML2 upregulation accompanies L-PGAM5-mediated activation of PINK1-dependent mitophagy. To determine whether STOML2 stabilizes L-PGAM5 on mitochondria, we knocked down STOML2 in the hippocampus (LV-Stoml2-RNAi) via stereotactic injection and allowed three weeks for viral expression before hypoxia exposure (Fig. 4 E). EGFP labeling confirmed successful transduction (Fig. 4 F). As expected, iSTOML2-H3d mice exhibited cognitive decline, whereas H3d and vector-H3d mice showed no significant impairment (Fig. 4 G–H). Nissl staining further revealed significant neuronal damage in iSTOML2-H3d mice, while hippocampal integrity was maintained in H3d and vector-H3d groups (Fig. 4 I–J). These findings suggest that STOML2 protects against hypoxia-induced neuronal damage. To confirm the functional role of STOML2 in mitophagy regulation, we knocked down STOML2 and assessed its mitochondrial protein levels via western blot (Fig. 4 K–L). Western blot analysis confirmed that STOML2 was successfully depleted in iSTOML2-H3d mice. Next, we examined whether STOML2 is necessary for L-PGAM5 stabilization by analyzing mitochondrial protein fractions (Fig. 4 M–N). Meanwhile, our results showed that the knockdown of PGAM5 did not affect STOML2 expression (Figure S2 ). The results showed that STOML2 knockdown reversed the hypoxia-induced increase in L-PGAM5 expression, indicating that STOML2 functions upstream of PGAM5 in mitophagy activation. Next, we examined whether STOML2 upregulation enhances PINK1-dependent mitophagy. Western blot analysis revealed that STOML2 knockdown abolished hypoxia-induced PINK1 accumulation on mitochondria (Fig. 4 O-P) and prevented mitophagy activation (Fig. 4 Q-R). Together, these findings demonstrate that hypoxia-induced STOML2 upregulation stabilizes L-PGAM5, which in turn activates PINK1-dependent mitophagy to confer resistance against hypoxic injury. STOML2 is widely recognized for its role in mitochondrial biogenesis and inner membrane organization during cancer growing[21, 22]. However, our study uncovers a previously unknown function of STOML2 in regulating mitophagy under hypoxia. Hypoxia promotes STOML2 transcription through HIF-1α pathway and thus activates mitophagy To investigate HIF-1α nuclear translocation under hypoxia, we analyzed HIF-1α levels in nuclear fractions from mouse hippocampal tissues and SH-SY5Y cells using western blot. Results showed a significant increase in nuclear HIF-1α in H1d and H3d mice (Fig. 5 A-B) and in H2h cells (Fig. 5 C-D), indicating that early hypoxia promotes HIF-1α nuclear entry. This suggests that hypoxia-induced mitophagy may be HIF-1α-dependent. To confirm HIF-1α’s role, we knocked down HIF-1α in the hippocampus (LV-Hif1α-RNAi) via stereotactic injection and allowed three weeks for viral expression before hypoxia exposure (Fig. 5 E). EGFP labeling confirmed successful transduction (Fig. 5 F). As expected, iHIF-H3d mice exhibited cognitive decline, while H3d and vector-H3d mice showed no significant impairment (Fig. 5 G–H). Nissl staining further revealed significant neuronal damage in iHIF-H3d mice, whereas hippocampal integrity was maintained in H3d and vector-H3d groups (Fig. 5 I–J). These findings indicate that HIF-1α protects against hypoxia-induced neuronal damage. STOML2 has been identified as a novel downstream target of HIF-1α [5]. To assess STOML2 transcriptional regulation by HIF-1α, we measured STOML2 mRNA levels via qPCR. In both mice (H3d) and SH-SY5Y cells (H30min, H60min, H90min), STOML2 mRNA was significantly increased, peaking at 60 minutes of hypoxia (Fig. 6 A-B). Notably, HIF-1α knockdown abolished this upregulation (Fig. 6 C), confirming that HIF-1α nuclear translocation enhances STOML2 transcription. Western blot further verified successful HIF-1α knockdown, as nuclear HIF-1α levels were no longer elevated in iHIF-H3d mice (Fig. 6 D-E). To determine whether HIF-1α acts upstream of mitophagy, we assessed mitochondrial LC3 levels following HIF-1α depletion. Results showed that HIF-1α knockdown abolished mitophagy activation in early hypoxia (Fig. 6 F-G). Collectively, our findings demonstrate that early hypoxia promotes HIF-1α nuclear translocation, which in turn upregulates STOML2 expression. This leads to enhanced L-PGAM5 stability and subsequent activation of PINK1-dependent mitophagy. We propose that the HIF-1α/STOML2/PGAM5/PINK1 axis represents a novel hypoxia-responsive signaling pathway that plays a crucial role in neuronal protection against hypoxic injury (Fig. 6 H). Intermittent hypoxia activates PINK1-dependent mitophagy through the HIF-1α/STOML pathway to resist nerve damage Previous studies suggest that intermittent hypoxia preconditioning (IH) can mitigate cognitive impairment in mice induced by chronic hypoxia. To investigate the underlying protective mechanisms, we examined whether mitophagy contributes to this effect. To assess mitophagy activation, we isolated mitochondrial and cytoplasmic proteins and performed western blot analysis. Results showed a significant increase in LC3-II levels in mitochondria (Fig. 7 A-B), whereas no such increase was observed in the cytoplasmic fraction (Fig. 7 C-D). This indicates that IH triggers mitophagy through the intrinsic pathway during early hypoxia. To determine whether IH activates the HIF-1α/STOML2/PGAM5/PINK1 pathway, we analyzed HIF-1α levels in nuclear fractions and found a significant increase after IH treatment (Fig. 7 E-F). Further western blot analysis of mitochondrial proteins revealed elevated STOML2, L-PGAM5, and PINK1 levels after IH (Fig. 7 G-H, J-L). Additionally, qPCR analysis confirmed a significant increase in STOML2 mRNA following IH (Fig. 7 I). These findings suggest that IH activates the HIF-1α/STOML2/PGAM5/PINK1 signaling pathway. To evaluate whether this pathway contributes to cognitive protection, mice underwent behavioral testing after 7 days of persistent hypoxia following IH treatment. Results from the novel object recognition and Y-maze tests demonstrated that IH significantly alleviated cognitive impairment induced by chronic hypoxia (Fig. 7 M-N). These findings suggest that IH activates the HIF-1α/STOML2/PGAM5/PINK1 pathway, which in turn induces mitophagy and protects against hypoxia-induced cognitive decline. This pathway may serve as a potential neuroprotective mechanism in hypoxic conditions. Discussion Our findings demonstrate that PINK1-dependent mitophagy serves as a critical protective mechanism in early hypoxia, enabling neurons to selectively eliminate damaged mitochondria and maintain cellular homeostasis (Fig. 8 ). This process is initiated by the stabilization of HIF-1α, which upregulates STOML2 expression, leading to the stabilization of PGAM5 and ultimately activating PINK1-mediated mitophagy. Moreover, this study lays the theoretical foundation for exploring IH as a potential clinical intervention to enhance neuroprotection against hypoxic injury. During early-stage hypoxia, mitophagy is transiently activated to remove dysfunctional mitochondria, allowing cells to adapt to reduced oxygen levels. However, prolonged hypoxia alters mitochondrial dynamics and cellular stress responses, causing mitophagy to shift from a protective adaptation to a maladaptive process. If mitophagy is sustained for too long, excessive mitochondrial clearance can lead to bioenergetic failure, cellular dysfunction, and even apoptosis. Previous studies have shown that the phosphorylation of FUNDC1 decreases, resulting in diminished mitophagy activity 27 . Similarly, studies in neurons have demonstrated that BNIP3/NIX-mediated mitophagy is transiently activated but suppressed as cells enter hypoxia-induced apoptosis 28 . These findings highlight the need for a tightly regulated mitophagy response, balancing mitochondrial clearance with cellular survival. In this study, we confirm that the HIF-1α/STOML2/PGAM5/PINK1 pathway functions as a novel and effective mechanism for mitophagy activation under hypoxia, as evidenced by knockdown experiments targeting key molecules in the pathway. Studies have indicated that stabilized HIF-1α enhances mitophagy, reinforcing its role in maintaining mitochondrial homeostasis 29 . Our findings confirm that hypoxia-induced mitophagy is HIF-1α-dependent, underscoring the importance of this regulatory axis. Notably, HIF-1α activation is transient 30 —it peaks within 4–8 hours and declines after 12–24 hours in HeLa cells 31 . HIF-1α provides short-term neuroprotection by promoting blood vessel formation (VEGF) and metabolic adaptation 32 , but prolonged HIF-1α activation can lead to blood-brain barrier disruption and edema 33 . This transient pattern supports our conclusion that mitophagy is similarly short-lived during early hypoxia, with HIF-1α playing a key role in the activation of PINK1-dependent mitophagy. Given that STOML2 functions as a downstream target of HIF-1α 34 , we propose a model in which early hypoxia stabilizes HIF-1α, upregulating STOML2 expression, which in turn maintains PGAM5 stability and activates PINK1-dependent mitophagy. Without PGAM5 stabilization, PINK1 is rapidly degraded, leading to impaired mitophagy and exacerbated neuronal injury under hypoxia 35 . Interestingly, previous studies have also shown that PGAM5 regulates mitochondrial fission by modulating DRP1 phosphorylation 36 , indicating that its function in mitophagy may extend beyond PINK1 stabilization. Future research should explore whether PGAM5 influences mitochondrial dynamics, particularly the balance between mitophagy and mitochondrial fission-fusion regulation in response to hypoxic stress. FUNDC1 is the canonical pathway that increases mitophagy after hypoxia. However, in our model, this process relies on PINK1. Unlike FUNDC1, which directly interacts with LC3 37 , PINK1 recruits Parkin, an E3 ubiquitin ligase, which ubiquitinates mitochondrial proteins to initiate mitophagy 38 . PGAM5 is involved in both pathways but plays distinct roles. PGAM5 functions as a phosphatase, dephosphorylating FUNDC1 to enhance its interaction with LC3 under hypoxia 39 . In contrast, PGAM5 stabilizes PINK1, preventing its degradation and facilitating mitophagy activation. Both pathways are crucial for maintaining mitochondrial homeostasis during hypoxia but operate through different mechanisms. Additionally, PINK1-dependent mitophagy can be triggered by other stressors, such as IH preconditioning. In this study, we observed that after IH preconditioning, no cognitive decline was observed in mice following 7 days of continuous hypoxia. This neuroprotective effect was associated with the activation of the HIF-1α/STOML2/PGAM5 pathway, which subsequently enhanced PINK1-dependent mitophagy, promoting mitochondrial quality control and neuronal survival. Previous studies have shown that IH confers neuroprotection through multiple mechanisms: In models of cerebral ischemia, IH promotes mitochondrial biogenesis and prevents oxidative stress-induced apoptosis 40 ; studies in stroke models have demonstrated that IH increases VEGF expression, improving cerebral blood flow and neuronal survival 41 ; IH preconditioning suppresses pro-inflammatory cytokines (TNF-α, IL-6) and enhances antioxidant enzyme activity 42 , thereby protecting neurons from hypoxia-induced damage. Notably, this study provides the first evidence demonstrating that IH specifically activates the HIF-1α/STOML2/PGAM5 axis, revealing a novel regulatory mechanism linking IH to enhanced mitophagy and neuroprotection. In conclusion, we propose that the stabilization of HIF-1α initiates a novel process that enhances STOML2 expression, promotes PGAM5 stability, and ultimately activates PINK1-dependent mitophagy. This pathway represents a potential new target for treating hypoxia-related diseases. Furthermore, IH may mimic the early stages of hypoxia and serve as an exogenous activator of the HIF-1α/STOML2/PGAM5/PINK1 pathway, providing neuroprotection. Our findings also offer experimental support for the clinical application of IH, although further studies are needed to confirm its therapeutic potential. Materials and Methods Animals Adult male C57BL mice were purchased from SPF Biotechnology (Beijing, China). All animals were housed at room temperature under a 12/12 h light/dark cycle and had free access to food and water. All animal experiments were approved by the Animal Care and Use Committee of the Institute of Animal Management, Capital Medical University (permit no. AEEI-2022-073), and conducted in accordance with ethical requirements and ARRIVE guidelines. Hypoxic treatment All mice were randomly assigned to the control group and each model group. Hypoxic mice were administered hypoxic treatment in a closed hypoxic chamber (China Innovation Instrument Co., Ltd, Ningbo, Zhejiang, China), which accurately set the desired hypoxic concentration and pattern. For chronic hypoxia, mice were treated continuously with 13% O2 for 1, 3, and 7 days. The hypoxic chamber was opened briefly for food and water additions every 3 days. Intermittent hypoxic mice were treated with 10 cycles of 5-min 13% O2 (hypoxia) and 5-min 21% O2 (normoxia) per day for 14 days. The IH-H7d group was followed by an additional continuous 3 days hypoxic treatment after IH treatment. Lentivirus Treatment To investigate the knockdown effects of four target molecules (HIF1α, STOML2, PGAM5, and PINK1), along with a negative control (vector), five lentivirus treatment groups were established, with 10 animals per group: H3d-vector group: Experimental animals were injected with lentivirus via stereotactic injection and subjected to continuous hypoxia (13% O₂) for 3 days. H3d-iHIF group: Lentivirus was administered via stereotactic injection to specifically knock down HIF1α, followed by 3 days of continuous hypoxia (13% O₂). H3d-iSTOML2 group: Lentivirus was injected to selectively knock down STOML2, followed by 3 days of continuous hypoxia (13% O₂). H3d-iPINK1 group: Lentivirus was injected to specifically knock down PINK1, followed by 3 days of continuous hypoxia (13% O₂). Behavioral tests The cognitive function of mice in each group was assessed using novel object recognition and Y-maze tests. For the novel object recognition test, a 40 cm × 40 cm × 40 cm lidless rectangular box was used, with a camera positioned overhead. The experiment consisted of three phases: adaptation, familiarity, and testing. In the adaptation phase, each mouse was placed in the apparatus and allowed to explore freely for 5 minutes to acclimate. In the familiarity phase, two identical objects A (old object) were introduced, and mice were given 5 minutes to explore. In the testing phase, one object A was replaced with a novel object (differing in color and shape), and mice were allowed another 5 minutes of exploration. The time spent interacting with both objects was recorded. The discrimination index was calculated as (Time exploring new object − Time exploring old object) / (Time exploring new + old objects). Mice with baseline cognitive impairments were excluded from behavioral tests. All video recordings were analyzed blindly by researchers not involved in conducting the experiments. The Y maze is typically made of opaque material and shaped like the letter “Y,” consisting of three equal-length arms (usually at a 120° angle). Each arm is approximately 30–40 cm long, 8–10 cm wide, and 15 cm high to prevent animals from escaping. The apparatus is placed in a disturbance-free laboratory environment, and a video tracking system is used to record animal behavior. Before the experiment, animals may be allowed to acclimate to the laboratory environment for about 30 minutes to reduce anxiety. The test begins by placing the animal in the start arm of the Y maze (typically a fixed arm), allowing it to explore freely for a set period (usually 5–10 minutes). During the experiment, the sequence and number of entries into each arm are recorded to calculate the alternation rate. A successful alternation is defined as consecutive entries into three different arms, such as A→B→C. If the animal revisits any arm within three consecutive choices, it is not counted as a successful alternation. The spontaneous alternation rate is calculated as: Spontaneous alternation rate = Number of successful alternations / Total exploration attempts. Nissl staining Brain tissue from the mice were cut into 10 µm sections on a frozen slicer and pasted on a slide. The samples were fixed in 70% ethanol, then sequentially dehydrated in 100%, 90%, 80%, and 70% ethanol for 2 minutes each. After clearing with xylene, the sections were incubated in 1% tar purple (Solarbio, G1430) for 30 minutes. They were then rinsed with distilled water and differentiated in 70% alcohol for several minutes. Dehydration was repeated with 70%, 80%, and 95% ethanol for 2 minutes each, followed by 100% ethanol, before being sealed with neutral gum. Western blots Mouse hippocampus protein lysates were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently immunoblotted onto polyvinylidene difluoride (PVDF) membranes. Membranes were blocked with 5% nonfat milk at room temperature for 1 h. After TBST washing (three times, 5 min per wash), the membranes were incubated with the indicated primary antibodies at 4°C overnight with shaking. The primary antibodies included: COX IV (Proteintech, 23274-1-AP), LaminB1 (Proteintech, 80906-1-RR), HIF-1α (Abcam, ab228649), STOML2 (Proteintech, 60052-1-AP), PGAM5 (Proteintech, 28445-1-AP), PINK1 (Abconal, A11435), LC3 (Sigma,L7543).After incubation, the membranes were washed three times and then incubated at room temperature for 1 h with secondary antibodies, including IRDye 680RD goat anti-mouse IgG (H + L) (Licor, 926-68070), IRDye 680RD goat anti-rabbit IgG (H + L) (Licor, 926-68071), IRDye 800CW goat anti-mouse IgG (H + L) (Licor, 926-32210), IRDye 800CW goat anti-rabbit IgG (H + L) (Licor, 926-32211). PVDF were scanned using a detection system (Odyssey, USA), and band intensities were normalized to Lamin B1 or COX IV. Statistical analyses were performed using ImageJ and GraphPad software. RT-PCR An RNeasy kit (Qiagen, 74104) was used to extract total RNA from mice hippocampal tissue, and then the Transcriptor High Fidelity cDNA synthesis kit (Roche, 5081963001) was used to reverse transcribe the RNA into cDNA. All operations were according to the instructions. The following primers were used: Stoml2 for: TACAAGGCAAGTTACGGTGTGG; Stoml2 rev: GAGAATGCGCTGACATACTGCT; 18S sense: GTAACCCGTTGAACCCCATT; 18S anti: CCATCCAATCGGTAGTAGCG. Cytotoxicity detection Cytotoxicity was detected by the LDH assay (Roche, 4744926001). The powder was dissolved in ddH2O and mixed thoroughly to make the catalytic solution. Then, 250 µL of the catalytic solution was added to the staining solution (11.25 mL) and mixed thoroughly. Then, 100 µL cell supernatant of each group was added to the new 96-well plate. The LDH reaction solution (100 µL) was added with subsequent incubation at room temperature away from light for 30 min. After the incubation, 50 µL stop solution was added to each well and gently mixed for 10 min. The OD value of each well was measured at 490 nm by a microplate reader. Cell Proliferation Assay Cell proliferation was detected by the CCK8 assay(), including followed steps: (1) Standard Curve: Count the cells in the suspension and prepare a cell concentration gradient. Dilute with culture medium to create 4–7 gradients, incubate overnight, then remove the medium and add fresh medium with CCK-8 reagent. After 1 hour, measure OD to create a standard curve. (2) Cell Seeding: Seed cells at the optimal density determined, and incubate overnight. (3) Add CCK-8: Remove the original medium, and add 100 µl of medium with CCK-8. (4) Incubation: Incubate for 1 hour, then transfer the hypoxia group to a 1% O2 incubator. (5) OD Measurement: Measure OD at 450 nm using a microplate reader. Cell death detection PI/Hoechst detection was used to detect the cell death rate. Hoechst labels all cells as blue fluorescence, and PI labels only dead cells as red fluorescence. Therefore, the ratio of red to blue can be used to calculate the cell death rate. After the cells were treated, the original medium was discarded, and the cells were rinsed three times with PBS. The PI (Sigma, P4170) and Hoechst (Sigma, B2261) mixture was added into the cell culture well and incubated at 37°C for 10 min under dark conditions. The cells were removed from the incubator, the mixture of PI and Hoechst was discarded, and the cells were rinsed three times with PBS. Confocal microscopy was used for observation and imaging. MitoTracker Staining and Flow Cytometry Detection Using MitoTracker Green probe kit purchased from Thermo Corporation. (1) Prepare staining solution: dilute 1mM MitoTracker stock in serum-free medium to a working concentration of 150nM. (2) Staining: Once cells reach the desired density, discard the old medium, add pre-warmed MitoTracker solution, and incubate for 10 minutes in the dark. (3) Remove staining solution: Replace with regular medium. (4) Flow cytometry: Digest, centrifuge, and collect cells to create a single-cell suspension. Perform fluorescence detection using a flow cytometer with the FITC channel. Mitophagy Inhibition (1) Preparation of Mdivi-1 Working Solution: Dissolve Mdivi-1 (purchased from Selleck, S7162) in DMSO to prepare a stock solution and store it at -20°C in the dark. Before use, dilute the stock solution in complete culture medium to a final concentration of 10 µM. (2) Cell Culture: Seed cells in a 96-well plate and incubate at 37°C with 5% CO₂ until they reach the appropriate density. (3) Cell Treatment: Remove the original culture medium and replace it with fresh medium containing Mdivi-1 at a ratio of 10 µl per 1 ml of medium. Pre-treat the cells for 30 minutes. (4) Subsequent Assays: Perform cell viability and functional assays such as CCK-8. Statistical analysis Excel and GraphPad Prism 9.0 software were used for data preservation, recording, statistics, and analyses. Image data were analyzed by ImageJ and other software. All results were analyzed using the t-test, one-way ANOVA, and two-way ANOVA as appropriate. Data are expressed as the mean ± standard error (mean ± SEM), with P ≤ 0.05 as a significant difference. In animal behavioral tests, n ≥ 10; in protein detection experiments, such as western blot and immunofluorescence, n ≥ 3. Abbreviations CNS, central nervous system; AD, Alzheimer’s disease; PD, Parkinson’s disease; ROS: reactive oxygen species; PINK1: PTEN-induced kinase 1; OMM: outer mitochondrial membrane; FUNDC1: FUN14 domain-containing 1; I/R: ischemia/reperfusion; IH: intermittent hypoxia; Drp1: dynamin-related protein 1; HIF-1α: hypoxia inducible factor-1α; Declarations Acknowledgments Not applicable. Declaration of Ethics approval All animal experiments were approved by the Animal Care and Use Committee of the Institute of Animal Management, Capital Medical University (permit no. AEEI-2022-073), and conducted in accordance with ethical requirements and ARRIVE guidelines. Consent for publication Consent for publication was obtained from the participants. Declaration of Competing Interest The authors declare no potential conflict to interest. Declaration of Artificial Intelligence (AI) During the writing process of this article, we used ChatGPT-4o for language refinement and optimization to enhance readability and fluency. However, all research content, data analysis, and conclusions were independently conducted by the authors. ChatGPT-4o was solely used for language enhancement and did not influence the scientific integrity or authenticity of the study. Fundings This research was supported by the National Natural Science Foundation of China (Grant number: 32100925), the Beijing Nova Program (Grant number: 20230484436), the Chinese Institutes for Medical Research (Grant number: CX23YQ01), Beijing, Beijing-Tianjin-Hebei Basic Research Cooperation Project (Grant number: S22ZX12032). References Li, S. et al. Preconditioning in neuroprotection: From hypoxia to ischemia. Prog Neurobiol 157 , 79-91, doi:10.1016/j.pneurobio.2017.01.001 (2017). Li, B. et al. Liriodendrin alleviates myocardial ischemia‑reperfusion injury via partially attenuating apoptosis, inflammation and mitochondria damage in rats. Int J Mol Med 55 , doi:10.3892/ijmm.2025.5506 (2025). Alshial, E. E. et al. Mitochondrial dysfunction and neurological disorders: A narrative review and treatment overview. Life Sci 334 , 122257, doi:10.1016/j.lfs.2023.122257 (2023). Schmitt, L. O. & Gaspar, J. M. Obesity-Induced Brain Neuroinflammatory and Mitochondrial Changes. Metabolites 13 , doi:10.3390/metabo13010086 (2023). Hoffmann, L. et al. Cofilin1 oxidation links oxidative distress to mitochondrial demise and neuronal cell death. Cell Death Dis 12 , 953, doi:10.1038/s41419-021-04242-1 (2021). Liang, R. et al. Exercise preconditioning mitigates Ischemia-Reperfusion injury in rats by enhancing mitochondrial respiration. Neuroscience 562 , 64-74, doi:10.1016/j.neuroscience.2024.10.045 (2024). Wen, P. et al. Oxidative stress and mitochondrial impairment: Key drivers in neurodegenerative disorders. Ageing Res Rev 104 , 102667, doi:10.1016/j.arr.2025.102667 (2025). Almeida, V. N. Somatostatin and the pathophysiology of Alzheimer's disease. Ageing Res Rev 96 , 102270, doi:10.1016/j.arr.2024.102270 (2024). Szczepanowska, K. & Trifunovic, A. Mitochondrial matrix proteases: quality control and beyond. Febs j 289 , 7128-7146, doi:10.1111/febs.15964 (2022). Tian, R. Z. et al. Role of Autophagy in Myocardial Remodeling After Myocardial Infarction. J Cardiovasc Pharmacol 85 , 1-11, doi:10.1097/fjc.0000000000001646 (2025). Cheng, Y. et al. Allicin alleviates traumatic brain injury-induced neuroinflammation by enhancing PKC-δ-mediated mitophagy. Phytomedicine 139 , 156500, doi:10.1016/j.phymed.2025.156500 (2025). Meng, Q. et al. A quinolinyl analog of resveratrol improves neuronal damage after ischemic stroke by promoting Parkin-mediated mitophagy. Chin J Nat Med 23 , 214-224, doi:10.1016/s1875-5364(25)60825-9 (2025). Wu, H. & Chen, Q. Hypoxia activation of mitophagy and its role in disease pathogenesis. Antioxid Redox Signal 22 , 1032-1046, doi:10.1089/ars.2014.6204 (2015). Liu, L. et al. Mitochondrial outer-membrane protein FUNDC1 mediates hypoxia-induced mitophagy in mammalian cells. Nat Cell Biol 14 , 177-185, doi:10.1038/ncb2422 (2012). Kuang, Y. et al. Structural basis for the phosphorylation of FUNDC1 LIR as a molecular switch of mitophagy. Autophagy 12 , 2363-2373, doi:10.1080/15548627.2016.1238552 (2016). Ge, P., Dawson, V. L. & Dawson, T. M. PINK1 and Parkin mitochondrial quality control: a source of regional vulnerability in Parkinson's disease. Mol Neurodegener 15 , 20, doi:10.1186/s13024-020-00367-7 (2020). Linqing, L. et al. Hypoxia-induced PINK1/Parkin-mediated mitophagy promotes pulmonary vascular remodeling. Biochem Biophys Res Commun 534 , 568-575, doi:10.1016/j.bbrc.2020.11.040 (2021). Shao, Q. et al. Proteomic Analysis Reveals That Mitochondria Dominate the Hippocampal Hypoxic Response in Mice. Int J Mol Sci 23 , 14094, doi:10.3390/ijms232214094 (2022). Cheng, M. et al. PGAM5: A crucial role in mitochondrial dynamics and programmed cell death. Eur J Cell Biol 100 , 151144, doi:10.1016/j.ejcb.2020.151144 (2021). Zeb, A. et al. A novel role of KEAP1/PGAM5 complex: ROS sensor for inducing mitophagy. Redox Biol 48 , 102186, doi:10.1016/j.redox.2021.102186 (2021). Yan, C. et al. PHB2 (prohibitin 2) promotes PINK1-PRKN/Parkin-dependent mitophagy by the PARL-PGAM5-PINK1 axis. Autophagy 16 , 419-434, doi:10.1080/15548627.2019.1628520 (2020). Fan, R. et al. Stomatin-like protein-2 attenuates macrophage pyroptosis and H9c2 cells apoptosis by protecting mitochondrial function. Biochem Biophys Res Commun 636 , 112-120, doi:10.1016/j.bbrc.2022.10.047 (2022). Christie, D. A. et al. Stomatin-like protein 2 deficiency in T cells is associated with altered mitochondrial respiration and defective CD4+ T cell responses. J Immunol 189 , 4349-4360, doi:10.4049/jimmunol.1103829 (2012). Guo, H. et al. Cytochrome B5 type A alleviates HCC metastasis via regulating STOML2 related autophagy and promoting sensitivity to ruxolitinib. Cell Death Dis 13 , 623, doi:10.1038/s41419-022-05053-8 (2022). Ma, W. et al. STOML2 interacts with PHB through activating MAPK signaling pathway to promote colorectal Cancer proliferation. J Exp Clin Cancer Res 40 , 359, doi:10.1186/s13046-021-02116-0 (2021). Wai, T. et al. The membrane scaffold SLP2 anchors a proteolytic hub in mitochondria containing PARL and the i-AAA protease YME1L. EMBO Rep 17 , 1844-1856, doi:10.15252/embr.201642698 (2016). Tang, T. et al. Src inhibition rescues FUNDC1-mediated neuronal mitophagy in ischaemic stroke. Stroke Vasc Neurol 9 , 367-379, doi:10.1136/svn-2023-002606 (2024). Chen, G. et al. Nix and Nip3 form a subfamily of pro-apoptotic mitochondrial proteins. J Biol Chem 274 , 7-10, doi:10.1074/jbc.274.1.7 (1999). Hu, S. et al. Stabilization of HIF-1α alleviates osteoarthritis via enhancing mitophagy. Cell Death Dis 11 , 481, doi:10.1038/s41419-020-2680-0 (2020). Randle, R. K., Amara, V. R. & Popik, W. IFI16 Is Indispensable for Promoting HIF-1α-Mediated APOL1 Expression in Human Podocytes under Hypoxic Conditions. Int J Mol Sci 25 , 3324, doi:10.3390/ijms25063324 (2024). Jewell, U. R. et al. Induction of HIF-1alpha in response to hypoxia is instantaneous. Faseb j 15 , 1312-1314 (2001). Liu, Y. et al. Normobaric Hyperoxia Extends Neuro- and Vaso-Protection of N-Acetylcysteine in Transient Focal Ischemia. Mol Neurobiol 54 , 3418-3427, doi:10.1007/s12035-016-9932-0 (2017). Zhang, Z., Yan, J. & Shi, H. Role of Hypoxia Inducible Factor 1 in Hyperglycemia-Exacerbated Blood-Brain Barrier Disruption in Ischemic Stroke. Neurobiol Dis 95 , 82-92, doi:10.1016/j.nbd.2016.07.012 (2016). Zheng, Y. et al. STOML2 potentiates metastasis of hepatocellular carcinoma by promoting PINK1-mediated mitophagy and regulates sensitivity to lenvatinib. J Hematol Oncol 14 , 16, doi:10.1186/s13045-020-01029-3 (2021). Lazarou, M. et al. The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. Nature 524 , 309-314, doi:10.1038/nature14893 (2015). Pedrera, L. et al. Ferroptosis triggers mitochondrial fragmentation via Drp1 activation. Cell Death Dis 16 , 40, doi:10.1038/s41419-024-07312-2 (2025). Qin, X. et al. Identification of an autoinhibitory, mitophagy-inducing peptide derived from the transmembrane domain of USP30. Autophagy 18 , 2178-2197, doi:10.1080/15548627.2021.2022360 (2022). Ling, Z. et al. Copper doped bioactive glass promotes matrix vesicles-mediated biomineralization via osteoblast mitophagy and mitochondrial dynamics during bone regeneration. Bioact Mater 46 , 195-212, doi:10.1016/j.bioactmat.2024.12.010 (2025). Li, K., Xia, X. & Tong, Y. Multiple roles of mitochondrial autophagy receptor FUNDC1 in mitochondrial events and kidney disease. Front Cell Dev Biol 12 , 1453365, doi:10.3389/fcell.2024.1453365 (2024). Su, Y., Ke, C., Li, C., Huang, C. & Wan, C. Intermittent hypoxia promotes the recovery of motor function in rats with cerebral ischemia by regulating mitochondrial function. Exp Biol Med (Maywood) 247 , 1364-1378, doi:10.1177/15353702221098962 (2022). Peng, W. et al. Role of intermittent hypoxic training combined with methazolamide in the prevention of high-altitude cerebral edema in rats. Sci Rep 14 , 30252, doi:10.1038/s41598-024-81226-z (2024). Wang, X. et al. Inhibition of NSUN6 protects against intermittent hypoxia-induced oxidative stress and inflammatory response in adipose tissue through suppressing macrophage ferroptosis and M1 polarization. Life Sci 364 , 123433, doi:10.1016/j.lfs.2025.123433 (2025). Supplementary Figures Supplementary figures S1 and S2 are not available with this version. Figure S1. PINK1 overexpression enhances the level of mitophagy. (A) The levels of PINK1 in mice of each group in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. (B) Statistical analysis of PINK1 in mice of each group. (C) The levels of LC3 in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. (D) Statistical analysis of LC3 II/I in mice of each group. Data was analyzed via one-way ANOVA and Tukey’s post-test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. Figure S2. STOML2 acts as an upstream regulator of PGAM5. (A) The levels of STOML2 in mice of each group in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. (B) Statistical analysis of PINK1 in mice of each group. Data was analyzed via one-way ANOVA and Tukey’s post-test. *p < 0.05. Additional Declarations (Not answered) Supplementary Files Supplementaryfile.docx Supplementary file Cite Share Download PDF Status: Published Journal Publication published 21 Feb, 2026 Read the published version in Cell Death Discovery → Version 1 posted Editorial decision: revise 23 Sep, 2025 Review # 1 received at journal 19 Aug, 2025 Reviewer # 3 agreed at journal 27 Jul, 2025 Reviewer # 2 agreed at journal 26 Jul, 2025 Reviewer # 1 agreed at journal 25 Jul, 2025 Reviewers invited by journal 25 Jul, 2025 Submission checks completed at journal 19 Jun, 2025 Editor assigned by journal 18 Jun, 2025 First submitted to journal 18 Jun, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6626715","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":491006162,"identity":"fc9ca660-1649-477c-b251-7c11d6d8276d","order_by":0,"name":"Jia Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/0lEQVRIiWNgGAWjYBACPmYGBoMEBgYefvbGhgMJBv/k2NjbD+DVwgbVIiPZc/jggQ8VB4z5eM4k4NcCpW0MbqQlH5xx5kDiPAkHA/xa2HkMCh7UMPAY3MgxOMzbdie9TYIhgeFHxTY8DuMxMEg4xsAjeeYNSMuz3DbpxgOMPWduE9DCxsDDdxxsC3Num8yBBGbGNkJa/jHwMByAaElnk0gwIKwlsY2BR+BEWgLQ+4cTiNDCVmCQ2Af0S8/hA8BATjNsAwbyQXx+4ec/vM3wxzcGe2BUNn9IMLCRl29vP/jgRwVuLSCLgNHwH1XoAD71QMD8gICCUTAKRsEoGOkAAGjJV/6TN345AAAAAElFTkSuQmCC","orcid":"","institution":"capital medical university","correspondingAuthor":true,"prefix":"","firstName":"Jia","middleName":"","lastName":"Liu","suffix":""},{"id":491006163,"identity":"174a9758-059e-404a-b1e4-fda1fc2394a5","order_by":1,"name":"Yuning Li","email":"","orcid":"https://orcid.org/0000-0002-9605-5692","institution":"Capital Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yuning","middleName":"","lastName":"Li","suffix":""},{"id":491006164,"identity":"e7a8d15b-3ff4-4ef7-88f4-78c1a634d11b","order_by":2,"name":"Mengyuan Guo","email":"","orcid":"","institution":"capital medical university","correspondingAuthor":false,"prefix":"","firstName":"Mengyuan","middleName":"","lastName":"Guo","suffix":""},{"id":491006165,"identity":"da8280e9-bf02-479d-8413-ee7a8984de98","order_by":3,"name":"Zhengming Tian","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhengming","middleName":"","lastName":"Tian","suffix":""},{"id":491006166,"identity":"11009e6f-e250-4572-97ad-a4014e020b3b","order_by":4,"name":"Qianqian Shao","email":"","orcid":"","institution":"capital medical university","correspondingAuthor":false,"prefix":"","firstName":"Qianqian","middleName":"","lastName":"Shao","suffix":""},{"id":491006167,"identity":"6dea6890-e8d1-49f6-afa4-05d5514b3a76","order_by":5,"name":"Yingxia Liu","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yingxia","middleName":"","lastName":"Liu","suffix":""},{"id":491006168,"identity":"226acdcc-fa66-45fa-a9ad-87e670238dc9","order_by":6,"name":"Yakun Gu","email":"","orcid":"","institution":"Second Military Medical University","correspondingAuthor":false,"prefix":"","firstName":"Yakun","middleName":"","lastName":"Gu","suffix":""},{"id":491006169,"identity":"a8cc6720-49cf-445c-a349-1604a4af555c","order_by":7,"name":"Zirui Xu","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zirui","middleName":"","lastName":"Xu","suffix":""},{"id":491006170,"identity":"ac279eff-8a07-466d-ba20-15cbd7601d5a","order_by":8,"name":"Feiyang Jin","email":"","orcid":"","institution":"Capital Medical University","correspondingAuthor":false,"prefix":"","firstName":"Feiyang","middleName":"","lastName":"Jin","suffix":""},{"id":491006171,"identity":"1dbf9f8e-23a1-4b40-8383-5e6ce61aaad3","order_by":9,"name":"Xunming Ji","email":"","orcid":"https://orcid.org/0000-0002-0527-2852","institution":"Capital Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xunming","middleName":"","lastName":"Ji","suffix":""}],"badges":[],"createdAt":"2025-05-09 08:36:35","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6626715/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6626715/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41420-026-02960-z","type":"published","date":"2026-02-21T05:00:00+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":87846057,"identity":"884d8808-5159-46fc-bd84-857b4bfe1c16","added_by":"auto","created_at":"2025-07-29 15:06:27","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":345405,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNeurons resist cellular damage by activating mitophagy in the early stage of hypoxic.\u003c/strong\u003e \u003cstrong\u003e(A) \u003c/strong\u003eSpecific hypoxia patterns. Mice were placed in hypoxic chambers with an O\u003csub\u003e2 \u003c/sub\u003econcentration of 13%. Constant levels of nitrogen and oxygen were maintained to achieve persistent hypoxia.\u003cstrong\u003e (B-C) \u003c/strong\u003eMice were continuously treated with hypoxia for 0,1, 3, and 7 days (Con, H1d, H3d, H7d), and behavioral tests were performed at different time points.\u003cstrong\u003e (B) \u003c/strong\u003eDetection and statistical analysis of Novel Object Test in mice of each group.\u003cstrong\u003e (C) \u003c/strong\u003eDetection and statistical analysis of the Y Maze Test in mice of each group.\u003cstrong\u003e (D)\u003c/strong\u003e Nissl staining was used to evaluate the neuronal arrangement in the hippocampus.\u003cstrong\u003e (E) \u003c/strong\u003eThe levels of Nissl-positive cells in mice of each group.\u003cstrong\u003e (F) \u003c/strong\u003eThe levels of LC3 in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference.\u003cstrong\u003e (G) \u003c/strong\u003eStatistical analysis of LC3 II/I in mice of each group. Statistical analysis of western blot was performed by homogenization, which means setting the value of the Con group as 1.\u003cstrong\u003e (H)\u003c/strong\u003e SY5Y cells were cultured with 21% O\u003csub\u003e2\u003c/sub\u003e(normal) and 1% O\u003csub\u003e2 \u003c/sub\u003e(hypoxia) for 0, 1, 2 and 4h, the cell relative proliferation was detected using the CCK-8 assay.\u003cstrong\u003e (I) \u003c/strong\u003eSY5Y cells were cultured with 1% O\u003csub\u003e2 \u003c/sub\u003efor 0, 1, 2 and 4h, the cytotoxicity was detected using LDH assay.\u003cstrong\u003e (J) \u003c/strong\u003eThe effect of hypoxic treatment on apoptosis was observed using PI/Hoechst staining kit and observed under a fluorescence microscope. \u003cstrong\u003e(K) \u003c/strong\u003eStatistical analysis of PI/Hoechst in different groups.\u003cstrong\u003e (L) \u003c/strong\u003eAfter mito-tracker staining, detected the mitochondria damage in SY5Y cells by flow cytometry. \u003cstrong\u003e(M) \u003c/strong\u003eStatistical analysis of healthy mitochondria counting.\u003cstrong\u003e (N)\u003c/strong\u003e The levels of LC3 in the mitochondrial protein in SY5Y cells were detected by western blotting using COX IV as the internal reference.\u003cstrong\u003e (O) \u003c/strong\u003eStatistical analysis of LC3 II/I in mice of each group. Statistical analysis of western blot was performed by homogenization, which means setting the value of the H0h group as 1. \u003cstrong\u003e(P) \u003c/strong\u003eThe cell relative proliferation was detected using the CCK-8 assay after suppressing mitophagy by mdivi1. Analysis was performed by homogenization, which means setting the value of the normal group as 1.\u003cstrong\u003e (Q) \u003c/strong\u003eThe cytotoxicity was detected using LDH assay after suppressing mitophagy by mdivi1. Data was analyzed via one-way ANOVA and Tukey’s post-test. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Binder31.png","url":"https://assets-eu.researchsquare.com/files/rs-6626715/v1/e29267dffa367b3fd81fc987.png"},{"id":87846987,"identity":"12b19207-154c-4984-a7b9-d974967b7f55","added_by":"auto","created_at":"2025-07-29 15:14:28","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":547057,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePINK1-dependent mitophagy is a necessary pathway helping neurons to resist hypoxic damage. (A) \u003c/strong\u003eMice were continuously treated with hypoxia for 0,1, 3, and 7 days (Con, H1d, H3d, H7d), and the levels of PINK1 in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference.\u003cstrong\u003e (B) \u003c/strong\u003eStatistical analysis of PINK1 in mice of each group. Statistical analysis of western blot was performed by homogenization, which means setting the value of the Con group as 1.\u003cstrong\u003e (C) \u003c/strong\u003eSY5Y cells were continuously treated with hypoxia for 0,1, 2, and 4 hours (H0h, H1h, H2h, H4h), and the levels of PINK1 in the neuron mitochondrial protein were detected by western blotting using COX IV as the internal reference.\u003cstrong\u003e (D) \u003c/strong\u003eStatistical analysis of PINK1 in cells of each group. Statistical analysis of western blot was performed by homogenization, which means setting the value of the H0h group as 1. \u003cstrong\u003e(E-N) \u003c/strong\u003eMice were administered the lentiviral targeting PINK1 and then received continuous hypoxic treatment for 3 days. Mice were grouped in 4 (Con, H3d, iPINK1-H3d and vector-H3d). \u003cstrong\u003e(E) \u003c/strong\u003eThe timeline of lentiviral injection and hypoxic treatment. \u003cstrong\u003e(F)\u003c/strong\u003e Expression of LV-Pink1-RNAi-EGFP in the hippocampus was observed under a fluorescence microscope.\u003cstrong\u003e(G)\u003c/strong\u003e Detection and statistical analysis of Novel Object Test in mice of each group.\u003cstrong\u003e (H) \u003c/strong\u003eDetection and statistical analysis of the Y Maze Test in mice of each group.\u003cstrong\u003e (I) \u003c/strong\u003eNissl staining was used to evaluate the neuronal arrangement in the hippocampus.\u003cstrong\u003e (J) \u003c/strong\u003eThe levels of Nissl-positive cells in mice of each group.\u003cstrong\u003e (K) \u003c/strong\u003eThe levels of PINK1 in mice of each group in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. \u003cstrong\u003e(L)\u003c/strong\u003e Statistical analysis of PINK1 in mice of each group. Statistical analysis of western blot was performed by homogenization, which means setting the value of the Con group as 1.\u003cstrong\u003e (M) \u003c/strong\u003eThe levels of LC3 in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference.\u003cstrong\u003e (N)\u003c/strong\u003e Statistical analysis of LC3 II/I in mice of each group. Data was analyzed via one-way ANOVA and Tukey’s post-test. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Binder32.png","url":"https://assets-eu.researchsquare.com/files/rs-6626715/v1/49a01b71296861a4eb45ad4b.png"},{"id":87848276,"identity":"2bb50382-d75e-458e-9b9b-6a3d8a2fb40f","added_by":"auto","created_at":"2025-07-29 15:30:27","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":487676,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eL-PGAM5 mediates PINK1-dependent mitophagy. (A) \u003c/strong\u003eMice were continuously treated with hypoxia for 0,1, 3, and 7 days (Con, H1d, H3d, H7d), and the levels of PGAM5 in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference.\u003cstrong\u003e (B) \u003c/strong\u003eStatistical analysis of L-PGAM5 in mice of each group. Statistical analysis of western blot was performed by homogenization, which means setting the value of the Con group as 1.\u003cstrong\u003e (C) \u003c/strong\u003eSY5Y cells were continuously treated with hypoxia for 0,1, 2, and 4 hours (H0h, H1h, H2h, H4h), and the levels of PGAM5 in the neuron mitochondrial protein were detected by western blotting using COX IV as the internal reference.\u003cstrong\u003e (D) \u003c/strong\u003eStatistical analysis of L-PGAM5 in cells of each group. Statistical analysis of western blot was performed by homogenization, which means setting the value of the H0h group as 1. \u003cstrong\u003e(E-N) \u003c/strong\u003eMice were administered the lentiviral targeting PGAM5 and then received continuous hypoxic treatment for 3 days. Mice were grouped in 4 (Con, H3d, iPGAM5-H3d and vector-H3d). \u003cstrong\u003e(E) \u003c/strong\u003eThe timeline of lentiviral injection and hypoxic treatment. \u003cstrong\u003e(F)\u003c/strong\u003e Expression of LV-Pgam5-RNAi-EGFP in the hippocampus was observed under a fluorescence microscope.\u003cstrong\u003e (G)\u003c/strong\u003e Detection and statistical analysis of Novel Object Test in mice of each group.\u003cstrong\u003e (H) \u003c/strong\u003eDetection and statistical analysis of the Y Maze Test in mice of each group.\u003cstrong\u003e (I) \u003c/strong\u003eNissl staining was used to evaluate the neuronal arrangement in the hippocampus.\u003cstrong\u003e(J) \u003c/strong\u003eThe levels of Nissl-positive cells in mice of each group.\u003cstrong\u003e (K) \u003c/strong\u003eThe levels of L-PGAM5 in mice of each group in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. \u003cstrong\u003e(L)\u003c/strong\u003e Statistical analysis of L-PGAM5 in mice of each group. \u003cstrong\u003e(M) \u003c/strong\u003eThe levels of PINK1 in mice of each group in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. \u003cstrong\u003e(N) \u003c/strong\u003eStatistical analysis of PINK1 in mice of each group. \u003cstrong\u003e(O) \u003c/strong\u003eThe levels of LC3 in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference.\u003cstrong\u003e (P)\u003c/strong\u003e Statistical analysis of LC3 II/I in mice of each group. \u003cstrong\u003e(Q)\u003c/strong\u003e The mechanism diagram of the pathway. Data was analyzed via one-way ANOVA and Tukey’s post-test. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Binder33.png","url":"https://assets-eu.researchsquare.com/files/rs-6626715/v1/b86b26e9b7ad6f08c6970ab6.png"},{"id":87846985,"identity":"58067d80-9d42-41bb-b65b-855591817372","added_by":"auto","created_at":"2025-07-29 15:14:27","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":685754,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSTOML2 helps L-PGAM5 to be stable on the membrane of mitochondria. (A) \u003c/strong\u003eMice were continuously treated with hypoxia for 0,1, 3, and 7 days (Con, H1d, H3d, H7d), and the levels of STOML2 in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference.\u003cstrong\u003e (B) \u003c/strong\u003eStatistical analysis of STOML2 in mice of each group. Statistical analysis of western blot was performed by homogenization, which means setting the value of the Con group as 1.\u003cstrong\u003e (C) \u003c/strong\u003eSY5Y cells were continuously treated with hypoxia for 0,1, 2, and 4 hours (H0h, H1h, H2h, H4h), and the levels of STOML2 in the neuron mitochondrial protein were detected by western blotting using COX IV as the internal reference.\u003cstrong\u003e (D) \u003c/strong\u003eStatistical analysis of STOML2 in cells of each group. Statistical analysis of western blot was performed by homogenization, which means setting the value of the H0h group as 1. \u003cstrong\u003e(E-N) \u003c/strong\u003eMice were administered the lentiviral targeting STOML2 and then received continuous hypoxic treatment for 3 days. Mice were grouped in 4 (Con, H3d, iSTOML2-H3d and vector-H3d). \u003cstrong\u003e(E) \u003c/strong\u003eThe timeline of lentiviral injection and hypoxic treatment. \u003cstrong\u003e(F)\u003c/strong\u003e Expression of LV-Stoml2-RNAi-EGFP in the hippocampus was observed under a fluorescence microscope.\u003cstrong\u003e (G)\u003c/strong\u003e Detection and statistical analysis of Novel Object Test in mice of each group.\u003cstrong\u003e (H) \u003c/strong\u003eDetection and statistical analysis of the Y Maze Test in mice of each group.\u003cstrong\u003e (I) \u003c/strong\u003eNissl staining was used to evaluate the neuronal arrangement in the hippocampus.\u003cstrong\u003e(J) \u003c/strong\u003eThe levels of Nissl-positive cells in mice of each group.\u003cstrong\u003e (K) \u003c/strong\u003eThe levels of STOML2 in mice of each group in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. \u003cstrong\u003e(L)\u003c/strong\u003eStatistical analysis of STOML2 in mice of each group. \u003cstrong\u003e(M)\u003c/strong\u003e The levels of L-PGAM5 in mice of each group in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. \u003cstrong\u003e(N)\u003c/strong\u003e Statistical analysis of L-PGAM5 in mice of each group. \u003cstrong\u003e(O) \u003c/strong\u003eThe levels of PINK1 in mice of each group in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. \u003cstrong\u003e(P) \u003c/strong\u003eStatistical analysis of PINK1 in mice of each group. \u003cstrong\u003e(Q) \u003c/strong\u003eThe levels of LC3 in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference.\u003cstrong\u003e (R)\u003c/strong\u003e Statistical analysis of LC3 II/I in mice of each group. Data was analyzed via one-way ANOVA and Tukey’s post-test. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Binder34.png","url":"https://assets-eu.researchsquare.com/files/rs-6626715/v1/4b7c331df4a999461ad40716.png"},{"id":87846982,"identity":"69949617-1cfb-4362-8de1-d0aa77009d95","added_by":"auto","created_at":"2025-07-29 15:14:27","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":515024,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eNeurons resist cellular damage by activating HIF-1α. (A) \u003c/strong\u003eMice were continuously treated with hypoxia for 0,1, 3, and 7 days (Con, H1d, H3d, H7d), and the levels of HIF1α in the hippocampus nucleus protein were detected by western blotting using LaminB1 as the internal reference.\u003cstrong\u003e (B) \u003c/strong\u003eStatistical analysis of HIF1α in mice of each group. Statistical analysis of western blot was performed by homogenization, which means setting the value of the Con group as 1.\u003cstrong\u003e (C) \u003c/strong\u003eSY5Y cells were continuously treated with hypoxia for 0,1, 2, and 4 hours (H0h, H1h, H2h, H4h), and the levels of HIF1α in the neuron mitochondrial protein were detected by western blotting using COX IV as the internal reference.\u003cstrong\u003e (D) \u003c/strong\u003eStatistical analysis of HIF1α in cells of each group. Statistical analysis of western blot was performed by homogenization, which means setting the value of the H0h group as 1. \u003cstrong\u003e(E-N) \u003c/strong\u003eMice were administered the lentiviral targeting HIF1α and then received continuous hypoxic treatment for 3 days. Mice were grouped in 4 (Con, H3d, iHIF1α-H3d and vector-H3d). \u003cstrong\u003e(E) \u003c/strong\u003eThe timeline of lentiviral injection and hypoxic treatment. \u003cstrong\u003e(F)\u003c/strong\u003e Expression of LV- Hif1α-RNAi-EGFP in the hippocampus was observed under a fluorescence microscope.\u003cstrong\u003e (G)\u003c/strong\u003e Detection and statistical analysis of Novel Object Test in mice of each group.\u003cstrong\u003e (H) \u003c/strong\u003eDetection and statistical analysis of the Y Maze Test in mice of each group.\u003cstrong\u003e (I) \u003c/strong\u003eNissl staining was used to evaluate the neuronal arrangement in the hippocampus.\u003cstrong\u003e(J) \u003c/strong\u003eThe levels of Nissl-positive cells in mice of each group. Data was analyzed via one-way ANOVA and Tukey’s post-test. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Binder35.png","url":"https://assets-eu.researchsquare.com/files/rs-6626715/v1/a9827ca9a6a0d1882046832b.png"},{"id":87846058,"identity":"c7bc49bd-2d46-49c7-b53b-cb08126d2c0b","added_by":"auto","created_at":"2025-07-29 15:06:27","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":282144,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSTOML2/PGAM5/PINK1 pathway depended on HIF-1α. (A) \u003c/strong\u003eThe levels of STOML2 mRNA were detected by qPCR\u003cstrong\u003e \u003c/strong\u003ein mice of each group. \u003cstrong\u003e(B) \u003c/strong\u003eThe levels of STOML2 mRNA were detected by qPCR\u003cstrong\u003e \u003c/strong\u003ein cells of each group.\u003cstrong\u003e (C-G)\u003c/strong\u003e Mice were administered the lentiviral targeting HIF1α and then received continuous hypoxic treatment for 3 days. Mice were grouped in 4 (Con, H3d, iHIF1α-H3d and vector-H3d). \u003cstrong\u003e(C) \u003c/strong\u003eThe levels of STOML2 mRNA were detected by qPCR\u003cstrong\u003e \u003c/strong\u003ein mice of each group. \u003cstrong\u003e(D) \u003c/strong\u003eThe levels of STOML2 in mice of each group in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. \u003cstrong\u003e(E) \u003c/strong\u003eStatistical analysis of STOML2 in mice of each group. \u003cstrong\u003e(F) \u003c/strong\u003eThe levels of LC3 in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference.\u003cstrong\u003e (G)\u003c/strong\u003e Statistical analysis of LC3 II/I in mice of each group. \u003cstrong\u003e(H)\u003c/strong\u003e The mechanism diagram of the pathway. Data was analyzed via one-way ANOVA and Tukey’s post-test. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Binder36.png","url":"https://assets-eu.researchsquare.com/files/rs-6626715/v1/5043ae5aab1a9d7d6e31e382.png"},{"id":87846986,"identity":"9b2312e8-b338-482b-8bd4-b322c4e21a92","added_by":"auto","created_at":"2025-07-29 15:14:28","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":338460,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIntermittent hypoxic treatment activates PINK1 dependent mitophagy via HIF-1α/STOML2 pathway. (A) \u003c/strong\u003eThe levels of LC3 in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference.\u003cstrong\u003e (B)\u003c/strong\u003e Statistical analysis of LC3 II/I in mice of each group.\u003cstrong\u003e (C) \u003c/strong\u003eThe levels of LC3 in the hippocampus cytoplasmic protein were detected by western blotting using β-actin as the internal reference.\u003cstrong\u003e (G)\u003c/strong\u003e Statistical analysis of LC3 II/I in mice of each group. \u003cstrong\u003e(E) \u003c/strong\u003ethe levels of HIF1α in the hippocampus nucleus protein were detected by western blotting using LaminB1 as the internal reference.\u003cstrong\u003e (F) \u003c/strong\u003eStatistical analysis of HIF1α in mice of each group. \u003cstrong\u003e(G)\u003c/strong\u003e The levels of STOML2 mRNA were detected by qPCR\u003cstrong\u003e \u003c/strong\u003ein mice of each group. \u003cstrong\u003e(H)\u003c/strong\u003e The levels of STOML2 and L-PGAM5 in mice of each group in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. \u003cstrong\u003e(I)\u003c/strong\u003e Statistical analysis of STOML2 in mice of each group. \u003cstrong\u003e(J)\u003c/strong\u003e Statistical analysis of L-PGAM5 in mice of each group. \u003cstrong\u003e(K)\u003c/strong\u003e The levels of PINK1 in mice of each group in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. \u003cstrong\u003e(L)\u003c/strong\u003e Statistical analysis of PINK1 in mice of each group. \u003cstrong\u003e(M-N) \u003c/strong\u003eMice received hypoxic treatment for 7 days after receiving intermittent hypoxic treatment and behavioral tests were performed. Mice were grouped into 3 (Con, H7d, IH+H7d). \u003cstrong\u003e(M)\u003c/strong\u003e Detection and statistical analysis of Novel Object Test in mice of each group.\u003cstrong\u003e (N) \u003c/strong\u003eDetection and statistical analysis of the Y Maze Test in mice of each group. Data was analyzed via paired two-tailed Student’s \u003cem\u003et\u003c/em\u003e-test. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ****p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Binder37.png","url":"https://assets-eu.researchsquare.com/files/rs-6626715/v1/b7ec98b16bed39a072c42fbc.png"},{"id":87847235,"identity":"69372f1b-9b6f-472a-8ccf-149bd9d91f9d","added_by":"auto","created_at":"2025-07-29 15:22:27","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":5713,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA novel neuronal hypoxia response mechanism. \u003c/strong\u003eIn the early stage of hypoxia or intermittent hypoxia treatment, PINK1-dependent mitophagy is activated by HIF-1α/STOML2-signaling to protect against hypoxia-induced neuronal injury.\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-6626715/v1/3c6665d0a1ed92f8c97baa8b.png"},{"id":103637663,"identity":"5e6a6fa4-59be-4133-b59b-db02d1f658fe","added_by":"auto","created_at":"2026-02-28 08:11:23","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4808501,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6626715/v1/cb404f9d-4ecb-49ad-bd23-0287eaa573f4.pdf"},{"id":87847237,"identity":"d10e729b-857a-4c25-b586-4f445bac0c11","added_by":"auto","created_at":"2025-07-29 15:22:28","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":14552294,"visible":true,"origin":"","legend":"Supplementary file","description":"","filename":"Supplementaryfile.docx","url":"https://assets-eu.researchsquare.com/files/rs-6626715/v1/c077683afcdfd5ec44778c71.docx"}],"financialInterests":"(Not answered)","formattedTitle":"Novel mechanism of neuronal hypoxia response: HIF-1α/STOML2 mediated PINK1-dependent mitophagy activation against neuronal injury","fulltext":[{"header":"Introduction","content":"\u003cp\u003eHypoxia is implicated in a variety of central nervous system (CNS) disorders, such as stroke and Parkinson\u0026rsquo;s disease, suggesting that hypoxia may act as a co-factor in neurological injury\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. One of the primary mechanisms by which hypoxia induces damage is through the disruption of mitochondrial function\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. Mitochondria, the cell\u0026rsquo;s energy powerhouse, are responsible for oxidative phosphorylation, the process that produces ATP (adenosine triphosphate), the cell\u0026rsquo;s main energy currency\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. The efficiency of this process is critical for maintaining cellular homeostasis, particularly in energy-demanding tissues like the brain\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e,\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Under hypoxic conditions, mitochondrial dysfunction is commonly observed and has been implicated as a central pathogenic factor in several neurological disorders\u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Dysfunctional mitochondria lead to the accumulation of reactive oxygen species (ROS), changes in mitochondrial dynamics, and eventually, cellular apoptosis\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e,\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u003c/sup\u003e. The accumulation of these damaged mitochondria contributes to neuronal injury in hypoxic environments. Therefore, understanding how hypoxia disrupts mitochondrial function and exploring the cellular mechanisms that mitigate this damage could reveal novel therapeutic targets for hypoxia-related neurological injuries.\u003c/p\u003e\u003cp\u003eOne critical mechanism for mitigating mitochondrial dysfunction is mitophagy, a selective form of autophagy that plays a crucial role in maintaining mitochondrial quality control by targeting and degrading dysfunctional or damaged mitochondria\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Although macroautophagy has similar functions, mitophagy is more specific and effective in dealing with dysfunctional mitochondria\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Mitophagy is essential for the proper maintenance of cellular homeostasis, particularly in high-energy-demanding tissues such as neurons and muscles, where the proper functioning of mitochondria is critical for survival\u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. Currently, a literature review summarizes the factors affecting mitophagy, among which hypoxia is an important way to activate mitophagy\u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Studies have shown that FUNDC1 (FUN14 domain-containing protein 1) is the classical mitophagy receptor in response to hypoxia\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. However, after conducting more literature searches, we found that not only FUNDC1 but also a variety of other factors can mediate the activation of mitophagy under hypoxic stress. For example, PINK1 (PTEN-induced kinase 1), PINK1 is a classical mitophagy receptor\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e. Hypoxia has been shown to promote PINK1-dependent mitophagy\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Although it is known that hypoxia promotes PINK1 accumulation and mitophagy activation, the exact mechanisms remain unclear. Understanding these mechanisms could lead to the identification of novel therapeutic targets for treating diseases related to mitochondrial dysfunction under hypoxic stress.\u003c/p\u003e\u003cp\u003eIn this study, we found that early-stage hypoxia activates PINK1-dependent mitophagy through the HIF-1α/STOML2/PGAM5 pathway, providing neuroprotection against hypoxic damage. To further investigate this, we performed knockdown experiments targeting these molecules. Additionally, we observed that intermittent hypoxia (IH) may also exert neuroprotective effects by activating this mitophagy pathway, offering promising clinical applications in the treatment of neurodegenerative diseases and conditions involving mitochondrial dysfunction.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eMitophagy undergoes transient compensatory activation in the early hypoxic stage to resist cell damage\u003c/h2\u003e\u003cp\u003eAdult C57BL mice were continuously exposed to 13% O₂, the oxygen concentration found on the Tibetan Plateau, for 0, 1, 3, and 7 days (Con, H1d, H3d, H7d). And we identify the H1d and H3d as early stages of hypoxia, while H7d as long-term hypoxic treatment. They subsequently underwent behavioral and postmortem histological analyses to assess neurological damage (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). To evaluate cognitive function, we performed the Novel Object Test, which evaluate novel object exploration and spatial exploration, respectively. Behavioral analysis revealed that while H1d and H3d mice maintained normal cognitive performance, H7d mice exhibited significant cognitive decline, indicating that prolonged hypoxia impairs cognitive function (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB\u0026ndash;C). Histological analysis of hippocampal neurons using Nissl staining revealed that neuronal arrangements in the Con, H1d, and H3d groups were orderly, whereas H7d mice exhibited disorganized hippocampal neuronal structures (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). Quantification of Nissl-positive cells, which represent viable neurons, further confirmed a significant decrease exclusively in the H7d group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). These findings align with previous reports of cognitive impairment associated with prolonged hypoxia, suggesting that hypoxia-induced neuronal damage does not occur immediately. Instead, certain protective mechanisms may allow neurons to withstand early-stage hypoxic conditions. To investigate whether mitophagy contributes to hypoxia resistance, we first assessed LC3-I and LC3-II levels in mitochondrial fractions via western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). The conversion of LC3-I to LC3-II serves as a marker of mitophagy activation. An increase in LC3-II/I ratio indicates mitophagy activation, which was significantly elevated in H1d and H3d groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). This suggests that mitophagy may play a crucial role in protecting against hypoxia-induced cognitive impairment. In summary, mitophagy is activated during the early stages of hypoxia (1\u0026ndash;3 days) and may play a critical role in protecting against hypoxia-induced cognitive impairment.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo evaluate neuronal responses to hypoxia, we utilized the SH-SY5Y cell line and cultured the cells in 1% O₂. Cell viability was assessed using the CCK-8 assay, which revealed a significant increase in proliferation in the H1h and H2h groups, whereas a significant decline was observed in the H4h group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH). Cytotoxicity was assessed using the LDH assay, which showed a significant increase in LDH release exclusively in the H4h group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI). Apoptosis rates were evaluated using PI/Hoechst staining, with analysis revealing a marked increase in the PI/Hoechst ratio in the H4h group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eJ\u0026ndash;K). These results are consistent with findings in mice, further supporting that hypoxia-induced neuronal damage occurs at a later phase of hypoxic exposure. To assess mitochondrial integrity, cells were stained with mito-tracker dye and analyzed by flow cytometry. The number of mito-tracker-positive (healthy) mitochondria was significantly reduced in the H4h group, indicating mitochondrial damage. To determine whether mitophagy protects against hypoxia-induced damage, we assessed LC3-II/I levels via western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eN) and found a significant increase in LC3-II/I in the H2h group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eO). Furthermore, to confirm the functional role of mitophagy, we inhibited mitophagy using mdivi-1. After mdivi-1 treatment, cell viability significantly decreased in the H2h group, suggesting that blocking mitophagy accelerates hypoxia-induced neuronal damage. Moreover, LDH release was significantly increased in H2h as well as H4h, further indicating that mitophagy is critical for neuronal survival under hypoxia. In summary, mitophagy is activated in neurons under hypoxic conditions and plays a protective role in preventing hypoxia-induced damage.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003ePINK1-dependent mitophagy is an indispensable pathway for neurons to resist cell damage induced by hypoxia\u003c/h3\u003e\n\u003cp\u003eTo identify key mediators of hypoxia-induced mitophagy, we examined whether PINK1 (PTEN-induced kinase 1) regulates mitophagy activation. As a classical mitophagy receptor \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, PINK1 has been implicated in hypoxia-induced mitophagy, though the precise activation mechanism remains unclear. To address this, we isolated mitochondrial fractions and analyzed PINK1 levels. Western blot analysis revealed a significant increase in mitochondrial PINK1 expression in H1d and H3d mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA\u0026ndash;B) and H2h cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC\u0026ndash;D), confirming hypoxia-induced PINK1 upregulation. These findings suggest that PINK1-dependent mitophagy plays a crucial role in hypoxic adaptation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo validate PINK1\u0026rsquo;s role, mice were administered lentiviral constructs targeting PINK1 and exposed to hypoxia for 3 days before undergoing behavioral and histological analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). EGFP labeling confirmed successful viral transduction (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). As expected, iPINK1-H3d mice exhibited cognitive decline, while H3d and vector-H3d mice showed no significant impairment (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG\u0026ndash;H). Consistently, Nissl staining revealed significant neuronal damage in iPINK1-H3d mice, whereas H3d and vector-H3d groups maintained hippocampal integrity (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI\u0026ndash;J). These findings indicate that PINK1 protects against hypoxia-induced neuronal damage.\u003c/p\u003e\u003cp\u003eTo confirm the role of PINK1 in mitophagy activation, we performed a western blot analysis to assess its expression in mitochondrial fractions (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eK\u0026ndash;L). The results showed that PINK1 was significantly upregulated in H3d but was reduced upon inhibition. Next, to determine whether PINK1 mediates hypoxia-induced mitophagy, we analyzed LC3 expression via western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eM). Results demonstrated that mitophagy activation, indicated by increased LC3-II/I ratios, was abolished in iPINK1-H3d mice, confirming that hypoxia-induced mitophagy is PINK1-dependent (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eN). Meanwhile, after injection of PINK1 overexpressing lentivirus, we found that the increase in mitophagy level would not be inhibited (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e), further suggesting that early hypoxia did activate PINK1-dependent mitophagy.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\n\u003ch3\u003eFull-length PGAM5 mediates PINK1-dependent mitophagy under hypoxia\u003c/h3\u003e\n\u003cp\u003eEarly hypoxia activates PINK1-dependent mitophagy to mitigate neuronal injury. However, the mechanism by which PINK1 is stabilized on the outer mitochondrial membrane (OMM) and its functional role remains unclear.\u003c/p\u003e\u003cp\u003eOur early research showed that PGAM5 and STOML2 significantly increased after Hypoxia. These two factors are associated with mitophagy\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. PGAM5 is a serine/threon ine phosphatase on mitochondria\u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e, and previous studies suggest that full-length PGAM5 (L-PGAM5) facilitates PINK1 stabilization on the OMM\u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e,\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. To explore the role of L-PGAM5 in early hypoxia-induced mitophagy, we isolated mitochondrial proteins from hippocampal tissues and SH-SY5Y cells for western blot analysis. Results showed a significant increase in mitochondrial L-PGAM5 levels after 3 days of hypoxia in mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B) and after 1\u0026ndash;2 hours of hypoxia in cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-D).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo determine whether PINK1 residency on mitochondria is necessary for mitophagy activation, we knocked down PGAM5 in the hippocampus via lentiviral injection (LV-Pgam5-RNAi) using stereotactic surgery and allowed three weeks for viral expression before hypoxia exposure (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eE). EGFP labeling confirmed successful viral transduction (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). As expected, iPGAM5-H3d mice exhibited cognitive decline, whereas H3d and vector-H3d mice showed no significant impairment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eG\u0026ndash;H). Nissl staining further revealed significant neuronal damage in iPGAM5-H3d mice, while hippocampal integrity was preserved in H3d and vector-H3d groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eI\u0026ndash;J). These findings suggest that PGAM5 protects against hypoxia-induced neuronal damage.\u003c/p\u003e\u003cp\u003eNext, we performed western blot analysis of mitochondrial proteins to confirm PGAM5 knockdown efficiency (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eK). L-PGAM5 levels were significantly reduced in the iPGAM5-H3d group, confirming successful knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eL). To investigate whether L-PGAM5 acts upstream of PINK1-dependent mitophagy, we examined mitochondrial PINK1 and LC3 levels in PGAM5-knockdown mice. PGAM5 depletion reversed the hypoxia-induced increase in mitochondrial PINK1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eM-N) and abolished mitophagy activation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eO-P) in the early stages of hypoxia. These findings indicate that L-PGAM5 upregulation during early hypoxia is crucial for PINK1 stabilization and mitophagy activation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eQ).\u003c/p\u003e\n\u003ch3\u003eIncreased STOML2 on mitochondria upregulates full-length PGAM5 level\u003c/h3\u003e\n\u003cp\u003eOur experimental results confirm that early hypoxia increases mitochondrial L-PGAM5, which activates PINK1-dependent mitophagy to protect against hypoxic injury. However, the mechanism by which L-PGAM5 is stabilized on mitochondria remains unclear. Previous studies suggest that STOML2, which increased significantly after hypoxia, is widely recognized for its role in mitochondrial biogenesis and inner membrane organization during cancer growing\u003csup\u003e\u003cspan additionalcitationids=\"CR23 CR24\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e, such as gastric cancer. However, the role of STOML2 in the nervous system is currently unknown. STOML2 has been implicated in PGAM5 cleavage regulation \u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e, suggesting a potential upstream role in mitophagy activation.\u003c/p\u003e\u003cp\u003eTo investigate STOML2\u0026rsquo;s role, we examined its mitochondrial levels under early hypoxia using western blot. Results showed a significant increase in mitochondrial STOML2 in H3d mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B) and in SH-SY5Y cells after 2 hours of hypoxia (H2h) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eC-D), suggesting that STOML2 upregulation accompanies L-PGAM5-mediated activation of PINK1-dependent mitophagy.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo determine whether STOML2 stabilizes L-PGAM5 on mitochondria, we knocked down STOML2 in the hippocampus (LV-Stoml2-RNAi) via stereotactic injection and allowed three weeks for viral expression before hypoxia exposure (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). EGFP labeling confirmed successful transduction (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). As expected, iSTOML2-H3d mice exhibited cognitive decline, whereas H3d and vector-H3d mice showed no significant impairment (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eG\u0026ndash;H). Nissl staining further revealed significant neuronal damage in iSTOML2-H3d mice, while hippocampal integrity was maintained in H3d and vector-H3d groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eI\u0026ndash;J). These findings suggest that STOML2 protects against hypoxia-induced neuronal damage.\u003c/p\u003e\u003cp\u003eTo confirm the functional role of STOML2 in mitophagy regulation, we knocked down STOML2 and assessed its mitochondrial protein levels via western blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eK\u0026ndash;L). Western blot analysis confirmed that STOML2 was successfully depleted in iSTOML2-H3d mice. Next, we examined whether STOML2 is necessary for L-PGAM5 stabilization by analyzing mitochondrial protein fractions (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eM\u0026ndash;N). Meanwhile, our results showed that the knockdown of PGAM5 did not affect STOML2 expression (Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). The results showed that STOML2 knockdown reversed the hypoxia-induced increase in L-PGAM5 expression, indicating that STOML2 functions upstream of PGAM5 in mitophagy activation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eNext, we examined whether STOML2 upregulation enhances PINK1-dependent mitophagy. Western blot analysis revealed that STOML2 knockdown abolished hypoxia-induced PINK1 accumulation on mitochondria (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eO-P) and prevented mitophagy activation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eQ-R). Together, these findings demonstrate that hypoxia-induced STOML2 upregulation stabilizes L-PGAM5, which in turn activates PINK1-dependent mitophagy to confer resistance against hypoxic injury. STOML2 is widely recognized for its role in mitochondrial biogenesis and inner membrane organization during cancer growing[21, 22]. However, our study uncovers a previously unknown function of STOML2 in regulating mitophagy under hypoxia.\u003c/p\u003e\n\u003ch3\u003eHypoxia promotes STOML2 transcription through HIF-1α pathway and thus activates mitophagy\u003c/h3\u003e\n\u003cp\u003eTo investigate HIF-1α nuclear translocation under hypoxia, we analyzed HIF-1α levels in nuclear fractions from mouse hippocampal tissues and SH-SY5Y cells using western blot. Results showed a significant increase in nuclear HIF-1α in H1d and H3d mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-B) and in H2h cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eC-D), indicating that early hypoxia promotes HIF-1α nuclear entry. This suggests that hypoxia-induced mitophagy may be HIF-1α-dependent.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo confirm HIF-1α\u0026rsquo;s role, we knocked down HIF-1α in the hippocampus (LV-Hif1α-RNAi) via stereotactic injection and allowed three weeks for viral expression before hypoxia exposure (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). EGFP labeling confirmed successful transduction (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eF). As expected, iHIF-H3d mice exhibited cognitive decline, while H3d and vector-H3d mice showed no significant impairment (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eG\u0026ndash;H). Nissl staining further revealed significant neuronal damage in iHIF-H3d mice, whereas hippocampal integrity was maintained in H3d and vector-H3d groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e5\u003c/span\u003eI\u0026ndash;J). These findings indicate that HIF-1α protects against hypoxia-induced neuronal damage.\u003c/p\u003e\u003cp\u003eSTOML2 has been identified as a novel downstream target of HIF-1α [5]. To assess STOML2 transcriptional regulation by HIF-1α, we measured STOML2 mRNA levels via qPCR. In both mice (H3d) and SH-SY5Y cells (H30min, H60min, H90min), STOML2 mRNA was significantly increased, peaking at 60 minutes of hypoxia (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eA-B). Notably, HIF-1α knockdown abolished this upregulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eC), confirming that HIF-1α nuclear translocation enhances STOML2 transcription.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eWestern blot further verified successful HIF-1α knockdown, as nuclear HIF-1α levels were no longer elevated in iHIF-H3d mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eD-E). To determine whether HIF-1α acts upstream of mitophagy, we assessed mitochondrial LC3 levels following HIF-1α depletion. Results showed that HIF-1α knockdown abolished mitophagy activation in early hypoxia (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eF-G).\u003c/p\u003e\u003cp\u003eCollectively, our findings demonstrate that early hypoxia promotes HIF-1α nuclear translocation, which in turn upregulates STOML2 expression. This leads to enhanced L-PGAM5 stability and subsequent activation of PINK1-dependent mitophagy. We propose that the HIF-1α/STOML2/PGAM5/PINK1 axis represents a novel hypoxia-responsive signaling pathway that plays a crucial role in neuronal protection against hypoxic injury (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e6\u003c/span\u003eH).\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eIntermittent hypoxia activates PINK1-dependent mitophagy through the HIF-1α/STOML pathway to resist nerve damage\u003c/h2\u003e\u003cp\u003ePrevious studies suggest that intermittent hypoxia preconditioning (IH) can mitigate cognitive impairment in mice induced by chronic hypoxia. To investigate the underlying protective mechanisms, we examined whether mitophagy contributes to this effect. To assess mitophagy activation, we isolated mitochondrial and cytoplasmic proteins and performed western blot analysis. Results showed a significant increase in LC3-II levels in mitochondria (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eA-B), whereas no such increase was observed in the cytoplasmic fraction (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eC-D). This indicates that IH triggers mitophagy through the intrinsic pathway during early hypoxia.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eTo determine whether IH activates the HIF-1α/STOML2/PGAM5/PINK1 pathway, we analyzed HIF-1α levels in nuclear fractions and found a significant increase after IH treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eE-F). Further western blot analysis of mitochondrial proteins revealed elevated STOML2, L-PGAM5, and PINK1 levels after IH (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eG-H, J-L). Additionally, qPCR analysis confirmed a significant increase in STOML2 mRNA following IH (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eI). These findings suggest that IH activates the HIF-1α/STOML2/PGAM5/PINK1 signaling pathway.\u003c/p\u003e\u003cp\u003eTo evaluate whether this pathway contributes to cognitive protection, mice underwent behavioral testing after 7 days of persistent hypoxia following IH treatment. Results from the novel object recognition and Y-maze tests demonstrated that IH significantly alleviated cognitive impairment induced by chronic hypoxia (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e7\u003c/span\u003eM-N).\u003c/p\u003e\u003cp\u003eThese findings suggest that IH activates the HIF-1α/STOML2/PGAM5/PINK1 pathway, which in turn induces mitophagy and protects against hypoxia-induced cognitive decline. This pathway may serve as a potential neuroprotective mechanism in hypoxic conditions.\u003c/p\u003e\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur findings demonstrate that PINK1-dependent mitophagy serves as a critical protective mechanism in early hypoxia, enabling neurons to selectively eliminate damaged mitochondria and maintain cellular homeostasis (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e8\u003c/span\u003e). This process is initiated by the stabilization of HIF-1α, which upregulates STOML2 expression, leading to the stabilization of PGAM5 and ultimately activating PINK1-mediated mitophagy. Moreover, this study lays the theoretical foundation for exploring IH as a potential clinical intervention to enhance neuroprotection against hypoxic injury.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eDuring early-stage hypoxia, mitophagy is transiently activated to remove dysfunctional mitochondria, allowing cells to adapt to reduced oxygen levels. However, prolonged hypoxia alters mitochondrial dynamics and cellular stress responses, causing mitophagy to shift from a protective adaptation to a maladaptive process. If mitophagy is sustained for too long, excessive mitochondrial clearance can lead to bioenergetic failure, cellular dysfunction, and even apoptosis. Previous studies have shown that the phosphorylation of FUNDC1 decreases, resulting in diminished mitophagy activity \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. Similarly, studies in neurons have demonstrated that BNIP3/NIX-mediated mitophagy is transiently activated but suppressed as cells enter hypoxia-induced apoptosis \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. These findings highlight the need for a tightly regulated mitophagy response, balancing mitochondrial clearance with cellular survival. In this study, we confirm that the HIF-1α/STOML2/PGAM5/PINK1 pathway functions as a novel and effective mechanism for mitophagy activation under hypoxia, as evidenced by knockdown experiments targeting key molecules in the pathway.\u003c/p\u003e\u003cp\u003eStudies have indicated that stabilized HIF-1α enhances mitophagy, reinforcing its role in maintaining mitochondrial homeostasis\u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. Our findings confirm that hypoxia-induced mitophagy is HIF-1α-dependent, underscoring the importance of this regulatory axis. Notably, HIF-1α activation is transient \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e\u0026mdash;it peaks within 4\u0026ndash;8 hours and declines after 12\u0026ndash;24 hours in HeLa cells \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. HIF-1α provides short-term neuroprotection by promoting blood vessel formation (VEGF) and metabolic adaptation\u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e, but prolonged HIF-1α activation can lead to blood-brain barrier disruption and edema\u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. This transient pattern supports our conclusion that mitophagy is similarly short-lived during early hypoxia, with HIF-1α playing a key role in the activation of PINK1-dependent mitophagy.\u003c/p\u003e\u003cp\u003eGiven that STOML2 functions as a downstream target of HIF-1α\u003csup\u003e34\u003c/sup\u003e, we propose a model in which early hypoxia stabilizes HIF-1α, upregulating STOML2 expression, which in turn maintains PGAM5 stability and activates PINK1-dependent mitophagy. Without PGAM5 stabilization, PINK1 is rapidly degraded, leading to impaired mitophagy and exacerbated neuronal injury under hypoxia\u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e. Interestingly, previous studies have also shown that PGAM5 regulates mitochondrial fission by modulating DRP1 phosphorylation\u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e, indicating that its function in mitophagy may extend beyond PINK1 stabilization. Future research should explore whether PGAM5 influences mitochondrial dynamics, particularly the balance between mitophagy and mitochondrial fission-fusion regulation in response to hypoxic stress.\u003c/p\u003e\u003cp\u003eFUNDC1 is the canonical pathway that increases mitophagy after hypoxia. However, in our model, this process relies on PINK1. Unlike FUNDC1, which directly interacts with LC3\u003csup\u003e37\u003c/sup\u003e, PINK1 recruits Parkin, an E3 ubiquitin ligase, which ubiquitinates mitochondrial proteins to initiate mitophagy \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. PGAM5 is involved in both pathways but plays distinct roles. PGAM5 functions as a phosphatase, dephosphorylating FUNDC1 to enhance its interaction with LC3 under hypoxia \u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e. In contrast, PGAM5 stabilizes PINK1, preventing its degradation and facilitating mitophagy activation. Both pathways are crucial for maintaining mitochondrial homeostasis during hypoxia but operate through different mechanisms. Additionally, PINK1-dependent mitophagy can be triggered by other stressors, such as IH preconditioning.\u003c/p\u003e\u003cp\u003eIn this study, we observed that after IH preconditioning, no cognitive decline was observed in mice following 7 days of continuous hypoxia. This neuroprotective effect was associated with the activation of the HIF-1α/STOML2/PGAM5 pathway, which subsequently enhanced PINK1-dependent mitophagy, promoting mitochondrial quality control and neuronal survival. Previous studies have shown that IH confers neuroprotection through multiple mechanisms: In models of cerebral ischemia, IH promotes mitochondrial biogenesis and prevents oxidative stress-induced apoptosis\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e\u003c/sup\u003e; studies in stroke models have demonstrated that IH increases VEGF expression, improving cerebral blood flow and neuronal survival\u003csup\u003e\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e; IH preconditioning suppresses pro-inflammatory cytokines (TNF-α, IL-6) and enhances antioxidant enzyme activity\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e, thereby protecting neurons from hypoxia-induced damage. Notably, this study provides the first evidence demonstrating that IH specifically activates the HIF-1α/STOML2/PGAM5 axis, revealing a novel regulatory mechanism linking IH to enhanced mitophagy and neuroprotection.\u003c/p\u003e\u003cp\u003eIn conclusion, we propose that the stabilization of HIF-1α initiates a novel process that enhances STOML2 expression, promotes PGAM5 stability, and ultimately activates PINK1-dependent mitophagy. This pathway represents a potential new target for treating hypoxia-related diseases. Furthermore, IH may mimic the early stages of hypoxia and serve as an exogenous activator of the HIF-1α/STOML2/PGAM5/PINK1 pathway, providing neuroprotection. Our findings also offer experimental support for the clinical application of IH, although further studies are needed to confirm its therapeutic potential.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eAnimals\u003c/h2\u003e\u003cp\u003eAdult male C57BL mice were purchased from SPF Biotechnology (Beijing, China). All animals were housed at room temperature under a 12/12 h light/dark cycle and had free access to food and water. All animal experiments were approved by the Animal Care and Use Committee of the Institute of Animal Management, Capital Medical University (permit no. AEEI-2022-073), and conducted in accordance with ethical requirements and ARRIVE guidelines.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eHypoxic treatment\u003c/h2\u003e\u003cp\u003eAll mice were randomly assigned to the control group and each model group. Hypoxic mice were administered hypoxic treatment in a closed hypoxic chamber (China Innovation Instrument Co., Ltd, Ningbo, Zhejiang, China), which accurately set the desired hypoxic concentration and pattern. For chronic hypoxia, mice were treated continuously with 13% O2 for 1, 3, and 7 days. The hypoxic chamber was opened briefly for food and water additions every 3 days. Intermittent hypoxic mice were treated with 10 cycles of 5-min 13% O2 (hypoxia) and 5-min 21% O2 (normoxia) per day for 14 days. The IH-H7d group was followed by an additional continuous 3 days hypoxic treatment after IH treatment.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eLentivirus Treatment\u003c/h2\u003e\u003cp\u003eTo investigate the knockdown effects of four target molecules (HIF1α, STOML2, PGAM5, and PINK1), along with a negative control (vector), five lentivirus treatment groups were established, with 10 animals per group: H3d-vector group: Experimental animals were injected with lentivirus via stereotactic injection and subjected to continuous hypoxia (13% O₂) for 3 days. H3d-iHIF group: Lentivirus was administered via stereotactic injection to specifically knock down HIF1α, followed by 3 days of continuous hypoxia (13% O₂). H3d-iSTOML2 group: Lentivirus was injected to selectively knock down STOML2, followed by 3 days of continuous hypoxia (13% O₂). H3d-iPINK1 group: Lentivirus was injected to specifically knock down PINK1, followed by 3 days of continuous hypoxia (13% O₂).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003eBehavioral tests\u003c/h2\u003e\u003cp\u003eThe cognitive function of mice in each group was assessed using novel object recognition and Y-maze tests. For the novel object recognition test, a 40 cm \u0026times; 40 cm \u0026times; 40 cm lidless rectangular box was used, with a camera positioned overhead. The experiment consisted of three phases: adaptation, familiarity, and testing. In the adaptation phase, each mouse was placed in the apparatus and allowed to explore freely for 5 minutes to acclimate. In the familiarity phase, two identical objects A (old object) were introduced, and mice were given 5 minutes to explore. In the testing phase, one object A was replaced with a novel object (differing in color and shape), and mice were allowed another 5 minutes of exploration. The time spent interacting with both objects was recorded. The discrimination index was calculated as (Time exploring new object\u0026thinsp;\u0026minus;\u0026thinsp;Time exploring old object) / (Time exploring new\u0026thinsp;+\u0026thinsp;old objects). Mice with baseline cognitive impairments were excluded from behavioral tests. All video recordings were analyzed blindly by researchers not involved in conducting the experiments.\u003c/p\u003e\u003cp\u003eThe Y maze is typically made of opaque material and shaped like the letter \u0026ldquo;Y,\u0026rdquo; consisting of three equal-length arms (usually at a 120\u0026deg; angle). Each arm is approximately 30\u0026ndash;40 cm long, 8\u0026ndash;10 cm wide, and 15 cm high to prevent animals from escaping. The apparatus is placed in a disturbance-free laboratory environment, and a video tracking system is used to record animal behavior. Before the experiment, animals may be allowed to acclimate to the laboratory environment for about 30 minutes to reduce anxiety. The test begins by placing the animal in the start arm of the Y maze (typically a fixed arm), allowing it to explore freely for a set period (usually 5\u0026ndash;10 minutes). During the experiment, the sequence and number of entries into each arm are recorded to calculate the alternation rate. A successful alternation is defined as consecutive entries into three different arms, such as A\u0026rarr;B\u0026rarr;C. If the animal revisits any arm within three consecutive choices, it is not counted as a successful alternation. The spontaneous alternation rate is calculated as: Spontaneous alternation rate\u0026thinsp;=\u0026thinsp;Number of successful alternations / Total exploration attempts.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eNissl staining\u003c/h2\u003e\u003cp\u003eBrain tissue from the mice were cut into 10 \u0026micro;m sections on a frozen slicer and pasted on a slide. The samples were fixed in 70% ethanol, then sequentially dehydrated in 100%, 90%, 80%, and 70% ethanol for 2 minutes each. After clearing with xylene, the sections were incubated in 1% tar purple (Solarbio, G1430) for 30 minutes. They were then rinsed with distilled water and differentiated in 70% alcohol for several minutes. Dehydration was repeated with 70%, 80%, and 95% ethanol for 2 minutes each, followed by 100% ethanol, before being sealed with neutral gum.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eWestern blots\u003c/h2\u003e\u003cp\u003eMouse hippocampus protein lysates were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and subsequently immunoblotted onto polyvinylidene difluoride (PVDF) membranes. Membranes were blocked with 5% nonfat milk at room temperature for 1 h. After TBST washing (three times, 5 min per wash), the membranes were incubated with the indicated primary antibodies at 4\u0026deg;C overnight with shaking. The primary antibodies included: COX IV (Proteintech, 23274-1-AP), LaminB1 (Proteintech, 80906-1-RR), HIF-1α (Abcam, ab228649), STOML2 (Proteintech, 60052-1-AP), PGAM5 (Proteintech, 28445-1-AP), PINK1 (Abconal, A11435), LC3 (Sigma,L7543).After incubation, the membranes were washed three times and then incubated at room temperature for 1 h with secondary antibodies, including IRDye 680RD goat anti-mouse IgG (H\u0026thinsp;+\u0026thinsp;L) (Licor, 926-68070), IRDye 680RD goat anti-rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) (Licor, 926-68071), IRDye 800CW goat anti-mouse IgG (H\u0026thinsp;+\u0026thinsp;L) (Licor, 926-32210), IRDye 800CW goat anti-rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) (Licor, 926-32211). PVDF were scanned using a detection system (Odyssey, USA), and band intensities were normalized to Lamin B1 or COX IV. Statistical analyses were performed using ImageJ and GraphPad software.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eRT-PCR\u003c/h2\u003e\u003cp\u003eAn RNeasy kit (Qiagen, 74104) was used to extract total RNA from mice hippocampal tissue, and then the Transcriptor High Fidelity cDNA synthesis kit (Roche, 5081963001) was used to reverse transcribe the RNA into cDNA. All operations were according to the instructions. The following primers were used: Stoml2 for: TACAAGGCAAGTTACGGTGTGG; Stoml2 rev: GAGAATGCGCTGACATACTGCT; 18S sense: GTAACCCGTTGAACCCCATT; 18S anti: CCATCCAATCGGTAGTAGCG.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eCytotoxicity detection\u003c/h2\u003e\u003cp\u003eCytotoxicity was detected by the LDH assay (Roche, 4744926001). The powder was dissolved in ddH2O and mixed thoroughly to make the catalytic solution. Then, 250 \u0026micro;L of the catalytic solution was added to the staining solution (11.25 mL) and mixed thoroughly. Then, 100 \u0026micro;L cell supernatant of each group was added to the new 96-well plate. The LDH reaction solution (100 \u0026micro;L) was added with subsequent incubation at room temperature away from light for 30 min. After the incubation, 50 \u0026micro;L stop solution was added to each well and gently mixed for 10 min. The OD value of each well was measured at 490 nm by a microplate reader.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eCell Proliferation Assay\u003c/h2\u003e\u003cp\u003eCell proliferation was detected by the CCK8 assay(), including followed steps: (1) Standard Curve: Count the cells in the suspension and prepare a cell concentration gradient. Dilute with culture medium to create 4\u0026ndash;7 gradients, incubate overnight, then remove the medium and add fresh medium with CCK-8 reagent. After 1 hour, measure OD to create a standard curve. (2) Cell Seeding: Seed cells at the optimal density determined, and incubate overnight. (3) Add CCK-8: Remove the original medium, and add 100 \u0026micro;l of medium with CCK-8. (4) Incubation: Incubate for 1 hour, then transfer the hypoxia group to a 1% O2 incubator. (5) OD Measurement: Measure OD at 450 nm using a microplate reader.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eCell death detection\u003c/h2\u003e\u003cp\u003ePI/Hoechst detection was used to detect the cell death rate. Hoechst labels all cells as blue fluorescence, and PI labels only dead cells as red fluorescence. Therefore, the ratio of red to blue can be used to calculate the cell death rate. After the cells were treated, the original medium was discarded, and the cells were rinsed three times with PBS. The PI (Sigma, P4170) and Hoechst (Sigma, B2261) mixture was added into the cell culture well and incubated at 37\u0026deg;C for 10 min under dark conditions. The cells were removed from the incubator, the mixture of PI and Hoechst was discarded, and the cells were rinsed three times with PBS. Confocal microscopy was used for observation and imaging.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eMitoTracker Staining and Flow Cytometry Detection\u003c/h2\u003e\u003cp\u003eUsing MitoTracker Green probe kit purchased from Thermo Corporation. (1) Prepare staining solution: dilute 1mM MitoTracker stock in serum-free medium to a working concentration of 150nM. (2) Staining: Once cells reach the desired density, discard the old medium, add pre-warmed MitoTracker solution, and incubate for 10 minutes in the dark. (3) Remove staining solution: Replace with regular medium. (4) Flow cytometry: Digest, centrifuge, and collect cells to create a single-cell suspension. Perform fluorescence detection using a flow cytometer with the FITC channel.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\u003ch2\u003eMitophagy Inhibition\u003c/h2\u003e\u003cp\u003e(1) Preparation of Mdivi-1 Working Solution: Dissolve Mdivi-1 (purchased from Selleck, S7162) in DMSO to prepare a stock solution and store it at -20\u0026deg;C in the dark. Before use, dilute the stock solution in complete culture medium to a final concentration of 10 \u0026micro;M. (2) Cell Culture: Seed cells in a 96-well plate and incubate at 37\u0026deg;C with 5% CO₂ until they reach the appropriate density. (3) Cell Treatment: Remove the original culture medium and replace it with fresh medium containing Mdivi-1 at a ratio of 10 \u0026micro;l per 1 ml of medium. Pre-treat the cells for 30 minutes. (4) Subsequent Assays: Perform cell viability and functional assays such as CCK-8.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec23\" class=\"Section2\"\u003e\u003ch2\u003eStatistical analysis\u003c/h2\u003e\u003cp\u003eExcel and GraphPad Prism 9.0 software were used for data preservation, recording, statistics, and analyses. Image data were analyzed by ImageJ and other software. All results were analyzed using the t-test, one-way ANOVA, and two-way ANOVA as appropriate. Data are expressed as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM), with P\u0026thinsp;\u0026le;\u0026thinsp;0.05 as a significant difference. In animal behavioral tests, n\u0026thinsp;\u0026ge;\u0026thinsp;10; in protein detection experiments, such as western blot and immunofluorescence, n\u0026thinsp;\u0026ge;\u0026thinsp;3.\u003c/p\u003e\u003c/div\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eCNS, central nervous system; AD, Alzheimer’s disease; PD, Parkinson’s disease; ROS: reactive oxygen species; PINK1: PTEN-induced kinase 1; OMM: outer mitochondrial membrane; FUNDC1: FUN14 domain-containing 1; I/R: ischemia/reperfusion; IH: intermittent hypoxia; Drp1: dynamin-related protein 1; HIF-1α: hypoxia inducible factor-1α;\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Ethics approval\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were approved by the Animal Care and Use Committee of the Institute of Animal Management, Capital Medical University (permit no. AEEI-2022-073), and conducted in accordance with ethical requirements and ARRIVE guidelines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eConsent for publication was obtained from the participants.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Competing Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no potential conflict to interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Artificial Intelligence (AI)\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDuring the writing process of this article, we used ChatGPT-4o for language refinement and optimization to enhance readability and fluency. However, all research content, data analysis, and conclusions were independently conducted by the authors. ChatGPT-4o was solely used for language enhancement and did not influence the scientific integrity or authenticity of the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFundings\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by the National Natural Science Foundation of China (Grant number: 32100925), the Beijing Nova Program (Grant number: 20230484436), the Chinese Institutes for Medical Research (Grant number: CX23YQ01), Beijing, Beijing-Tianjin-Hebei Basic Research Cooperation Project (Grant number: S22ZX12032).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLi, S.\u003cem\u003e et al.\u003c/em\u003e Preconditioning in neuroprotection: From hypoxia to ischemia. \u003cem\u003eProg Neurobiol\u003c/em\u003e \u003cstrong\u003e157\u003c/strong\u003e, 79-91, doi:10.1016/j.pneurobio.2017.01.001 (2017).\u003c/li\u003e\n\u003cli\u003eLi, B.\u003cem\u003e et al.\u003c/em\u003e Liriodendrin alleviates myocardial ischemia‑reperfusion injury via partially attenuating apoptosis, inflammation and mitochondria damage in rats. \u003cem\u003eInt J Mol Med\u003c/em\u003e \u003cstrong\u003e55\u003c/strong\u003e, doi:10.3892/ijmm.2025.5506 (2025).\u003c/li\u003e\n\u003cli\u003eAlshial, E. E.\u003cem\u003e et al.\u003c/em\u003e Mitochondrial dysfunction and neurological disorders: A narrative review and treatment overview. \u003cem\u003eLife Sci\u003c/em\u003e \u003cstrong\u003e334\u003c/strong\u003e, 122257, doi:10.1016/j.lfs.2023.122257 (2023).\u003c/li\u003e\n\u003cli\u003eSchmitt, L. O. \u0026amp; Gaspar, J. M. Obesity-Induced Brain Neuroinflammatory and Mitochondrial Changes. \u003cem\u003eMetabolites\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, doi:10.3390/metabo13010086 (2023).\u003c/li\u003e\n\u003cli\u003eHoffmann, L.\u003cem\u003e et al.\u003c/em\u003e Cofilin1 oxidation links oxidative distress to mitochondrial demise and neuronal cell death. \u003cem\u003eCell Death Dis\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 953, doi:10.1038/s41419-021-04242-1 (2021).\u003c/li\u003e\n\u003cli\u003eLiang, R.\u003cem\u003e et al.\u003c/em\u003e Exercise preconditioning mitigates Ischemia-Reperfusion injury in rats by enhancing mitochondrial respiration. \u003cem\u003eNeuroscience\u003c/em\u003e \u003cstrong\u003e562\u003c/strong\u003e, 64-74, doi:10.1016/j.neuroscience.2024.10.045 (2024).\u003c/li\u003e\n\u003cli\u003eWen, P.\u003cem\u003e et al.\u003c/em\u003e Oxidative stress and mitochondrial impairment: Key drivers in neurodegenerative disorders. \u003cem\u003eAgeing Res Rev\u003c/em\u003e \u003cstrong\u003e104\u003c/strong\u003e, 102667, doi:10.1016/j.arr.2025.102667 (2025).\u003c/li\u003e\n\u003cli\u003eAlmeida, V. N. Somatostatin and the pathophysiology of Alzheimer\u0026apos;s disease. \u003cem\u003eAgeing Res Rev\u003c/em\u003e \u003cstrong\u003e96\u003c/strong\u003e, 102270, doi:10.1016/j.arr.2024.102270 (2024).\u003c/li\u003e\n\u003cli\u003eSzczepanowska, K. \u0026amp; Trifunovic, A. Mitochondrial matrix proteases: quality control and beyond. \u003cem\u003eFebs j\u003c/em\u003e \u003cstrong\u003e289\u003c/strong\u003e, 7128-7146, doi:10.1111/febs.15964 (2022).\u003c/li\u003e\n\u003cli\u003eTian, R. Z.\u003cem\u003e et al.\u003c/em\u003e Role of Autophagy in Myocardial Remodeling After Myocardial Infarction. \u003cem\u003eJ Cardiovasc Pharmacol\u003c/em\u003e \u003cstrong\u003e85\u003c/strong\u003e, 1-11, doi:10.1097/fjc.0000000000001646 (2025).\u003c/li\u003e\n\u003cli\u003eCheng, Y.\u003cem\u003e et al.\u003c/em\u003e Allicin alleviates traumatic brain injury-induced neuroinflammation by enhancing PKC-\u0026delta;-mediated mitophagy. \u003cem\u003ePhytomedicine\u003c/em\u003e \u003cstrong\u003e139\u003c/strong\u003e, 156500, doi:10.1016/j.phymed.2025.156500 (2025).\u003c/li\u003e\n\u003cli\u003eMeng, Q.\u003cem\u003e et al.\u003c/em\u003e A quinolinyl analog of resveratrol improves neuronal damage after ischemic stroke by promoting Parkin-mediated mitophagy. \u003cem\u003eChin J Nat Med\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 214-224, doi:10.1016/s1875-5364(25)60825-9 (2025).\u003c/li\u003e\n\u003cli\u003eWu, H. \u0026amp; Chen, Q. Hypoxia activation of mitophagy and its role in disease pathogenesis. \u003cem\u003eAntioxid Redox Signal\u003c/em\u003e \u003cstrong\u003e22\u003c/strong\u003e, 1032-1046, doi:10.1089/ars.2014.6204 (2015).\u003c/li\u003e\n\u003cli\u003eLiu, L.\u003cem\u003e et al.\u003c/em\u003e Mitochondrial outer-membrane protein FUNDC1 mediates hypoxia-induced mitophagy in mammalian cells. \u003cem\u003eNat Cell Biol\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 177-185, doi:10.1038/ncb2422 (2012).\u003c/li\u003e\n\u003cli\u003eKuang, Y.\u003cem\u003e et al.\u003c/em\u003e Structural basis for the phosphorylation of FUNDC1 LIR as a molecular switch of mitophagy. \u003cem\u003eAutophagy\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 2363-2373, doi:10.1080/15548627.2016.1238552 (2016).\u003c/li\u003e\n\u003cli\u003eGe, P., Dawson, V. L. \u0026amp; Dawson, T. M. PINK1 and Parkin mitochondrial quality control: a source of regional vulnerability in Parkinson\u0026apos;s disease. \u003cem\u003eMol Neurodegener\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 20, doi:10.1186/s13024-020-00367-7 (2020).\u003c/li\u003e\n\u003cli\u003eLinqing, L.\u003cem\u003e et al.\u003c/em\u003e Hypoxia-induced PINK1/Parkin-mediated mitophagy promotes pulmonary vascular remodeling. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e \u003cstrong\u003e534\u003c/strong\u003e, 568-575, doi:10.1016/j.bbrc.2020.11.040 (2021).\u003c/li\u003e\n\u003cli\u003eShao, Q.\u003cem\u003e et al.\u003c/em\u003e Proteomic Analysis Reveals That Mitochondria Dominate the Hippocampal Hypoxic Response in Mice. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e23\u003c/strong\u003e, 14094, doi:10.3390/ijms232214094 (2022).\u003c/li\u003e\n\u003cli\u003eCheng, M.\u003cem\u003e et al.\u003c/em\u003e PGAM5: A crucial role in mitochondrial dynamics and programmed cell death. \u003cem\u003eEur J Cell Biol\u003c/em\u003e \u003cstrong\u003e100\u003c/strong\u003e, 151144, doi:10.1016/j.ejcb.2020.151144 (2021).\u003c/li\u003e\n\u003cli\u003eZeb, A.\u003cem\u003e et al.\u003c/em\u003e A novel role of KEAP1/PGAM5 complex: ROS sensor for inducing mitophagy. \u003cem\u003eRedox Biol\u003c/em\u003e \u003cstrong\u003e48\u003c/strong\u003e, 102186, doi:10.1016/j.redox.2021.102186 (2021).\u003c/li\u003e\n\u003cli\u003eYan, C.\u003cem\u003e et al.\u003c/em\u003e PHB2 (prohibitin 2) promotes PINK1-PRKN/Parkin-dependent mitophagy by the PARL-PGAM5-PINK1 axis. \u003cem\u003eAutophagy\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 419-434, doi:10.1080/15548627.2019.1628520 (2020).\u003c/li\u003e\n\u003cli\u003eFan, R.\u003cem\u003e et al.\u003c/em\u003e Stomatin-like protein-2 attenuates macrophage pyroptosis and H9c2 cells apoptosis by protecting mitochondrial function. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e \u003cstrong\u003e636\u003c/strong\u003e, 112-120, doi:10.1016/j.bbrc.2022.10.047 (2022).\u003c/li\u003e\n\u003cli\u003eChristie, D. A.\u003cem\u003e et al.\u003c/em\u003e Stomatin-like protein 2 deficiency in T cells is associated with altered mitochondrial respiration and defective CD4+ T cell responses. \u003cem\u003eJ Immunol\u003c/em\u003e \u003cstrong\u003e189\u003c/strong\u003e, 4349-4360, doi:10.4049/jimmunol.1103829 (2012).\u003c/li\u003e\n\u003cli\u003eGuo, H.\u003cem\u003e et al.\u003c/em\u003e Cytochrome B5 type A alleviates HCC metastasis via regulating STOML2 related autophagy and promoting sensitivity to ruxolitinib. \u003cem\u003eCell Death Dis\u003c/em\u003e \u003cstrong\u003e13\u003c/strong\u003e, 623, doi:10.1038/s41419-022-05053-8 (2022).\u003c/li\u003e\n\u003cli\u003eMa, W.\u003cem\u003e et al.\u003c/em\u003e STOML2 interacts with PHB through activating MAPK signaling pathway to promote colorectal Cancer proliferation. \u003cem\u003eJ Exp Clin Cancer Res\u003c/em\u003e \u003cstrong\u003e40\u003c/strong\u003e, 359, doi:10.1186/s13046-021-02116-0 (2021).\u003c/li\u003e\n\u003cli\u003eWai, T.\u003cem\u003e et al.\u003c/em\u003e The membrane scaffold SLP2 anchors a proteolytic hub in mitochondria containing PARL and the i-AAA protease YME1L. \u003cem\u003eEMBO Rep\u003c/em\u003e \u003cstrong\u003e17\u003c/strong\u003e, 1844-1856, doi:10.15252/embr.201642698 (2016).\u003c/li\u003e\n\u003cli\u003eTang, T.\u003cem\u003e et al.\u003c/em\u003e Src inhibition rescues FUNDC1-mediated neuronal mitophagy in ischaemic stroke. \u003cem\u003eStroke Vasc Neurol\u003c/em\u003e \u003cstrong\u003e9\u003c/strong\u003e, 367-379, doi:10.1136/svn-2023-002606 (2024).\u003c/li\u003e\n\u003cli\u003eChen, G.\u003cem\u003e et al.\u003c/em\u003e Nix and Nip3 form a subfamily of pro-apoptotic mitochondrial proteins. \u003cem\u003eJ Biol Chem\u003c/em\u003e \u003cstrong\u003e274\u003c/strong\u003e, 7-10, doi:10.1074/jbc.274.1.7 (1999).\u003c/li\u003e\n\u003cli\u003eHu, S.\u003cem\u003e et al.\u003c/em\u003e Stabilization of HIF-1\u0026alpha; alleviates osteoarthritis via enhancing mitophagy. \u003cem\u003eCell Death Dis\u003c/em\u003e \u003cstrong\u003e11\u003c/strong\u003e, 481, doi:10.1038/s41419-020-2680-0 (2020).\u003c/li\u003e\n\u003cli\u003eRandle, R. K., Amara, V. R. \u0026amp; Popik, W. IFI16 Is Indispensable for Promoting HIF-1\u0026alpha;-Mediated APOL1 Expression in Human Podocytes under Hypoxic Conditions. \u003cem\u003eInt J Mol Sci\u003c/em\u003e \u003cstrong\u003e25\u003c/strong\u003e, 3324, doi:10.3390/ijms25063324 (2024).\u003c/li\u003e\n\u003cli\u003eJewell, U. R.\u003cem\u003e et al.\u003c/em\u003e Induction of HIF-1alpha in response to hypoxia is instantaneous. \u003cem\u003eFaseb j\u003c/em\u003e \u003cstrong\u003e15\u003c/strong\u003e, 1312-1314 (2001).\u003c/li\u003e\n\u003cli\u003eLiu, Y.\u003cem\u003e et al.\u003c/em\u003e Normobaric Hyperoxia Extends Neuro- and Vaso-Protection of N-Acetylcysteine in Transient Focal Ischemia. \u003cem\u003eMol Neurobiol\u003c/em\u003e \u003cstrong\u003e54\u003c/strong\u003e, 3418-3427, doi:10.1007/s12035-016-9932-0 (2017).\u003c/li\u003e\n\u003cli\u003eZhang, Z., Yan, J. \u0026amp; Shi, H. Role of Hypoxia Inducible Factor 1 in Hyperglycemia-Exacerbated Blood-Brain Barrier Disruption in Ischemic Stroke. \u003cem\u003eNeurobiol Dis\u003c/em\u003e \u003cstrong\u003e95\u003c/strong\u003e, 82-92, doi:10.1016/j.nbd.2016.07.012 (2016).\u003c/li\u003e\n\u003cli\u003eZheng, Y.\u003cem\u003e et al.\u003c/em\u003e STOML2 potentiates metastasis of hepatocellular carcinoma by promoting PINK1-mediated mitophagy and regulates sensitivity to lenvatinib. \u003cem\u003eJ Hematol Oncol\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 16, doi:10.1186/s13045-020-01029-3 (2021).\u003c/li\u003e\n\u003cli\u003eLazarou, M.\u003cem\u003e et al.\u003c/em\u003e The ubiquitin kinase PINK1 recruits autophagy receptors to induce mitophagy. \u003cem\u003eNature\u003c/em\u003e \u003cstrong\u003e524\u003c/strong\u003e, 309-314, doi:10.1038/nature14893 (2015).\u003c/li\u003e\n\u003cli\u003ePedrera, L.\u003cem\u003e et al.\u003c/em\u003e Ferroptosis triggers mitochondrial fragmentation via Drp1 activation. \u003cem\u003eCell Death Dis\u003c/em\u003e \u003cstrong\u003e16\u003c/strong\u003e, 40, doi:10.1038/s41419-024-07312-2 (2025).\u003c/li\u003e\n\u003cli\u003eQin, X.\u003cem\u003e et al.\u003c/em\u003e Identification of an autoinhibitory, mitophagy-inducing peptide derived from the transmembrane domain of USP30. \u003cem\u003eAutophagy\u003c/em\u003e \u003cstrong\u003e18\u003c/strong\u003e, 2178-2197, doi:10.1080/15548627.2021.2022360 (2022).\u003c/li\u003e\n\u003cli\u003eLing, Z.\u003cem\u003e et al.\u003c/em\u003e Copper doped bioactive glass promotes matrix vesicles-mediated biomineralization via osteoblast mitophagy and mitochondrial dynamics during bone regeneration. \u003cem\u003eBioact Mater\u003c/em\u003e \u003cstrong\u003e46\u003c/strong\u003e, 195-212, doi:10.1016/j.bioactmat.2024.12.010 (2025).\u003c/li\u003e\n\u003cli\u003eLi, K., Xia, X. \u0026amp; Tong, Y. Multiple roles of mitochondrial autophagy receptor FUNDC1 in mitochondrial events and kidney disease. \u003cem\u003eFront Cell Dev Biol\u003c/em\u003e \u003cstrong\u003e12\u003c/strong\u003e, 1453365, doi:10.3389/fcell.2024.1453365 (2024).\u003c/li\u003e\n\u003cli\u003eSu, Y., Ke, C., Li, C., Huang, C. \u0026amp; Wan, C. Intermittent hypoxia promotes the recovery of motor function in rats with cerebral ischemia by regulating mitochondrial function. \u003cem\u003eExp Biol Med (Maywood)\u003c/em\u003e \u003cstrong\u003e247\u003c/strong\u003e, 1364-1378, doi:10.1177/15353702221098962 (2022).\u003c/li\u003e\n\u003cli\u003ePeng, W.\u003cem\u003e et al.\u003c/em\u003e Role of intermittent hypoxic training combined with methazolamide in the prevention of high-altitude cerebral edema in rats. \u003cem\u003eSci Rep\u003c/em\u003e \u003cstrong\u003e14\u003c/strong\u003e, 30252, doi:10.1038/s41598-024-81226-z (2024).\u003c/li\u003e\n\u003cli\u003eWang, X.\u003cem\u003e et al.\u003c/em\u003e Inhibition of NSUN6 protects against intermittent hypoxia-induced oxidative stress and inflammatory response in adipose tissue through suppressing macrophage ferroptosis and M1 polarization. \u003cem\u003eLife Sci\u003c/em\u003e \u003cstrong\u003e364\u003c/strong\u003e, 123433, doi:10.1016/j.lfs.2025.123433 (2025).\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Supplementary Figures","content":"\u003cp\u003eSupplementary figures S1 and S2 are not available with this version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFigure S1. PINK1 overexpression enhances the level of mitophagy.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003e The levels of PINK1 in mice of each group in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. \u003cstrong\u003e(B)\u003c/strong\u003e Statistical analysis of PINK1 in mice of each group. \u003cstrong\u003e(C)\u003c/strong\u003e The levels of LC3 in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. \u003cstrong\u003e(D)\u003c/strong\u003e Statistical analysis of LC3 II/I in mice of each group. Data was analyzed via one-way ANOVA and Tukey’s post-test. *p \u0026lt; 0.05, **p \u0026lt; 0.01, ***p \u0026lt; 0.001, ****p \u0026lt; 0.0001.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFigure S2. STOML2 acts as an upstream regulator of PGAM5.\u003c/strong\u003e \u003cstrong\u003e(A)\u003c/strong\u003e The levels of STOML2 in mice of each group in the hippocampus mitochondrial protein were detected by western blotting using COX IV as the internal reference. \u003cstrong\u003e(B)\u003c/strong\u003e Statistical analysis of PINK1 in mice of each group. Data was analyzed via one-way ANOVA and Tukey’s post-test. *p \u0026lt; 0.05.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"cell-death-discovery","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddiscovery","sideBox":"Learn more about [Cell Death Discovery](http://www.nature.com/cddiscovery/)","snPcode":"41420","submissionUrl":"https://mts-cddiscovery.nature.com/","title":"Cell Death Discovery","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Hypoxia, Mitophagy, PINK1, HIF-1α, Intermittent hypoxia","lastPublishedDoi":"10.21203/rs.3.rs-6626715/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6626715/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eHypoxic stress contributes to brain disorders by causing neuronal injury, making it crucial to understand neuronal hypoxic response mechanisms for disease resistance. In the early stage of stress, neurons initiate a series of compensatory pathways to resist cell damage, but the underlying mechanisms have not been fully elucidated. In this study, we found that hypoxia transiently activates PTEN-induced kinase 1 (PINK1)-dependent mitophagy in the early stage before cell damage and neurological dysfunction. When PINK1-dependent mitophagy is inhibited, neuronal injury begins to exacerbate. Under hypoxia, overexpression of PINK1 can resist neuronal injury, while knockdown of PINK1 aggravates neuronal injury, revealing that PINK1-dependent mitophagy plays a key role in neuronal compensatory hypoxia response. Mechanistically, in the early stage of hypoxia, the nuclear translocation of HIF-1α increases, mediating the transcription of its downstream target molecule STOML2. STOML2 translocates to the outer mitochondrial membrane and participates in the cleavage of PGAM5. These processes initiate PINK1-dependent mitophagy. Knockdown of HIF-1α, STOML2, or PGAM5 inhibits mitophagy and worsens hypoxia-induced dysfunction, highlighting this pathway\u0026rsquo;s importance. Intermittent hypoxia, a conditioning strategy, stimulates endogenous protection. Notably, it activates the HIF-1α/STOML2 axis, inducing PINK1-dependent mitophagy and protecting neurons. In conclusion, our study reveals a new \"self-protection\" mechanism of neurons against hypoxic stress and discovers that intermittent hypoxia can effectively activate this pathway to resist neuronal injury, providing new insights into the mechanisms and interventions of hypoxia-related nerve injury.\u003c/p\u003e","manuscriptTitle":"Novel mechanism of neuronal hypoxia response: HIF-1α/STOML2 mediated PINK1-dependent mitophagy activation against neuronal injury","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-29 15:06:23","doi":"10.21203/rs.3.rs-6626715/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2025-09-23T16:04:49+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2025-08-19T12:50:50+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-07-28T01:01:12+00:00","index":3,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-07-26T06:46:53+00:00","index":2,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2025-07-25T20:40:33+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2025-07-25T17:39:13+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-06-19T11:13:29+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-06-19T03:42:15+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death Discovery","date":"2025-06-19T03:42:14+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"cell-death-discovery","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddiscovery","sideBox":"Learn more about [Cell Death Discovery](http://www.nature.com/cddiscovery/)","snPcode":"41420","submissionUrl":"https://mts-cddiscovery.nature.com/","title":"Cell Death Discovery","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ae035a83-bce1-4941-ac64-bb0a7b54b0f2","owner":[],"postedDate":"July 29th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":52139304,"name":"Biological sciences/Neuroscience/Cellular neuroscience"},{"id":52139305,"name":"Biological sciences/Cell biology/Autophagy/Mitophagy"}],"tags":[],"updatedAt":"2026-02-28T08:10:59+00:00","versionOfRecord":{"articleIdentity":"rs-6626715","link":"https://doi.org/10.1038/s41420-026-02960-z","journal":{"identity":"cell-death-discovery","isVorOnly":false,"title":"Cell Death Discovery"},"publishedOn":"2026-02-21 05:00:00","publishedOnDateReadable":"February 21st, 2026"},"versionCreatedAt":"2025-07-29 15:06:23","video":"","vorDoi":"10.1038/s41420-026-02960-z","vorDoiUrl":"https://doi.org/10.1038/s41420-026-02960-z","workflowStages":[]},"version":"v1","identity":"rs-6626715","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6626715","identity":"rs-6626715","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.