Developmental exposure to perfluorooctanoic sulfonate(PFOS) impairs the endometrial receptivity

preprint OA: closed
Full text JSON View at publisher
Full text 109,829 characters · extracted from preprint-html · click to expand
Developmental exposure to perfluorooctanoic sulfonate(PFOS) impairs the endometrial receptivity | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Developmental exposure to perfluorooctanoic sulfonate(PFOS) impairs the endometrial receptivity Rui Ren, Xinyue Zhou, Tianyu Jia, Bin Wang, Ahui Liu, Ji Song, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5117605/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Jan, 2025 Read the published version in Scientific Reports → Version 1 posted 11 You are reading this latest preprint version Abstract Perfluorooctanoic sulfonate (PFOS) is difficult to degrade and tends to accumulate in the body, which causes widespread concern. The expression of genes related to endometrial receptivity and the differentiation of human endometrial stromal cells (hESCs) were assessed in this study concerning PFOS. In this study, we investigated the effect of PFOS exposure on endometrial tolerance by cell and animal experiments. The activity against endometrial mesenchymal cells was significantly reduced by PFOS intervention, and the apoptosis flow assay results showed that PFOS significantly promoted cell death in a concentration-dependent manner. Transmission electron microscopy results revealed mitochondrial damage in the PFOS-intervened group, and WB results showed that the expression levels of endometrial tolerance-related proteins Homeobox A10 (HOXA10) and integrin beta3 (ITGB3) were decreased, and the expression level of Forkhead box O1 (FOXO1) protein was increased. Animal studies have shown that PFOS can affect the locomotor cycle in mice, and significant damage to pinopodes morphology was observed after PFOS exposure administration. In the present study, we found that PFOS may synergistically affect the viability of endometrial mesenchymal stromal cells through accumulation in vivo, and that PFOS may contribute to the failure of embryo implantation by affecting mitochondrial function and consequently endometrial permissive sites. Biological sciences/Biochemistry Earth and environmental sciences/Environmental sciences Health sciences/Health care Perfluorooctanoic sulfonate (PFOS) Endometrial stromal cells In vitro fertilization Endometrial receptivity Pinopodes morphology Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Perfluorinated compounds are a class of organic pollutants in which the hydrogen atoms on the carbon chain and alkyl groups are completely replaced by fluorine atoms. This category includes perfluoroalkylamines, perfluoroethers and perfluoroalkanoic acids[ 1 ]. Due to their high-energy bonds, perfluoroalkanoic acids exhibit excellent physicochemical stability and biological stability, making them of significant industrial value. They are widely used in industries such as textiles, food packaging, cosmetics, coatings, electronics products, and home furnishings[ 2 ]. Among these compounds, PFOS has half-life of 3.4 years in human serum due to its robust carbon-fluorine bond that imparts thermal-chemical stability; thus it remains uneliminated in both external environments and within the human body[ 3 ]. Due to the extensive use of PFOS in industrial production, it enters the atmosphere, water, soil and other environmental media through various ways[ 4 ]. International research has revealed elevated levels of PFOS accumulation in human liver tissues as well as kidneys and bones. It exerts toxicity on multiple systems including endocrine system, nervous system, immune system, reproductive system etc, and its exposure level is closely related to the occurrence of a variety of diseases[ 5 , 6 ]. An increasing number of studies have confirmed that PFOS exposure is related to female reproductive system diseases. A clinical study on Chinese women showed that serum PFOS concentration was negatively correlated with prolonged menstrual cycle length and menorrhagia[ 7 ]. In addition, other studies have suggested that PFOS exposure is associated with primary ovarian insufficiency and preterm birth[ 8 , 9 ]. In female infertility, endometrial function and receptivity status are key factors affecting pregnancy success. Decidualization is a morphological and functional change experienced by endometrial stromal cells to support endometrial receptivity[ 10 ]. At present, it has been reported that PFOS inhibits decidualization of stromal cells, and PFOS disrupts the regeneration of cortisol in decidual tissue by inhibiting the reduction of key proinflammatory cytokines in maternal-fetal immune intolerance, thus impairing decidualization and immune tolerance environment in early pregnancy[ 11 ]. In addition, PFOS exposure can reduce the activity of protein kinases PKA, ROCK and Akt/PKB and prolactin secretion in human endometrial stromal cells, thereby affecting the process of endometrial decidualization[ 12 ]. Few studies have evaluated the effect of PFOS on endometrial stromal cells in vitro, despite reports of its effects on the reproductive system. The process of PFOS interference with endometrial decidualization, which forms the substrate for embryo implantation, must be further investigated. Therefore, To enhance our understanding of the mechanisms of endometrial regulation after PFOS exposure, our study aimed to assess whether any associations exist between the following: (1) PFOS exposure and endometrial receptivity indexes; (2) PFOS concentrations and pinopodes morphology. 2. Materials and Methods 2.1 Chemicals and reagents PFOS was obtained from Dr. Ehrenstorfer (Augsburg, Germany) and dissolved in dimethyl sulfoxide (DMSO); The culture medium DMEM was obtained from Biosharp (China); fetal bovine serum was obtained from Animal Blood Ware (China); 0.25% trypsin ethylenediaminetetraacetic acid solution and penicillin-streptomycin double antibody solution were obtained from Basaimedia (China). The collagenase I was obtained from Solarbio (China). The cell counting kit-8 and cell tissue lysate for RNA extraction were obtained from Coolaber (China). 2.2 Isolation and culture of endometrial stromal cells Endometrial tissue sample collection for this study was approved by the Ethics Committee of the First Hospital of Lanzhou University (Approval number: LDYYSZLLKH2023-04). Endometrial tissue samples were obtained from women attending the Reproductive Center of the First Hospital of Lanzhou University. Written informed consent was obtained from patient prior to acquisition of samples in accordance with the Declaration of Helsinki. As described previously[ 13 ], primary human endometrial stromal cells were isolated and cultured. Briefly, the human endometrium tissue was poured into Petri dishes and rinsed with phosphate-buffered saline (PBS) at least thrice until there was no blood. The chopped endometrial tissue was transferred to a 15 mL centrifuge tube and 3 mL of 1 mg/mL collagenase I was added. After 1 h in a 37°C water bath, 3 mL DMEM was added to prevent overdigestion. The digested cell supernatant was filtered and collected using a 70 µm screen and then centrifuged to obtain stromal cells. Subsequently, the stromal cells were resuspended in DMEM medium containing 10% fetal bovine serum and antibiotics (1% penicillin-streptomycin solution) and cultured in a cell culture incubator at at 37°C with 5% CO2. 2.3 Cell viability assay Human endometrial stromal cells were seeded into 96-well plates at a density of 3000 cells per well. The cells were treated with PFOS at various concentrations (0.01, 0.1, 1, 10 and 100 µM), and then cultured for 12, 24, 36, 48, and 60 h, respectively. Further, 10 µL of CCK-8 solution was added to each well, and the cells were incubated at 37°C for 2 h to detect cell viability. 2.4 Real-time quantitative PCR (RT-qPCR) analysis The mRNA expression levels of Bax, Bcl-2, HOXA10, and ITGB3 were measured using RT-qPCR. Total RNAs of endometrial stromal cells were extracted with Trizol reagent (Coolaber, Beijing, China). Nanodrop 2000 spectrophotometer was used to assess the RNA purity. FastKing gDNA Dispelling RT SuperMix kit (Tiangen, Beijing, China) was used to synthesize first-strand complementary DNA. The amplification program was run in QuantStudio™ 3 System (Thermo Fisher Scientific, Rockford, IL). SuperReal PreMix Plus was used to amplify DNA. Amplification was performed for 40 cycles consisting of 5 seconds at 95 ℃, 30 seconds at 60 ℃, and then 15 seconds at 95 ℃. Each experiment was performed in triplicates. The primers used for qPCR were synthesized by Shanghai Sangon Biotechnology Co., Ltd. and are presented in Table 1 . Table 1 Primer sequences for RT-qPCR Gene Primer sequence GAPDH Forward GGAGCGAGATCCCTCCAAAAT Reverse GGCTGTTGTCATACTTCTCATGG Bax Forward TTTGCTTCAGGGTTTCATCC Reverse CAGTTGAAGTTGCCGTCAGA Bcl2 Forward GAGGATTGTGGCCTTCTTTG Reverse ACAGTTCCACAAAGGCATCC HOXA10 Forward GGTTTGTTCTGACTTTTTGTTTCT Reverse TGACACTTAGGACAATATCTATCTCTA ITGB3 Forward ACTTCTCCTGTGTCCGCTACAAG Reverse GGTGTCAGTACGCGTGGTACA 2.5 Western blot analysis All proteins of endometrial stromal cells were extracted by cell lysis buffer (Coolaber). Proteins were quantified using a bicinchoninic protein assay kit (Coolaber, Beijing, China). Equal amounts of the extracts were electrophoresed on sodium dodecyl sulfate-polyacrylamide gel and transferred onto a polyvinylidene difluoride membrane (Millipore, Bedford, MA) using the electrophoresis & transmembrane system of Bio-Rad (Hercules, CA). The membrane was incubated with primary antibodies including GAPDH, Bax, Bcl2, HOXA10, ITGB3, FOXO1, cytokeratin 18, and vimentin from Proteintech (China). The membrane was rinsed and incubated with HRP-conjugated secondary antibody (Proteintech, Wuhan, China). Immune-reactive proteins were detected using meilunbio FGSuper sensitive enhanced chemiluminescence (Meilun, Dalian, China). The values of optical densities of the proteins were converted into quantitative data and analyzed using image J. Each experiment was performed in triplicate. 2.6 Flow cytometry assay Cell apoptosis was detected using an Apoptosis Detection kit (Lianke, China). Collect the suspended cells, add an appropriate amount of pre-cooled 1×Binding Buffer and mix by blowing, so that the resuspension is filtered through a screen and transferred to a flow-through tube, in which a single stained tube was added with 5 µL of Annexin V-FITC or 10 µL of PI, respectively, and incubated for 5 min away from light. Detection of Annexin V-FITC by FITC detection channel (Ex = 488nm; Em = 530nm) and PI by PI detection channel (Ex = 535nm; Em = 615nm) using a flow meter. 2.7 Transcriptomics analysis RNA extraction and cDNA synthesis as described previously (“Real-time quantitative PCR analysis”). RNA sequences were analyzed by Shanghai Majorbio Bio-pharm Biotechnology Co., Ltd. (Shanghai, China). The sequencing library was performed by Novogene using an NovaSeq 6000 PE150 platform (Illumina). Trimmomatic software was used to process raw reads[ 14 ]. Next, Raw sequencing data (fastq) were aligned using the HISAT2 (version 2.1.0). In order to summarize read counts for each gene, HTSeq (Version 0.6.1) was used to generate gene-level count data. Finally, genes with differential expression (log2FC > 1 and P value < 0.05) were filtered using the DEseq algorithm. 2.8 Cell cycle analysis Cell cycle stage were detected with a cell cycle assay kit (Lianke, China) using flow cytometry. Human endometrial stromal cells were seeded into 6-well plates and incubated overnight. The cells were treated with PFOS (0.01, 0.1, 1 µM) for 24 h. Next, the cells were collected and washed 1 time with PBS, subsequently, 1 mL of DNA staining solution and 10 µL of permeabilization solution were added and mixed by vortexing, and finally incubated for 30 min in the darkness at room temperature. The samples were subsequently analyzed by flow cytometry. 2.9 Molecular docking First, we downloaded the molecular structure of PFOS from the PubChem database ( https://pubchem.ncbi.nlm.nih.gov/ ) and the structures of the target proteins HOXA10, ITGB3 from the PDB database ( https://www.rcsb.org/structure ), and PyMoL software was used to remove water and original ligands. Secondly, we used AutoDock Vina[ 15 ] to perform molecular docking and PyMOL to visualize the docking results. Finally, the binding strength and activity of protein targets and PFOS were assessed by molecular docking binding energy. 2.10 Immunofluorescence staining Twenty-four hours following PFOS exposure, endometrial stromal cells were fixed with 4% paraformaldehyde for 30 min and then washed with washing buffer (PBS containing 0.01% Triton X-100, 0.01% Tween, and 2% BSA). Afterward, the endometrial stromal cells were sealed in a washing buffer at 37 ℃ for 2 h and incubated overnight at 4 ℃ with rabbit anti-HOXA10 and anti-ITGB3 polyclonal antibody (Bioss, Beijing, China). The following day, endometrial stromal cells were washed with washing buffer (thrice for 10 min each) and then incubated with goat anti-rabbit immunoglobulin G secondary antibody (Bioss, Beijing, China) at 37 ℃ for 1 h. Endometrial stromal cells were mounted on glass slides and observed under a fluorescence microscope (Nikon, Japan). 2.11 Transmission electron microscopy (TEM) Collect cells or bacteria precipitation after centrifuge, requiring the precipitation should be at least mung beans size. The TEM fixative (Servicebio, China) was added to the tube and let the precipitation re-suspended in the fixative, and then fixed at 4℃ for preservation and transportation. The cuprum grids were observed under TEM and take images. Transmission Electron Microscope using hitachis’ factory production (HT7800). 2.12 Mice administration Animal experimentation protocols were approved by the Ethics Committee of the First Hospital of Lanzhou University (Approval number: LDYYSZLL2021-005), and were conducted in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals and ARRIVE guidelines. The 6-8-week-old female C57BL/6 mice were purchased from the Experimental Animal Center of Lanzhou University. Mice were housed with controlled temperatures (22 ± 1 ℃), humidity (40–60%), and light/dark cycles (12 hours each) under pathogen-free conditions. Mice in the PFOS group were given different concentrations of PFOS (0.5 mg/kg, 1 mg/kg, and 2 mg/kg) by gavage for 21 consecutive days, while the control group was given an equal amount of saline, and after 21 days, sampling was carried out and mice uteri were placed in a 2.5% glutaraldehyde fixative (Servicebio, China) for subsequent electron microscopic observation of pinopodes. Mice were euthanized with a lethal dose of sodium pentobarbital (120 mg/kg). 2.13 Estrous cycle determination Mice vaginal smears were collected at 08:00 a.m. every day for 21 consecutive days, starting from day 1 of modelling. The detached vaginal epithelial cells were fixed and subjected to hematoxylin and eosin (HE) staining, followed by observation under a light microscope to determine the stage of the estrous cycle in which the mice were in. Proestrus consists of mostly round nucleated epithelial cells; estrus was characterized by cornified squamous epithelial cells; metestrus consists of cornified epithelial cells and leukocytes; The diestrus stage has a predominance of leucocytes. 2.14 Statistical analysis The statistical analyses were performed using IBM SPSS 22.0 and Graphpad prism 9. Continuous variables were presented as means ± standard deviations, and a t-test was used for comparisons. If normality was not satisfied, the Mann − Whitney U test was used for comparisons. Categorical variables were presented as a percentage. P < 0.05 was considered statistically significant. Western blotting and PCR were repeated thrice. 3. Results 3.1 PFOS inhibited cell viability The chemical structural formula of PFOS is shown in Fig. 1 A. To assess the purity of the primary endometrial stromal cells culture, immunofluorescence staining of the cells with anti-CK18 (a marker of epithelial cells) and anti-vimentin (a specific marker of stromal cells) were performed. As shown in Fig. 1 B, vimentin predominantly localized within the cytoplasm of endometrial stromal cells. To assess PFOS cytotoxicity, we used a CCK-8 to evaluate the effect of 0.01–100 µM PFOS on endometrial stromal cell proliferation for 24 h. The CCK-8 assay revealed that PFOS inhibited human endometrial stromal cells in a concentration-dependent manner, compared to the control group (Fig. 1 C). We further treated cells with 0.1µM PFOS for 12-60h and found that cell viability decreased with increasing duration of action (Fig. 1 D). The morphology of the cells changed in response to PFOS, by becoming more wrinkled and sparse (Fig. 1 E). 3.2 PFOS induced apoptosis in endometrial stromal cells Next, we used RT-qPCR and Western Blot technology to detect the expression of apoptosis-related genes Bax and Bcl-2 in cells. As shown in Fig. 2 A, PFOS exposure significantly increased the mRNA expression of Bax, a pro-apoptotic indicator, and decreased the mRNA expression of Bcl-2, an anti-apoptotic indicator, compared with the control group. Consistent with our qRT-PCR results, PFOS treatment significantly increased Bax protein expression and decreased Bcl-2 protein expression (Fig. 2 B, E). We further examined the effect of PFOS on apoptosis by flow cytometry, as shown in Fig. 2 C-D, Q2 and Q3 area indicated late apoptotic or necrotic cells and early apoptotic cells, respectively, and their combination indicated the proportion of apoptotic cells. Our results showed that 1 µM PFOS treatment significantly increased apoptosis in normal cells (3.06% vs. 15.28%). 3.3 Transcriptomics analysis The effects of PFOS were further analysed by transcriptomics. The PCA showed satisfactory separation between the two groups, the PFOS group all clustered on the left side and the control group all clustered on the right side (Fig. 3 A). The Venn diagram shows the number of common and specific genes between the two groups (Fig. 3 B). The volcano plots showed the differential genes between the control and PFOS groups, there were a total of 1204 differentially expressed genes between the two groups, of which 441 were up-regulated and 763 were down-regulated (Fig. 3 C). As shown in Fig. 4 A, the heatmap showed the top 20 genes with the greatest differential expression. We carried out GO and KEGG enrichment analyses to examine the differences in gene function enrichment and pathways between the two groups. The results of the GO annotation analysis showed that the differential genes were mainly enriched in cell cycle process, mitotic cell cycle process, and regulation of biological process, etc (Fig. 4 B). KEGG enrichment analysis revealed that these differential genes were mainly enriched in in cell cycle, cell adhesion molecules, and homologous recombination, etc (Fig. 4 C). We found that the cell cycle is a biological process and pathway in which differential genes are predominantly enriched. Therefore, we performed the cell cycle assay by flow cytometry, and found that PFOS treatment resulted in an increased proportion of the endometrial stromal cells population in the G1 phases (increased cell cycle arrest) (Fig. 4 D). 3.4 PFOS down-regulated endometrial receptivity in endometrial stromal cells Next, we explored the effect of PFOS on the biomarkers of endometrial receptivity. HOXA10 and ITGB3 are important indicators associated with endometrial receptivity. Molecular docking showed that the binding energies of PFOS with HOXA10 and ITGB3 were − 6.2 kcal/mol and − 6.5 kcal/mol, respectively, suggesting a strong interaction between them (Fig. 5 A). RT-qPCR results showed that PFOS treatment significantly reduced the mRNA levels of HOXA10 and ITGB3 compared with the control group (Fig. 5 B), similarly, Western Blot results showed that PFOS treatment significantly reduced the protein levels of HOXA10, ITGB3, and FOXO1 (Fig. 5 C, D). Consistent with the Western Blot results, immunofluorescence further confirmed that PFOS reduced the expression of HOXA10 and ITGB3 in endometrial stromal cells (Fig. 5 F,G). In addition, transmission electron microscopy showed that the mitochondrial structure was impaired in the endometrial stromal cells after 1 µM PFOS treatment for 24 h, as evidenced by the slight swelling of mitochondria (red arrows), the thinning of the matrix within them, and the breakage of the cristae (Fig. 5 E), which provided a more specific explanation for the negative effects of PFOS on the endometrial stromal cells. 3.5 Effects of PFOS exposure in mice We further explored the effects of PFOS by mice experiments (Fig. 6 A). Monitoring of the estrous cycle in all groups of mice revealed that PFOS administered mice exhibited disturbances in the estrous cycle. It was seen that the control group presented a normal estrous cycle, PFOS exposure led to disruption of the estrous cycle in mice, with the low (0.5 mg/kg) and medium (1 mg/kg) PFOS dose groups showing a stay in one period for multiple days, and the high (2 mg/kg) PFOS dose group persisting in a non-estrous state (Fig. 6 C, D). In addition, as shown in Fig. 6 B, the gross morphology of the mice uterus was significantly thinner and smaller after treatment with 2 mg/kg of PFOS compared with the control group. Scanning electron microscopy results showed severe cytosolic synapse damage with increasing concentrations of PFOS drug exposure in mice, indirectly responding to decreased endometrial receptivity (Fig. 6 E). 4. Discussions Women fertility crisis has been a hot topic recently, endometrial receptivity thus draws more and more attention as a crucial factor of fertilization. Our study combined cell and animal experiments exploring the effects of PFOS on endometrium and potential effect mechanism. PFOS is a part of PFAS, even though its applies have been banned by China since 2019[ 16 ], the risks on human health caused by its high emmision and persistence previously can still be worrying. The distribution of PFOS in human body is wide, so far, it has been detected in blood, urine, and breast milk[ 17 – 19 ]. Beyond that, the existence of PFOS in placenta is also noteworthy for its highest concentration among various PFAS in placenta which reaches to 0.84ng/g[ 20 ]. Reported by a study on primary human decidual stromal cells, PFOS can disrupts cortisol regeneration and then impairs decidualization and immune tolerance environment in early pregnancy[ 11 ]. Anothor investigation on women with endometriosis indicated that their median concentration of total PFOS in serum was 12.6ng/mL, notably higher than normal wmen. Meanwhile, the concentrations of total PFOS and its isomeride were significantly associated with endometriosis[ 21 ]. These studies showed that PFOS exposure may cause negative effects on uterus. We found PFOS can lower the viability of primary human endometrial stromal cells with concentration and time - dependent pattern. Taking this as the starting point, we explored the effect mechnaism of PFOS on uterus subsequently. After treated with 1µM PFOS, the proportion of apoptotic cells obviously increased, from 3.06–15.28%. Meanwhile, the apoptosis-related molecular Bax and Bcl-2, their mRNA and protien expression were also notably changed. Then, transcriptomics analysis showed the differential genes between PFOS treated group and control group were mainly enriched in cell cycle, the subsequent result also found obvious cell cycle arrest in G1 phase after 1µM PFOS treatment. Apoptosis is a programmed death in cell, strongly associated with cell proliferation[ 22 ]. Cell cycle can regualte apoptosis, manifesting as cell apoptosis needs to effect on moleculars in G1 late phase and the transformation from G1 phase to S phase needs the control of p53[ 23 , 24 ], which can lead the decrease of Bcl-2 and the increase of Bax to trigger apoptosis[ 25 , 26 ]. These changes on apoptosis and cell cycle provides possible explanation for uterus toxicity of PFOS. Endometrial receptivity was influenced by estrogen, progesterone and multiple endocrine factors, promoting the attachment, invasion and development of blastaea[ 27 , 28 ]. The impairment of endometrial receptivity is deemed as the major reaseon of embryo implantation failure[ 29 ]. Vascular endothelial growth factor (VEGF) plays crucial role in embryo implantation and development in early pregnancy, its increased expression is conducive to improve endometrial receptivity[ 30 ]. Meanwhile, FOXO1 can regualte VEGF-A directly. It plays important role in angiogenesis through down-regualting anti-angiogenic signal CD36, activating pro-angiogenic signal VEGF and building polarity of endothelial cells[ 31 ]. HOXA10, which is also necessary for embryo implantation, its expression in endometrium was lower in women with endometriosis, adenomyosis and recurrent abortion[ 32 – 34 ]. Besides, the expression of ITGB3 was decreased in women with recurrent abortion and positvely related to the expression of HOXA10[ 35 , 36 ]. Our results found PFOS exposure caused decreased mRNA and protein expression of HOXA10, ITGB3 and FOXO1, confirming the damage of PFOS on endometrial receptivity. Another study indicated that PFOS exposure can disrupt trophoblast motility including migration, invasion and angiopoiesis by excessive reactive oxygen species (ROS), reduced ATP and declined mitochondrial membrane potential[ 37 ] while mitochondrial dysfunction will cause polarization of M1-like macrophages in decidua and induce recurrent abortion[ 38 ]. We also found swollen mitochondria and cristae fracture in primary human endometrial stromal cells, these mitochondrial damage characteristics were consistent with previous studies. Our results provided more evidences for confirming the negative effects of PFOS on uterus. The menstrual cycle can also influenced by PFOS. In a cross-sectional study, women with higher concentration of PFOS had higher odds of irregular and long menstrual cycle[ 7 ]. Its finding was also supported by another study[ 39 ]. Animal experiments showed that took 10mg/kg PFOS orally exhibited activation of AVPV-kisspeptin neurons, caused decreased gonadotropin-releasing hormone (GnRH), progesterone and luteinizing hormone (LH) and thus induced decreased corpus luteum and prolonged gestation period[ 40 ]. In addition, it was also reported that PFOS exposure induced increased estradiol and irregular estrous state more frequently[ 41 ]. In our study, 2mg/kg treated group had smaller and thiner uterus and persisting in a non-estrous state. With all of these reults together, the effects of PFOS on neruo-reproductive endocrinology may associated with its damages on uterus. This stuyd combined in vivo and in vitro experiments, exploring the effect mechnaism of PFOS on uterus from different aspects. We provided more experimental evidence for confirming uterus toxicity of PFOS, but there are several limitations. First, sex hormones are also indispensable for the normal function of endometrium, but we did not detected the changes of sex hormones and aromatase activity in mice after PFOS exposure. In addition, we only detected partial phenotypes, whereas PFOS may affect endometrium by modulating some signal pathway, such as PI3K/AKT/mTOR is a classic pathway which realted to apoptosis[ 42 , 43 ]. Furthermore, the primary human endometrial stromal cells we used were extracted from different individual, it may have certain individual difference so we expected these results could be verified by more stable cell lines. The threats of PFAS are more and more arrestive and it has been an urgent problem. We hope more studies could figure out their pathogenic mechanism, urging related department take effective measures to reduce their emission and intervene the harmful effects early. Declarations Ethics approval and consent to participate Endometrial tissue sample collection for this study was approved by the Ethics Committee of the First Hospital of Lanzhou University (Approval number: LDYYSZLLKH2023-04). Endometrial tissue samples were obtained from women attending the Reproductive Center of the First Hospital of Lanzhou University. Written informed consent was obtained from patient prior to acquisition of samples in accordance with the Declaration of Helsinki. Animal experimentation protocols were approved by the Ethics Committee of the First Hospital of Lanzhou University (Approval number: LDYYSZLL2021-005), and were conducted in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals and ARRIVE guidelines. The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Consent for publication Not Applicable. Funding The Article was supported by the Gansu Youth Science and Technology Fund (23JRRA1617), Gansu Province Health Care Industry Research Program (GSWSHL2022-07). Data availability Data is provided within the manuscript or supplementary information files. Raw document of all gene data has been uploaded to the Gene Expression Omnibus (GEO) as GSE279228 (https://www.ncbi.nlm.nih.gov/). Authorship contribution statement All authors contributed to the study conception and design. Rui Ren, Xuehong Zhang and Haofei Shen: design the project. Xinyue Zhou and Tianyu Jia: data collection and management. Ji Song and Min Gao: data analysis, manuscript writing. Ahui Liu, Liulin Yu and Bin Wang: data analysis. Manuscript editing was conducted by Yuanxue Jing and Liyan Wang. All authors read and approved the final manuscript. References Lindstrom, A.B., M.J. Strynar, and E.L. Libelo, Polyfluorinated compounds: past, present, and future. Environ Sci Technol, 2011. 45 (19): p. 7954-61. Pan, Y., et al., Profiles of Emerging and Legacy Per-/Polyfluoroalkyl Substances in Matched Serum and Semen Samples: New Implications for Human Semen Quality. Environ Health Perspect, 2019. 127 (12): p. 127005. Pilli, S., et al., Detection and removal of poly and perfluoroalkyl polluting substances for sustainable environment. J Environ Manage, 2021. 297 : p. 113336. Zhuchen, H.Y., et al., Research Progress on Neurodevelopmental Toxicity in Offspring after Indirect Exposure to PFASs in Early Life. Toxics, 2023. 11 (7). Xie, M.Y., et al., Per- and polyfluoroalkyl substances (PFAS) exposure in plasma and their blood-brain barrier transmission efficiency-A pilot study. Environ Int, 2024. 187 : p. 108719. Koskela, A., et al., Perfluoroalkyl substances in human bone: concentrations in bones and effects on bone cell differentiation. Sci Rep, 2017. 7 (1): p. 6841. Zhou, W., et al., Plasma Perfluoroalkyl and Polyfluoroalkyl Substances Concentration and Menstrual Cycle Characteristics in Preconception Women. Environ Health Perspect, 2017. 125 (6): p. 067012. Zhang, S., et al., Association of Perfluoroalkyl and Polyfluoroalkyl Substances With Premature Ovarian Insufficiency in Chinese Women. J Clin Endocrinol Metab, 2018. 103 (7): p. 2543-2551. Qin, X.D., et al., Prenatal Exposure to PFAS, Associations with Preterm Birth and Modification by Maternal Estrogen Levels: The Maoming Birth Study. Environ Health Perspect, 2023. 131 (11): p. 117006. Gellersen, B., I.A. Brosens, and J.J. Brosens, Decidualization of the human endometrium: mechanisms, functions, and clinical perspectives. Semin Reprod Med, 2007. 25 (6): p. 445-53. Yang, Q., et al., Effect of PFOS on glucocorticoid-induced changes in human decidual stromal cells in the first trimester of pregnancy. Reprod Toxicol, 2016. 63 : p. 142-50. Lavogina, D., et al., Endocrine disrupting chemicals interfere with decidualization of human primary endometrial stromal cells in vitro. Front Endocrinol (Lausanne), 2022. 13 : p. 903505. Wang, Z., et al., ATF3 deficiency impairs the proliferative-secretory phase transition and decidualization in RIF patients. Cell Death Dis, 2021. 12 (4): p. 387. Bolger, A.M., M. Lohse, and B. Usadel, Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics, 2014. 30 (15): p. 2114-20. Trott, O. and A.J. Olson, AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem, 2010. 31 (2): p. 455-61. Sun, X., et al., Correlation analysis between per-fluoroalkyl and poly-fluoroalkyl substances exposure and depressive symptoms in adults: NHANES 2005-2018. Sci Total Environ, 2024. 906 : p. 167639. Shearer, J.J., et al., Serum Concentrations of Per- and Polyfluoroalkyl Substances and Risk of Renal Cell Carcinoma. J Natl Cancer Inst, 2021. 113 (5): p. 580-587. Worley, R.R., et al., Per- and polyfluoroalkyl substances in human serum and urine samples from a residentially exposed community. Environ Int, 2017. 106 : p. 135-143. Zheng, G., et al., Per- and Polyfluoroalkyl Substances (PFAS) in Breast Milk: Concerning Trends for Current-Use PFAS. Environ Sci Technol, 2021. 55 (11): p. 7510-7520. Pascali, J.P., et al., Analysis and distribution of per- and polyfluoroalkyl substances in decidua and villi placenta explants. Environ Res, 2023. 229 : p. 115955. Ao, J., et al., Environmental exposure to legacy and emerging per- and polyfluoroalkyl substances and endometriosis in women of childbearing age. Sci Total Environ, 2024. 907 : p. 167838. Elmore, S., Apoptosis: a review of programmed cell death. Toxicol Pathol, 2007. 35 (4): p. 495-516. Alenzi, F.Q., Links between apoptosis, proliferation and the cell cycle. Br J Biomed Sci, 2004. 61 (2): p. 99-102. Sun, Y., et al., The Influence of Cell Cycle Regulation on Chemotherapy. Int J Mol Sci, 2021. 22 (13). Miyashita, T., et al., Tumor suppressor p53 is a regulator of bcl-2 and bax gene expression in vitro and in vivo. Oncogene, 1994. 9 (6): p. 1799-805. Yin, C., et al., Bax suppresses tumorigenesis and stimulates apoptosis in vivo. Nature, 1997. 385 (6617): p. 637-40. Altmäe, S. and L. Aghajanova, Growth Hormone and Endometrial Receptivity. Front Endocrinol (Lausanne), 2019. 10 : p. 653. Guo, J., et al., Using organoids to investigate human endometrial receptivity. Front Endocrinol (Lausanne), 2023. 14 : p. 1158515. Norwitz, E.R., D.J. Schust, and S.J. Fisher, Implantation and the survival of early pregnancy. N Engl J Med, 2001. 345 (19): p. 1400-8. Mrozikiewicz, A.E., M. Ożarowski, and P. Jędrzejczak, Biomolecular Markers of Recurrent Implantation Failure-A Review. Int J Mol Sci, 2021. 22 (18). Adiguzel, D. and C. Celik-Ozenci, FoxO1 is a cell-specific core transcription factor for endometrial remodeling and homeostasis during menstrual cycle and early pregnancy. Hum Reprod Update, 2021. 27 (3): p. 570-583. Tiberi, F., et al., Prokineticin 1, homeobox A10, and progesterone receptor messenger ribonucleic acid expression in primary cultures of endometrial stromal cells isolated from endometrium of healthy women and from eutopic endometrium of women with endometriosis. Fertil Steril, 2010. 94 (7): p. 2558-63. Celik, O., et al., Laparoscopic endometrioma resection increases peri-implantation endometrial HOXA-10 and HOXA-11 mRNA expression. Fertil Steril, 2015. 104 (2): p. 356-65. Zhu, M., et al., Human chorionic gonadotropin improves endometrial receptivity by increasing the expression of homeobox A10. Mol Hum Reprod, 2020. 26 (6): p. 413-424. Germeyer, A., et al., Endometrial beta3 integrin profile reflects endometrial receptivity defects in women with unexplained recurrent pregnancy loss. Reprod Biol Endocrinol, 2014. 12 : p. 53. Qu, X.L., et al., Effect of 2,3',4,4',5-Pentachlorobiphenyl Exposure on Endometrial Receptivity and the Methylation of HOXA10. Reprod Sci, 2018. 25 (2): p. 256-268. Zhao, Y., et al., Perfluorooctane sulfonate exposure induces preeclampsia-like syndromes by damaging trophoblast mitochondria in pregnant mice. Ecotoxicol Environ Saf, 2022. 247 : p. 114256. Wang, L., et al., Decorin promotes decidual M1-like macrophage polarization via mitochondrial dysfunction resulting in recurrent pregnancy loss. Theranostics, 2022. 12 (17): p. 7216-7236. Fei, C., et al., Maternal levels of perfluorinated chemicals and subfecundity. Hum Reprod, 2009. 24 (5): p. 1200-5. Wang, X., et al., Impact of Perfluorooctane Sulfonate on Reproductive Ability of Female Mice through Suppression of Estrogen Receptor α-Activated Kisspeptin Neurons. Toxicol Sci, 2018. 165 (2): p. 475-486. Du, G., et al., Neonatal and juvenile exposure to perfluorooctanoate (PFOA) and perfluorooctane sulfonate (PFOS): Advance puberty onset and kisspeptin system disturbance in female rats. Ecotoxicol Environ Saf, 2019. 167 : p. 412-421. Xu, K., et al., SIRT3 ameliorates osteoarthritis via regulating chondrocyte autophagy and apoptosis through the PI3K/Akt/mTOR pathway. Int J Biol Macromol, 2021. 175 : p. 351-360. Tong, C., et al., Insulin resistance, autophagy and apoptosis in patients with polycystic ovary syndrome: Association with PI3K signaling pathway. Front Endocrinol (Lausanne), 2022. 13 : p. 1091147. Additional Declarations No competing interests reported. Supplementary Files supplementarymaterialsUncutwesternblotstrips.docx Cite Share Download PDF Status: Published Journal Publication published 11 Jan, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 22 Nov, 2024 Reviews received at journal 17 Nov, 2024 Reviewers agreed at journal 09 Nov, 2024 Reviews received at journal 25 Oct, 2024 Reviewers agreed at journal 25 Oct, 2024 Reviewers agreed at journal 24 Oct, 2024 Reviewers invited by journal 24 Oct, 2024 Editor assigned by journal 24 Oct, 2024 Editor invited by journal 15 Oct, 2024 Submission checks completed at journal 14 Oct, 2024 First submitted to journal 19 Sep, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5117605","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":381425796,"identity":"b12ff72a-86d9-4055-ae4b-7aaaf8b26d15","order_by":0,"name":"Rui Ren","email":"","orcid":"","institution":"The First Clinical Medical College of Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Rui","middleName":"","lastName":"Ren","suffix":""},{"id":381425797,"identity":"be260e5d-c86b-4ae6-9939-7da13768fb37","order_by":1,"name":"Xinyue Zhou","email":"","orcid":"","institution":"The First Clinical Medical College of Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Xinyue","middleName":"","lastName":"Zhou","suffix":""},{"id":381425798,"identity":"42fd65ba-8f27-4257-a080-9c1aeb88e292","order_by":2,"name":"Tianyu Jia","email":"","orcid":"","institution":"The First Clinical Medical College of Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Tianyu","middleName":"","lastName":"Jia","suffix":""},{"id":381425799,"identity":"95f54b38-1608-4fc0-9c57-6fe2061d8f22","order_by":3,"name":"Bin Wang","email":"","orcid":"","institution":"The First Hospital of Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Bin","middleName":"","lastName":"Wang","suffix":""},{"id":381425800,"identity":"2fd065f7-e75a-4f6e-87f2-dfdc9a7193e9","order_by":4,"name":"Ahui Liu","email":"","orcid":"","institution":"The First Clinical Medical College of Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Ahui","middleName":"","lastName":"Liu","suffix":""},{"id":381425801,"identity":"46f6cbf0-4c79-4701-ac55-2aee7b7e0efa","order_by":5,"name":"Ji Song","email":"","orcid":"","institution":"The First Hospital of Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Ji","middleName":"","lastName":"Song","suffix":""},{"id":381425802,"identity":"414b452c-15ee-457b-b8c5-8868a53f6157","order_by":6,"name":"Liyan Wang","email":"","orcid":"","institution":"The First Hospital of Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Liyan","middleName":"","lastName":"Wang","suffix":""},{"id":381425803,"identity":"50b919df-dd69-4279-8610-23550a01896e","order_by":7,"name":"Yuanxue Jing","email":"","orcid":"","institution":"The First Hospital of Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Yuanxue","middleName":"","lastName":"Jing","suffix":""},{"id":381425804,"identity":"6e6018bf-c257-48d1-aedd-688b4174add9","order_by":8,"name":"Liulin Yu","email":"","orcid":"","institution":"The First Hospital of Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Liulin","middleName":"","lastName":"Yu","suffix":""},{"id":381425805,"identity":"061f9265-c560-4b41-af88-9716baeb3406","order_by":9,"name":"Haofei Shen","email":"","orcid":"","institution":"The First Hospital of Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Haofei","middleName":"","lastName":"Shen","suffix":""},{"id":381425807,"identity":"51c48f77-d6db-4a5f-b193-ca9bc70bd410","order_by":10,"name":"Xuehong Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5klEQVRIiWNgGAWjYDACCShtwN7cAKIZG4jXwnOQZC0SiURqkZ/d/Ozh17bDcuaSD5s/8zDYyG44wPzsAT4tjHOOmRvLnDlsbDk7scGYhyHNeMMBNnMDfFqYJRLMpCUqDiduuJ3YkMzDAGQc4GGTwKeFTSL9m7SEweH6DTcPNhzmYfhPWAuPRI6Z5IeKwwkGNxgbm3kYDhDWIiGRUybNcCbdcMOZxGbGOQbJxjMPs5nh1SI/I32b5M82a3mD44cPf3hTYSfbd7z5GV4tIMDMA2eCgoqZkHogYPxBhKJRMApGwSgYwQAAWjZId1pcNDsAAAAASUVORK5CYII=","orcid":"","institution":"The First Clinical Medical College of Lanzhou University","correspondingAuthor":true,"prefix":"","firstName":"Xuehong","middleName":"","lastName":"Zhang","suffix":""},{"id":381425808,"identity":"e82533a9-4028-43f1-b39f-0cce16722dcc","order_by":11,"name":"Min Gao","email":"","orcid":"","institution":"The First Clinical Medical College of Lanzhou University","correspondingAuthor":false,"prefix":"","firstName":"Min","middleName":"","lastName":"Gao","suffix":""}],"badges":[],"createdAt":"2024-09-19 14:08:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5117605/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5117605/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-024-84732-2","type":"published","date":"2025-01-11T15:57:52+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":72315948,"identity":"454243d9-c9a8-4864-9acd-f9e9e1df8d00","added_by":"auto","created_at":"2024-12-25 07:54:11","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":658575,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of PFOS on human endometrial stromal cells viability.\u003cstrong\u003e \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eMolecular formula of PFOS. (\u003cstrong\u003eB\u003c/strong\u003e) Characterization of primary human endometrial stromal cells. (\u003cstrong\u003eC) \u003c/strong\u003eThe effect of different concentrations of PFOS on cell viability was detected by CCK8 assay. (\u003cstrong\u003eD\u003c/strong\u003e) Effect of PFOS on cell viability at different times of action. (\u003cstrong\u003eE\u003c/strong\u003e) Effect of different concentrations of PFOS on cell morphology. Results are presented as the means ± SEM. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-5117605/v1/f53a6edbd557c114d59816a7.png"},{"id":72315947,"identity":"1b262594-08ca-47a2-ba05-f2d87f4a088e","added_by":"auto","created_at":"2024-12-25 07:54:11","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":449833,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of PFOS on endometrial stromal cells apoptosis. (\u003cstrong\u003eA\u003c/strong\u003e) The mRNA expression levels of Bax, Bcl-2 were detected by using RT-qPCR. (\u003cstrong\u003eB,E\u003c/strong\u003e) Expression and quantification of Bax and Bcl-2 proteins in cells. (\u003cstrong\u003eC,D\u003c/strong\u003e) Cell apoptosis was measured by flow cytometry. Results are presented as the means ± SEM. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-5117605/v1/b4f98fdf7db611de7952a7ac.png"},{"id":72315950,"identity":"6e3daf5b-b914-4b76-a72f-13e2892c2933","added_by":"auto","created_at":"2024-12-25 07:54:11","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":268249,"visible":true,"origin":"","legend":"\u003cp\u003eTranscriptomic analysis after PFOS treatment. (\u003cstrong\u003eA\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eThe PCA scores plot of control and PFOS group, n=3 per group. (\u003cstrong\u003eB\u003c/strong\u003e) Venn diagram of thecontrol and PFOS group. (\u003cstrong\u003eC\u003c/strong\u003e) Volcano plots of the differential genes in control and PFOS group, red denotes the up-regulation of differential genes, blue denotes down-regulation of differential genes, and grey represents non-significant differential genes.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-5117605/v1/65148a643fd6140c32f12266.png"},{"id":72315953,"identity":"df6ad9c6-16e9-4769-9a6f-20b096e4a0d4","added_by":"auto","created_at":"2024-12-25 07:54:11","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":535483,"visible":true,"origin":"","legend":"\u003cp\u003eEnrichment analysis of differential genes. (\u003cstrong\u003eA\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eHeat map of the top 20 differential genes between the two groups. (\u003cstrong\u003eB\u003c/strong\u003e) GO enrichment analysis. (\u003cstrong\u003eC\u003c/strong\u003e) KEGG enrichment analysis. (\u003cstrong\u003eD\u003c/strong\u003e) Cell cycle analysis.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-5117605/v1/3c099debb2c4b992899a8c63.png"},{"id":72316253,"identity":"6d52a3a2-6c24-4e37-8a19-582294cef91c","added_by":"auto","created_at":"2024-12-25 08:02:11","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":989093,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of PFOS on endometrial receptivity. (\u003cstrong\u003eA\u003c/strong\u003e) Molecular docking of PFOS with HOXA10 and ITGB3. (\u003cstrong\u003eB\u003c/strong\u003e) The mRNA expression levels of HOXA10, ITGB3 were detected by using RT-qPCR. (\u003cstrong\u003eC-D\u003c/strong\u003e) Expression and quantification of HOXA10, ITGB3 and FOXO1 proteins in cells. (\u003cstrong\u003eE\u003c/strong\u003e) Transmission electron microscopy showed the normal mitochondrial morphology (green arrow), mitochondrial damage (red arrow) in endometrial stromal cells. Immunofluorescence staining reveals expression of HOXA10 (\u003cstrong\u003eF\u003c/strong\u003e) and ITGB3 (\u003cstrong\u003eG\u003c/strong\u003e) in endometrial stromal cells, Scale bar = 200 μm. Results are presented as the means ± SEM. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-5117605/v1/8cba74e5e8022487a3ee9322.png"},{"id":72315952,"identity":"6c63a64b-7942-4557-aca5-2fdcf909e349","added_by":"auto","created_at":"2024-12-25 07:54:11","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1064489,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of PFOS exposure in mice. (\u003cstrong\u003eA\u003c/strong\u003e)\u003cstrong\u003e \u003c/strong\u003eFlow chart of mice handling in each group. (\u003cstrong\u003eB\u003c/strong\u003e) The change in gross morphology of the uterine tissue after PFOS treatment. (\u003cstrong\u003eC\u003c/strong\u003e) Typical images of vaginal smears from mice at different stages of the estrous cycle, Scale bar = 200 μm. (\u003cstrong\u003eD\u003c/strong\u003e) Effects of PFOS exposure on the estrous cycle in mice (P: proestrus; E: estrus; M: metestrus; D: diestrus). (\u003cstrong\u003eE) \u003c/strong\u003ePinopodes morphology under scanning electron microscope, Scale bar = 100 μm, n=5 per group.\u003c/p\u003e","description":"","filename":"floatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-5117605/v1/57a8ab62a8c6d8c1dbf2cfc8.png"},{"id":73694095,"identity":"e55b40e6-9743-4556-a3f9-72b02f9161e5","added_by":"auto","created_at":"2025-01-13 16:10:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5399746,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5117605/v1/d287112e-e321-4ebd-af30-c8f60b42eb5a.pdf"},{"id":72315954,"identity":"70f330b5-df6e-4e48-8df7-2ec10be2689f","added_by":"auto","created_at":"2024-12-25 07:54:11","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":8597269,"visible":true,"origin":"","legend":"","description":"","filename":"supplementarymaterialsUncutwesternblotstrips.docx","url":"https://assets-eu.researchsquare.com/files/rs-5117605/v1/420fb95125a339badde4bd7c.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Developmental exposure to perfluorooctanoic sulfonate(PFOS) impairs the endometrial receptivity","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003ePerfluorinated compounds are a class of organic pollutants in which the hydrogen atoms on the carbon chain and alkyl groups are completely replaced by fluorine atoms. This category includes perfluoroalkylamines, perfluoroethers and perfluoroalkanoic acids[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Due to their high-energy bonds, perfluoroalkanoic acids exhibit excellent physicochemical stability and biological stability, making them of significant industrial value. They are widely used in industries such as textiles, food packaging, cosmetics, coatings, electronics products, and home furnishings[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Among these compounds, PFOS has half-life of 3.4 years in human serum due to its robust carbon-fluorine bond that imparts thermal-chemical stability; thus it remains uneliminated in both external environments and within the human body[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDue to the extensive use of PFOS in industrial production, it enters the atmosphere, water, soil and other environmental media through various ways[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. International research has revealed elevated levels of PFOS accumulation in human liver tissues as well as kidneys and bones. It exerts toxicity on multiple systems including endocrine system, nervous system, immune system, reproductive system etc, and its exposure level is closely related to the occurrence of a variety of diseases[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAn increasing number of studies have confirmed that PFOS exposure is related to female reproductive system diseases. A clinical study on Chinese women showed that serum PFOS concentration was negatively correlated with prolonged menstrual cycle length and menorrhagia[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. In addition, other studies have suggested that PFOS exposure is associated with primary ovarian insufficiency and preterm birth[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. In female infertility, endometrial function and receptivity status are key factors affecting pregnancy success. Decidualization is a morphological and functional change experienced by endometrial stromal cells to support endometrial receptivity[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. At present, it has been reported that PFOS inhibits decidualization of stromal cells, and PFOS disrupts the regeneration of cortisol in decidual tissue by inhibiting the reduction of key proinflammatory cytokines in maternal-fetal immune intolerance, thus impairing decidualization and immune tolerance environment in early pregnancy[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. In addition, PFOS exposure can reduce the activity of protein kinases PKA, ROCK and Akt/PKB and prolactin secretion in human endometrial stromal cells, thereby affecting the process of endometrial decidualization[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFew studies have evaluated the effect of PFOS on endometrial stromal cells in vitro, despite reports of its effects on the reproductive system. The process of PFOS interference with endometrial decidualization, which forms the substrate for embryo implantation, must be further investigated. Therefore, To enhance our understanding of the mechanisms of endometrial regulation after PFOS exposure, our study aimed to assess whether any associations exist between the following: (1) PFOS exposure and endometrial receptivity indexes; (2) PFOS concentrations and pinopodes morphology.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Chemicals and reagents\u003c/h2\u003e \u003cp\u003ePFOS was obtained from Dr. Ehrenstorfer (Augsburg, Germany) and dissolved in dimethyl sulfoxide (DMSO); The culture medium DMEM was obtained from Biosharp (China); fetal bovine serum was obtained from Animal Blood Ware (China); 0.25% trypsin ethylenediaminetetraacetic acid solution and penicillin-streptomycin double antibody solution were obtained from Basaimedia (China). The collagenase I was obtained from Solarbio (China). The cell counting kit-8 and cell tissue lysate for RNA extraction were obtained from Coolaber (China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Isolation and culture of endometrial stromal cells\u003c/h2\u003e \u003cp\u003e Endometrial tissue sample collection for this study was approved by the Ethics Committee of the First Hospital of Lanzhou University (Approval number: LDYYSZLLKH2023-04). Endometrial tissue samples were obtained from women attending the Reproductive Center of the First Hospital of Lanzhou University. Written informed consent was obtained from patient prior to acquisition of samples in accordance with the Declaration of Helsinki. As described previously[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], primary human endometrial stromal cells were isolated and cultured. Briefly, the human endometrium tissue was poured into Petri dishes and rinsed with phosphate-buffered saline (PBS) at least thrice until there was no blood. The chopped endometrial tissue was transferred to a 15 mL centrifuge tube and 3 mL of 1 mg/mL collagenase I was added. After 1 h in a 37\u0026deg;C water bath, 3 mL DMEM was added to prevent overdigestion. The digested cell supernatant was filtered and collected using a 70 \u0026micro;m screen and then centrifuged to obtain stromal cells. Subsequently, the stromal cells were resuspended in DMEM medium containing 10% fetal bovine serum and antibiotics (1% penicillin-streptomycin solution) and cultured in a cell culture incubator at at 37\u0026deg;C with 5% CO2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Cell viability assay\u003c/h2\u003e \u003cp\u003eHuman endometrial stromal cells were seeded into 96-well plates at a density of 3000 cells per well. The cells were treated with PFOS at various concentrations (0.01, 0.1, 1, 10 and 100 \u0026micro;M), and then cultured for 12, 24, 36, 48, and 60 h, respectively. Further, 10 \u0026micro;L of CCK-8 solution was added to each well, and the cells were incubated at 37\u0026deg;C for 2 h to detect cell viability.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Real-time quantitative PCR (RT-qPCR) analysis\u003c/h2\u003e \u003cp\u003eThe mRNA expression levels of Bax, Bcl-2, HOXA10, and ITGB3 were measured using RT-qPCR. Total RNAs of endometrial stromal cells were extracted with Trizol reagent (Coolaber, Beijing, China). Nanodrop 2000 spectrophotometer was used to assess the RNA purity. FastKing gDNA Dispelling RT SuperMix kit (Tiangen, Beijing, China) was used to synthesize first-strand complementary DNA. The amplification program was run in QuantStudio\u0026trade; 3 System (Thermo Fisher Scientific, Rockford, IL). SuperReal PreMix Plus was used to amplify DNA. Amplification was performed for 40 cycles consisting of 5 seconds at 95 ℃, 30 seconds at 60 ℃, and then 15 seconds at 95 ℃. Each experiment was performed in triplicates. The primers used for qPCR were synthesized by Shanghai Sangon Biotechnology Co., Ltd. and are presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences for RT-qPCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward GGAGCGAGATCCCTCCAAAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse GGCTGTTGTCATACTTCTCATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBax\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward TTTGCTTCAGGGTTTCATCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse CAGTTGAAGTTGCCGTCAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBcl2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward GAGGATTGTGGCCTTCTTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse ACAGTTCCACAAAGGCATCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHOXA10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward GGTTTGTTCTGACTTTTTGTTTCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse TGACACTTAGGACAATATCTATCTCTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eITGB3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward ACTTCTCCTGTGTCCGCTACAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eReverse GGTGTCAGTACGCGTGGTACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Western blot analysis\u003c/h2\u003e \u003cp\u003eAll proteins of endometrial stromal cells were extracted by cell lysis buffer (Coolaber). Proteins were quantified using a bicinchoninic protein assay kit (Coolaber, Beijing, China). Equal amounts of the extracts were electrophoresed on sodium dodecyl sulfate-polyacrylamide gel and transferred onto a polyvinylidene difluoride membrane (Millipore, Bedford, MA) using the electrophoresis \u0026amp; transmembrane system of Bio-Rad (Hercules, CA). The membrane was incubated with primary antibodies including GAPDH, Bax, Bcl2, HOXA10, ITGB3, FOXO1, cytokeratin 18, and vimentin from Proteintech (China). The membrane was rinsed and incubated with HRP-conjugated secondary antibody (Proteintech, Wuhan, China). Immune-reactive proteins were detected using meilunbio FGSuper sensitive enhanced chemiluminescence (Meilun, Dalian, China). The values of optical densities of the proteins were converted into quantitative data and analyzed using image J. Each experiment was performed in triplicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Flow cytometry assay\u003c/h2\u003e \u003cp\u003eCell apoptosis was detected using an Apoptosis Detection kit (Lianke, China). Collect the suspended cells, add an appropriate amount of pre-cooled 1\u0026times;Binding Buffer and mix by blowing, so that the resuspension is filtered through a screen and transferred to a flow-through tube, in which a single stained tube was added with 5 \u0026micro;L of Annexin V-FITC or 10 \u0026micro;L of PI, respectively, and incubated for 5 min away from light. Detection of Annexin V-FITC by FITC detection channel (Ex\u0026thinsp;=\u0026thinsp;488nm; Em\u0026thinsp;=\u0026thinsp;530nm) and PI by PI detection channel (Ex\u0026thinsp;=\u0026thinsp;535nm; Em\u0026thinsp;=\u0026thinsp;615nm) using a flow meter.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Transcriptomics analysis\u003c/h2\u003e \u003cp\u003eRNA extraction and cDNA synthesis as described previously (\u0026ldquo;Real-time quantitative PCR analysis\u0026rdquo;). RNA sequences were analyzed by Shanghai Majorbio Bio-pharm Biotechnology Co., Ltd. (Shanghai, China). The sequencing library was performed by Novogene using an NovaSeq 6000 PE150 platform (Illumina). Trimmomatic software was used to process raw reads[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Next, Raw sequencing data (fastq) were aligned using the HISAT2 (version 2.1.0). In order to summarize read counts for each gene, HTSeq (Version 0.6.1) was used to generate gene-level count data. Finally, genes with differential expression (log2FC\u0026thinsp;\u0026gt;\u0026thinsp;1 and \u003cem\u003eP\u003c/em\u003e value\u0026thinsp;\u0026lt;\u0026thinsp;0.05) were filtered using the DEseq algorithm.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Cell cycle analysis\u003c/h2\u003e \u003cp\u003eCell cycle stage were detected with a cell cycle assay kit (Lianke, China) using flow cytometry. Human endometrial stromal cells were seeded into 6-well plates and incubated overnight. The cells were treated with PFOS (0.01, 0.1, 1 \u0026micro;M) for 24 h. Next, the cells were collected and washed 1 time with PBS, subsequently, 1 mL of DNA staining solution and 10 \u0026micro;L of permeabilization solution were added and mixed by vortexing, and finally incubated for 30 min in the darkness at room temperature. The samples were subsequently analyzed by flow cytometry.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9 Molecular docking\u003c/h2\u003e \u003cp\u003eFirst, we downloaded the molecular structure of PFOS from the PubChem database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://pubchem.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://pubchem.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and the structures of the target proteins HOXA10, ITGB3 from the PDB database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.rcsb.org/structure\u003c/span\u003e\u003cspan address=\"https://www.rcsb.org/structure\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e), and PyMoL software was used to remove water and original ligands. Secondly, we used AutoDock Vina[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] to perform molecular docking and PyMOL to visualize the docking results. Finally, the binding strength and activity of protein targets and PFOS were assessed by molecular docking binding energy.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10 Immunofluorescence staining\u003c/h2\u003e \u003cp\u003eTwenty-four hours following PFOS exposure, endometrial stromal cells were fixed with 4% paraformaldehyde for 30 min and then washed with washing buffer (PBS containing 0.01% Triton X-100, 0.01% Tween, and 2% BSA). Afterward, the endometrial stromal cells were sealed in a washing buffer at 37 ℃ for 2 h and incubated overnight at 4 ℃ with rabbit anti-HOXA10 and anti-ITGB3 polyclonal antibody (Bioss, Beijing, China). The following day, endometrial stromal cells were washed with washing buffer (thrice for 10 min each) and then incubated with goat anti-rabbit immunoglobulin G secondary antibody (Bioss, Beijing, China) at 37 ℃ for 1 h. Endometrial stromal cells were mounted on glass slides and observed under a fluorescence microscope (Nikon, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Transmission electron microscopy (TEM)\u003c/h2\u003e \u003cp\u003eCollect cells or bacteria precipitation after centrifuge, requiring the precipitation should be at least mung beans size. The TEM fixative (Servicebio, China) was added to the tube and let the precipitation re-suspended in the fixative, and then fixed at 4℃ for preservation and transportation. The cuprum grids were observed under TEM and take images. Transmission Electron Microscope using hitachis\u0026rsquo; factory production (HT7800).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12 Mice administration\u003c/h2\u003e \u003cp\u003e Animal experimentation protocols were approved by the Ethics Committee of the First Hospital of Lanzhou University (Approval number: LDYYSZLL2021-005), and were conducted in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals and ARRIVE guidelines. The 6-8-week-old female C57BL/6 mice were purchased from the Experimental Animal Center of Lanzhou University. Mice were housed with controlled temperatures (22\u0026thinsp;\u0026plusmn;\u0026thinsp;1 ℃), humidity (40\u0026ndash;60%), and light/dark cycles (12 hours each) under pathogen-free conditions. Mice in the PFOS group were given different concentrations of PFOS (0.5 mg/kg, 1 mg/kg, and 2 mg/kg) by gavage for 21 consecutive days, while the control group was given an equal amount of saline, and after 21 days, sampling was carried out and mice uteri were placed in a 2.5% glutaraldehyde fixative (Servicebio, China) for subsequent electron microscopic observation of pinopodes. Mice were euthanized with a lethal dose of sodium pentobarbital (120 mg/kg).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13 Estrous cycle determination\u003c/h2\u003e \u003cp\u003eMice vaginal smears were collected at 08:00 a.m. every day for 21 consecutive days, starting from day 1 of modelling. The detached vaginal epithelial cells were fixed and subjected to hematoxylin and eosin (HE) staining, followed by observation under a light microscope to determine the stage of the estrous cycle in which the mice were in. Proestrus consists of mostly round nucleated epithelial cells; estrus was characterized by cornified squamous epithelial cells; metestrus consists of cornified epithelial cells and leukocytes; The diestrus stage has a predominance of leucocytes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.14 Statistical analysis\u003c/h2\u003e \u003cp\u003eThe statistical analyses were performed using IBM SPSS 22.0 and Graphpad prism 9. Continuous variables were presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviations, and a t-test was used for comparisons. If normality was not satisfied, the Mann\u0026thinsp;\u0026minus;\u0026thinsp;Whitney U test was used for comparisons. Categorical variables were presented as a percentage. \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. Western blotting and PCR were repeated thrice.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.1 PFOS inhibited cell viability\u003c/h2\u003e \u003cp\u003eThe chemical structural formula of PFOS is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. To assess the purity of the primary endometrial stromal cells culture, immunofluorescence staining of the cells with anti-CK18 (a marker of epithelial cells) and anti-vimentin (a specific marker of stromal cells) were performed. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, vimentin predominantly localized within the cytoplasm of endometrial stromal cells. To assess PFOS cytotoxicity, we used a CCK-8 to evaluate the effect of 0.01\u0026ndash;100 \u0026micro;M PFOS on endometrial stromal cell proliferation for 24 h. The CCK-8 assay revealed that PFOS inhibited human endometrial stromal cells in a concentration-dependent manner, compared to the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). We further treated cells with 0.1\u0026micro;M PFOS for 12-60h and found that cell viability decreased with increasing duration of action (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). The morphology of the cells changed in response to PFOS, by becoming more wrinkled and sparse (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.2 PFOS induced apoptosis in endometrial stromal cells\u003c/h2\u003e \u003cp\u003eNext, we used RT-qPCR and Western Blot technology to detect the expression of apoptosis-related genes Bax and Bcl-2 in cells. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, PFOS exposure significantly increased the mRNA expression of Bax, a pro-apoptotic indicator, and decreased the mRNA expression of Bcl-2, an anti-apoptotic indicator, compared with the control group. Consistent with our qRT-PCR results, PFOS treatment significantly increased Bax protein expression and decreased Bcl-2 protein expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, E). We further examined the effect of PFOS on apoptosis by flow cytometry, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC-D, Q2 and Q3 area indicated late apoptotic or necrotic cells and early apoptotic cells, respectively, and their combination indicated the proportion of apoptotic cells. Our results showed that 1 \u0026micro;M PFOS treatment significantly increased apoptosis in normal cells (3.06% vs. 15.28%).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.3 Transcriptomics analysis\u003c/h2\u003e \u003cp\u003eThe effects of PFOS were further analysed by transcriptomics. The PCA showed satisfactory separation between the two groups, the PFOS group all clustered on the left side and the control group all clustered on the right side (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). The Venn diagram shows the number of common and specific genes between the two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The volcano plots showed the differential genes between the control and PFOS groups, there were a total of 1204 differentially expressed genes between the two groups, of which 441 were up-regulated and 763 were down-regulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, the heatmap showed the top 20 genes with the greatest differential expression. We carried out GO and KEGG enrichment analyses to examine the differences in gene function enrichment and pathways between the two groups. The results of the GO annotation analysis showed that the differential genes were mainly enriched in cell cycle process, mitotic cell cycle process, and regulation of biological process, etc (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). KEGG enrichment analysis revealed that these differential genes were mainly enriched in in cell cycle, cell adhesion molecules, and homologous recombination, etc (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). We found that the cell cycle is a biological process and pathway in which differential genes are predominantly enriched. Therefore, we performed the cell cycle assay by flow cytometry, and found that PFOS treatment resulted in an increased proportion of the endometrial stromal cells population in the G1 phases (increased cell cycle arrest) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.4 PFOS down-regulated endometrial receptivity in endometrial stromal cells\u003c/h2\u003e \u003cp\u003eNext, we explored the effect of PFOS on the biomarkers of endometrial receptivity. HOXA10 and ITGB3 are important indicators associated with endometrial receptivity. Molecular docking showed that the binding energies of PFOS with HOXA10 and ITGB3 were \u0026minus;\u0026thinsp;6.2 kcal/mol and \u0026minus;\u0026thinsp;6.5 kcal/mol, respectively, suggesting a strong interaction between them (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). RT-qPCR results showed that PFOS treatment significantly reduced the mRNA levels of HOXA10 and ITGB3 compared with the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB), similarly, Western Blot results showed that PFOS treatment significantly reduced the protein levels of HOXA10, ITGB3, and FOXO1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, D). Consistent with the Western Blot results, immunofluorescence further confirmed that PFOS reduced the expression of HOXA10 and ITGB3 in endometrial stromal cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF,G). In addition, transmission electron microscopy showed that the mitochondrial structure was impaired in the endometrial stromal cells after 1 \u0026micro;M PFOS treatment for 24 h, as evidenced by the slight swelling of mitochondria (red arrows), the thinning of the matrix within them, and the breakage of the cristae (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE), which provided a more specific explanation for the negative effects of PFOS on the endometrial stromal cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Effects of PFOS exposure in mice\u003c/h2\u003e \u003cp\u003eWe further explored the effects of PFOS by mice experiments (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Monitoring of the estrous cycle in all groups of mice revealed that PFOS administered mice exhibited disturbances in the estrous cycle. It was seen that the control group presented a normal estrous cycle, PFOS exposure led to disruption of the estrous cycle in mice, with the low (0.5 mg/kg) and medium (1 mg/kg) PFOS dose groups showing a stay in one period for multiple days, and the high (2 mg/kg) PFOS dose group persisting in a non-estrous state (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC, D). In addition, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, the gross morphology of the mice uterus was significantly thinner and smaller after treatment with 2 mg/kg of PFOS compared with the control group. Scanning electron microscopy results showed severe cytosolic synapse damage with increasing concentrations of PFOS drug exposure in mice, indirectly responding to decreased endometrial receptivity (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussions","content":"\u003cp\u003eWomen fertility crisis has been a hot topic recently, endometrial receptivity thus draws more and more attention as a crucial factor of fertilization. Our study combined cell and animal experiments exploring the effects of PFOS on endometrium and potential effect mechanism.\u003c/p\u003e \u003cp\u003ePFOS is a part of PFAS, even though its applies have been banned by China since 2019[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], the risks on human health caused by its high emmision and persistence previously can still be worrying. The distribution of PFOS in human body is wide, so far, it has been detected in blood, urine, and breast milk[\u003cspan additionalcitationids=\"CR18\" citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Beyond that, the existence of PFOS in placenta is also noteworthy for its highest concentration among various PFAS in placenta which reaches to 0.84ng/g[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Reported by a study on primary human decidual stromal cells, PFOS can disrupts cortisol regeneration and then impairs decidualization and immune tolerance environment in early pregnancy[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Anothor investigation on women with endometriosis indicated that their median concentration of total PFOS in serum was 12.6ng/mL, notably higher than normal wmen. Meanwhile, the concentrations of total PFOS and its isomeride were significantly associated with endometriosis[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. These studies showed that PFOS exposure may cause negative effects on uterus.\u003c/p\u003e \u003cp\u003eWe found PFOS can lower the viability of primary human endometrial stromal cells with concentration and time - dependent pattern. Taking this as the starting point, we explored the effect mechnaism of PFOS on uterus subsequently. After treated with 1\u0026micro;M PFOS, the proportion of apoptotic cells obviously increased, from 3.06\u0026ndash;15.28%. Meanwhile, the apoptosis-related molecular Bax and Bcl-2, their mRNA and protien expression were also notably changed. Then, transcriptomics analysis showed the differential genes between PFOS treated group and control group were mainly enriched in cell cycle, the subsequent result also found obvious cell cycle arrest in G1 phase after 1\u0026micro;M PFOS treatment. Apoptosis is a programmed death in cell, strongly associated with cell proliferation[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Cell cycle can regualte apoptosis, manifesting as cell apoptosis needs to effect on moleculars in G1 late phase and the transformation from G1 phase to S phase needs the control of p53[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], which can lead the decrease of Bcl-2 and the increase of Bax to trigger apoptosis[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. These changes on apoptosis and cell cycle provides possible explanation for uterus toxicity of PFOS.\u003c/p\u003e \u003cp\u003eEndometrial receptivity was influenced by estrogen, progesterone and multiple endocrine factors, promoting the attachment, invasion and development of blastaea[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. The impairment of endometrial receptivity is deemed as the major reaseon of embryo implantation failure[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Vascular endothelial growth factor (VEGF) plays crucial role in embryo implantation and development in early pregnancy, its increased expression is conducive to improve endometrial receptivity[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Meanwhile, FOXO1 can regualte VEGF-A directly. It plays important role in angiogenesis through down-regualting anti-angiogenic signal CD36, activating pro-angiogenic signal VEGF and building polarity of endothelial cells[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. HOXA10, which is also necessary for embryo implantation, its expression in endometrium was lower in women with endometriosis, adenomyosis and recurrent abortion[\u003cspan additionalcitationids=\"CR33\" citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Besides, the expression of ITGB3 was decreased in women with recurrent abortion and positvely related to the expression of HOXA10[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Our results found PFOS exposure caused decreased mRNA and protein expression of HOXA10, ITGB3 and FOXO1, confirming the damage of PFOS on endometrial receptivity.\u003c/p\u003e \u003cp\u003eAnother study indicated that PFOS exposure can disrupt trophoblast motility including migration, invasion and angiopoiesis by excessive reactive oxygen species (ROS), reduced ATP and declined mitochondrial membrane potential[\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e] while mitochondrial dysfunction will cause polarization of M1-like macrophages in decidua and induce recurrent abortion[\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. We also found swollen mitochondria and cristae fracture in primary human endometrial stromal cells, these mitochondrial damage characteristics were consistent with previous studies. Our results provided more evidences for confirming the negative effects of PFOS on uterus.\u003c/p\u003e \u003cp\u003eThe menstrual cycle can also influenced by PFOS. In a cross-sectional study, women with higher concentration of PFOS had higher odds of irregular and long menstrual cycle[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Its finding was also supported by another study[\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Animal experiments showed that took 10mg/kg PFOS orally exhibited activation of AVPV-kisspeptin neurons, caused decreased gonadotropin-releasing hormone (GnRH), progesterone and luteinizing hormone (LH) and thus induced decreased corpus luteum and prolonged gestation period[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In addition, it was also reported that PFOS exposure induced increased estradiol and irregular estrous state more frequently[\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. In our study, 2mg/kg treated group had smaller and thiner uterus and persisting in a non-estrous state. With all of these reults together, the effects of PFOS on neruo-reproductive endocrinology may associated with its damages on uterus.\u003c/p\u003e \u003cp\u003eThis stuyd combined in vivo and in vitro experiments, exploring the effect mechnaism of PFOS on uterus from different aspects. We provided more experimental evidence for confirming uterus toxicity of PFOS, but there are several limitations. First, sex hormones are also indispensable for the normal function of endometrium, but we did not detected the changes of sex hormones and aromatase activity in mice after PFOS exposure. In addition, we only detected partial phenotypes, whereas PFOS may affect endometrium by modulating some signal pathway, such as PI3K/AKT/mTOR is a classic pathway which realted to apoptosis[\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Furthermore, the primary human endometrial stromal cells we used were extracted from different individual, it may have certain individual difference so we expected these results could be verified by more stable cell lines. The threats of PFAS are more and more arrestive and it has been an urgent problem. We hope more studies could figure out their pathogenic mechanism, urging related department take effective measures to reduce their emission and intervene the harmful effects early.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eEndometrial tissue sample collection for this study was approved by the Ethics Committee of the First Hospital of Lanzhou University (Approval number: LDYYSZLLKH2023-04). Endometrial tissue samples were obtained from women attending the Reproductive Center of the First Hospital of Lanzhou University. Written informed consent was obtained from patient prior to acquisition of samples in accordance with the Declaration of Helsinki. Animal experimentation protocols were approved by the Ethics Committee of the First Hospital of Lanzhou University (Approval number: LDYYSZLL2021-005), and were conducted in accordance with the National Institute of Health Guide for the Care and Use of Laboratory Animals and ARRIVE guidelines.\u0026nbsp;The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe Article was supported by the Gansu Youth Science and Technology Fund (23JRRA1617), Gansu Province Health Care Industry Research Program (GSWSHL2022-07).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData is provided within the manuscript or supplementary information files. Raw document of all gene data has been uploaded to the Gene Expression Omnibus (GEO) as GSE279228 (https://www.ncbi.nlm.nih.gov/).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthorship contribution statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the study conception and design. Rui Ren, Xuehong Zhang and Haofei Shen: design the project. Xinyue Zhou and Tianyu Jia: data collection and management. Ji Song and Min Gao: data analysis, manuscript writing. Ahui Liu, Liulin Yu and Bin Wang: data analysis. Manuscript editing was conducted by Yuanxue Jing and Liyan Wang. All authors read and approved the final manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLindstrom, A.B., M.J. Strynar, and E.L. Libelo, \u003cem\u003ePolyfluorinated compounds: past, present, and future.\u003c/em\u003e Environ Sci Technol, 2011. \u003cstrong\u003e45\u003c/strong\u003e(19): p. 7954-61.\u003c/li\u003e\n\u003cli\u003ePan, Y., et al., \u003cem\u003eProfiles of Emerging and Legacy Per-/Polyfluoroalkyl Substances in Matched Serum and Semen Samples: New Implications for Human Semen Quality.\u003c/em\u003e Environ Health Perspect, 2019. \u003cstrong\u003e127\u003c/strong\u003e(12): p. 127005.\u003c/li\u003e\n\u003cli\u003ePilli, S., et al., \u003cem\u003eDetection and removal of poly and perfluoroalkyl polluting substances for sustainable environment.\u003c/em\u003e J Environ Manage, 2021. \u003cstrong\u003e297\u003c/strong\u003e: p. 113336.\u003c/li\u003e\n\u003cli\u003eZhuchen, H.Y., et al., \u003cem\u003eResearch Progress on Neurodevelopmental Toxicity in Offspring after Indirect Exposure to PFASs in Early Life.\u003c/em\u003e Toxics, 2023. \u003cstrong\u003e11\u003c/strong\u003e(7).\u003c/li\u003e\n\u003cli\u003eXie, M.Y., et al., \u003cem\u003ePer- and polyfluoroalkyl substances (PFAS) exposure in plasma and their blood-brain barrier transmission efficiency-A pilot study.\u003c/em\u003e Environ Int, 2024. \u003cstrong\u003e187\u003c/strong\u003e: p. 108719.\u003c/li\u003e\n\u003cli\u003eKoskela, A., et al., \u003cem\u003ePerfluoroalkyl substances in human bone: concentrations in bones and effects on bone cell differentiation.\u003c/em\u003e Sci Rep, 2017. \u003cstrong\u003e7\u003c/strong\u003e(1): p. 6841.\u003c/li\u003e\n\u003cli\u003eZhou, W., et al., \u003cem\u003ePlasma Perfluoroalkyl and Polyfluoroalkyl Substances Concentration and Menstrual Cycle Characteristics in Preconception Women.\u003c/em\u003e Environ Health Perspect, 2017. \u003cstrong\u003e125\u003c/strong\u003e(6): p. 067012.\u003c/li\u003e\n\u003cli\u003eZhang, S., et al., \u003cem\u003eAssociation of Perfluoroalkyl and Polyfluoroalkyl Substances With Premature Ovarian Insufficiency in Chinese Women.\u003c/em\u003e J Clin Endocrinol Metab, 2018. \u003cstrong\u003e103\u003c/strong\u003e(7): p. 2543-2551.\u003c/li\u003e\n\u003cli\u003eQin, X.D., et al., \u003cem\u003ePrenatal Exposure to PFAS, Associations with Preterm Birth and Modification by Maternal Estrogen Levels: The Maoming Birth Study.\u003c/em\u003e Environ Health Perspect, 2023. \u003cstrong\u003e131\u003c/strong\u003e(11): p. 117006.\u003c/li\u003e\n\u003cli\u003eGellersen, B., I.A. Brosens, and J.J. Brosens, \u003cem\u003eDecidualization of the human endometrium: mechanisms, functions, and clinical perspectives.\u003c/em\u003e Semin Reprod Med, 2007. \u003cstrong\u003e25\u003c/strong\u003e(6): p. 445-53.\u003c/li\u003e\n\u003cli\u003eYang, Q., et al., \u003cem\u003eEffect of PFOS on glucocorticoid-induced changes in human decidual stromal cells in the first trimester of pregnancy.\u003c/em\u003e Reprod Toxicol, 2016. \u003cstrong\u003e63\u003c/strong\u003e: p. 142-50.\u003c/li\u003e\n\u003cli\u003eLavogina, D., et al., \u003cem\u003eEndocrine disrupting chemicals interfere with decidualization of human primary endometrial stromal cells in vitro.\u003c/em\u003e Front Endocrinol (Lausanne), 2022. \u003cstrong\u003e13\u003c/strong\u003e: p. 903505.\u003c/li\u003e\n\u003cli\u003eWang, Z., et al., \u003cem\u003eATF3 deficiency impairs the proliferative-secretory phase transition and decidualization in RIF patients.\u003c/em\u003e Cell Death Dis, 2021. \u003cstrong\u003e12\u003c/strong\u003e(4): p. 387.\u003c/li\u003e\n\u003cli\u003eBolger, A.M., M. Lohse, and B. Usadel, \u003cem\u003eTrimmomatic: a flexible trimmer for Illumina sequence data.\u003c/em\u003e Bioinformatics, 2014. \u003cstrong\u003e30\u003c/strong\u003e(15): p. 2114-20.\u003c/li\u003e\n\u003cli\u003eTrott, O. and A.J. Olson, \u003cem\u003eAutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading.\u003c/em\u003e J Comput Chem, 2010. \u003cstrong\u003e31\u003c/strong\u003e(2): p. 455-61.\u003c/li\u003e\n\u003cli\u003eSun, X., et al., \u003cem\u003eCorrelation analysis between per-fluoroalkyl and poly-fluoroalkyl substances exposure and depressive symptoms in adults: NHANES 2005-2018.\u003c/em\u003e Sci Total Environ, 2024. \u003cstrong\u003e906\u003c/strong\u003e: p. 167639.\u003c/li\u003e\n\u003cli\u003eShearer, J.J., et al., \u003cem\u003eSerum Concentrations of Per- and Polyfluoroalkyl Substances and Risk of Renal Cell Carcinoma.\u003c/em\u003e J Natl Cancer Inst, 2021. \u003cstrong\u003e113\u003c/strong\u003e(5): p. 580-587.\u003c/li\u003e\n\u003cli\u003eWorley, R.R., et al., \u003cem\u003ePer- and polyfluoroalkyl substances in human serum and urine samples from a residentially exposed community.\u003c/em\u003e Environ Int, 2017. \u003cstrong\u003e106\u003c/strong\u003e: p. 135-143.\u003c/li\u003e\n\u003cli\u003eZheng, G., et al., \u003cem\u003ePer- and Polyfluoroalkyl Substances (PFAS) in Breast Milk: Concerning Trends for Current-Use PFAS.\u003c/em\u003e Environ Sci Technol, 2021. \u003cstrong\u003e55\u003c/strong\u003e(11): p. 7510-7520.\u003c/li\u003e\n\u003cli\u003ePascali, J.P., et al., \u003cem\u003eAnalysis and distribution of per- and polyfluoroalkyl substances in decidua and villi placenta explants.\u003c/em\u003e Environ Res, 2023. \u003cstrong\u003e229\u003c/strong\u003e: p. 115955.\u003c/li\u003e\n\u003cli\u003eAo, J., et al., \u003cem\u003eEnvironmental exposure to legacy and emerging per- and polyfluoroalkyl substances and endometriosis in women of childbearing age.\u003c/em\u003e Sci Total Environ, 2024. \u003cstrong\u003e907\u003c/strong\u003e: p. 167838.\u003c/li\u003e\n\u003cli\u003eElmore, S., \u003cem\u003eApoptosis: a review of programmed cell death.\u003c/em\u003e Toxicol Pathol, 2007. \u003cstrong\u003e35\u003c/strong\u003e(4): p. 495-516.\u003c/li\u003e\n\u003cli\u003eAlenzi, F.Q., \u003cem\u003eLinks between apoptosis, proliferation and the cell cycle.\u003c/em\u003e Br J Biomed Sci, 2004. \u003cstrong\u003e61\u003c/strong\u003e(2): p. 99-102.\u003c/li\u003e\n\u003cli\u003eSun, Y., et al., \u003cem\u003eThe Influence of Cell Cycle Regulation on Chemotherapy.\u003c/em\u003e Int J Mol Sci, 2021. \u003cstrong\u003e22\u003c/strong\u003e(13).\u003c/li\u003e\n\u003cli\u003eMiyashita, T., et al., \u003cem\u003eTumor suppressor p53 is a regulator of bcl-2 and bax gene expression in vitro and in vivo.\u003c/em\u003e Oncogene, 1994. \u003cstrong\u003e9\u003c/strong\u003e(6): p. 1799-805.\u003c/li\u003e\n\u003cli\u003eYin, C., et al., \u003cem\u003eBax suppresses tumorigenesis and stimulates apoptosis in vivo.\u003c/em\u003e Nature, 1997. \u003cstrong\u003e385\u003c/strong\u003e(6617): p. 637-40.\u003c/li\u003e\n\u003cli\u003eAltm\u0026auml;e, S. and L. Aghajanova, \u003cem\u003eGrowth Hormone and Endometrial Receptivity.\u003c/em\u003e Front Endocrinol (Lausanne), 2019. \u003cstrong\u003e10\u003c/strong\u003e: p. 653.\u003c/li\u003e\n\u003cli\u003eGuo, J., et al., \u003cem\u003eUsing organoids to investigate human endometrial receptivity.\u003c/em\u003e Front Endocrinol (Lausanne), 2023. \u003cstrong\u003e14\u003c/strong\u003e: p. 1158515.\u003c/li\u003e\n\u003cli\u003eNorwitz, E.R., D.J. Schust, and S.J. Fisher, \u003cem\u003eImplantation and the survival of early pregnancy.\u003c/em\u003e N Engl J Med, 2001. \u003cstrong\u003e345\u003c/strong\u003e(19): p. 1400-8.\u003c/li\u003e\n\u003cli\u003eMrozikiewicz, A.E., M. Ożarowski, and P. Jędrzejczak, \u003cem\u003eBiomolecular Markers of Recurrent Implantation Failure-A Review.\u003c/em\u003e Int J Mol Sci, 2021. \u003cstrong\u003e22\u003c/strong\u003e(18).\u003c/li\u003e\n\u003cli\u003eAdiguzel, D. and C. Celik-Ozenci, \u003cem\u003eFoxO1 is a cell-specific core transcription factor for endometrial remodeling and homeostasis during menstrual cycle and early pregnancy.\u003c/em\u003e Hum Reprod Update, 2021. \u003cstrong\u003e27\u003c/strong\u003e(3): p. 570-583.\u003c/li\u003e\n\u003cli\u003eTiberi, F., et al., \u003cem\u003eProkineticin 1, homeobox A10, and progesterone receptor messenger ribonucleic acid expression in primary cultures of endometrial stromal cells isolated from endometrium of healthy women and from eutopic endometrium of women with endometriosis.\u003c/em\u003e Fertil Steril, 2010. \u003cstrong\u003e94\u003c/strong\u003e(7): p. 2558-63.\u003c/li\u003e\n\u003cli\u003eCelik, O., et al., \u003cem\u003eLaparoscopic endometrioma resection increases peri-implantation endometrial HOXA-10 and HOXA-11 mRNA expression.\u003c/em\u003e Fertil Steril, 2015. \u003cstrong\u003e104\u003c/strong\u003e(2): p. 356-65.\u003c/li\u003e\n\u003cli\u003eZhu, M., et al., \u003cem\u003eHuman chorionic gonadotropin improves endometrial receptivity by increasing the expression of homeobox A10.\u003c/em\u003e Mol Hum Reprod, 2020. \u003cstrong\u003e26\u003c/strong\u003e(6): p. 413-424.\u003c/li\u003e\n\u003cli\u003eGermeyer, A., et al., \u003cem\u003eEndometrial beta3 integrin profile reflects endometrial receptivity defects in women with unexplained recurrent pregnancy loss.\u003c/em\u003e Reprod Biol Endocrinol, 2014. \u003cstrong\u003e12\u003c/strong\u003e: p. 53.\u003c/li\u003e\n\u003cli\u003eQu, X.L., et al., \u003cem\u003eEffect of 2,3\u0026apos;,4,4\u0026apos;,5-Pentachlorobiphenyl Exposure on Endometrial Receptivity and the Methylation of HOXA10.\u003c/em\u003e Reprod Sci, 2018. \u003cstrong\u003e25\u003c/strong\u003e(2): p. 256-268.\u003c/li\u003e\n\u003cli\u003eZhao, Y., et al., \u003cem\u003ePerfluorooctane sulfonate exposure induces preeclampsia-like syndromes by damaging trophoblast mitochondria in pregnant mice.\u003c/em\u003e Ecotoxicol Environ Saf, 2022. \u003cstrong\u003e247\u003c/strong\u003e: p. 114256.\u003c/li\u003e\n\u003cli\u003eWang, L., et al., \u003cem\u003eDecorin promotes decidual M1-like macrophage polarization via mitochondrial dysfunction resulting in recurrent pregnancy loss.\u003c/em\u003e Theranostics, 2022. \u003cstrong\u003e12\u003c/strong\u003e(17): p. 7216-7236.\u003c/li\u003e\n\u003cli\u003eFei, C., et al., \u003cem\u003eMaternal levels of perfluorinated chemicals and subfecundity.\u003c/em\u003e Hum Reprod, 2009. \u003cstrong\u003e24\u003c/strong\u003e(5): p. 1200-5.\u003c/li\u003e\n\u003cli\u003eWang, X., et al., \u003cem\u003eImpact of Perfluorooctane Sulfonate on Reproductive Ability of Female Mice through Suppression of Estrogen Receptor \u0026alpha;-Activated Kisspeptin Neurons.\u003c/em\u003e Toxicol Sci, 2018. \u003cstrong\u003e165\u003c/strong\u003e(2): p. 475-486.\u003c/li\u003e\n\u003cli\u003eDu, G., et al., \u003cem\u003eNeonatal and juvenile exposure to perfluorooctanoate (PFOA) and perfluorooctane sulfonate (PFOS): Advance puberty onset and kisspeptin system disturbance in female rats.\u003c/em\u003e Ecotoxicol Environ Saf, 2019. \u003cstrong\u003e167\u003c/strong\u003e: p. 412-421.\u003c/li\u003e\n\u003cli\u003eXu, K., et al., \u003cem\u003eSIRT3 ameliorates osteoarthritis via regulating chondrocyte autophagy and apoptosis through the PI3K/Akt/mTOR pathway.\u003c/em\u003e Int J Biol Macromol, 2021. \u003cstrong\u003e175\u003c/strong\u003e: p. 351-360.\u003c/li\u003e\n\u003cli\u003eTong, C., et al., \u003cem\u003eInsulin resistance, autophagy and apoptosis in patients with polycystic ovary syndrome: Association with PI3K signaling pathway.\u003c/em\u003e Front Endocrinol (Lausanne), 2022. \u003cstrong\u003e13\u003c/strong\u003e: p. 1091147.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Perfluorooctanoic sulfonate (PFOS), Endometrial stromal cells, In vitro fertilization, Endometrial receptivity, Pinopodes morphology","lastPublishedDoi":"10.21203/rs.3.rs-5117605/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5117605/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003ePerfluorooctanoic sulfonate (PFOS) is difficult to degrade and tends to accumulate in the body, which causes widespread concern. The expression of genes related to endometrial receptivity and the differentiation of human endometrial stromal cells (hESCs) were assessed in this study concerning PFOS. In this study, we investigated the effect of PFOS exposure on endometrial tolerance by cell and animal experiments. The activity against endometrial mesenchymal cells was significantly reduced by PFOS intervention, and the apoptosis flow assay results showed that PFOS significantly promoted cell death in a concentration-dependent manner. Transmission electron microscopy results revealed mitochondrial damage in the PFOS-intervened group, and WB results showed that the expression levels of endometrial tolerance-related proteins Homeobox A10 (HOXA10) and integrin beta3 (ITGB3) were decreased, and the expression level of Forkhead box O1 (FOXO1) protein was increased. Animal studies have shown that PFOS can affect the locomotor cycle in mice, and significant damage to pinopodes morphology was observed after PFOS exposure administration. In the present study, we found that PFOS may synergistically affect the viability of endometrial mesenchymal stromal cells through accumulation in vivo, and that PFOS may contribute to the failure of embryo implantation by affecting mitochondrial function and consequently endometrial permissive sites.\u003c/p\u003e","manuscriptTitle":"Developmental exposure to perfluorooctanoic sulfonate(PFOS) impairs the endometrial receptivity","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-12-25 07:54:06","doi":"10.21203/rs.3.rs-5117605/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-11-22T13:22:53+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-11-17T22:32:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"188195709167488091274776965052250328309","date":"2024-11-09T18:43:28+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-10-25T20:27:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"261129352694737322003811968069148429980","date":"2024-10-25T13:36:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"310405300079388001312847507140314658099","date":"2024-10-24T15:03:17+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-10-24T14:48:55+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-10-24T14:43:30+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2024-10-15T09:03:49+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-10-14T12:06:01+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2024-09-19T14:04:28+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2e349f9f-dbb2-4155-8138-df3630266a5d","owner":[],"postedDate":"December 25th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":40628357,"name":"Biological sciences/Biochemistry"},{"id":40628358,"name":"Earth and environmental sciences/Environmental sciences"},{"id":40628359,"name":"Health sciences/Health care"}],"tags":[],"updatedAt":"2025-01-13T16:03:50+00:00","versionOfRecord":{"articleIdentity":"rs-5117605","link":"https://doi.org/10.1038/s41598-024-84732-2","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-01-11 15:57:52","publishedOnDateReadable":"January 11th, 2025"},"versionCreatedAt":"2024-12-25 07:54:06","video":"","vorDoi":"10.1038/s41598-024-84732-2","vorDoiUrl":"https://doi.org/10.1038/s41598-024-84732-2","workflowStages":[]},"version":"v1","identity":"rs-5117605","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5117605","identity":"rs-5117605","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00