Detection and assessment of antibiotic-resistant strains of Salmonella Typhimurium in raptors referred to the Environmental Protection Organization of Kerman, Iran

Detection and assessment of antibiotic-resistant strains of Salmonella Typhimurium in raptors referred to the Environmental Protection Organization of Kerman, Iran | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Detection and assessment of antibiotic-resistant strains of Salmonella Typhimurium in raptors referred to the Environmental Protection Organization of Kerman, Iran Sara Amrollahi, Hemad Shafiei, Maziar Jajarmi, Mahmood Salehi, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7271789/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Wildlife can serve as a long-term asymptomatic reservoir for zoonotic bacteria, such as Salmonella spp. wild birds are carriers of different serovars of Salmonella enterica, which can play a significant role in the epidemiology of Salmonella disease in humans and livestock. In this study, we detect and evaluate the antibiotic resistance of Salmonella strains, particularly Salmonella Typhimurium, from 33 raptors that carry this pathogen. For this purpose, 66 swab samples were collected: 33 choanal swabs and 33 cloacal swabs. So that, 9 Salmonella spp. isolates and 4 Salmonella Typhimurium isolates were obtained through culture, biochemical tests, and PCR. Continuing the study, the antibiotic resistance of Salmonella-positive samples was measured against seven antibiotics. Among the nine Salmonella detects the highest antibiotic resistance was observed against neomycin, fosfomycin, colistin, and enrofloxacin. In contrast, trimethoprim-sulfadiazine, lincomycin-spectinomycin, and chloramphenicol showed the lowest resistance, with similar percentages. The isolation of Salmonella species, specifically Typhimurium, from raptors in Kerman province, coupled with the observed antibiotic resistance in these strains, has reduced available treatment options. Furthermore, the role of birds of prey in transmitting resistant and pathogenic bacteria to humans and domestic animals, due to their migratory patterns, underscores the importance of adopting a One Health approach. The monitoring, treating, and studying of this disease in infected captive raptors are critical components in controlling Salmonella within the animal-human-ecosystem cycle. Raptors Salmonella Typhimurium PCR Antibiotic resistance Kerman Province Figures Figure 1 Figure 2 Introduction Wild birds are reservoirs and carriers of zoonotic disease pathogens transmitted through direct air contact or carriers like rodents and other birds. These birds play a vital role in biodiversity and have significant impacts on the ecosystem, which affects the health of humans and other animals. Therefore, it is crucial to research zoonotic infectious diseases in wildlife. This research will help establish monitoring programs for clinical work in wildlife rehabilitation centers and aid in the control of zoonotic diseases (Bhan 2005; Gargiulo 2018). So far, approximately 57 species of birds of prey have been recorded in Iran, which spend a significant part of their migration there, and some of them are classified as endangered. The Enterobacteriaceae family comprises significant bacteria impacting the digestive system in humans and animals. Salmonella is one of the most common pathogens causing zoonotic diseases, including Salmonella typhoid and Salmonella paratyphoid. Most Salmonella serovars belong to the category of Salmonella paratyphoid. Salmonella enterica subspecies enterica is one of the important subspecies, which includes two important serovars, Enteritidis and Typhimurium , and according to reports, they have been able to cause intestinal infections in humans and asymptomatic infections in birds (McMullin 2020). In the study by Jurado-Tarifa et al., which examined 394 birds of prey in Spain, 18 cases, representing 4.6%, tested positive for Salmonella spp. The serovars most frequently isolated in this investigation were Salmonella Enteritidis and Salmonella Typhimurium (Jurado-Tarifa et al. 2016 ). Raptors can carry salmonella or become infected with it, whether in captivity or the wild. In a study conducted by Vidal et al. regarding free-living birds of prey, it was reported that the prevalence of Salmonella species isolated from these avian subjects was low. However, regarding symptom severity, approximately 7% of the birds exhibited systemic disease, while 3% displayed significant weakness and suboptimal body condition (Vidal et al. 2017 ). In instances of systemic salmonella infection that can lead to death, postmortem examinations reveal the bad condition of the body, crop full of undigested food, internal organs, damaged joints, and in some cases, enlarged liver and spleen (Benskin et al. 2009 ). Antibiotics are frequently used to treat and prevent bacterial infections in humans and livestock. The widespread use of antibiotics exerts selective pressure on bacteria, resulting in the swift emergence of antimicrobial resistance (AMR). Recent studies indicate that wildlife may function as a reservoir for antimicrobial resistance (AMR) bacteria. This phenomenon potentially facilitates the transmission of AMR isolates to humans and livestock (Prestinaci et al. 2015 ). whereas the detection and assessment of antibiotic resistance in Salmonella Typhimurium isolated from wildlife in Kerman have not yet been performed. This study is designed to specifically identify this species of Salmonella, given the paramount importance of recognizing pathogenic bacteria in wildlife populations. Materials and methods Sampling and Salmonella Isolation From April to October 2023, 66 samples were collected from 33 raptors referred to the Environment Department of Kerman province. Swabs were transported to the microbiology laboratory at Shahid Bahonar Faculty of Veterinary Medicine in Kerman within two hours, using tubes with Cary-Blair transport medium (Merck, Germany) placed next to ice. Each cloacal and choanal swab was transferred separately to a selenite F broth enrichment medium (Merck, Germany) and incubated at 37°C. After 16 to 20 hours, samples were cultured using the streak plate method on Salmonella-Shigella agar (Merck, Germany) and incubated at 37°C for 24 hours. Two suspicious colonies were checked and identified by a pale color with a black center due to H2S production. To further purify, these colonies were subcultured on SS agar at 37°C for another 24 hours. Suspicious colonies were cultured on nutrient agar medium (Merck, Germany) for storage. Then, TSA, IMViC, and urease biochemical tests were performed. Finally, urease-negative isolates were preserved for further steps. To safeguard the isolates suspended in LB broth medium (Merck, Germany), 50% glycerol was added, and after vortexing, they were frozen at -20°C (Jajarmi et al. 2016 ). DNA extraction and PCR DNA extraction was conducted on the cultured Tryptic Soy Agar (TSA) and on each isolate retained from the previous step, using a kit from Favorgen Biotech, Taiwan. DNA extracted from each sample was stored in separate microtubes at -18°C. Molecular detection of Salmonella Typhimurium was conducted using conventional PCR (polymerase chain reaction). The reaction volume was 25 µl and included 12 µl of PCR Master Mix Red (Amplikon, Denmark), 7 µl of distilled water, 0.5 µM of each primer (Pishgam, Iran; see Table 1 ), and 5 µl of DNA template. Table 1 Sequence of primers used(Cohen et al. 1996 ) Name of pathogen Gene Sequence (5'-3') Length Salmonella Typhimurium flic F: CGGTGTTGCCCAGGTTGGTAAT R: ACTCTTGCTGGCGGTGCGACTT 559 The thermal programs typically included initial denaturation at 95°C for 5 minutes, denaturation at 95°C for 45 seconds, annealing at 60°C for 45 seconds, extension at 72°C for 60 seconds, and final extension at 72°C for 10 minutes. The steps of denaturation, annealing, and extension were repeated 35 times. All PCR products were subjected to electrophoresis on a 2% agarose gel at a voltage of 100 volts for 40 minutes. To assess the PCR results, images of the bands were captured and photographed using the Gel Doc 1000 imaging system (Vilbert Lormat, France)( Moghadam et al. 2017 ). Antibiotic sensitivity testing The antibiotic sensitivity of the isolates was evaluated using the Kirby-Bauer technique for seven antibiotics: Colistin, Trimethoprim / Sulfadiazine, Enrofloxacin, Lincomycin/spectinomycin, Chloramphenicol, Neomycin and Fosfomycin (Padtan Teb Company, Iran) on Mueller Hinton agar plate (Merck, Germany). Finally, the diameter of the area lacking bacterial growth around the antibiotic discs was measured using calipers. The results were compared to the standards set by the Clinical Laboratory Standard Institute (CLSI) (Pierce et al. 2022; CLSI 2018 ; CLSI 2020 ). Results In this study, 19 out of 66 swabs were suspected of Salmonella spp. as lactose-negative and H2S-positive by culture in SS agar medium. Additionally, 9 samples from 7 raptors tested positive for Salmonella spp. in microbiological tests. Four samples from four different raptors tested positive for Salmonella Typhimurium using the PCR method. (Table 2 , 3 and Fig. 1 ). Table 2 Number of positive samples by biochemical and PCR tests Total swabs Chonal swabs Cloacal swabs Total number 66 33 33 Isolates of Salmonella spp. by microbiological tests 9 4 5 Isolates of Salmonella Typhimurium by PCR 4 1 3 Table 3 Salmonella isolations in Raptors referred to the environmental protection organization of Kerman province Name of species Number of Raptors examined Isolates of Salmonella spp. Isolates of Salmonella Typhimurium common kestrel 17 3 3 Peregrine falcon 2 0 0 Long-legged buzzard 10 4 1 Eurasian sparrowhawk 1 0 0 Black kite 1 0 0 Eurasian goshawk 1 0 0 Cooper's hawk 1 0 0 Also, the results show that among the 9 isolates of Salmonella spp. , the highest antimicrobial resistance belonged to Neomycin, Fosfomycin, Colistin, and Enrofloxacin respectively, and Trimethoprim / Sulfadiazine, Lincomycin/spectinomycin, and Chloramphenicol had the same percentage of resistance as the lowest among the investigated antibiotics (Fig. 2 ). Discussion A "One Health" approach is crucial in understanding and managing the health risks associated with Salmonella in birds of prey and its potential impacts on ecosystems and human health. Isolation of Salmonella species in 9 out of 66 samples (13.6%) indicates a significant level of exposure or infection with this disease in the Kerman raptor population. Furthermore, this amount poses a danger to the health of wildlife, other animals, and humans due to environmental pollution. Identifying Salmonella typhimurium in four samples (6%) is significant because this serovar is one of the most common and pathogenic types associated with Salmonella disease in humans and animals. The presence of this pathogen in birds of prey can help its spread in the ecosystem. Numerous studies have investigated the prevalence of Salmonella species in wild birds. For instance, In a study by Craven et al. ( 2000 ), the prevalence of Salmonella species in two bird species, European starlings (Sturnus vulgaris) and house sparrows (Passer domesticus), was reported to be 10.6% (Craven et al. 2000 ). Vlahović et al. ( 2004 ) reported a Salmonella prevalence of 7.4% and a Salmonella Typhimurium prevalence of 3.7% in fresh fecal samples from 107 free-living birds (Vlahović et al. 2004 ). In another study, Kobayashi et al. ( 2007 ) reported a prevalence of 5.79% for Salmonella species isolated from cloacal swabs, all identified as Salmonella Typhimurium. Awadallah et al. ( 2013 ) reported a Salmonella prevalence of 10.75% in doves, quails, sparrows, and cattle egrets (Kobayashi et al. 2007 ; Awadallah et al. 2013 ). The prevalence of salmonella is influenced by various factors, including geographical location, habitat type, predator species, environmental and nutritional conditions, sample type, and the diagnostic methods used (Allgayer et al.2008). In captive breeding facilities, these birds are mainly fed commercial chicken meat or frozen day-old chicks (Tizard 2004 ). In a series of studies conducted in Iran, the isolation rate of Salmonella in broiler chickens was reported at 10.83%, based on samples collected over two years from broiler farms throughout the nation (2011). In Sanandaj, the isolation rate from 37 broiler poultry houses was found to be 1.8% in the year 2017 (Peighambari et al. 2013 ; Doulatyabi et al. 2017 ). A study by Firouzabadi et al. (2018) conducted in Kerman revealed that Salmonella infection in chicken farms was 48%. Notably, 24% of these infections were identified as Salmonella Typhimurium . This data underscores the potential implications of Salmonella infections for captive raptor populations. (Firouzabadi et al. 2020 ). Free-living birds may become infected with Salmonella spp. through the predation of small birds, rodents, and other small animals. Research conducted in Norway demonstrates that Salmonella is endemic among avian populations in this region, with small birds capable of serving as asymptomatic carriers of this bacterium (Refsum et al. 2002 ). Pigeons, which are frequently hunted by birds of prey, may act as a reservoir for the Typhimurium serotype of this bacterium (Toro et al. 1999 ). One of the primary factors affecting the prevalence of Salmonella in raptors is their dietary choices and feeding behaviors. While this study did not include detailed information regarding the diets of free-living birds, it was observed that three of the positive Salmonella samples originated from birds that were provided with chicken meat. Salmonella infection in predatory animals can result in clinical disease, manifested by symptoms such as anorexia, dehydration, ruffled feathers, green-colored feces, and involvement of the liver and spleen (McMullin 2020). In our study, the analysis of recorded histories and clinical symptoms indicated that a majority of positive samples presented with lethargy, anorexia, ruffled feathers, and diarrhea. The prevalence of Salmonella and the susceptibility to infection differ among various species of birds of prey. These variations can be attributed to dietary habits, behavior, physiological differences, and habitat conditions. A study by Milan et al. (2004) in the Basque Country of Spain examined the presence of Salmonella and its various strains among wild birds representing different orders and species. The researchers successfully isolated four distinct Salmonella serotypes, including Salmonella typhimurium , in Eurasian griffon vulture (Gyps fulvus), Eurasian sparrowhawk (Accipiter nisus), common buzzard (Buteo buteo), and common kestrel (Falco tinnunculus) (Millán et al. 2004 ). In another study on 105 diurnal raptors in Italy (2017) by Gargiulo et al., it was determined that eight birds tested positive for Salmonella species. This group included six common kestrels, one saker falcon, and one common buzzard. Notably, a case of Salmonella Typhimurium was isolated from one of the common kestrels. In our research, three common kestrels also tested positive for Salmonella Typhimurium. The common kestrel (Falco tinnunculus) primarily preys on small mammals, birds, and insects. This species is typically found in open habitats, woodlands, wetland peripheries, and areas in proximity to urban environments. The association of the kestrel with human-modified landscapes, including poultry and livestock farms, as well as aquifers that supply water, may elucidate the observed higher prevalence of Salmonella in this species. This prevalence may be attributed to its diet, which includes insects and avian species that are potential carriers of Salmonella spp. (Gargiulo et al. 2018 ). Antibiotic resistance in bacteria isolated from domestic poultry is a prevalent concern; however, it has also been documented in bacteria sourced from wild birds A study conducted by Molina-López et al. (2011) identified antibiotic resistance of Salmonella Typhimurium to sulfonamides and aminoglycosides in raptors (Molina-Lopez et al. 2011 ). Further research by Molina-López et al. ( 2015 ) at a wildlife rehabilitation center in Spain evaluated antibiotic resistance in Salmonella Typhimurium. Among seven positive Salmonella cases, five were confirmed as Salmonella Typhimurium. The resistance patterns observed in these five cases indicated that 60% (three cases) were resistant to chloramphenicol, 40% (two cases) were resistant to colistin, 40% (two cases) were resistant to sulfadiazine/trimethoprim, 80% (four cases) were resistant to streptomycin, and 40% (two cases) were resistant to gentamicin (Molina-Lopez et al. 2015). Additionally, a study by Tardone et al. ( 2020 ) reported the occurrence of antibiotic resistance in Salmonella among raptors and aquatic birds. In raptors, resistance was documented solely to aminoglycosides, specifically gentamicin, while multidrug resistance (MDR) was noted among aquatic birds (Tardone et al. 2020 ). In the current study, aminoglycoside resistance was observed in Salmonella Typhimurium isolated from raptors, corroborating findings from existing research. Furthermore, the highest levels of antibiotic resistance were identified against neomycin, fosfomycin, colistin, and enrofloxacin among the Salmonella strains examined in this investigation. Antibiotic resistance in Salmonella spp. has been extensively documented across various domestic and farmed species by numerous researchers. Notably, the 2016 European AMR surveillance report indicated the prevalence of colistin resistance in Salmonella, with findings of 29.6% in turkey meat, 5.5% in chicken meat, and 10.5% in breeder chickens(ECDC 2014 ). In a study conducted by Amira et al. in Egypt in 2017, the authors investigated antibiotic resistance in 15 isolates of Salmonella enterica obtained from raw chicken and beef meat. The findings revealed that none of the isolates exhibited resistance to chloramphenicol or colistin. However, it was noted that 53% of the isolates displayed resistance to sulfadiazine/trimethoprim (Moawad et al. 2017 ). In Burkina Faso, a study conducted by Kagambèga et al. ( 2018 ) identified multi-drug resistant (MDR) Salmonella Typhimurium in isolates obtained from both human and poultry sources. This particular strain exhibits resistance to ampicillin, chloramphenicol, streptomycin, sulfonamides, and trimethoprim, thereby indicating a significant potential risk for food contamination (Kagambèga et al. 2018 ). A study conducted by Mir et al. in southeastern Iran in 2021 revealed that Salmonella species isolated from two chicken meat samples demonstrated resistance to the antibiotics sulfadiazine/trimethoprim and lincomycin-spectinomycin (Mir et al. 2022 ). This observation, which aligns with findings from other research on domestic birds, underscores the potential for transmission of antibiotic resistance to raptors that consume domestic avian species. Consequently, this highlights the significant risk that raptors may acquire resistant bacteria through their diet, particularly when ingesting infected poultry. Conclusions The isolation of Salmonella species, specifically Typhimurium, from raptors in Kerman province, coupled with the observed antibiotic resistance in these strains, has led to a reduction in available treatment options. Furthermore, the role of birds of prey in the transmission of these resistant and pathogenic bacteria to humans and domestic animals, due to their migratory patterns, underscores the importance of adopting a One Health approach. The monitoring, treatment, and study of this disease in infected captive raptors are critical components in controlling salmonella within the animal-human-ecosystem cycle. Consequently, it is imperative to conduct further research in various geographical regions of Iran to effectively enhance the identification and management of this disease. Declarations Compliance with ethical standards Funding: This study was not supported by any funding . Conflict of interest : The authors declare that they have no conflict of interest. Ethical approval: All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. Authors' Contribution1- Study concept and design: Shafiei.H, Amrollahi.S, Salehi.M2- Acquisition of data: Jajarmi.M3- Analysis and interpretation of data: Shafiei.H, Jajarmi.M4- Drafting of the manuscript: Shafiei.H, Amrollahi.S, Zangiabadi. M5- Critical revision of the manuscript for important intellectual content: Shafiei.H6- Statistical analysis: Jajarmi.M, Zangiabadi. M7- Administrative, technical, and material support: Jajarmi.M, Shafiei.H8- Study supervision: Shafiei.H, Salehi.MAll authors reviewed the manuscript. References Allgayer MC, Lima-Rosa CA V, Weimer TA, Rodenbusch CR, Pereira RA, Streck AF, Oliveira SD, Canal CW (2008) Molecular diagnosis of Salmonella species in captive psittacine birds. Vet Rec 162:816–819. https://doi.org/10.1136/vr.162.25.816 Awadallah MA, Merwad AM, Mohamed RE (2013) Prevalence of Zoonotic Escherichia coli and Salmonellae in Wild Birds and Humans in Egypt with Emphasis on RAPD-PCR Fingerprinting of E. coli. Glob Vet 11:781–788 Benskin CMH, Wilson K, Jones K, Hartley IR (2009) Bacterial pathogens in wild birds: a review of the frequency and effects of infection. Biol Rev 84:349–373 Bhan MK, Bahl R, Bhatnagar S (2005) Typhoid and paratyphoid fever. Lancet 366:749–762 CLSI (2018). Performance standards for antimicrobial disk and dilution susceptibilty tests for bacteria isolated from animals. 4 th ed. CLSI supplement VET08. Wayne, PA: Clinical and Laboratory Standards Institute. CLSI (2020). Performance standards for antimicrobial susceptibility testing. 30 th ed. CLSI supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute. Cohen HJ, Mechanda SM, Lin W (1996) PCR amplification of the fimA gene sequence of Salmonella typhimurium, a specific method for detection of Salmonella spp. Appl Environ Microbiol 62:4303–4308 Craven SE, Stern NJ, Line E, Bailey JS, Cox NA, Fedorka-Cray P (2000) Determination of the Incidence of Salmonella spp., Campylobacter jejuni, and Clostridium perfringens in Wild Birds near Broiler Chicken Houses by Sampling Intestinal Droppings. Avian Dis 44:715–720. https://doi.org/10.2307/1593118 Doulatyabi S, Peighambari SM, Morshed R (2017) Survey of Salmonella infections in broiler farms around Sanandaj. J Ilam Univ Med Sci 25:70–78 ECDC E (2014) EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control), 2015. Eur Union Summ Rep trends sources zoonoses, zoonotic agents food-borne outbreaks 13:4036 Firouzabadi A, Saadati D, Najimi M, Jajarmi M (2020) Prevalence and related factors of Salmonella spp. and Salmonella Typhimurium contamination among broiler farms in Kerman province, Iran. Prev Vet Med 175:104838 Gargiulo A, Fioretti A, Russo TP, Varriale L, Rampa L, Paone S, De Luca Bossa LM, Raia P, Dipineto L (2018) Occurrence of enteropathogenic bacteria in birds of prey in Italy. Lett Appl Microbiol 66:202–206. https://doi.org/10.1111/lam.12836 Jajarmi M, Ghanbarpour R, Sharifi H, Golchin M (2016) Distribution pattern of EcoR phylogenetic groups among shiga toxin-producing and enteropathogenic Escherichia coli isolated from healthy goats. Int J Enteric Pathog 3:5–27971 Jurado-Tarifa E, Torralbo A, Borge C, Cerdà-Cuéllar M, Ayats T, Carbonero A, García-Bocanegra I (2016) Genetic diversity and antimicrobial resistance of Campylobacter and Salmonella strains isolated from decoys and raptors. Comp Immunol Microbiol Infect Dis 48:14–21 Kagambèga A, Lienemann T, Frye JG, Barro N, Haukka K (2018) Whole genome sequencing of multidrug-resistant Salmonella enterica serovar Typhimurium isolated from humans and poultry in Burkina Faso. Trop Med Health 46:1–5 Kobayashi H, Kanazaki M, Shimizu Y, Nakajima H, Khatun MM, Hata E, Kubo M (2007) Salmonella isolates from cloacal swabs and footpads of wild birds in the immediate environment of Tokyo Bay. J Vet Med Sci 69:309–311 McMullin PF (2020) Diseases of poultry 14th edition: David E. Swayne, Martine Boulianne, Catherine M. Logue, Larry R. McDougald, Venugopal Nair, David L. Suarez, Sjaak de Wit, Tom Grimes, Deirdre Johnson, Michelle Kromm, Teguh Yodiantara Prajitno, Ian Rubinoff & Guillermo Z. Taylor & Francis. Avian Pathology, 49, 526. https://doi.org/10.1080/03079457.2020.1794237 Millán J, Aduriz G, Moreno B, Juste RA, Barral M (2004) Salmonella isolates from wild birds and mammals in the Basque Country (Spain). OIE Rev Sci Tech 23:905–911. https://doi.org/10.20506/rst.23.3.1529 Mir R, Salari S, Najimi M, Rashki A (2022) Determination of frequency, multiple antibiotic resistance index and resistotype of Salmonella spp. in chicken meat collected from southeast of Iran. Vet Med Sci 8:229–236. https://doi.org/https://doi.org/10.1002/vms3.647 Moawad AA, Hotzel H, Awad O, Tomaso H, Neubauer H, Hafez HM, El-Adawy H (2017) Occurrence of Salmonella enterica and Escherichia coli in raw chicken and beef meat in northern Egypt and dissemination of their antibiotic resistance markers. Gut Pathog 9:1–13 Moghadam A, Nazarian S, Amani J (2017) Identification and assessment of Salmonella typhimurium, infantis and enteritidis serotypes in clinical samples from medical centers of Kerman province. Iran J Med Microbiol 11:1–8 Molina-Lopez RA, Valverdú N, Martin M, Mateu E, Obon E, Cerdà-Cuéllar M, Darwich L (2011) Wild raptors as carriers of antimicrobial-resistant Salmonella and Campylobacter strains. Vet Rec 168:565 Molina-López RA, Vidal A, Obón E, Martín M, Darwich L (2015) Multidrug-resistant Salmonella enterica serovar Typhimurium monophasic variant 4, 12: i:-isolated from asymptomatic wildlife in a Catalonian wildlife rehabilitation center, Spain. J Wildl Dis 51:759–763 Peighambari SM, Akbarian R, Morshed R, Yazdani A (2013) Characterization of Salmonella isolates from poultry sources in Iran Pierce VM, Mathers AJ (2022) Setting antimicrobial susceptibility testing breakpoints: a primer for pediatric infectious diseases specialists on the Clinical and Laboratory Standards Institute approach. J Pediatric Infect Dis Soc 11:73–80 Prestinaci F, Pezzotti P, Pantosti A (2015) Antimicrobial resistance: a global multifaceted phenomenon. Pathog Glob Health 109:309–318 Refsum T, Handeland K, Baggesen DL, Holstad G, Kapperud G (2002) Salmonellae in avian wildlife in Norway from 1969 to 2000. Appl Environ Microbiol 68:5595–5599 Tardone R, Rivera D, Dueñas F, Sallaberry-Pincheira N, Hamilton-West C, Adell AD, Moreno-Switt AI (2020) Salmonella in Raptors and Aquatic Wild Birds in Chile. J Wildl Dis 56:707–712. https://doi.org/10.7589/2019-08-198 Tizard I (2004) Salmonellosis in wild birds. Semin Avian Exot Pet Med 13:50–66. https://doi.org/https://doi.org/10.1053/j.saep.2004.01.008 Toro H, Saucedo C, Borie C, Gough RE, Alcaino H (1999) Health status of free-living pigeons in the city of Santiago. Avian Pathol 28:619–623 Vidal A, Baldomà L, Molina-López RA, Martin M, Darwich L (2017) Microbiological diagnosis and antimicrobial sensitivity profiles in diseased free-living raptors. Avian Pathol 46:442–450. https://doi.org/10.1080/03079457.2017.1304529 Vlahović K, Matica B, Bata I, Pavlak M, Pavičić Ž, Popović M, Nejedli S, Dovč A (2004) Campylobacter, salmonella and chlamydia in free-living birds of Croatia. Eur J Wildl Res 50:127–132. https://doi.org/10.1007/s10344-004-0052-1 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 15 Sep, 2025 Reviews received at journal 14 Sep, 2025 Reviews received at journal 12 Sep, 2025 Reviewers agreed at journal 05 Sep, 2025 Reviewers agreed at journal 04 Sep, 2025 Reviewers invited by journal 04 Sep, 2025 Editor assigned by journal 03 Aug, 2025 Submission checks completed at journal 03 Aug, 2025 First submitted to journal 01 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7271789","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":510859079,"identity":"524672af-8f0e-47eb-a6ab-acec8a94efca","order_by":0,"name":"Sara Amrollahi","email":"","orcid":"","institution":"Shahid Bahonar University of Kerman","correspondingAuthor":false,"prefix":"","firstName":"Sara","middleName":"","lastName":"Amrollahi","suffix":""},{"id":510859080,"identity":"299aa48e-3327-4530-9d61-ffdc083dbe97","order_by":1,"name":"Hemad Shafiei","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA9ElEQVRIiWNgGAWjYBACAxDBw8CQwMB8sIEhoQIiAOQSo4UtEajlDGlagMoY26Ba8AFz9u7ED28Y6vL425gbHzycd9iYgf3wA4aHe3Brsew5u1lyDsPhYoljjM0GidsOmzHwpBkwJDzD47AbuRukeRgOJDbcb2yTAGqxYWDIAbrzAB4t999u/s3DUJc4/xhj+4/EOUAt/G8IaLnBuw1oC3PihmNAvyc2AB0mQciWM7nbLOcYHE7cCPSLRMKxdGM2iWcGB/BqOX528403FXWJ846xP/z4o8basJ8/+eHDH3i0QDUisdmAmKCGUTAKRsEoGAX4AQBDKVXgQ+qilwAAAABJRU5ErkJggg==","orcid":"","institution":"Shahid Bahonar University of Kerman","correspondingAuthor":true,"prefix":"","firstName":"Hemad","middleName":"","lastName":"Shafiei","suffix":""},{"id":510859081,"identity":"1141f650-60d9-40ca-803b-1eb6e65843ac","order_by":2,"name":"Maziar Jajarmi","email":"","orcid":"","institution":"Shahid Bahonar University of Kerman","correspondingAuthor":false,"prefix":"","firstName":"Maziar","middleName":"","lastName":"Jajarmi","suffix":""},{"id":510859082,"identity":"2c86dbdc-4dcb-4ee5-9738-15e162f3727c","order_by":3,"name":"Mahmood Salehi","email":"","orcid":"","institution":"Shahid Bahonar University of Kerman","correspondingAuthor":false,"prefix":"","firstName":"Mahmood","middleName":"","lastName":"Salehi","suffix":""},{"id":510859084,"identity":"6acd6843-b972-44e7-b316-b5b00d5caf98","order_by":4,"name":"Mostafa Zangiabadi","email":"","orcid":"","institution":"Shahid Bahonar University of Kerman","correspondingAuthor":false,"prefix":"","firstName":"Mostafa","middleName":"","lastName":"Zangiabadi","suffix":""}],"badges":[],"createdAt":"2025-08-01 13:38:29","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7271789/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7271789/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":91012392,"identity":"36135029-38e2-4fec-a0eb-244e9a15001b","added_by":"auto","created_at":"2025-09-10 16:00:33","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":51228,"visible":true,"origin":"","legend":"\u003cp\u003eElectrophoresis of PCR products to detect specific gene of Salmonella typhimurium (bp559): bp100 marker (M), negative control (C-), positive control (C+), negative sample (-), positive sample (+)\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7271789/v1/078889be623efecbe027dbb5.png"},{"id":91012393,"identity":"13c7afb2-a3e4-4757-b6d6-0f6116583a2b","added_by":"auto","created_at":"2025-09-10 16:00:33","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":8174,"visible":true,"origin":"","legend":"\u003cp\u003eChart comparing the frequency of antibiotic resistance in Salmonella isolates (N: Neomycin/ Fos: Fosfomycin/ CL: Colistin/ NFX: Enrofloxacin/ SLT: Trimethoprim / Sulfadiazine/ LS: Lincomycin/spectinomycin/ C: Chloramphenicol)\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7271789/v1/3d7cfdec1261b488c3b770dd.png"},{"id":91014573,"identity":"3659316f-bc1c-4cff-89f7-c4b021f40d72","added_by":"auto","created_at":"2025-09-10 16:24:33","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":596373,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7271789/v1/6d8ec486-8ba4-4617-bec9-02a59194077e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Detection and assessment of antibiotic-resistant strains of Salmonella Typhimurium in raptors referred to the Environmental Protection Organization of Kerman, Iran","fulltext":[{"header":"Introduction","content":"\u003cp\u003eWild birds are reservoirs and carriers of zoonotic disease pathogens transmitted through direct air contact or carriers like rodents and other birds. These birds play a vital role in biodiversity and have significant impacts on the ecosystem, which affects the health of humans and other animals. Therefore, it is crucial to research zoonotic infectious diseases in wildlife. This research will help establish monitoring programs for clinical work in wildlife rehabilitation centers and aid in the control of zoonotic diseases (Bhan 2005; Gargiulo 2018). So far, approximately 57 species of birds of prey have been recorded in Iran, which spend a significant part of their migration there, and some of them are classified as endangered.\u003c/p\u003e\u003cp\u003eThe Enterobacteriaceae family comprises significant bacteria impacting the digestive system in humans and animals. Salmonella is one of the most common pathogens causing zoonotic diseases, including Salmonella typhoid and Salmonella paratyphoid. Most Salmonella serovars belong to the category of Salmonella paratyphoid. \u003cem\u003eSalmonella enterica\u003c/em\u003e subspecies \u003cem\u003eenterica\u003c/em\u003e is one of the important subspecies, which includes two important serovars, \u003cem\u003eEnteritidis\u003c/em\u003e and \u003cem\u003eTyphimurium\u003c/em\u003e, and according to reports, they have been able to cause intestinal infections in humans and asymptomatic infections in birds (McMullin 2020). In the study by Jurado-Tarifa et al., which examined 394 birds of prey in Spain, 18 cases, representing 4.6%, tested positive for Salmonella spp. The serovars most frequently isolated in this investigation were \u003cem\u003eSalmonella Enteritidis\u003c/em\u003e and \u003cem\u003eSalmonella Typhimurium\u003c/em\u003e (Jurado-Tarifa et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Raptors can carry salmonella or become infected with it, whether in captivity or the wild. In a study conducted by Vidal et al. regarding free-living birds of prey, it was reported that the prevalence of Salmonella species isolated from these avian subjects was low. However, regarding symptom severity, approximately 7% of the birds exhibited systemic disease, while 3% displayed significant weakness and suboptimal body condition (Vidal et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In instances of systemic salmonella infection that can lead to death, postmortem examinations reveal the bad condition of the body, crop full of undigested food, internal organs, damaged joints, and in some cases, enlarged liver and spleen (Benskin et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAntibiotics are frequently used to treat and prevent bacterial infections in humans and livestock. The widespread use of antibiotics exerts selective pressure on bacteria, resulting in the swift emergence of antimicrobial resistance (AMR). Recent studies indicate that wildlife may function as a reservoir for antimicrobial resistance (AMR) bacteria. This phenomenon potentially facilitates the transmission of AMR isolates to humans and livestock (Prestinaci et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e\u003cp\u003ewhereas the detection and assessment of antibiotic resistance in Salmonella Typhimurium isolated from wildlife in Kerman have not yet been performed. This study is designed to specifically identify this species of Salmonella, given the paramount importance of recognizing pathogenic bacteria in wildlife populations.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e\u003cb\u003eSampling and Salmonella Isolation\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFrom April to October 2023, 66 samples were collected from 33 raptors referred to the Environment Department of Kerman province. Swabs were transported to the microbiology laboratory at Shahid Bahonar Faculty of Veterinary Medicine in Kerman within two hours, using tubes with Cary-Blair transport medium (Merck, Germany) placed next to ice.\u003c/p\u003e\u003cp\u003eEach cloacal and choanal swab was transferred separately to a selenite F broth enrichment medium (Merck, Germany) and incubated at 37\u0026deg;C. After 16 to 20 hours, samples were cultured using the streak plate method on Salmonella-Shigella agar (Merck, Germany) and incubated at 37\u0026deg;C for 24 hours. Two suspicious colonies were checked and identified by a pale color with a black center due to H2S production. To further purify, these colonies were subcultured on SS agar at 37\u0026deg;C for another 24 hours. Suspicious colonies were cultured on nutrient agar medium (Merck, Germany) for storage. Then, TSA, IMViC, and urease biochemical tests were performed. Finally, urease-negative isolates were preserved for further steps. To safeguard the isolates suspended in LB broth medium (Merck, Germany), 50% glycerol was added, and after vortexing, they were frozen at -20\u0026deg;C (Jajarmi et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eDNA extraction and PCR\u003c/b\u003e\u003c/p\u003e\u003cp\u003eDNA extraction was conducted on the cultured Tryptic Soy Agar (TSA) and on each isolate retained from the previous step, using a kit from Favorgen Biotech, Taiwan. DNA extracted from each sample was stored in separate microtubes at -18\u0026deg;C. Molecular detection of Salmonella Typhimurium was conducted using conventional PCR (polymerase chain reaction). The reaction volume was 25 \u0026micro;l and included 12 \u0026micro;l of PCR Master Mix Red (Amplikon, Denmark), 7 \u0026micro;l of distilled water, 0.5 \u0026micro;M of each primer (Pishgam, Iran; see Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e), and 5 \u0026micro;l of DNA template.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eSequence of primers used(Cohen et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e1996\u003c/span\u003e)\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eName of pathogen\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGene\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSequence (5'-3')\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eLength\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e\u003cem\u003eSalmonella Typhimurium\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e\u003cem\u003eflic\u003c/em\u003e\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eF: CGGTGTTGCCCAGGTTGGTAAT\u003c/p\u003e\u003cp\u003eR: ACTCTTGCTGGCGGTGCGACTT\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e559\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eThe thermal programs typically included initial denaturation at 95\u0026deg;C for 5 minutes, denaturation at 95\u0026deg;C for 45 seconds, annealing at 60\u0026deg;C for 45 seconds, extension at 72\u0026deg;C for 60 seconds, and final extension at 72\u0026deg;C for 10 minutes. The steps of denaturation, annealing, and extension were repeated 35 times. All PCR products were subjected to electrophoresis on a 2% agarose gel at a voltage of 100 volts for 40 minutes. To assess the PCR results, images of the bands were captured and photographed using the Gel Doc 1000 imaging system (Vilbert Lormat, France)( Moghadam et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2017\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eAntibiotic sensitivity testing\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe antibiotic sensitivity of the isolates was evaluated using the Kirby-Bauer technique for seven antibiotics: Colistin, Trimethoprim / Sulfadiazine, Enrofloxacin, Lincomycin/spectinomycin, Chloramphenicol, Neomycin and Fosfomycin (Padtan Teb Company, Iran) on Mueller Hinton agar plate (Merck, Germany). Finally, the diameter of the area lacking bacterial growth around the antibiotic discs was measured using calipers. The results were compared to the standards set by the Clinical Laboratory Standard Institute (CLSI) (Pierce et al. 2022; CLSI \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; CLSI \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003eIn this study, 19 out of 66 swabs were suspected of \u003cem\u003eSalmonella spp.\u003c/em\u003e as lactose-negative and H2S-positive by culture in SS agar medium. Additionally, 9 samples from 7 raptors tested positive for \u003cem\u003eSalmonella spp.\u003c/em\u003e in microbiological tests. Four samples from four different raptors tested positive for \u003cem\u003eSalmonella Typhimurium\u003c/em\u003e using the PCR method. (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e,\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e and Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eNumber of positive samples by biochemical and PCR tests\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTotal swabs\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eChonal swabs\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eCloacal swabs\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTotal number\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e66\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e33\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e33\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIsolates of \u003cem\u003eSalmonella spp.\u003c/em\u003e by microbiological tests\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e9\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e5\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eIsolates of \u003cem\u003eSalmonella Typhimurium\u003c/em\u003e by PCR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eSalmonella isolations in Raptors referred to the environmental protection organization of Kerman province\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eName of species\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNumber of Raptors examined\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eIsolates of \u003cem\u003eSalmonella spp.\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eIsolates of \u003cem\u003eSalmonella Typhimurium\u003c/em\u003e\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ecommon kestrel\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e3\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePeregrine falcon\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLong-legged buzzard\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eEurasian sparrowhawk\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBlack kite\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eEurasian goshawk\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCooper's hawk\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e\u003cp\u003e1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e\u003cp\u003e0\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eAlso, the results show that among the 9 isolates of \u003cem\u003eSalmonella spp.\u003c/em\u003e, the highest antimicrobial resistance belonged to Neomycin, Fosfomycin, Colistin, and Enrofloxacin respectively, and Trimethoprim / Sulfadiazine, Lincomycin/spectinomycin, and Chloramphenicol had the same percentage of resistance as the lowest among the investigated antibiotics (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eA \"One Health\" approach is crucial in understanding and managing the health risks associated with \u003cem\u003eSalmonella\u003c/em\u003e in birds of prey and its potential impacts on ecosystems and human health. Isolation of \u003cem\u003eSalmonella\u003c/em\u003e species in 9 out of 66 samples (13.6%) indicates a significant level of exposure or infection with this disease in the Kerman raptor population. Furthermore, this amount poses a danger to the health of wildlife, other animals, and humans due to environmental pollution. Identifying Salmonella typhimurium in four samples (6%) is significant because this serovar is one of the most common and pathogenic types associated with Salmonella disease in humans and animals. The presence of this pathogen in birds of prey can help its spread in the ecosystem. Numerous studies have investigated the prevalence of Salmonella species in wild birds. For instance, In a study by Craven et al. (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2000\u003c/span\u003e), the prevalence of Salmonella species in two bird species, European starlings (Sturnus vulgaris) and house sparrows (Passer domesticus), was reported to be 10.6% (Craven et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). Vlahović et al. (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2004\u003c/span\u003e) reported a Salmonella prevalence of 7.4% and a Salmonella Typhimurium prevalence of 3.7% in fresh fecal samples from 107 free-living birds (Vlahović et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). In another study, Kobayashi et al. (\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) reported a prevalence of 5.79% for Salmonella species isolated from cloacal swabs, all identified as \u003cem\u003eSalmonella Typhimurium.\u003c/em\u003e Awadallah et al. (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) reported a Salmonella prevalence of 10.75% in doves, quails, sparrows, and cattle egrets (Kobayashi et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Awadallah et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The prevalence of salmonella is influenced by various factors, including geographical location, habitat type, predator species, environmental and nutritional conditions, sample type, and the diagnostic methods used (Allgayer et al.2008). In captive breeding facilities, these birds are mainly fed commercial chicken meat or frozen day-old chicks (Tizard \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). In a series of studies conducted in Iran, the isolation rate of Salmonella in broiler chickens was reported at 10.83%, based on samples collected over two years from broiler farms throughout the nation (2011). In Sanandaj, the isolation rate from 37 broiler poultry houses was found to be 1.8% in the year 2017 (Peighambari et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Doulatyabi et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). A study by Firouzabadi et al. (2018) conducted in Kerman revealed that Salmonella infection in chicken farms was 48%. Notably, 24% of these infections were identified as \u003cem\u003eSalmonella Typhimurium\u003c/em\u003e. This data underscores the potential implications of Salmonella infections for captive raptor populations. (Firouzabadi et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). Free-living birds may become infected with Salmonella spp. through the predation of small birds, rodents, and other small animals. Research conducted in Norway demonstrates that Salmonella is endemic among avian populations in this region, with small birds capable of serving as asymptomatic carriers of this bacterium (Refsum et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Pigeons, which are frequently hunted by birds of prey, may act as a reservoir for the Typhimurium serotype of this bacterium (Toro et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). One of the primary factors affecting the prevalence of Salmonella in raptors is their dietary choices and feeding behaviors. While this study did not include detailed information regarding the diets of free-living birds, it was observed that three of the positive Salmonella samples originated from birds that were provided with chicken meat. Salmonella infection in predatory animals can result in clinical disease, manifested by symptoms such as anorexia, dehydration, ruffled feathers, green-colored feces, and involvement of the liver and spleen (McMullin 2020). In our study, the analysis of recorded histories and clinical symptoms indicated that a majority of positive samples presented with lethargy, anorexia, ruffled feathers, and diarrhea. The prevalence of Salmonella and the susceptibility to infection differ among various species of birds of prey. These variations can be attributed to dietary habits, behavior, physiological differences, and habitat conditions. A study by Milan et al. (2004) in the Basque Country of Spain examined the presence of Salmonella and its various strains among wild birds representing different orders and species. The researchers successfully isolated four distinct Salmonella serotypes, including \u003cem\u003eSalmonella typhimurium\u003c/em\u003e, in Eurasian griffon vulture (Gyps fulvus), Eurasian sparrowhawk (Accipiter nisus), common buzzard (Buteo buteo), and common kestrel (Falco tinnunculus) (Mill\u0026aacute;n et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). In another study on 105 diurnal raptors in Italy (2017) by Gargiulo et al., it was determined that eight birds tested positive for Salmonella species. This group included six common kestrels, one saker falcon, and one common buzzard. Notably, a case of \u003cem\u003eSalmonella Typhimurium\u003c/em\u003e was isolated from one of the common kestrels. In our research, three common kestrels also tested positive for Salmonella Typhimurium. The common kestrel (Falco tinnunculus) primarily preys on small mammals, birds, and insects. This species is typically found in open habitats, woodlands, wetland peripheries, and areas in proximity to urban environments. The association of the kestrel with human-modified landscapes, including poultry and livestock farms, as well as aquifers that supply water, may elucidate the observed higher prevalence of Salmonella in this species. This prevalence may be attributed to its diet, which includes insects and avian species that are potential carriers of Salmonella spp. (Gargiulo et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAntibiotic resistance in bacteria isolated from domestic poultry is a prevalent concern; however, it has also been documented in bacteria sourced from wild birds A study conducted by Molina-L\u0026oacute;pez et al. (2011) identified antibiotic resistance of Salmonella Typhimurium to sulfonamides and aminoglycosides in raptors (Molina-Lopez et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Further research by Molina-L\u0026oacute;pez et al. (\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) at a wildlife rehabilitation center in Spain evaluated antibiotic resistance in Salmonella Typhimurium. Among seven positive Salmonella cases, five were confirmed as Salmonella Typhimurium. The resistance patterns observed in these five cases indicated that 60% (three cases) were resistant to chloramphenicol, 40% (two cases) were resistant to colistin, 40% (two cases) were resistant to sulfadiazine/trimethoprim, 80% (four cases) were resistant to streptomycin, and 40% (two cases) were resistant to gentamicin (Molina-Lopez et al. 2015). Additionally, a study by Tardone et al. (\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) reported the occurrence of antibiotic resistance in Salmonella among raptors and aquatic birds. In raptors, resistance was documented solely to aminoglycosides, specifically gentamicin, while multidrug resistance (MDR) was noted among aquatic birds (Tardone et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In the current study, aminoglycoside resistance was observed in Salmonella Typhimurium isolated from raptors, corroborating findings from existing research. Furthermore, the highest levels of antibiotic resistance were identified against neomycin, fosfomycin, colistin, and enrofloxacin among the Salmonella strains examined in this investigation. Antibiotic resistance in Salmonella spp. has been extensively documented across various domestic and farmed species by numerous researchers. Notably, the 2016 European AMR surveillance report indicated the prevalence of colistin resistance in Salmonella, with findings of 29.6% in turkey meat, 5.5% in chicken meat, and 10.5% in breeder chickens(ECDC \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In a study conducted by Amira et al. in Egypt in 2017, the authors investigated antibiotic resistance in 15 isolates of Salmonella enterica obtained from raw chicken and beef meat. The findings revealed that none of the isolates exhibited resistance to chloramphenicol or colistin. However, it was noted that 53% of the isolates displayed resistance to sulfadiazine/trimethoprim (Moawad et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In Burkina Faso, a study conducted by Kagamb\u0026egrave;ga et al. (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) identified multi-drug resistant (MDR) Salmonella Typhimurium in isolates obtained from both human and poultry sources. This particular strain exhibits resistance to ampicillin, chloramphenicol, streptomycin, sulfonamides, and trimethoprim, thereby indicating a significant potential risk for food contamination (Kagamb\u0026egrave;ga et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). A study conducted by Mir et al. in southeastern Iran in 2021 revealed that Salmonella species isolated from two chicken meat samples demonstrated resistance to the antibiotics sulfadiazine/trimethoprim and lincomycin-spectinomycin (Mir et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). This observation, which aligns with findings from other research on domestic birds, underscores the potential for transmission of antibiotic resistance to raptors that consume domestic avian species. Consequently, this highlights the significant risk that raptors may acquire resistant bacteria through their diet, particularly when ingesting infected poultry.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eThe isolation of Salmonella species, specifically Typhimurium, from raptors in Kerman province, coupled with the observed antibiotic resistance in these strains, has led to a reduction in available treatment options. Furthermore, the role of birds of prey in the transmission of these resistant and pathogenic bacteria to humans and domestic animals, due to their migratory patterns, underscores the importance of adopting a One Health approach. The monitoring, treatment, and study of this disease in infected captive raptors are critical components in controlling salmonella within the animal-human-ecosystem cycle. Consequently, it is imperative to conduct further research in various geographical regions of Iran to effectively enhance the identification and management of this disease.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCompliance with ethical standards\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThis study was not supported by any funding\u003cstrong\u003e.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e: The authors declare that they have no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical approval:\u003c/strong\u003e All applicable international, national, and/or institutional guidelines for the care and use of animals were followed.\u003c/p\u003e\u003cp\u003eAuthors' Contribution1- Study concept and design: Shafiei.H, Amrollahi.S, Salehi.M2- Acquisition of data: Jajarmi.M3- Analysis and interpretation of data: Shafiei.H, Jajarmi.M4- Drafting of the manuscript: Shafiei.H, Amrollahi.S, Zangiabadi. M5- Critical revision of the manuscript for important intellectual content: Shafiei.H6- Statistical analysis: Jajarmi.M, Zangiabadi. M7- Administrative, technical, and material support: Jajarmi.M, Shafiei.H8- Study supervision: Shafiei.H, Salehi.MAll authors reviewed the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAllgayer MC, Lima-Rosa CA V, Weimer TA, Rodenbusch CR, Pereira RA, Streck AF, Oliveira SD, Canal CW (2008) Molecular diagnosis of Salmonella species in captive psittacine birds. Vet Rec 162:816\u0026ndash;819. https://doi.org/10.1136/vr.162.25.816\u003c/li\u003e\n\u003cli\u003eAwadallah MA, Merwad AM, Mohamed RE (2013) Prevalence of Zoonotic Escherichia coli and Salmonellae in Wild Birds and Humans in Egypt with Emphasis on RAPD-PCR Fingerprinting of E. coli. Glob Vet 11:781\u0026ndash;788\u003c/li\u003e\n\u003cli\u003eBenskin CMH, Wilson K, Jones K, Hartley IR (2009) Bacterial pathogens in wild birds: a review of the frequency and effects of infection. Biol Rev 84:349\u0026ndash;373\u003c/li\u003e\n\u003cli\u003eBhan MK, Bahl R, Bhatnagar S (2005) Typhoid and paratyphoid fever. Lancet 366:749\u0026ndash;762\u003c/li\u003e\n\u003cli\u003eCLSI (2018). Performance standards for antimicrobial disk and dilution susceptibilty tests for bacteria isolated from animals. 4\u003csup\u003eth \u003c/sup\u003eed. CLSI supplement VET08. Wayne, PA: Clinical and Laboratory Standards Institute.\u003c/li\u003e\n\u003cli\u003eCLSI (2020). Performance standards for antimicrobial susceptibility testing. 30\u003csup\u003eth\u003c/sup\u003e ed. CLSI supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute. \u003c/li\u003e\n\u003cli\u003eCohen HJ, Mechanda SM, Lin W (1996) PCR amplification of the fimA gene sequence of Salmonella typhimurium, a specific method for detection of Salmonella spp. Appl Environ Microbiol 62:4303\u0026ndash;4308\u003c/li\u003e\n\u003cli\u003eCraven SE, Stern NJ, Line E, Bailey JS, Cox NA, Fedorka-Cray P (2000) Determination of the Incidence of Salmonella spp., Campylobacter jejuni, and Clostridium perfringens in Wild Birds near Broiler Chicken Houses by Sampling Intestinal Droppings. Avian Dis 44:715\u0026ndash;720. https://doi.org/10.2307/1593118\u003c/li\u003e\n\u003cli\u003eDoulatyabi S, Peighambari SM, Morshed R (2017) Survey of Salmonella infections in broiler farms around Sanandaj. J Ilam Univ Med Sci 25:70\u0026ndash;78\u003c/li\u003e\n\u003cli\u003eECDC E (2014) EFSA (European Food Safety Authority) and ECDC (European Centre for Disease Prevention and Control), 2015. Eur Union Summ Rep trends sources zoonoses, zoonotic agents food-borne outbreaks 13:4036\u003c/li\u003e\n\u003cli\u003eFirouzabadi A, Saadati D, Najimi M, Jajarmi M (2020) Prevalence and related factors of Salmonella spp. and Salmonella Typhimurium contamination among broiler farms in Kerman province, Iran. Prev Vet Med 175:104838\u003c/li\u003e\n\u003cli\u003eGargiulo A, Fioretti A, Russo TP, Varriale L, Rampa L, Paone S, De Luca Bossa LM, Raia P, Dipineto L (2018) Occurrence of enteropathogenic bacteria in birds of prey in Italy. Lett Appl Microbiol 66:202\u0026ndash;206. https://doi.org/10.1111/lam.12836\u003c/li\u003e\n\u003cli\u003eJajarmi M, Ghanbarpour R, Sharifi H, Golchin M (2016) Distribution pattern of EcoR phylogenetic groups among shiga toxin-producing and enteropathogenic Escherichia coli isolated from healthy goats. Int J Enteric Pathog 3:5\u0026ndash;27971\u003c/li\u003e\n\u003cli\u003eJurado-Tarifa E, Torralbo A, Borge C, Cerd\u0026agrave;-Cu\u0026eacute;llar M, Ayats T, Carbonero A, Garc\u0026iacute;a-Bocanegra I (2016) Genetic diversity and antimicrobial resistance of Campylobacter and Salmonella strains isolated from decoys and raptors. Comp Immunol Microbiol Infect Dis 48:14\u0026ndash;21\u003c/li\u003e\n\u003cli\u003eKagamb\u0026egrave;ga A, Lienemann T, Frye JG, Barro N, Haukka K (2018) Whole genome sequencing of multidrug-resistant Salmonella enterica serovar Typhimurium isolated from humans and poultry in Burkina Faso. Trop Med Health 46:1\u0026ndash;5\u003c/li\u003e\n\u003cli\u003eKobayashi H, Kanazaki M, Shimizu Y, Nakajima H, Khatun MM, Hata E, Kubo M (2007) Salmonella isolates from cloacal swabs and footpads of wild birds in the immediate environment of Tokyo Bay. J Vet Med Sci 69:309\u0026ndash;311\u003c/li\u003e\n\u003cli\u003eMcMullin PF (2020) Diseases of poultry 14th edition: David E. Swayne, Martine Boulianne, Catherine M. Logue, Larry R. McDougald, Venugopal Nair, David L. Suarez, Sjaak de Wit, Tom Grimes, Deirdre Johnson, Michelle Kromm, Teguh Yodiantara Prajitno, Ian Rubinoff \u0026amp; Guillermo Z. Taylor \u0026amp; Francis. Avian Pathology, 49, 526. https://doi.org/10.1080/03079457.2020.1794237\u003c/li\u003e\n\u003cli\u003eMill\u0026aacute;n J, Aduriz G, Moreno B, Juste RA, Barral M (2004) Salmonella isolates from wild birds and mammals in the Basque Country (Spain). OIE Rev Sci Tech 23:905\u0026ndash;911. https://doi.org/10.20506/rst.23.3.1529\u003c/li\u003e\n\u003cli\u003eMir R, Salari S, Najimi M, Rashki A (2022) Determination of frequency, multiple antibiotic resistance index and resistotype of Salmonella spp. in chicken meat collected from southeast of Iran. Vet Med Sci 8:229\u0026ndash;236. https://doi.org/https://doi.org/10.1002/vms3.647\u003c/li\u003e\n\u003cli\u003eMoawad AA, Hotzel H, Awad O, Tomaso H, Neubauer H, Hafez HM, El-Adawy H (2017) Occurrence of Salmonella enterica and Escherichia coli in raw chicken and beef meat in northern Egypt and dissemination of their antibiotic resistance markers. Gut Pathog 9:1\u0026ndash;13\u003c/li\u003e\n\u003cli\u003eMoghadam A, Nazarian S, Amani J (2017) Identification and assessment of Salmonella typhimurium, infantis and enteritidis serotypes in clinical samples from medical centers of Kerman province. Iran J Med Microbiol 11:1\u0026ndash;8\u003c/li\u003e\n\u003cli\u003eMolina-Lopez RA, Valverd\u0026uacute; N, Martin M, Mateu E, Obon E, Cerd\u0026agrave;-Cu\u0026eacute;llar M, Darwich L (2011) Wild raptors as carriers of antimicrobial-resistant Salmonella and Campylobacter strains. Vet Rec 168:565\u003c/li\u003e\n\u003cli\u003eMolina-L\u0026oacute;pez RA, Vidal A, Ob\u0026oacute;n E, Mart\u0026iacute;n M, Darwich L (2015) Multidrug-resistant Salmonella enterica serovar Typhimurium monophasic variant 4, 12: i:-isolated from asymptomatic wildlife in a Catalonian wildlife rehabilitation center, Spain. J Wildl Dis 51:759\u0026ndash;763\u003c/li\u003e\n\u003cli\u003ePeighambari SM, Akbarian R, Morshed R, Yazdani A (2013) Characterization of Salmonella isolates from poultry sources in Iran\u003c/li\u003e\n\u003cli\u003ePierce VM, Mathers AJ (2022) Setting antimicrobial susceptibility testing breakpoints: a primer for pediatric infectious diseases specialists on the Clinical and Laboratory Standards Institute approach. J Pediatric Infect Dis Soc 11:73\u0026ndash;80\u003c/li\u003e\n\u003cli\u003ePrestinaci F, Pezzotti P, Pantosti A (2015) Antimicrobial resistance: a global multifaceted phenomenon. Pathog Glob Health 109:309\u0026ndash;318\u003c/li\u003e\n\u003cli\u003eRefsum T, Handeland K, Baggesen DL, Holstad G, Kapperud G (2002) Salmonellae in avian wildlife in Norway from 1969 to 2000. Appl Environ Microbiol 68:5595\u0026ndash;5599\u003c/li\u003e\n\u003cli\u003eTardone R, Rivera D, Due\u0026ntilde;as F, Sallaberry-Pincheira N, Hamilton-West C, Adell AD, Moreno-Switt AI (2020) Salmonella in Raptors and Aquatic Wild Birds in Chile. J Wildl Dis 56:707\u0026ndash;712. https://doi.org/10.7589/2019-08-198\u003c/li\u003e\n\u003cli\u003eTizard I (2004) Salmonellosis in wild birds. Semin Avian Exot Pet Med 13:50\u0026ndash;66. https://doi.org/https://doi.org/10.1053/j.saep.2004.01.008\u003c/li\u003e\n\u003cli\u003eToro H, Saucedo C, Borie C, Gough RE, Alcaino H (1999) Health status of free-living pigeons in the city of Santiago. Avian Pathol 28:619\u0026ndash;623\u003c/li\u003e\n\u003cli\u003eVidal A, Baldom\u0026agrave; L, Molina-L\u0026oacute;pez RA, Martin M, Darwich L (2017) Microbiological diagnosis and antimicrobial sensitivity profiles in diseased free-living raptors. Avian Pathol 46:442\u0026ndash;450. https://doi.org/10.1080/03079457.2017.1304529\u003c/li\u003e\n\u003cli\u003eVlahović K, Matica B, Bata I, Pavlak M, Pavičić Ž, Popović M, Nejedli S, Dovč A (2004) Campylobacter, salmonella and chlamydia in free-living birds of Croatia. Eur J Wildl Res 50:127\u0026ndash;132. https://doi.org/10.1007/s10344-004-0052-1\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"comparative-clinical-pathology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Comparative Clinical Pathology](https://link.springer.com/journal/580)","snPcode":"580","submissionUrl":"https://submission.springernature.com/new-submission/580/3","title":"Comparative Clinical Pathology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Raptors, Salmonella Typhimurium, PCR, Antibiotic resistance, Kerman Province","lastPublishedDoi":"10.21203/rs.3.rs-7271789/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7271789/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eWildlife can serve as a long-term asymptomatic reservoir for zoonotic bacteria, such as Salmonella spp. wild birds are carriers of different serovars of Salmonella enterica, which can play a significant role in the epidemiology of Salmonella disease in humans and livestock. In this study, we detect and evaluate the antibiotic resistance of Salmonella strains, particularly Salmonella Typhimurium, from 33 raptors that carry this pathogen. For this purpose, 66 swab samples were collected: 33 choanal swabs and 33 cloacal swabs. So that, 9 Salmonella spp. isolates and 4 Salmonella Typhimurium isolates were obtained through culture, biochemical tests, and PCR. Continuing the study, the antibiotic resistance of Salmonella-positive samples was measured against seven antibiotics. Among the nine Salmonella detects the highest antibiotic resistance was observed against neomycin, fosfomycin, colistin, and enrofloxacin. In contrast, trimethoprim-sulfadiazine, lincomycin-spectinomycin, and chloramphenicol showed the lowest resistance, with similar percentages. The isolation of Salmonella species, specifically Typhimurium, from raptors in Kerman province, coupled with the observed antibiotic resistance in these strains, has reduced available treatment options. Furthermore, the role of birds of prey in transmitting resistant and pathogenic bacteria to humans and domestic animals, due to their migratory patterns, underscores the importance of adopting a One Health approach. The monitoring, treating, and studying of this disease in infected captive raptors are critical components in controlling Salmonella within the animal-human-ecosystem cycle.\u003c/p\u003e","manuscriptTitle":"Detection and assessment of antibiotic-resistant strains of Salmonella Typhimurium in raptors referred to the Environmental Protection Organization of Kerman, Iran","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-10 16:00:28","doi":"10.21203/rs.3.rs-7271789/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-15T06:24:46+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-14T18:26:42+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-12T12:02:24+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"238971473581403942421549109205135482893","date":"2025-09-05T14:47:53+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"259282951504996912557836522262693401742","date":"2025-09-04T17:08:22+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-04T08:31:27+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-04T00:11:55+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-04T00:10:49+00:00","index":"","fulltext":""},{"type":"submitted","content":"Comparative Clinical Pathology","date":"2025-08-01T13:35:18+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"comparative-clinical-pathology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Comparative Clinical Pathology](https://link.springer.com/journal/580)","snPcode":"580","submissionUrl":"https://submission.springernature.com/new-submission/580/3","title":"Comparative Clinical Pathology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"3339fc30-d4a4-4d13-a7a4-9e02c907f680","owner":[],"postedDate":"September 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2025-12-07T06:23:28+00:00","versionOfRecord":[],"versionCreatedAt":"2025-09-10 16:00:28","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7271789","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7271789","identity":"rs-7271789","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}