Discovery of Gongshan muntjac (Muntiacus gongshanensis) in Arunachal Pradesh: overlapping distribution with Muntiacus vaginalis and taxonomic insights

Discovery of Gongshan muntjac (Muntiacus gongshanensis) in Arunachal Pradesh: overlapping distribution with Muntiacus vaginalis and taxonomic insights | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Discovery of Gongshan muntjac (Muntiacus gongshanensis) in Arunachal Pradesh: overlapping distribution with Muntiacus vaginalis and taxonomic insights Stanzin Dolker, Lenrik Konchok Wangmo, Sirumai Khusiali Kri, Vinay Kumar, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8439843/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 15 You are reading this latest preprint version Abstract Rapid evolving chromosome numbers and the emergence of new species within the Muntiacus genus have led to taxonomic ambiguity. Gongshan muntjac ( M. gongshanensis ) was reported as endemic to China and its distribution in northern Myanmar and north-east India remained doubtful, due to lack of firm evidences. We collected a few samples from the trophy-hunted specimens in eastern Arunachal Pradesh, and two samples on genetic analysis identified to be of Gongshan muntjac, while two others identified as red muntjac ( M. vaginalis ). Interestingly, these specimens were sourced from the same household through hunting in eastern Arunachal Pradesh, bordering south-west China. The Bayesian-based phylogenetic analysis shows the clustering of these specimens with the respective species providing the first genetic evidence of occurrence of M. gongshanensis from Arunachal Pradesh and also suggesting its overlapping range with M. vaginalis in the eastern Arunachal Pradesh, India. 12S ribosomal RNA Cytochrome b Muntjacs M. gongshanensis Species identity Figures Figure 1 Figure 2 Full Text The genus Muntiacus has a wide distribution throughout South and Southeast Asia [1]. Much attention has been paid to the genus due to its fast-evolving chromosome number[1,2]. However, there is an ambiguity in their phylogenetic relationship within the Muntiacus [1]. With the increased number of new species, their distribution and taxonomic classification remains controversial. Ma.et. al. (1990) reported five species of Muntaicus while in 2011 Grove & Grubb reported 16 species and the most recent study by Zhang et al (2021) reported 12 species [1,3,4].Currently, the IUCN has reported13 species of Muntaicus, of which seven are listed as data deficient. In India, four species of Muntiacus have been reported, namely M. muntjac ( Southern red muntjac) , M. aureus (Himalayan red muntjac), M. vaginalis (Mainland red muntjac), and M. malabaricus (Western Ghats &Sri Lankan red muntjac) [5,6]. Dutta et. al (2003) report the first record of M. putaoenis from Changlang district in eastern Arunachal Pradesh based on the skull morphology and later on verified by molecular evidence [7,8]. A few studies have assumed the presence of M. gongshanesis from Arunachal Pradesh based on the knowledge of local hunters [6,9]. However, the absence of definitive evidence confirming its presence in India has hindered further research. Moreover, the taxonomic ambiguity surrounding the recognition of M. gongshanensis has added complexity to the issue. Previously, the species was included as a subspecies of M. feae or M. cirinifrons while, a recent study based on the mitogenome sequencing described M. gongshanensis and M. cirinifrons as monophyletic and described the presence of M. gongshanensis in southwest China and northern Myanmar [1]. IUCN also reports the distribution of the species in southwestern China and northern Myanmar while, it is described as uncertain in India, Tibet, and Bhutan. According to the IUCN Red List, M. gongshanensis is classified as data deficient, while the Red List of China’s vertebrates lists it as Critically Endangered[10]. This study aimed to conduct exploratory surveys in eastern Arunachal Pradesh using sign surveys, camera trapping, and non-invasive genetic methods to investigate transboundary free-ranging large mammal species between India and China. During this survey, Muntiacus gongshanensis was unexpectedly identified from tissue samples collected at a hunter’s residence in Anjaw district, Arunachal Pradesh. We undertook field surveys in eastern Arunachal Pradesh, including the East Siang, Lower Dibang Valley, Lohit, and Anjaw districts, during March 2024. A total of 18 ungulate hunting trophies displayed in local households were sampled from Sethi village in the Anjaw district, Arunachal Pradesh. All samples comprised only preserved heads. Due to the absence of complete bodies and diagnostic morphological characters, bosed on morphological was not possible, and genetic identification was therefore adopted. Genomic DNA was extracted using DNeasy Blood & Tissue Kit (QIAGEN Germany) following the manufacturer's instructions. We sequenced a partial segment of mitochondrial gene Cytochrome b (5′-CCATCCAACATCTCAGCATGATGAAA-3′) and (5′GCCCCTCAGAATGATATTTGTCCTCA-3′) [11] and 12S rRNA (5′-AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT-3′) and (5′TGACTGCAGAGGGTGACGGGGGTGTGT -3′) [11] from all the samples. PCR amplifications were performed with a total volume of 10 μl comprising of 5-10 ng template DNA, 5U Taq polymerase (Promega), 5X PCR buffer, 25 mM MgCl 2 , 10 mM dNTPs mix, 0.1 µM of each primer on VeritiPro™ Thermal Cycler (Applied Biosystems, USA). Thermal cycling conditions include an initial denaturation step at 94°C for 5 min, followed by 35 cycles of denaturation at 94°C (30s), annealing at 50°C for Cytb and 51°C 12S rRNA(45s), and extension at72°C (60s). The final extension was at 72°C for 10 min. The sequencing was performed using Big-Dye Terminator Cycle Sequencing Kit v.3.1 (Thermo Scientific, USA) on an ABI 3730 Genetic analyzer (Applied Biosystems, USA). The obtained sequences were manually validated using Sequencher v 4.7 (www. genecode.com), and multiple sequence alignments were performed using the CLUSTAL W function, implemented in program BioEdit v 7.0.9.0 [12]. Additionally, we downloaded eighteen complementary sequences of barking deer from GenBank / NCBI (Supplementary table 1). Phylogenetic trees were reconstructed using a Bayesian approach in BEAST v2.5[13]. The best-fit nucleotide substitution model was selected using MrModelTest v2.3 [14], and the HKY model, which had the lowest AIC value, was applied. Markov Chain Monte Carlo (MCMC) simulations were run for 20 million generations, sampling every 1000th tree, with the first 20% of sampled trees discarded as burn-in. The final phylogenetic tree was annotated in Tree Annotator v1.8.1 to obtain the maximum clade credibility (MCC) tree [13] and visualized in FigTree v1.4.0 [15] (Fig. 2). Additionally, we performed Maximum Likelihood (ML) and Neighbor-Joining (NJ) analyses in MEGA X [16] with 1000 bootstrap replications (Supplementary Fig. S1 and S2). Out of the 18 specimens sampled, four were identified as belonging to the muntjac group. Among them, two specimens ( MT-8483 and MT-8484 ) were identified as Muntiacus vaginalis , while the other two ( MT-8470 and MT-8471 ) were identified as Muntiacus gongshanensis , based on NCBI BLAST results showing >99% similarity. The novel sequences generated for M. vaginalis (Cytochrome b : PQ063858 and PQ063859; 12S rRNA: PX512267 and PX512268) and for M. gongshanensis (Cytochrome b : PQ063856 and PQ063857; 12S rRNA: PX512265 and PX512266) were submitted to NCBI GenBank. All Muntiacus sequences clustered into two major clades across all three phylogenetic analyses (Bayesian, ML, and NJ) (Fig. 2, Supplementary Fig. S1 and S2). The first clade includes M. gongshanesis, M. crinifrons, M. feae, M. vaginalis, M. aureus, M. muntjak, M. malabaricus, and M. atherodes. The second clade includes M. vuguangensis, M. putaoensis, and M. reevesi coinciding with the previous studies [1].Sequences from the present study grouped within the first clade, MT-8470 - MT8471 with M. gongshanesis and MT8483- MT8484 with M. vaginalis in the phylogenetic tree. Surprisingly, samples of M. gongshanesis and M. vaginalis were collected from the same hunter’s house in the Anjaw district and the hunter reported that both specimens were obtained from the Warti mountain during different seasons. This provides clues for further exploring and validating the possible overlapping distribution of these two species. Zhang et al. (2021) reported that eight sequences i.e. DQ445732-DQ445735 by Chen et al (2008) and EF523661-EF523664 by James et al. (2008) originally belongs to the M. gongshanensis , but was misidentified as M. crinifrons by earlier studies (Chen et al., 2008 James et al., 2008). We agree with Zhang et al. (2021) based on the clustering pattern observed in the phylogenetic analysis (Fig.2). The ML tree constructed with the Cytb gene and 12S rRNA gene coincided with the clustering patterns with the Bayesian–based phylogenetic tree (Supplementary Figure S1a and b). A few studies have claimed that M. gongshanensis is endemic to China (Wang, 2003; Jiang et al., 2016) while other studies argued the species' presence may extend to northeast India and northern Myanmar[19]. The present study records the first genetic evidence of the occurrence of M. gongshanensis from eastern Arunachal Pradesh, India, and also provides clues for the overlapping distribution of M. gongshanensis with M. vaginalis. This study will be pivotal to establish first genetic evidence of occurrence of M. gongshanensis in India. This study contributes to conservation planning in data-deficient and unexplored regions, particularly in areas subjected to high traditional hunting pressure. The application of molecular approaches, even when based on mitochondrial markers, aids in the identification of unknown or previously unreported species and provides valuable baseline information for biodiversity assessments. However, given the complex evolutionary history of muntjacs, mitochondrial data alone cannot conclusively rule out hybridization or introgression. Furthermore, this study underscores the need for future investigations integrating nuclear genetic markers and morphological analyses to more precisely determine the distributional range, species boundaries, and conservation status of transboundary Himalayan taxa. Declarations Funding statement: The study was supported by the in-house grant and facilities provided by the Zoological Survey of India, Kolkata. Author information: Author and Affiliations Zoological Survey of India, M Block, New Alipore, Kolkata 700053, West Bengal, India Stanzin Dolker, Lenrik Konchok Wangmo, Avijit Ghosh, Vinay Kumar, Bheem Dutt Joshi, Kamalakannan Manokaran, Lalit Kumar Sharma, Mukesh Thakur. E-67, Pomliang, Tezu, Lohit district, 792001, Arunachal Pradesh Sirumai Khusiali Kri Amity Institute of Forestry and Wildlife, Amity University, Gautam Budhha Nagar, Noida, 201303, Uttar Pradesh Sujeet Kumar Singh Contributions: Conceptualization: MT, LKS, SKS and BDJ; Sample collection: LKW, SKK; Methodology: SD, AG, VS and KM; visualization: SD and MT; and writing: SD and MT. Corresponding author: Mukesh Thakur, E-mail: [email protected] Ethics declarations Ethics approval and Consent to participate: Not applicable Ethics statement Fieldwork and sample collection were carried out after obtaining research permission from the State Forest Department of Arunachal Pradesh Clinical trial number: Not applicable Consent to Publish declaration: Not applicable Competing interests: The authors declare no competing interests. Data availability statement: The novel sequences generated sequences generated were submitted to NCBI GenBank under the following accession numbers: M . vaginalis (Cytochrome b : PQ063858 and PQ063859; 12S rRNA: PX512267 and PX512268) and for M. gongshanensis (Cytochrome b : PQ063856 and PQ063857; 12S rRNA: PX512265 and PX512266) Acknowledgements : The authors thank the State Forest Department of Arunachal Pradesh, India for granting permission to undertake the field survey and sample collection. The authors also acknowledge the local guides and field assistants who helped during fieldwork. The study was supported by the in-house grant and facilities provided by the Zoological Survey of India, Kolkata. References Zhang YC, Ye HL, Li R, Maung KW, Li GG, Quan RC. Molecular phylogeny of the genus Muntiacus with special emphasis on the phylogenetic position of Muntiacus gongshanensis. Zool Res. 2021;42(2):212–6. Wang W, Lan H. Rapid and Parallel Chromosomal Number Reductions in Muntjac Deer Inferred from Mitochondrial DNA Phylogeny. Mol Biol Evol. 2000;17(9):1326–33. Groves C, Grubb P. Unglulate Taxonomy. 2011. Ma Slai, Wang Y, xiang, Shi L. ming. A new species of the genus Muntiacus from Yunnan, China. Zool Res. 1990;11(1):47–53. Singh B, Kumar A, Uniyal V, Gupta S. Phylogeography and population genetic structure of red muntjacs: evidence of enigmatic Himalayan red muntjac from India. BMC Ecol Evol. 2021;21(1). Menon V. Indian Mammals: A mamField Guide. Hachette India; 2023. Aparajita D, Japang P, Madhusuda MD, Mishra C. Discovery of the leaf deer Muntiacus putaoensis in Arunachal Pradesh: An addition to the large mammals of India. Curr Sci. 2003;84(3):454–8. James J, Ramakrishnan U, Datta A. Molecular evidence for the occurrence of the leaf deer Muntiacus putaoensis in Arunachal Pradesh, north-east India. Conserv Genet. 2008;9(4):927–31. Choudhury A. The Mammals of Arunachal Pradesh. Daya Books; 2003. Jiang Z, Li L, Luo Z, Tang S, Li C, Hu H, et al. Evaluating the status of China’s mammals and analyzing their causes of endangerment through the red list assessment. Biodivers Sci. 2016;24(5):552–67. Kocher TD, Thomas WK, Meyer A, Edwards SV, Pääbo S, Villablanca FX, et al. Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc Natl Acad Sci. 1989;86(16):6196–200. Hall TASS. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. 1999;41:95–8. Bouckaert R, Vaughan TG, Barido-Sottani J, Duchêne S, Fourment M, Gavryushkina A, et al. BEAST 2.5: An advanced software platform for Bayesian evolutionary analysis. PLOS Comput Biol. 2019;15(4):e1006650. Nylander JAA. MrModeltest v2. Program distributed by the author. Evol Biol Cent Uppsala Univ. 2004;2(October):1–2. Rambaut A. Oct. FigTree version 1.4. 0 Available at http://tree.bio.ed.ac.uk/software/figtree . Accessed 2016. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35(6):1547–9. Jiang Z, Jiang J, Wang Y, Zhang E, Zhang Y, Xie Li L, et al. Red List of China’s Vertebrates. Biodivers Sci. 2016;24(5):500–51. Wang YX. A complete checklist of mammal species and subspecies in China: a taxonomic and geographic reference (Zhongguo buru dongwu zhongqun he yazhong fenlei minglu yu fenbu daquan). Beijing: China Forestry Publishing House; 2003. (Zhongguo linye chubanshe). Smith A, Lunde D, Hoffmann R, Xie Y. A guide to the mammals of China. Princet Univ; 2010. Additional Declarations No competing interests reported. Supplementary Files GongshanMuntjacSupplimentryFigurediscoverconservation.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 12 Mar, 2026 Reviews received at journal 02 Mar, 2026 Reviews received at journal 28 Feb, 2026 Reviews received at journal 28 Feb, 2026 Reviewers agreed at journal 22 Feb, 2026 Reviewers agreed at journal 19 Feb, 2026 Reviewers agreed at journal 19 Feb, 2026 Reviews received at journal 10 Feb, 2026 Reviewers agreed at journal 08 Feb, 2026 Reviews received at journal 26 Jan, 2026 Reviewers agreed at journal 22 Jan, 2026 Reviewers invited by journal 22 Jan, 2026 Editor assigned by journal 27 Dec, 2025 Submission checks completed at journal 27 Dec, 2025 First submitted to journal 24 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8439843","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":580719163,"identity":"72c33f7b-d2ec-48de-b538-29cf0be57d0f","order_by":0,"name":"Stanzin Dolker","email":"","orcid":"","institution":"Zoological Survey of India","correspondingAuthor":false,"prefix":"","firstName":"Stanzin","middleName":"","lastName":"Dolker","suffix":""},{"id":580719164,"identity":"8e92d4d3-0726-49a9-8bc8-da3a98f523b7","order_by":1,"name":"Lenrik Konchok Wangmo","email":"","orcid":"","institution":"Zoological Survey of India","correspondingAuthor":false,"prefix":"","firstName":"Lenrik","middleName":"Konchok","lastName":"Wangmo","suffix":""},{"id":580719165,"identity":"c6d973a9-d68c-4af4-864d-87cddae90759","order_by":2,"name":"Sirumai Khusiali Kri","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Sirumai","middleName":"Khusiali","lastName":"Kri","suffix":""},{"id":580719166,"identity":"bb7d55c8-77b3-45c4-b23d-b7457dcf333b","order_by":3,"name":"Vinay Kumar","email":"","orcid":"","institution":"Zoological Survey of India","correspondingAuthor":false,"prefix":"","firstName":"Vinay","middleName":"","lastName":"Kumar","suffix":""},{"id":580719167,"identity":"e831910a-5d43-4471-a3ca-94883b15ca14","order_by":4,"name":"Bheem Dutt Joshi","email":"","orcid":"","institution":"Zoological Survey of India","correspondingAuthor":false,"prefix":"","firstName":"Bheem","middleName":"Dutt","lastName":"Joshi","suffix":""},{"id":580719168,"identity":"86d2d4b5-8e0b-4822-991c-9d3af76d6270","order_by":5,"name":"Kamalakannan Manokaran","email":"","orcid":"","institution":"Zoological Survey of India","correspondingAuthor":false,"prefix":"","firstName":"Kamalakannan","middleName":"","lastName":"Manokaran","suffix":""},{"id":580719169,"identity":"760426f9-2cf9-4df0-9137-44178ee95b09","order_by":6,"name":"Lalit Kumar Sharma","email":"","orcid":"","institution":"Zoological Survey of India","correspondingAuthor":false,"prefix":"","firstName":"Lalit","middleName":"Kumar","lastName":"Sharma","suffix":""},{"id":580719170,"identity":"7876e281-212f-4682-b9da-c4a29da31b56","order_by":7,"name":"Sujeet Kumar Singh Singh","email":"","orcid":"","institution":"Amity Institute of Forestry and Wildlife, Amity University","correspondingAuthor":false,"prefix":"","firstName":"Sujeet","middleName":"Kumar Singh","lastName":"Singh","suffix":""},{"id":580719172,"identity":"722da35b-a4eb-47ef-96e4-ebe590a2eb65","order_by":8,"name":"Mukesh Thakur","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0UlEQVRIiWNgGAWjYDACCRBxgIHBgL0ByDCwIKyDB66F5wBIiwQpWiQS4JbiB/bSzU8385yxsTeXfH51w48CCQb+9u4E/LbIHDO7zXMjLXHn7Jyymz1Ah0mcObuBgMMSgFo+HE4wuJ2TdoMHqMVAIpeQlvRvQC3/7Q1unkm7+Yc4LTkghx1g3HCD/dht4my5AfTCnDPJiRvO5LDdljGQ4CHoF/YZ6dtuvDlmZ29w/Pizm2/+2Mjxt/fi14JsoQGYJFY52MIHpKgeBaNgFIyCEQQANnxLxDawD48AAAAASUVORK5CYII=","orcid":"","institution":"Zoological Survey of India","correspondingAuthor":true,"prefix":"","firstName":"Mukesh","middleName":"","lastName":"Thakur","suffix":""}],"badges":[],"createdAt":"2025-12-24 07:08:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8439843/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8439843/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":101243973,"identity":"5c2287bd-b933-474c-b31c-227171d4e4af","added_by":"auto","created_at":"2026-01-27 16:11:12","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1085625,"visible":true,"origin":"","legend":"\u003cp\u003eMap representing sampling location and the samples collected from the Anjaw district of Arunachal Pradesh alongside the IUCN distribution of M. vaginalis and M. gongshanensis in India. Images of trophy-hunted specimens, including one picture of each species, are also shown.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8439843/v1/95a71a6aa8fcf158f7798e41.png"},{"id":101243927,"identity":"7375d6a5-a616-45d4-90df-f757ee7e2245","added_by":"auto","created_at":"2026-01-27 16:11:06","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":187095,"visible":true,"origin":"","legend":"\u003cp\u003eBayesian–based (BI) phylogenetic tree reconstructed based on the mitochondrial gene Cytochrome b gene using BEAST v2.5. Samples from the study were marked with red boxes while green dots represent the misidentified sequences of M. gongsiansis submitted to GenBank.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8439843/v1/ef1ea20723dcde2c31eaef00.png"},{"id":101296679,"identity":"7f53660a-0e4f-44fd-acec-b7025cd0ced2","added_by":"auto","created_at":"2026-01-28 09:18:45","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1903945,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8439843/v1/e391f0c0-5cba-4077-8a01-9b80abada92b.pdf"},{"id":101243975,"identity":"90d56c00-6197-4c02-88bf-bd95dc650580","added_by":"auto","created_at":"2026-01-27 16:11:13","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":638717,"visible":true,"origin":"","legend":"","description":"","filename":"GongshanMuntjacSupplimentryFigurediscoverconservation.docx","url":"https://assets-eu.researchsquare.com/files/rs-8439843/v1/66dff976bf43f067a55447b9.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Discovery of Gongshan muntjac (Muntiacus gongshanensis) in Arunachal Pradesh: overlapping distribution with Muntiacus vaginalis and taxonomic insights","fulltext":[{"header":"Full Text","content":"\u003cp\u003eThe genus \u003cem\u003eMuntiacus\u003c/em\u003e has a wide distribution throughout South and Southeast Asia [1]. Much attention has been paid to the genus due to its fast-evolving chromosome number[1,2]. However, there is an ambiguity in their phylogenetic relationship within the \u003cem\u003eMuntiacus \u0026nbsp;\u003c/em\u003e[1]. With the increased number of new species, their distribution and taxonomic classification remains controversial. Ma.et. al. (1990) reported five species of \u003cem\u003eMuntaicus\u0026nbsp;\u003c/em\u003ewhile in 2011 Grove \u0026amp; Grubb reported 16 species and the most recent study by Zhang et al (2021) reported 12 species \u0026nbsp;[1,3,4].Currently, the IUCN has reported13 species of \u003cem\u003eMuntaicus,\u0026nbsp;\u003c/em\u003eof which seven are listed as data deficient.\u003c/p\u003e\n\u003cp\u003eIn India, four species of \u003cem\u003eMuntiacus\u003c/em\u003e have been reported, namely \u003cem\u003eM. muntjac (\u003c/em\u003eSouthern red muntjac)\u003cem\u003e, M. aureus\u003c/em\u003e (Himalayan red muntjac), \u003cem\u003eM. vaginalis\u003c/em\u003e (Mainland red muntjac), and \u003cem\u003eM. malabaricus\u003c/em\u003e (Western Ghats \u0026amp;Sri Lankan red \u0026nbsp;muntjac) [5,6]. Dutta et. al (2003) report the first record of \u003cem\u003eM. putaoenis\u003c/em\u003e from Changlang district in eastern Arunachal Pradesh based on the skull morphology and later on verified by molecular evidence [7,8]. A few studies have assumed the presence of \u003cem\u003eM. gongshanesis\u003c/em\u003e from Arunachal Pradesh based on the knowledge of local hunters [6,9]. However, the absence of definitive evidence confirming its presence in India has hindered further research. Moreover, the taxonomic ambiguity surrounding the recognition of \u003cem\u003eM. gongshanensis\u003c/em\u003e has added complexity to the issue. Previously, the species was included as a subspecies of \u003cem\u003eM. feae or M. cirinifrons\u003c/em\u003e while, a recent study based on the mitogenome sequencing described \u003cem\u003eM. gongshanensis\u0026nbsp;\u003c/em\u003eand \u003cem\u003eM. cirinifrons\u0026nbsp;\u003c/em\u003eas monophyletic and described the presence of \u003cem\u003eM. gongshanensis\u0026nbsp;\u003c/em\u003ein southwest China and northern Myanmar [1]. IUCN also reports the distribution of the species in southwestern China and northern Myanmar while, it is described as uncertain in India, Tibet, and Bhutan. According to the IUCN Red List, \u003cem\u003eM. gongshanensis\u003c/em\u003e is classified as data deficient, while the Red List of China\u0026rsquo;s vertebrates lists it as Critically Endangered[10].\u003c/p\u003e\n\u003cp\u003eThis study aimed to conduct exploratory surveys in eastern Arunachal Pradesh using sign surveys, camera trapping, and non-invasive genetic methods to investigate transboundary free-ranging large mammal species between India and China. During this survey, \u003cem\u003eMuntiacus gongshanensis\u003c/em\u003e was unexpectedly identified from tissue samples collected at a hunter\u0026rsquo;s residence in Anjaw district, Arunachal Pradesh.\u003c/p\u003e\n\u003cp\u003eWe undertook field surveys in eastern Arunachal Pradesh, including the East Siang, Lower Dibang Valley, Lohit, and Anjaw districts, during March 2024. A total of 18 ungulate hunting trophies displayed in local households were sampled from Sethi village in the Anjaw district, Arunachal Pradesh. All samples comprised only preserved heads. Due to the absence of complete bodies and diagnostic morphological characters, bosed on morphological was not possible, and genetic identification was therefore adopted. Genomic DNA was extracted using DNeasy Blood \u0026amp; Tissue Kit (QIAGEN Germany) following the manufacturer\u0026apos;s instructions. We sequenced a partial segment of mitochondrial gene Cytochrome b (5\u0026prime;-CCATCCAACATCTCAGCATGATGAAA-3\u0026prime;) and \u0026nbsp;(5\u0026prime;GCCCCTCAGAATGATATTTGTCCTCA-3\u0026prime;) [11] and 12S rRNA (5\u0026prime;-AAAAAGCTTCAAACTGGGATTAGATACCCCACTAT-3\u0026prime;) and (5\u0026prime;TGACTGCAGAGGGTGACGGGGGTGTGT -3\u0026prime;) [11] from all the samples. PCR amplifications were performed with a total volume of 10 \u0026mu;l comprising of 5-10 ng template DNA, 5U Taq polymerase (Promega), 5X PCR buffer, 25 mM MgCl\u003csub\u003e2\u003c/sub\u003e, 10 mM dNTPs mix, 0.1 \u0026micro;M of each primer on VeritiPro\u0026trade; Thermal Cycler (Applied Biosystems, USA). Thermal cycling conditions include an initial denaturation step at 94\u0026deg;C for 5 min, followed by 35 cycles of denaturation at 94\u0026deg;C (30s), annealing at 50\u0026deg;C for Cytb and 51\u0026deg;C 12S rRNA(45s), and extension at72\u0026deg;C (60s). The final extension was at 72\u0026deg;C for 10 min. The sequencing was performed using Big-Dye Terminator Cycle Sequencing Kit v.3.1 (Thermo Scientific, USA) on an ABI 3730 Genetic analyzer (Applied Biosystems, USA).\u003c/p\u003e\n\u003cp\u003eThe obtained sequences were manually validated using Sequencher v 4.7 (www. genecode.com), and multiple sequence alignments were performed using the CLUSTAL W function, implemented in program BioEdit v 7.0.9.0 [12]. Additionally, we downloaded eighteen complementary sequences of barking deer from GenBank / NCBI (Supplementary table 1). Phylogenetic trees were reconstructed using a Bayesian approach in BEAST v2.5[13]. The best-fit nucleotide substitution model was selected using MrModelTest v2.3 [14], and the HKY model, which had the lowest AIC value, was applied. Markov Chain Monte Carlo (MCMC) simulations were run for 20 million generations, sampling every 1000th tree, with the first 20% of sampled trees discarded as burn-in. The final phylogenetic tree was annotated in Tree Annotator v1.8.1 to obtain the maximum clade credibility (MCC) tree [13] and visualized in FigTree v1.4.0 [15] (Fig. 2). Additionally, we performed Maximum Likelihood (ML) and Neighbor-Joining (NJ) analyses in MEGA X [16] with 1000 bootstrap replications (Supplementary Fig. S1 and S2).\u0026nbsp;\u003c/p\u003e\n\u003cp skip=\"true\"\u003eOut of the 18 specimens sampled, four were identified as belonging to the muntjac group. Among them, two specimens (\u003cem\u003eMT-8483\u003c/em\u003e and \u003cem\u003eMT-8484\u003c/em\u003e) were identified as \u003cem\u003eMuntiacus vaginalis\u003c/em\u003e, while the other two (\u003cem\u003eMT-8470\u003c/em\u003e and \u003cem\u003eMT-8471\u003c/em\u003e) were identified as \u003cem\u003eMuntiacus gongshanensis\u003c/em\u003e, based on NCBI BLAST results showing \u0026gt;99% similarity. The novel sequences generated for \u003cem\u003eM. vaginalis \u003c/em\u003e(Cytochrome \u003cem\u003eb\u003c/em\u003e: PQ063858 and PQ063859; 12S rRNA: PX512267 and PX512268) and for \u003cem\u003eM. gongshanensis \u003c/em\u003e(Cytochrome \u003cem\u003eb\u003c/em\u003e: PQ063856 and PQ063857; 12S rRNA: PX512265 and PX512266) were submitted to NCBI GenBank. \u003c/p\u003e\n\u003cp skip=\"true\"\u003eAll \u003cem\u003eMuntiacus\u003c/em\u003e sequences clustered into two major clades across all three phylogenetic analyses (Bayesian, ML, and NJ) (Fig. 2, Supplementary Fig. S1 and S2). The first clade includes \u003cem\u003eM. gongshanesis, M. crinifrons, M. feae, M. vaginalis, M. aureus, M. muntjak, M. malabaricus, and M. atherodes. \u003c/em\u003eThe second clade includes \u003cem\u003eM. vuguangensis, M. putaoensis, and M. reevesi \u003c/em\u003ecoinciding with the previous studies [1].Sequences from the present study grouped within the first clade, MT-8470 - MT8471 with \u003cem\u003eM. gongshanesis\u003c/em\u003e and MT8483- MT8484 with \u003cem\u003eM. vaginalis \u003c/em\u003ein the phylogenetic tree. Surprisingly, samples of \u003cem\u003eM. gongshanesis\u003c/em\u003e and \u003cem\u003eM. vaginalis \u003c/em\u003ewere collected from the same hunter\u0026rsquo;s house in the Anjaw district and the hunter reported that both specimens were obtained from the Warti mountain during different seasons. This provides clues for further exploring and validating the possible overlapping distribution of these two species.\u0026nbsp;\u0026nbsp;Zhang et al. (2021) reported that eight sequences \u003cem\u003ei.e.\u003c/em\u003e DQ445732-DQ445735 by Chen et al (2008) and EF523661-EF523664 by James et al. (2008) originally belongs to the \u003cem\u003eM. gongshanensis\u003c/em\u003e, but was misidentified as \u003cem\u003eM. crinifrons\u003c/em\u003e by earlier studies (Chen et al., 2008 James et al., 2008). We agree with Zhang et al. (2021) based on the clustering pattern observed in the phylogenetic analysis (Fig.2). \u003c/p\u003e\n\u003cp skip=\"true\"\u003eThe ML tree constructed with the Cytb gene and 12S rRNA gene coincided with the clustering patterns with the Bayesian\u0026ndash;based phylogenetic tree (Supplementary Figure S1a and b). A few studies have claimed that \u003cem\u003eM. gongshanensis \u003c/em\u003eis endemic to China (Wang, 2003; Jiang et al., 2016) while other studies argued the species\u0026apos; presence may extend to northeast India and northern Myanmar[19]. The present study records the first genetic evidence of the occurrence of \u003cem\u003eM. gongshanensis \u003c/em\u003efrom eastern Arunachal Pradesh, India, and also provides clues for the overlapping distribution of \u003cem\u003eM. gongshanensis \u003c/em\u003ewith \u003cem\u003eM. vaginalis. \u003c/em\u003eThis study will be pivotal to establish first genetic evidence of occurrence of \u003cem\u003eM. gongshanensis \u003c/em\u003ein India.\u003c/p\u003e\n\u003cp\u003eThis study contributes to conservation planning in data-deficient and unexplored regions, particularly in areas subjected to high traditional hunting pressure. The application of molecular approaches, even when based on mitochondrial markers, aids in the identification of unknown or previously unreported species and provides valuable baseline information for biodiversity assessments. However, given the complex evolutionary history of muntjacs, mitochondrial data alone cannot conclusively rule out hybridization or introgression. Furthermore, this study underscores the need for future investigations integrating nuclear genetic markers and morphological analyses to more precisely determine the distributional range, species boundaries, and conservation status of transboundary Himalayan taxa.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding statement:\u003c/strong\u003e The study was supported by the in-house grant and facilities provided by the Zoological Survey of India, Kolkata.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor information:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor and Affiliations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eZoological Survey of India, M Block, New Alipore, Kolkata 700053, West Bengal, India\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStanzin Dolker, Lenrik Konchok Wangmo, Avijit Ghosh, Vinay Kumar, Bheem Dutt Joshi, Kamalakannan Manokaran, Lalit Kumar Sharma, Mukesh Thakur.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eE-67, Pomliang, Tezu, Lohit district, 792001, Arunachal Pradesh\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSirumai Khusiali Kri\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAmity Institute of Forestry and Wildlife, Amity University, Gautam Budhha Nagar, Noida, 201303, Uttar Pradesh\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eSujeet Kumar Singh\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions:\u0026nbsp;\u003c/strong\u003eConceptualization: MT, LKS, SKS and BDJ; Sample collection: LKW, SKK; Methodology: SD, AG, VS and KM; visualization: SD and MT; and writing: SD and MT.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCorresponding author:\u0026nbsp;\u003c/strong\u003eMukesh Thakur, E-mail: [email protected]\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u0026nbsp;\u003c/strong\u003eand \u003cstrong\u003eConsent to participate:\u003c/strong\u003e Not applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFieldwork and sample collection were carried out after obtaining research permission from the State Forest Department of Arunachal Pradesh\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eClinical trial number:\u003c/strong\u003e Not applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Publish declaration:\u0026nbsp;\u003c/strong\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests:\u003c/strong\u003e The authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement:\u0026nbsp;\u003c/strong\u003eThe novel sequences generated sequences generated were submitted to NCBI GenBank under the following accession numbers: M\u003cem\u003e. vaginalis\u0026nbsp;\u003c/em\u003e(Cytochrome \u003cem\u003eb\u003c/em\u003e: PQ063858 and PQ063859; 12S rRNA: PX512267 and PX512268) and for \u003cem\u003eM. gongshanensis\u0026nbsp;\u003c/em\u003e(Cytochrome \u003cem\u003eb\u003c/em\u003e: PQ063856 and PQ063857; 12S rRNA: PX512265 and PX512266)\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e: The authors thank the State Forest Department of Arunachal Pradesh, India for granting permission to undertake the field survey and sample collection. The authors also acknowledge the local guides and field assistants who helped during fieldwork. The study was supported by the in-house grant and facilities provided by the Zoological Survey of India, Kolkata.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eZhang YC, Ye HL, Li R, Maung KW, Li GG, Quan RC. Molecular phylogeny of the genus Muntiacus with special emphasis on the phylogenetic position of Muntiacus gongshanensis. Zool Res. 2021;42(2):212\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang W, Lan H. Rapid and Parallel Chromosomal Number Reductions in Muntjac Deer Inferred from Mitochondrial DNA Phylogeny. Mol Biol Evol. 2000;17(9):1326\u0026ndash;33.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGroves C, Grubb P. Unglulate Taxonomy. 2011.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa Slai, Wang Y, xiang, Shi L. ming. A new species of the genus Muntiacus from Yunnan, China. Zool Res. 1990;11(1):47\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSingh B, Kumar A, Uniyal V, Gupta S. Phylogeography and population genetic structure of red muntjacs: evidence of enigmatic Himalayan red muntjac from India. BMC Ecol Evol. 2021;21(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMenon V. Indian Mammals: A mamField Guide. Hachette India; 2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAparajita D, Japang P, Madhusuda MD, Mishra C. Discovery of the leaf deer Muntiacus putaoensis in Arunachal Pradesh: An addition to the large mammals of India. Curr Sci. 2003;84(3):454\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJames J, Ramakrishnan U, Datta A. Molecular evidence for the occurrence of the leaf deer Muntiacus putaoensis in Arunachal Pradesh, north-east India. Conserv Genet. 2008;9(4):927\u0026ndash;31.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoudhury A. The Mammals of Arunachal Pradesh. Daya Books; 2003.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang Z, Li L, Luo Z, Tang S, Li C, Hu H, et al. Evaluating the status of China\u0026rsquo;s mammals and analyzing their causes of endangerment through the red list assessment. Biodivers Sci. 2016;24(5):552\u0026ndash;67.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKocher TD, Thomas WK, Meyer A, Edwards SV, P\u0026auml;\u0026auml;bo S, Villablanca FX, et al. Dynamics of mitochondrial DNA evolution in animals: amplification and sequencing with conserved primers. Proc Natl Acad Sci. 1989;86(16):6196\u0026ndash;200.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHall TASS. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. 1999;41:95\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBouckaert R, Vaughan TG, Barido-Sottani J, Duch\u0026ecirc;ne S, Fourment M, Gavryushkina A, et al. BEAST 2.5: An advanced software platform for Bayesian evolutionary analysis. PLOS Comput Biol. 2019;15(4):e1006650.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNylander JAA. MrModeltest v2. Program distributed by the author. Evol Biol Cent Uppsala Univ. 2004;2(October):1\u0026ndash;2.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRambaut A. Oct. FigTree version 1.4. 0 Available at \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://tree.bio.ed.ac.uk/software/figtree\u003c/span\u003e\u003cspan address=\"http://tree.bio.ed.ac.uk/software/figtree\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Accessed 2016.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35(6):1547\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiang Z, Jiang J, Wang Y, Zhang E, Zhang Y, Xie Li L, et al. Red List of China\u0026rsquo;s Vertebrates. Biodivers Sci. 2016;24(5):500\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang YX. A complete checklist of mammal species and subspecies in China: a taxonomic and geographic reference (Zhongguo buru dongwu zhongqun he yazhong fenlei minglu yu fenbu daquan). Beijing: China Forestry Publishing House; 2003. (Zhongguo linye chubanshe).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmith A, Lunde D, Hoffmann R, Xie Y. A guide to the mammals of China. Princet Univ; 2010.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"discover-conservation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Discover Conservation](https://link.springer.com/journal/44353)","snPcode":"44353","submissionUrl":"https://submission.springernature.com/new-submission/44353/3","title":"Discover Conservation","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"12S ribosomal RNA, Cytochrome b, Muntjacs, M. gongshanensis, Species identity","lastPublishedDoi":"10.21203/rs.3.rs-8439843/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8439843/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eRapid evolving chromosome numbers and the emergence of new species within the \u003cem\u003eMuntiacus\u003c/em\u003e genus have led to taxonomic ambiguity. Gongshan muntjac (\u003cem\u003eM. gongshanensis\u003c/em\u003e) was reported as endemic to China and its distribution in northern Myanmar and north-east India remained doubtful, due to lack of firm evidences. We collected a few samples from the trophy-hunted specimens in eastern Arunachal Pradesh, and two samples on genetic analysis identified to be of Gongshan muntjac, while two others identified as red muntjac (\u003cem\u003eM. vaginalis\u003c/em\u003e). Interestingly, these specimens were sourced from the same household through hunting in eastern Arunachal Pradesh, bordering south-west China. The Bayesian-based phylogenetic analysis shows the clustering of these specimens with the respective species providing the first genetic evidence of occurrence of \u003cem\u003eM. gongshanensis\u003c/em\u003e from Arunachal Pradesh and also suggesting its overlapping range with \u003cem\u003eM. vaginalis\u003c/em\u003e in the eastern Arunachal Pradesh, India.\u003c/p\u003e","manuscriptTitle":"Discovery of Gongshan muntjac (Muntiacus gongshanensis) in Arunachal Pradesh: overlapping distribution with Muntiacus vaginalis and taxonomic insights","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-27 16:10:54","doi":"10.21203/rs.3.rs-8439843/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-03-12T06:40:04+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-03-03T04:25:43+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-28T22:38:00+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-28T06:54:21+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"335479352507737647027957580751089028554","date":"2026-02-22T14:31:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"268873714386980650020758769727823733267","date":"2026-02-19T23:34:20+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"43956795838871239647477505801460798877","date":"2026-02-19T17:35:52+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-10T15:26:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"295502408339502824143059088789285791008","date":"2026-02-08T16:00:17+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-01-26T19:23:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"162567218568263934752747379939050325945","date":"2026-01-22T11:41:09+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-22T11:09:57+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-12-27T12:09:01+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-12-27T12:07:28+00:00","index":"","fulltext":""},{"type":"submitted","content":"Discover Conservation","date":"2025-12-24T06:53:27+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"discover-conservation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Discover Conservation](https://link.springer.com/journal/44353)","snPcode":"44353","submissionUrl":"https://submission.springernature.com/new-submission/44353/3","title":"Discover Conservation","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Discover Series","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"2058c1ab-2d76-4298-ac60-07b475f2aee7","owner":[],"postedDate":"January 27th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-03-26T15:38:18+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-27 16:10:54","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8439843","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8439843","identity":"rs-8439843","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}