Identification and promoter analysis of a GA-stimulated transcript 1 gene from Jatropha curcas | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification and promoter analysis of a GA-stimulated transcript 1 gene from Jatropha curcas Shikang Lei, Liangqing Zhao, Yuqian Chen, Gang Xu This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2303234/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Members of Gibberellic acid-stimulated Arabidopsis (GASA) gene family play roles in plant growth and development, particularly in flower induction and seed development. However, there is still relatively limited knowledge of GASA genes in Jatropha curcas . Herein, we identified a GASA family gene from Jatropha curcas , namely JcGAST1 , which encodes a protein containing a conserved GASA domain. Sequence alignment showed that JcGASAT1 protein shares 76% sequence identity and 80% sequence similarity with SlGAST1. JcGAST1 had higher expression and protein levels in the male flowers than in the female flowers. Overexpression of JcGAST1 in tobacco promotes plant growth but inhibits pistil development. JcGAST1 expression was upregulated by GA and downregulated by MeJA. Promoter analysis indicated that the pyrimidine box and CGTCA motif were the GA-and MeJA-responsive elements of the JcGAST1 promoter. Using a Y1H screen, six transcription factors were found to interact with the pyrimidine box, and three transcription factors were found to interact with theCGTCA motif. Overall, the results of this study improve our understanding of the JcGAST1 gene and provide useful information for further studies. GAST1 GA MeJA promoter flower Jatropha curcas Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Key Message Overexpression of JcGAST1 promotes plant growth but inhibits pistil development. The pyrimidine box and CGTCA motif of JcGAST1 promoter was responsible for GA and MeJA response. Introduction Biodiesel is a green, renewable alternative to fossil fuel. Jatropha curcas L. (hereafter referred to as J. curcas ), a member of the Euphorbiaceae family, which is native to tropical regions in the Western Hemisphere and has been considered an important biofuel plant (Maghuly and Laimer. 2013). The seeds of J. curcas contain a high content of oil (30 ~ 40%), and this seed oil contains high levels of unsaturated fatty acids, which are suitable for producing biodiesel (Gübitz et al. 1999 ; Openshaw. 2000; Thomas et al. 2008 ). However, due to low seed yield, this plant has limited economic benefit for exploitation and further expansion of the Jatropha -based biodiesel industry. J. curcas is a monoecious plant, and separate female and male flowers are present in the same inflorescence (Chen et al. 2017 ). The low ratio of female to male flowers (1/10 ~ 1/30) is an important factor that causes low seed productivity in J. curcas (Raju and Ezradanam. 2002). Despite the availability of transgenic breeding for J. curcas , the limited knowledge about the flowering mechanism in J. curcas has led to some gap toward the goal of producing high-yielding J. curcas cultivars. Thus, dissection of the molecular mechanisms of flowering and floral sex differentiation in J. curcas is beneficial for developing high-yielding J. curcas cultivars. Phytohormones are essential for plant developmental regulation and have been confirmed to be involved in floral development (Izawa. 2021). Among these phytohormones, gibberellin (GA) has been considered a florigen (King and Evans. 2003). GA regulates floral development by suppressing the function of DELLA proteins, which can physically interact with and regulate the activity of many transcription factors related to flowering (Bao et al. 2020 ). In J. curcas , GA is thought to play essential and complicated roles in floral organ development. GA treatment could increase the number of both male and female flowers of J. curcas and promote the production of bisexual flowers (Pi et al. 2013 ; Pan et al. 2014 ). GASA proteins is a cysteine-rich low molecular weight peptide that is extensively widespread in the plant kingdom (Nahirñak et al. 2012 ). The GASA gene family is unique in plants, and most members are regulated by GA (Zhang and Wang. 2017). Tomato ( Solanum lycopersicum L.) GA-stimulated gene GAST1 (GA-stimulated transcript 1) was the first GASA gene reported in 1992 (Shi et al. 1992 ). Subsequently, a large number of GASA genes and proteins were identified in Arabidopsi s ( Arabidopsis thaliana ), Petunia ( Petunia hybrida ), rice ( Oryza sativa ), soybean ( Glycine max ), poplar ( Populus trichocarpa ) and tobacco ( Nicotiana tabacum ) (Herzog et al. 1995 ; Ben-Nissan and Weiss. 1996; Furukawa et al. 2006 ; Ahmad et al. 2019 ; Han et al. 2021 ; Li et al. 2022 ). Most GASA proteins contain a GASA domain consisting of 60 amino acids, typically including 12 cysteine residues (Sun et al. 2013 ). A previous study reported that lack of a GASA domain or mutation of conserved cysteine residues in the GASA domain will result in loss-of-function of the GASA protein (Rubinovich and Weiss. 2010). Growing evidence has revealed that GASA genes play an important role in the regulation of plant growth and development, including seed germination, stem elongation, root growth, floral induction and flower organ development (Zhang and Wang. 2017). In the same GASA gene family, different members may play an opposite biological function. In Arabidopsis , AtGASA4 was reported to contribute to flowering, and suppression of both AtGASA4 and AtGASA6 causes late flowering (Qu et al. 2016 ). However, AtGASA5 inhibits flowering by upregulating the expression of the flowering repressor FLC (LOWERING LOCUSC). GASA proteins also act as phytohormonal signaling transducers and integrators (Zhang et al. 2009 ). It has been reported that AtGASA6 plays a role as an integrator of GA, ABA (abscisic acid), and Glc (glucose) signaling to regulate seed germination by linking AtRGL2 and AtEXPA1 functions (Zhong et al. 2015 ). In rice, the GASA protein OsGSR1 interacts with brassinolide (BR) synthase DIM/DWF1 directly to promote the biosynthesis of BR (Wang et al. 2009 ). Additionally, the GASA gene family is also involved in plant responses to biotic and abiotic stresses. Overexpression of the beech FsGASA4 gene in Arabidopsis improves tolerance to salt, reduce oxygen species (ROS), and heat stress (Alonso-Ramírez et al. 2009 ). Sun et al. reported that the Arabidopsis atgasa14 mutant is sensitive to ABA and reduced salinity tolerance, and overexpression of AtGASA14 could reduce ROS to resist ABA and salt stress (Sun et al. 2013 ). Similar to AtGASA14 , overexpression of AtGASA4 also inhibits ROS accumulation (Rubinovich et al. 2010). Although some GASA genes have been studied in Arabidopsis and other plant species, there is still relatively limited knowledge of GASA genes in J. curcas . Herein, we identified a homolog of tomato GA-stimulated transcript 1 from J. curcas , termed JcGAST1. The mRNA and protein levels of JcGAST1 were higher in male flowers than in female flowers. Overexpression of JcGAST1 in tobacco not only promotes the growth of plants but also inhibits the development of the stigma. The promoter of JcGAST1 contains GA- and MeJA-responsive elements, and the activity of the JcGAST1 promoter was induced by GA but inhibited by MeJA. Taken together, our study sheds light on the potential role of JcGAST1 in floral development of J. curcas . Materials And Methods Plant materials and growth conditions Flower bud samples at different developmental stages were collected from thirty Jatropha curcas trees in Zhenfeng, Guizhou Province, China (36°14′50.2″N, 87°51′47.8″E). The flower bud samples were dipped immediately in RNAlocker (Tiandz, Inc., Beijing China) on ice for RNA isolation. Jatropha curcas or tobacco ( Nicotiana benthamiana ) seeds were sown in a soil mixture (peat moss, perlite, and vermiculite, 8:1:1) and grown in a greenhouse at 25°C under a 16-h light/8-h dark cycle at 50% relative humidity. Bioinformatic Analysis The coding sequence (CDS), peptide and 2,249 bp upstream of the translational start site (ATG) promoter region sequence information of JcGAST1 is available in the NCBI database ( https://www.ncbi.nlm.nih.gov/ ). The functional domains of JcGAST1 were predicted using SMART online software ( http://smart.embl-heidelberg.de/ ). A phylogenetic tree was constructed using the neighbor-joining (NJ) method with MEGA 6.0 software. The PlantCARE database ( http://bioinformatics.psb.ugent.be/webtools/plantcare/html/ ) was used to identify potential cis-elements of the JcGAST1 promoter. Rna Isolation And Qpcr Total RNA was isolated from Jatropha curcas flower buds or leaves using E.Z.N.A Total RNA Kit (OMEGA) according to the manufacturer's protocol. cDNA was synthesized with an AMV RNA PCR Kit 3.0 (Takara) in 10 µL of reaction mixture containing 1 µg of total RNA according to the manufacturer's instructions. Quantitative PCR was performed with the ABI StepOnePlus Real-Time PCR System (Applied Biosystems, Inc. USA) using 2 × SYBR green PCR mix (QIAGEN, Shanghai, China). To analyze the expression of JcGAST1 in flower development, the flower bud samples were divided into eight development phases as previously described (Xu et al., 2019 ). To quantify the transcriptional levels of JcGAST1 in response to phytohormones treatment, three-month-old Jatropha curcas seedlings were treated with 100 µM MeJA, 100 µM GA 3 , 100 µM IAA or 100 µM SA, respectively, and leaves that collected at 3 h and 24 h after phytohormones treatment were used for total RNA extraction. The primers used for qPCR are listed in Supporting Information Table S1. JcTUB was used as an internal positive control. Plasmid Construction And Plant Transformation The full-length coding sequence (CDS) of JcGAST1 was cloned from Jatropha curcas cDNA and inserted into the pCAMBIA1305 vector to generate the 35S::JcGAST1 construct. The construct was transformed into Agrobacterium tumefaciens GV3101 through heat shock transformation. To generate stable tobacco transgenic plants, plants were transformed by Agrobacterium-mediated transformation through the leaf disc transformation regeneration method. The JcGAST1 promoter fragments of different lengths were inserted upstream of the GUS gene coding region of the pCAMBIA1304 vector to replace the cauliflower mosaic virus (CaMV) 35S promoter, obtaining a series of proJcGAST1-GUS constructs named FL (-2249/-1, 2249 bp), P1 (-1799/-1, 1799 bp), P2 (-1215/-1, 1215 bp), P3 (-713/-1, 713 bp) and P4 (-359/-1, 359 bp). The promoter constructs were transformed into tobacco leaves using the transient transformation method for the GUS activity assay. Protein Extraction And Immunoblotting Total proteins of J. curcas flower buds were extracted using a Plant Total Protein Extraction Kit (Sangon Biotech, China) according to the manufacturer's instructions. For immunoblotting, the proteins were separated by sodium dodecyl sulfate‒polyacrylamide gel electrophoresis (SDS‒PAGE) and then transferred to a 0.22 µm PVDF membrane. The membrane was incubated with an anti-JcGAST1 antibody (DetaiBio, China). The blot was developed using an enhanced chemiluminescent kit (Biosharp) and detected by a Tanon-5500 system. Gus Histochemical And Fluorometric Assay For histochemical GUS staining, tobacco leaf discs expressing various Promoter-GUS were immersed in GUS staining solution and incubated at 37°C overnight. The chlorophyll was removed by immersion of the leaf disc samples in 70% ethanol. Images were taken using a stereomicroscope (Leica M80). A fluorometric assay of GUS activity was performed as previously described (Jefferson et al., 1987) by using 4-methylumbelliferyl-b-glucuronide (4-MUG) as a substrate. The tobacco leaves transformed with various promoter-GUS vectors were treated with 100 µM MeJA, 100 µM GA 3 , 100 µM IAA or 100 µM SA and then collected for protein extraction. The protein concentration was quantified using the Bradford protein assay. Fluorescence was measured by using a Thermo Varioskan™ LUX Microplate Reader. Yeast One-hybrid Assay The coding sequences of JcRF2a , JcIAA9 , JcAHL9 , ERF106 , JcbZIP11 , JcPAT1 , JcSAP8 and JcRAG1 were cloned into the pGADT7 vector. The primer pairs used for gene cloning are listed in Supplemental Table S1. The cis-elements of the JcGAST1 promoter, like 3×CCTTTT and 3×CGTCA, were inserted into the pHIS2 vector, respectively. All of the constructs were transformed into the yeast Y187 strain using the lithium acetate method. The transformed cells were harvested and evenly coated on minimal synthetic dextrose medium lacking leucine, tryptophan and histidine (SD/-LWH) containing 3-amino-1,2,4-triazole (3-AT) and grown at 30°C for three days. Dual-luciferase Assay A dual-LUC assay was performed as previously described (Zhang et al. 2015 ). Briefly, the cis-elements of the JcGAST1 promoter, like 3×CCTTTT and 3×CGTCA, were inserted into the pGreenII 0800-LUC plasmid to generate the reporter vectors, respectively. The coding sequences of JcRF2a , JcIAA9 , JcAHL9 , ERF106 , JcbZIP11 , JcPAT1 , JcSAP8 and JcRAG1 were cloned into the pCAMBIA1305 plasmid driven by the CaMV 35S promoter as the effector vectors, respectively, and 35S::YFP served as a negative control. The resultant constructs were subsequently transiently expressed in tobacco leaves. The relative LUC/REN activity was examined using a Dual-Luciferase Assay System Kit (Promega). Accession Numbers Sequence data of this article can be found in the NCBI database ( https://www.ncbi.nlm.nih.gov ) under the following accession numbers: JcGAST1 (XM_012234671.3), JcTUB (XM_012218402.3), JcRF2a (XM_012229037.3), JcERF106 (XM_012235114.3), JcIAA9 (XM_012212698.3), JcAHL9 (XM_012228026.3), JcbZIP11 (XM_012211837.3), JcPAT1 (XM_012232033.3), JcSAP8 (XM_012234577.3), JcRAG1 (XM_012212711.2) and Nt18S (HQ384692.1). Results Characterization of JcGAST1 Based on the gene expression profile of developing flowers in J. curcas , a homolog of the tomato GA-stimulated transcript 1 ( GAST1 ) gene was isolated from differentially expressed genes, termed JcGAST1 . The cDNA of the JcGAST1 gene is composed of a 348 bp ORF that encodes a protein of 115 amino acids. Sequence comparisons showed that JcGAST1 shares 76% identity and 80% similarity with SlGAST1. Similar to SlGAST1, JcGAST1 also contains a GASA domain at the C-terminus (Fig. 1 A). The GASA domain could be found in all GASA proteins, and its impairment would result in loss of function (Rubinovich and Weiss. 2010). In addition, phylogenetic analysis demonstrated significant evolutionary relevance between JcGAST1 and its homologs in 10 plant species (Fig. 1 B). To investigate the function of JcGAST1 during floral development in J. curcas , we first performed quantitative PCR (qPCR) to monitor the expression of JcGAST1 at nine different stages for sex differentiation and floral development. As shown in Fig. 2 A, the transcripts of JcGAST1 could be detected in all of the development phases, and the JCFIII stage had the highest level, followed by the JCFII stage. Compared to the JCUN stage, JcGAST1 expression was higher at the four developmental stages of the male flower but lower at the other four developmental stages of the female flower. Subsequently, we examined the accumulation of JcGAST1 protein at the nine stages of J. curcas flowering. Immunoblot analysis showed that the amount of JcGAST1 protein was highest at the JCFII stage. Furthermore, the protein levels of JcGAST1 in male flowers were higher than those in female flowers (Fig. 2 B). These results indicated that JcGAST1 may play an opposite role during male and female flower development in J. curcas . Overexpression of JcGAST1 inhibits the development of stigma in transgenic tobacco To further investigate the function of JcGAST1 during flower development and sex differentiation, the JcGAST1 gene was overexpressed in tobacco plants (cultivar K326). RT‒PCR analysis showed that JcGAST1 transcripts were undetectable in wild-type (WT) tobacco plants but could be detected in the three transgenic lines ( 35S::JcGAST1 #1, #2 and #3), which were selected for further study (Fig. S1). As shown in Fig. 3 A, the 35S::JcGAST1 plants showed increased growth compared with the WT plants. To determine the extent of increased growth of 35S::JcGAST1 plants, the plant height, leaf length and leaf width were measured. We found that there was a significant elevation in the plant height, leaf length and leaf width of 35S::JcGAST1 plants compared with those of WT plants (Fig. 3 C–E), suggesting that overexpression of the JcGAST1 gene could promote the growth of plants. Significantly, the stigma development of these selected 35S::JcGAST1 plants was obviously inhibited (Fig. 3 B). Compared to 0.97 ± 0.11 of that of the WT plants, the filament/stigma length ratio of 35S::JcGAST1 plants was enhanced to 1.13 ± 0.06, 1.12 ± 0.09 and 1.47 ± 0.15, respectively (Fig. 3 F). These results indicated that JcGAST1 may be involved in the regulation of flower development. Sequence and deletion analysis of the JcGAST1 promoter To predict the potential regulatory mechanism mediated by JcGAST1 during flower development, the cis-acting elements of the promoter were analyzed. Except for the basic elements CAAT box and TATA box, the JcGAST1 promoter also contains the light response elements (G box and Box 4), the meristem expression element (CAT box) and the stress responsive element (TC-rich repeats). Some hormone response elements were also found in the JcGAST1 promoter, including the TCA element (salicylic acid responsiveness), the GARE motif (gibberellin responsiveness), the TGA element (auxin responsiveness), the CGTCA motif (MeJA responsiveness), and the ABRE motif (abscisic acid responsiveness) (Fig. S2 and Table S2). Moreover, pollen-specific elements (GTGANTG10 and POLLEN1LELAT52) and embryo-specific elements (DPBFCOREDCDC3) were present in the JcGAST1 promoter. The coordination of phytohormone signaling plays an important role in the regulation of flower development (Ma et al. 2018 ). Considering that the JcGAST1 promoter contains hormone response elements, the effects of phytohormones on JcGAST1 expression were investigated. qPCR showed that the expression of JcGAST1 could be induced by IAA, GA and SA treatment but inhibited by MeJA treatment (Fig. S3). To determine the regulatory effects of different regions of the JcGAST1 promoter, a series of 5’-deleted fragments of the promoter were fused with the GUS gene (Fig. 4 A). As Fig. 4 B shows, except for P4 (-359/-1 region), the GUS activity of these deleted promoter constructs was detectable, and P3 had the highest GUS activity. Consistently, the GUS staining intensity was notably enhanced in P3 compared with FL, indicating that P3 (-713/-319 region) may contain the core region of the JcGAST1 promoter. Using GUS staining and the 5’-deleted constructs of P3, we further identified the core region of the JcGAST1 promoter and found that the − 381/-1 region had the highest GUS activity. These results suggest that the 22-bp region (AATAACCAGTGAAATTTGTTGT) may be the core region of the JcGAST1 promoter. GA and MeJA response analysis of the JcGAST1 promoter Due to the hormone response elements were predicted in the JcGAST1 promoter, the effects of GA, MeJA, IAA and SA on the activity of the JcGAST1 promoter were investigated. As shown in Fig. 5 A, there were no obvious differences in GUS activity in FL and P1 upon treatment with these phytohormones. However, the GUS activity was significantly increased in P2 after GA treatment and decreased with SA treatment. Additionally, significantly decreased GUS activity was also observed in P3 after IAA, SA and MeJA treatment. Considering that the expression of JcGAST1 was induced by GA treatment but downregulated with MeJA treatment (Fig. S3), we further identified the GA- and MeJA-responsive cis-acting element of the JcGAST1 promoter. We found that P2 contains a predicted GA responsive element (pyrimidine box, CCTTTT), and a MeJA responsive element (CGTCA motif) was predicated in P3. We substituted the CCTTTT motif in P2 with CCGTTT to generate the mP2-GUS construct. In the presence of GA 3 , the GUS activity of P2 was approximately 2-fold higher than that of mP2 (Fig. 5 B). Meanwhile, CGGCA was substituted for the CGTCA motif of P3 to generate the mP3-GUS construct. In the presence of MeJA, the GUS activity of mP3 was approximately 9-fold higher than that of P3 (Fig. 5 C). These results suggest that the transcripts of JcGAST1 regulated by GA and MeJA are associated with the pyrimidine box and CGTCA motif. Identify the interactors of GA- and MeJA-responsive elements in J. curcas To identify potential regulators acting upstream of GA- and MeJA-responsive elements of the JcGAST1 promoter, the 3×CCTTTT and 3×CGTCA motifs were inserted into a pHis2 vector for yeast one-hybrid (Y1H) screening using a cDNA library of J. curcas flowers. As a result, some cDNA fragments for 3×CCTTTT screening or 3×CGTCA screening were obtained. Using the NCBI database, these cDNA fragments were matched with J. curcas genes. The potential transcription factors are listed in Table S4, including six proteins for 3×CCTTTT screening (JcRF2a, JcIAA9, JcPAT1, JcERF106, JcAHL19 and JcbZIP11) and three proteins for 3×CGTCA screening (JcIAA9, JcAHL19 and JcSAP8). Subsequently, the interaction between these proteins and GA- or MeJA-responsive elements was verified with a Y1H assay. The results showed that yeast cells containing the construct pairs pHis2-CCTTTT and pGADT7-JcRF2a/JcERF106/JcAHL19/JcbZIP11/JcIAA9/JcPAT1 or pHis2-CGTCA and pGADT7-JcAHL19/JcSAP8/JcIAA9 grew well on SD/-Trp/-His/-Leu media supplemented with 3-AT, suggesting the potential interaction between these proteins and the two motifs (Fig. S6A). To determine the effects of the interaction between GA- or MeJA-responsive elements and their interactors on gene transcription, a dual-luciferase assay was performed. The 3×CCTTTT and 3×CGTCA motifs were fused to the LUC gene as the reporter. The coding sequences of the interactors were inserted into the pCAMBIA1305 vector as the effector constructs, and the YFP gene was used as the control (Fig. 6 B). The dual-LUC assay results showed that the LUC/REN value was increased by coexpression with the 35S::JcRF2a/JcAHL19/JcbZIP11 and 3×CCTTTT-LUC constructs or the 35S:: JcAHL19/JcSAP8 and 3×CGTCA-LUC constructs. These results indicated that these element interactors could bind to the CCTTTT or CGTCA motif to enhance the transcription of downstream genes. Discussion Members of the GASA gene family play an important role in the regulation of plant growth (Zhang and Wang. 2017). A large number of GASA genes have been identified in some plant species, but there have been no studies on the GASA gene in J. curcas . In this study, JcGAST1 was cloned from J. curcas , which encodes a protein containing a highly conserved GASA domain (Fig. 1 A). The regulative function of GASA genes in floral development has been described in previous studies, most of which were in bisexual flower plants (Kotilainen et al. 1999 ; Roxrud et al. 2007 ; Zhang et al. 2009 ). J. curcas is a monoecious plant, and sex differentiation of flowers occurs after the initiation of five petal primordia. Xu et al. reported that the development of J. curcas female flowers requires a hermaphroditic period: stamens first develop with carpels and then gradually degenerate as the three carpels to be fused (Xu et al. 2016 ). In contrast to the female flowers, the male flowers of J. curcas did not undergo a hermaphroditic period. Our transcriptome data indicate that the JcGAST1 gene is differentially expressed in female and male flowers (data not shown). Both the transcript and protein levels of JcGAST1 were higher in the male flowers than in the female flowers (Fig. 2 ). This means that JcGAST1 may play different roles in female and male flowers. In Arabidopsis , AtGASA14 is speculated to function in the promotion of cell elongation, and overexpression of AtGASA14 promotes an increase in leaf size (Sun et al. 2013 ). Additionally, we observed that transgenic tobacco plants overexpressing the JcGAST1 gene increased leaf size and plant height (Fig. 3 A, C-E), suggesting that JcGAST1 might be a contributor to vegetative growth in plants. Although JcGAST1 showed a high level of expression in the male flowers (Fig. 2 A), the development of stamens was not influenced in 35S::JcGAST1 transgenic tobacco plants. In contrast, significant inhibition was observed in the stigmas of transgenic tobacco plants (Fig. 3 B, F). These phenotypic studies revealed a negative role for JcGAST1 in the development of female organs, which may be the reason why J. curcas female flowers had a lower JcGAST1 expression level. In gynoecious plants, GA treatment represses pistil development in female flowers to produce neutral flowers but does not resume the development of stamens (Chen et al. 2013). Most GASA genes were upregulated by GA, such as tomato SlGAST1 , Arabidopsis AtGASA4 , AtGASA6 , AtGASA7 , AtGASA8 and AtGASA13 , and beech FsGASA4 . (Shi et al. 1992 ; Zhang and Wang. 2008; Alonso-Ramírez et al. 2009 ; Rubinovich and Weiss. 2010). Similar to these genes, JcGAST1 expression was also induced by GA. These results implied that the regulatory role of JcGAST1 in plant reproductive growth was largely associated with the GA signaling pathway. GASA family genes are thought to be integrators of phytohormone signals. In Arabidopsis, all GASA genes contain GA signaling-associated GARE and ABA signaling-related ABRE elements (Zhang and Wang. 2008). The promoter sequence analysis showed that the JcGAST1 promoter not only contains GARE and ABRE elements but also contains TCA-element (SA responsive element), TGA-element (Auxin responsive element) and CGTCA-motif (MeJA responsive element). Our deletion analysis found that the promoter region containing the GARE element was nonessential for the GA response. However, substitution of a base in the pyrimidine box decreased the activity of the JcGAST1 promoter upon GA treatment, suggesting that the pyrimidine box may be the key element for the GA response. The pyrimidine box was first found in cereal, and mutations in the pyrimidine box caused a reduction in GA induction (Huang et al. 1990 ; Gubler and Jacobsen. 1992; Rogers and Rogers. 1992). Previous studies reported that the transcription factors of the DNA Binding with One Finger (DOF) class could interact with the pyrimidine box (Mena et al. 2002 ). DOF transcription factors have been confirmed to be involved in the regulation of pollen development in maize (Yanagisawa. 2000; Chen et al. 2012 ). Except for the pyrimidine box, we noticed that the JcGAST1 promoter also contains the GTGANTG10 and POLLEN1LELAT52 motifs, which are both pollen-specific expression elements. These results prompted us to speculate that, perhaps, there is a DOF-GAST1 module that regulates pollen development in J. curcas . This possibility should be addressed in the future. JA and MeJA are naturally occurring plant hormones that function as key signaling molecules in response to biotic and abiotic stresses. In strawberry, FaGAST2 expression was not affected by MeJA (Moyano-Cañete et al. 2013 ). However, in Arabidopsis , the expression of AtGASA4 and AtGASA6 was downregulated by JA (Qu et al. 2016 ). The JcGAST1 promoter contains a CGTCA motif, and both qPCR and GUS activity assays proved that MeJA plays a negative role in JcGAST1 transcription. Using a Y1H screen, we found that the three transcription factors JcIAA9, JcSAP8 and JcAHL19 interacted with the CGTCA motif. IAA9 has been reported to act as a transcriptional repressor of auxin signaling in tomato (Wang et al. 2005 ). AHL19 and SAP8 have been described to be involved in stress resistance in Arabidopsis and barley, respectively (Yadeta et al. 2011 ; Baidyussen et al. 2021 ). Due to the promotional effect of JcGAST1 on plant growth, there may be some regulatory factors that repress GAST1 to maintain energy to ensure that the organism can survive in adverse environments. Significantly, JcIAA9 and JcAHL19 were also found in the Y1H screen of the pyrimidine box, suggesting that they may cross-link GA and MeJA signaling to regulate JcGAST1 . Additionally, we found that four other transcription factors, JcbZIP11, JcERF106, JcRF2a and JcPAT1, all interact with the pyrimidine box. JcbZIP11 and JcRF2a are members of the bZIP transcription factor family, and their homologs in other species have been described to be involved in pathogen resistance (Dai et al. 2004 ; Prior et al. 2021 ). Homologs of JcERF106 and JcPAT1 have been reported to be involved in ethylene and JA signaling (Feng et al. 2020 ; Wang et al. 2021 ). However, the regulatory relationship between these transcription factors and JcGAST1 requires further investigation. In summary, our results indicate that JcGAST1 plays an important role in the regulation of plant vegetative growth and inhibition of the development of female organs. GA and MeJA act as inducers and inhibitors of the expression of JcGAST1 , respectively. Our present research provides valuable insight into the potential regulatory mechanisms of JcGAST1 during floral development. Further studies will focus on the upstream transcriptional regulators of JcGAST1 . Declarations Acknowledgments This study was supported by the National Natural Science Foundation of China (grant No, 31760198). Author contributions GX designed and managed this study; SL, LZ and YC performed the experiments; LZ and YC analyzed the data; SL and GX wrote the manuscript; all authors read and approved the manuscript. Conflict of interest The authors have no conflicts of interest to declare. References Ahmad MZ, Sana A, Jamil A, Nasir JA, Ahmed S, Hameed MU, Abdullah (2019) A genome-wide approach to the comprehensive analysis of GASA gene family in Glycine max . Plant Mol Biol 100:607–620 Alonso-Ramírez A, Rodríguez D, Reyes D, Jiménez JA, Nicolás G, López-Climent M, Gómez-Cadenas A, Nicolás C (2009) Evidence for a role of gibberellins in salicylic acid-modulated early plant responses to abiotic stress in Arabidopsis seeds. Plant Physiol 150:1335–1344 Baidyussen A, Jatayev S, Khassanova G, Amantayev B, Sereda G, Sereda S, Gupta NK, Gupta S, Schramm C, Anderson P, Jenkins CLD, Soole KL, Langridge P, Shavrukov Y (2021) Expression of specific alleles of Zinc-Finger transcription factors, HvSAP8 and HvSAP16, and corresponding SNP markers, are associated with drought tolerance in barley populations. Int J Mol Sci 22:12156 Bao S, Hua C, Shen L, Yu H (2020) New insights into gibberellin signaling in regulating flowering in Arabidopsis . J Integr Plant Biol 62:118–131 Ben-Nissan G, Weiss D (1996) The petunia homologue of tomato gast1: transcript accumulation coincides with gibberellin-induced corolla cell elongation. Plant Mol Biol 32:1067–1074 Chen MS, Pan BZ, Fu Q, Tao YB, Martínez-Herrera J, Niu L, Ni J, Dong Y, Zhao ML, Xu ZF (2017) Comparative transcriptome analysis between gynoecious and monoecious plants identifies regulatory networks controlling sex determination in Jatropha curcas . Front Plant Sci 7:1953 Chen XY, Wang DX, Liu C, Wang MZ, Wang T, Zhao Q, Yu JJ (2012) Maize transcription factor Zmdof1 involves in the regulation of Zm401 gene. Plant Growth Regul 66:271–284 Dai S, Zhang Z, Chen S, Beachy RN (2004) RF2b, a rice bZIP transcription activator, interacts with RF2a and is involved in symptom development of rice tungro disease. Proc Natl Acad Sci U S A 101:687–692 Feng K, Hou XL, Xing GM, Liu JX, Duan AQ, Xu ZS, Li MY, Zhuang J, Xiong AS (2020) Advances in AP2/ERF super-family transcription factors in plant. Crit Rev Biotechnol 40:750–776 Furukawa T, Sakaguchi N, Shimada H (2006) Two OsGASR genes, rice GAST homologue genes that are abundant in proliferating tissues, show different expression patterns in developing panicles. Genes Genet Syst 81:171–180 Gübitz GM, Mittelbach M, Trabi M (1999) Exploitation of the tropical oil seed plant J atropha curcas L. Bioresour Technol 67:73–82 Gubler F, Jacobsen JV Gibberellin-responsive elements in the promoter of a barley high-pI alpha-amylase gene.Plant Cell4:1435–1441 Han S, Jiao Z, Niu MX, Yu X, Huang M, Liu C, Wang HL, Zhou Y, Mao W, Wang X, Yin W, Xia X (2021) Genome-wide comprehensive analysis of the GASA gene family in Populus . Int J Mol Sci 22:12336 Herzog M, Dorne AM, Grellet F (1995) GASA , a gibberellin-regulated gene family from Arabidopsis thaliana related to the tomato GAST1 gene. Plant Mol Biol 27:743–752 Huang N, Sutliff TD, Litts JC, Rodriguez RL (1990) Classification and characterization of the rice alpha-amylase multigene family. Plant Mol Biol 14:655–668 Izawa T (2021) What is going on with the hormonal control of flowering in plants? Plant J 105:431–445 King RW, Evans LT (2003) Gibberellins and flowering of grasses and cereals: prizing open the lid of the “florigen” black box. Annu Rev Plant Biol 54:307–328 Kotilainen M, Helariutta Y, Mehto M, Pollanen E, Albert VA, Elomaa P, Teeri TH (1999) GEG participates in the regulation of cell and organ shape during corolla and carpel development in gerbera hybrida. Plant Cell 11:1093–1104 Li Z, Gao J, Wang G, Wang S, Chen K, Pu W, Wang Y, Xia Q, Fan X (2022) Genome-wide identification and characterization of GASA Gene family in Nicotiana tabacum . Front Genet 12:768942 Ma N, Ma C, Liu Y, Shahid MO, Wang C, Gao J (2018) Petal senescence: a hormone view. J Exp Bot 69:719–732 Maghuly F, Laimer M (2013) Jatropha curcas , a biofuel crop: functional genomics for understanding metabolic pathways and genetic improvement. Biotechnol J 8:1172–1182 Mena M, Cejudo FJ, Isabel-Lamoneda I, Carbonero P (2002) A role for the DOF transcription factor BPBF in the regulation of gibberellin-responsive genes in barley aleurone. Plant Physiol 130:111–119 Moyano-Cañete E, Bellido ML, García-Caparrós N, Medina-Puche L, Amil-Ruiz F, González-Reyes JA, Caballero JL, Muñoz-Blanco J, Blanco-Portales R (2013) FaGAST2 , a strawberry ripening-related gene, acts together with FaGAST1 to determine cell size of the fruit receptacle. Plant Cell Physiol 54:218–236 Nahirñak V, Almasia NI, Hopp HE, Vazquez-Rovere C (2012) Snakin/GASA proteins: involvement in hormone crosstalk and redox homeostasis. Plant Signal Behav 7:1004–1008 Openshaw K (2000) A review of Jatropha curcas: An oil plant of unfulfilled promise. Biomass Bioenergy 19:1–15 Pan BZ, Chen MS, Ni J, Xu ZF (2014) Transcriptome of the inflorescence meristems of the biofuel plant Jatropha curcas treated with cytokinin. BMC Genomics 15:974 Pi X, Pan B, Xu Z (2013) Induction of bisexual flowers by gibberellins in monoecious biofuel plant Jatropha curcas (Euphorbiaceae). Plant Divers Resour 35:26–32 Prior MJ, Selvanayagam J, Kim JG, Tomar M, Jonikas M, Mudgett MB, Smeekens S, Hanson J, Frommer WB (2021) Arabidopsis bZIP11 is a susceptibility factor during Pseudomonas syringae infection. Mol Plant Microbe Interact 34:439–447 Qu J, Kang SG, Hah C, Jang JC (2016) Molecular and cellular characterization of GA-stimulated transcripts GASA4 and GASA6 in Arabidopsis thaliana . Plant Sci 246:1–10 Raju AJS, Ezradanam V (2002) Pollination ecology and fruiting behaviour in a monoe-cious species, Jatropha curcas L. (Euphorbiaceae). Current Science 83:13951398 Rogers JC, Rogers SW (1992) Definition and functional implications of gibberellin and abscisic acid cis-acting hormone response complexes. Plant Cell 4:1443–1451 Roxrud I, Lid SE, Fletcher JC, Schmidt ED, Opsahl-Sorteberg HG (2007) GASA4, one of the 14-member Arabidopsis GASA family of small polypeptides, regulates flowering and seed development. Plant Cell Physiol 48:471–483 Rubinovich L, Weiss D (2010) The Arabidopsis cysteine-rich protein GASA4 promotes GA responses and exhibits redox activity in bacteria and in planta . Plant J 64:1018–1027 Shi L, Gast RT, Gopalraj M, Olszewski NE (1992) Characterization of a shoot specific, GA3- and ABA-regulated gene from tomato. Plant J 2:153–159 Sun S, Wang H, Yu H, Zhong C, Zhang X, Peng J, Wang X (2013) GASA14 regulates leaf expansion and abiotic stress resistance by modulating reactive oxygen species accumulation. J Exp Bot 64:1637–1647 Thomas R, Sah NK, Sharma PB (2008) Therapeutic biology of Jatropha curcas: a mini review. Curr Pharm Biotechnol 9:315–324 Wang H, Jones B, Li Z, Frasse P, Delalande C, Regad F, Chaabouni S, Latché A, Pech JC, Bouzayen M (2005) The tomato Aux/IAA transcription factor IAA9 is involved in fruit development and leaf morphogenesis. Plant Cell 17:2676–2692 Wang L, Wang Z, Xu Y, Joo SH, Kim SK, Xue Z, Xu Z, Wang Z, Chong K (2009) OsGSR1 is involved in crosstalk between gibberellins and brassinosteroids in rice. Plant J 57:498–510 Wang Z, Wong DCJ, Wang Y, Xu G, Ren C, Liu Y, Kuang Y, Fan P, Li S, Xin H, Liang Z (2021) GRAS-domain transcription factor PAT1 regulates jasmonic acid biosynthesis in grape cold stress response. Plant Physiol 186:1660–1678 Xu G, Huang J, Lei SK, Sun XG, Li X (2019) Comparative gene expression profile analysis of ovules provides insights into Jatropha curcas L. ovule development. Sci Rep 9:15973 Xu G, Huang J, Yang Y, Yao YA (2016) Transcriptome analysis of flower sex differentiation in Jatropha curcas L. using RNA sequencing. PLoS ONE 11:e0145613 Yadeta KA, Hanemian M, Smit P, Hiemstra JA, Pereira A, Marco Y, Thomma BP (2011) The Arabidopsis thaliana DNA-binding protein AHL19 mediates verticillium wilt resistance. Mol Plant Microbe Interact 24:1582–1591 Yanagisawa S (2000) Dof1 and Dof2 transcription factors are associated with expression of multiple genes involved in carbon metabolism in maize. Plant J 21:281–288 Zhang F, Fu X, Lv Z, Lu X, Shen Q, Zhang L, Zhu M, Wang G, Sun X, Liao Z, Tang K (2015) A basic leucine zipper transcription factor, AabZIP1, connects abscisic acid signaling with artemisinin biosynthesis in Artemisia annua . Mol Plant 8:163–175 Zhang S, Wang X (2017) One new kind of phytohormonal signaling integrator: Up-and-coming GASA family genes. Plant Signal Behav 12:e1226453 Zhang S, Yang C, Peng J, Sun S, Wang X (2009) GASA5 , a regulator of flowering time and stem growth in Arabidopsis thaliana . Plant Mol Biol 69:745–759 Zhang SC, Wang XJ (2008) Expression pattern of GASA , downstream genes of DELLA, in Arabidopsis . Chin Sci Bull 53:3839–3846 Zhong C, Xu H, Ye S, Wang S, Li L, Zhang S, Wang X (2015) Gibberellic acid-stimulated Arabidopsis6 serves as an integrator of gibberellin, abscisic acid, and glucose signaling during seed germination in Arabidopsis. Plant Physiol 169:2288–2303 Supplementary Files GAST1supplementarymaterials.pdf Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2303234","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":157396815,"identity":"6277fdfe-3de9-4a6f-bdf6-c02bb4b2b566","order_by":0,"name":"Shikang Lei","email":"","orcid":"","institution":"Southwest University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shikang","middleName":"","lastName":"Lei","suffix":""},{"id":157396816,"identity":"3970803d-4acb-469a-b38f-e1d2b144439c","order_by":1,"name":"Liangqing Zhao","email":"","orcid":"","institution":"Guizhou Botanical Garden","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Liangqing","middleName":"","lastName":"Zhao","suffix":""},{"id":157396817,"identity":"94fd1809-a8e4-4b6d-b9b6-881ad67dcb91","order_by":2,"name":"Yuqian Chen","email":"","orcid":"","institution":"Guizhou University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Yuqian","middleName":"","lastName":"Chen","suffix":""},{"id":157396818,"identity":"bb4fac43-e5c2-439d-a5c5-27f40d6cad7a","order_by":3,"name":"Gang Xu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4ElEQVRIiWNgGAWjYFAC9sOPf/yQ4OFnYG44QKQWnjRjxh4bOckGRqK1MBhIM7ClGRscYGwgUv35BQnGBTyHEzcfP9h4mLftDgN/e3cCXi2SMx4eeDzD4nDitjOJDUAtzxgkzpzdgFcLv8SBBAMeoC3bDoC1HGYwkMjFr4VN4oCBBA8b0GH9D4nUws/fYCDNA/K+BLG2SM7gSTOcCQxkiRsPGw7OOXeYh6BfDM4fP/zgAygq+5MPf3hTdliOv70XvxYGiQQEm4kHGLP4lYM9cwDBZvxBWP0oGAWjYBSMQAAAEsZRl7f3j+UAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0003-2093-9763","institution":"Guangdong Pharmaceutical University","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Gang","middleName":"","lastName":"Xu","suffix":""}],"badges":[],"createdAt":"2022-11-23 02:49:02","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2303234/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2303234/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":30024185,"identity":"c94e303b-03e6-4b69-9114-f09d2cadbf0f","added_by":"auto","created_at":"2022-12-07 17:17:36","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":3272119,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBioinformatics analysis of JcGAST1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Amino acid sequence alignment of JcGAST1 and SlGAST1. Identical and similar amino acids are indicated by black and white boxes, respectively. The GASA domain is highlighted via a black line. (B) Phylogenetic analysis of JcGAST1 and its homologs in plants. The neighbor-joiningtree was constructed using MEGA software (version 6.0). Scale bar: 0.1 estimated amino acid substitutions per site.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-2303234/v1/afa5fed64863c9200507a0e6.png"},{"id":30023635,"identity":"574a6a33-bb48-4421-89f2-646380cabb6f","added_by":"auto","created_at":"2022-12-07 17:09:35","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1937706,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eExpression pattern of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eJcGAST1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eand protein levels during flower development\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) qPCR analysis of \u003cem\u003eJcGAST1\u003c/em\u003etranscripts at different flower development stages (JCUN, undifferentiated stage; JCMI, the formation of ten stamen primordia; JCMII, from the occurrence of sporogenous cells to the occurrence of microspore mother cell; JCMIII, from themeiosis of microspore mother cell to the formation of meiotic tetrads; JCMIV, from free microspore stage to thematuration of pollen grain; JCFI, the growth of three carpels; JCFII, from the occurrence of sporogenous cells to the occurrence of macrospore mother cell (MMC); JCFIII, from the meiosis of MMC to the formation of mononuclear embryo sac; JCFIV, from the formation of MES to the maturation of embryo sac). \u003cem\u003eJcTUB\u003c/em\u003eserved as an internal control. (B) Protein levels of JcGAST1 at different flower developmental stages. Immunoblot analysis was performed using an anti-JcGAST1 antibody. Coomassie blue-stained Rubisco large subunit (RBCL) was used as the loading control. Relative protein intensity was quantified by ImageJ software. The protein intensity at the JCUN stage was set to 1.0. Error bars represent the standard deviation (SD). Different letters above the columns indicate significant differences at \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-2303234/v1/af680cbda2106001d6e2cb26.png"},{"id":30024184,"identity":"80e339e4-b464-4b4b-8906-10f3f7d657b6","added_by":"auto","created_at":"2022-12-07 17:17:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":6415029,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePhenotypic assay of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e35S::JcGAST1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003etransgenic tobacco plants\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Representative images of 2-month-old WT and \u003cem\u003eJcGAST1\u003c/em\u003etransgenic tobacco plants (#1, #2 and #3). (B) Morphology of transgenic tobacco plants flowers. The statistical analysis of plant height (C), leaf length (D), leaf width (E) and filament/stigma ratio (F) of WT and transgenic tobacco plants. Error bars represent the standard deviation (SD; n ≥ 3, \u003cem\u003et\u003c/em\u003etest: * \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01). Scale bar = (A) 5 cm; (B) 1 cm.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-2303234/v1/beaf1e80d1019cff47a7b47a.png"},{"id":30024443,"identity":"40e7da7b-e95b-49d7-9b11-4ee4d76db31e","added_by":"auto","created_at":"2022-12-07 17:25:36","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":9039422,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDeletion analysis of the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eJcGAST1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e promoter\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Schematic diagram of \u003cem\u003eproJcGAST1::GUS\u003c/em\u003e constructs. (B) Schematic representation of various \u003cem\u003eJcGAST1\u003c/em\u003epromoter deletions (left panel) and the fluorometric assay of GUS activity in the anthers (right panel). (C) Histochemical GUS staining of tobacco leafdiscs expressing deleted constructs. (D) Identification of the \u003cem\u003eJcGAST1\u003c/em\u003e promoter core region. Error bars represent the standard deviation (SD).\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-2303234/v1/99d2c88c6b2e01ecc272e571.png"},{"id":30023636,"identity":"29f144a2-f388-485f-a76c-8c4a1852de40","added_by":"auto","created_at":"2022-12-07 17:09:36","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1035419,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePromoter activity analysis of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eJcGAST1\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e upon phytohormone treatment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) GUS activity of \u003cem\u003eJcGAST1\u003c/em\u003e promoter deletions in response to GA\u003csub\u003e3\u003c/sub\u003e, MeJA, IAA and SA. Identification of cis-acting GA (B) and MeJA (C) responsive elements in\u003cem\u003e \u003c/em\u003ethe\u003cem\u003e JcGAST1\u003c/em\u003e promoter. Error bars represent the standard deviation (SD; n ≥ 3, \u003cem\u003et\u003c/em\u003e test: ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01).\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-2303234/v1/4d82f58a41de0b0231678b93.png"},{"id":30023640,"identity":"6a19fab2-f66f-4fe7-a412-0328032b92f5","added_by":"auto","created_at":"2022-12-07 17:09:36","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":12355039,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIdentification of interactors of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eJ. curcas\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e cis-acting GA- and MeJA-responsive elements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(A) Interactions of JcRF2a, JcIAA9, JcAHL9, ERF106, JcbZIP11, JcPAT1, and JcSAP8 proteinswith cis-acting GA- and MeJA-responsive elements in yeast cells. (B) Diagrams of reporter and effector constructs in transient dual-luciferase assays. Effects of JcRF2a, JcIAA9, JcAHL9, ERF106, JcbZIP11, andJcPAT1 on the activities of cis-acting GA responsive elements (C) and JcIAA9, JcAHL9 and JcSAP8 on the activities of cis-acting MeJA responsive elements in tobacco leafcells. Error bars represent the standard deviation (SD; n ≥ 3, \u003cem\u003et\u003c/em\u003e test: ** \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01).\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-2303234/v1/15a28e5bc098260ab73b801f.png"},{"id":31581197,"identity":"de34c9bb-4c9c-4003-9dd8-9ea5f23d41ea","added_by":"auto","created_at":"2023-01-15 00:12:19","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1812576,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2303234/v1/2d26473f-7f50-4d95-8685-7e883480a664.pdf"},{"id":30023637,"identity":"c1f8911c-c884-4882-a59e-335ce3dfc1dc","added_by":"auto","created_at":"2022-12-07 17:09:36","extension":"pdf","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":478078,"visible":true,"origin":"","legend":"","description":"","filename":"GAST1supplementarymaterials.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2303234/v1/c732bd76e70cc53ed64b10c4.pdf"}],"financialInterests":"","formattedTitle":"Identification and promoter analysis of a GA-stimulated transcript 1 gene from Jatropha curcas","fulltext":[{"header":"Key Message","content":"\u003cp\u003e\u003cstrong\u003eOverexpression of \u003cem\u003eJcGAST1\u003c/em\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003epromotes plant\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;growth but\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003einhibits pistil\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;development. The pyrimidine box and CGTCA\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003cstrong\u003emotif of \u003cem\u003eJcGAST1\u003c/em\u003e promoter was responsible for GA and MeJA response.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cbr\u003e\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003eBiodiesel is a green, renewable alternative to fossil fuel. \u003cem\u003eJatropha curcas\u003c/em\u003e L. (hereafter referred to as \u003cem\u003eJ. curcas\u003c/em\u003e), a member of the Euphorbiaceae family, which is native to tropical regions in the Western Hemisphere and has been considered an important biofuel plant (Maghuly and Laimer. 2013). The seeds of \u003cem\u003eJ. curcas\u003c/em\u003e contain a high content of oil (30\u0026thinsp;~\u0026thinsp;40%), and this seed oil contains high levels of unsaturated fatty acids, which are suitable for producing biodiesel (G\u0026uuml;bitz et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Openshaw. 2000; Thomas et al. \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). However, due to low seed yield, this plant has limited economic benefit for exploitation and further expansion of the \u003cem\u003eJatropha\u003c/em\u003e-based biodiesel industry. \u003cem\u003eJ. curcas\u003c/em\u003e is a monoecious plant, and separate female and male flowers are present in the same inflorescence (Chen et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The low ratio of female to male flowers (1/10\u0026thinsp;~\u0026thinsp;1/30) is an important factor that causes low seed productivity in \u003cem\u003eJ. curcas\u003c/em\u003e (Raju and Ezradanam. 2002). Despite the availability of transgenic breeding for \u003cem\u003eJ. curcas\u003c/em\u003e, the limited knowledge about the flowering mechanism in \u003cem\u003eJ. curcas\u003c/em\u003e has led to some gap toward the goal of producing high-yielding \u003cem\u003eJ. curcas\u003c/em\u003e cultivars. Thus, dissection of the molecular mechanisms of flowering and floral sex differentiation in \u003cem\u003eJ. curcas\u003c/em\u003e is beneficial for developing high-yielding \u003cem\u003eJ. curcas\u003c/em\u003e cultivars. Phytohormones are essential for plant developmental regulation and have been confirmed to be involved in floral development (Izawa. 2021). Among these phytohormones, gibberellin (GA) has been considered a florigen (King and Evans. 2003). GA regulates floral development by suppressing the function of DELLA proteins, which can physically interact with and regulate the activity of many transcription factors related to flowering (Bao et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In \u003cem\u003eJ. curcas\u003c/em\u003e, GA is thought to play essential and complicated roles in floral organ development. GA treatment could increase the number of both male and female flowers of \u003cem\u003eJ. curcas\u003c/em\u003e and promote the production of bisexual flowers (Pi et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Pan et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGASA proteins is a cysteine-rich low molecular weight peptide that is extensively widespread in the plant kingdom (Nahir\u0026ntilde;ak et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). The GASA gene family is unique in plants, and most members are regulated by GA (Zhang and Wang. 2017). Tomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e L.) GA-stimulated gene \u003cem\u003eGAST1\u003c/em\u003e (GA-stimulated transcript 1) was the first GASA gene reported in 1992 (Shi et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e1992\u003c/span\u003e). Subsequently, a large number of GASA genes and proteins were identified in \u003cem\u003eArabidopsi\u003c/em\u003es (\u003cem\u003eArabidopsis thaliana\u003c/em\u003e), \u003cem\u003ePetunia\u003c/em\u003e (\u003cem\u003ePetunia hybrida\u003c/em\u003e), rice (\u003cem\u003eOryza sativa\u003c/em\u003e), soybean (\u003cem\u003eGlycine max\u003c/em\u003e), poplar (\u003cem\u003ePopulus trichocarpa\u003c/em\u003e) and tobacco (\u003cem\u003eNicotiana tabacum\u003c/em\u003e) (Herzog et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e1995\u003c/span\u003e; Ben-Nissan and Weiss. 1996; Furukawa et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Ahmad et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Han et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Li et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Most GASA proteins contain a GASA domain consisting of 60 amino acids, typically including 12 cysteine residues (Sun et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). A previous study reported that lack of a GASA domain or mutation of conserved cysteine residues in the GASA domain will result in loss-of-function of the GASA protein (Rubinovich and Weiss. 2010). Growing evidence has revealed that GASA genes play an important role in the regulation of plant growth and development, including seed germination, stem elongation, root growth, floral induction and flower organ development (Zhang and Wang. 2017). In the same GASA gene family, different members may play an opposite biological function. In \u003cem\u003eArabidopsis\u003c/em\u003e, \u003cem\u003eAtGASA4\u003c/em\u003e was reported to contribute to flowering, and suppression of both \u003cem\u003eAtGASA4\u003c/em\u003e and \u003cem\u003eAtGASA6\u003c/em\u003e causes late flowering (Qu et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). However, \u003cem\u003eAtGASA5\u003c/em\u003e inhibits flowering by upregulating the expression of the flowering repressor \u003cem\u003eFLC\u003c/em\u003e (LOWERING LOCUSC). GASA proteins also act as phytohormonal signaling transducers and integrators (Zhang et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). It has been reported that AtGASA6 plays a role as an integrator of GA, ABA (abscisic acid), and Glc (glucose) signaling to regulate seed germination by linking AtRGL2 and AtEXPA1 functions (Zhong et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). In rice, the GASA protein OsGSR1 interacts with brassinolide (BR) synthase DIM/DWF1 directly to promote the biosynthesis of BR (Wang et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Additionally, the GASA gene family is also involved in plant responses to biotic and abiotic stresses. Overexpression of the beech \u003cem\u003eFsGASA4\u003c/em\u003e gene in \u003cem\u003eArabidopsis\u003c/em\u003e improves tolerance to salt, reduce oxygen species (ROS), and heat stress (Alonso-Ram\u0026iacute;rez et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Sun et al. reported that the \u003cem\u003eArabidopsis atgasa14\u003c/em\u003e mutant is sensitive to ABA and reduced salinity tolerance, and overexpression of \u003cem\u003eAtGASA14\u003c/em\u003e could reduce ROS to resist ABA and salt stress (Sun et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Similar to \u003cem\u003eAtGASA14\u003c/em\u003e, overexpression of \u003cem\u003eAtGASA4\u003c/em\u003e also inhibits ROS accumulation (Rubinovich et al. 2010).\u003c/p\u003e \u003cp\u003eAlthough some GASA genes have been studied in \u003cem\u003eArabidopsis\u003c/em\u003e and other plant species, there is still relatively limited knowledge of GASA genes in \u003cem\u003eJ. curcas\u003c/em\u003e. Herein, we identified a homolog of tomato GA-stimulated transcript 1 from \u003cem\u003eJ. curcas\u003c/em\u003e, termed JcGAST1. The mRNA and protein levels of JcGAST1 were higher in male flowers than in female flowers. Overexpression of \u003cem\u003eJcGAST1\u003c/em\u003e in tobacco not only promotes the growth of plants but also inhibits the development of the stigma. The promoter of \u003cem\u003eJcGAST1\u003c/em\u003e contains GA- and MeJA-responsive elements, and the activity of the \u003cem\u003eJcGAST1\u003c/em\u003e promoter was induced by GA but inhibited by MeJA. Taken together, our study sheds light on the potential role of JcGAST1 in floral development of \u003cem\u003eJ. curcas\u003c/em\u003e.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant materials and growth conditions\u003c/h2\u003e \u003cp\u003eFlower bud samples at different developmental stages were collected from thirty \u003cem\u003eJatropha curcas\u003c/em\u003e trees in Zhenfeng, Guizhou Province, China (36\u0026deg;14\u0026prime;50.2\u0026Prime;N, 87\u0026deg;51\u0026prime;47.8\u0026Prime;E). The flower bud samples were dipped immediately in RNAlocker (Tiandz, Inc., Beijing China) on ice for RNA isolation. \u003cem\u003eJatropha curcas\u003c/em\u003e or tobacco (\u003cem\u003eNicotiana benthamiana\u003c/em\u003e) seeds were sown in a soil mixture (peat moss, perlite, and vermiculite, 8:1:1) and grown in a greenhouse at 25\u0026deg;C under a 16-h light/8-h dark cycle at 50% relative humidity.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eBioinformatic Analysis\u003c/h3\u003e\n\u003cp\u003eThe coding sequence (CDS), peptide and 2,249 bp upstream of the translational start site (ATG) promoter region sequence information of \u003cem\u003eJcGAST1\u003c/em\u003e is available in the NCBI database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The functional domains of JcGAST1 were predicted using SMART online software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://smart.embl-heidelberg.de/\u003c/span\u003e\u003cspan address=\"http://smart.embl-heidelberg.de/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). A phylogenetic tree was constructed using the neighbor-joining (NJ) method with MEGA 6.0 software. The PlantCARE database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://bioinformatics.psb.ugent.be/webtools/plantcare/html/\u003c/span\u003e\u003cspan address=\"http://bioinformatics.psb.ugent.be/webtools/plantcare/html/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to identify potential cis-elements of the \u003cem\u003eJcGAST1\u003c/em\u003e promoter.\u003c/p\u003e\n\u003ch3\u003eRna Isolation And Qpcr\u003c/h3\u003e\n\u003cp\u003eTotal RNA was isolated from \u003cem\u003eJatropha curcas\u003c/em\u003e flower buds or leaves using E.Z.N.A Total RNA Kit (OMEGA) according to the manufacturer's protocol. cDNA was synthesized with an AMV RNA PCR Kit 3.0 (Takara) in 10 \u0026micro;L of reaction mixture containing 1 \u0026micro;g of total RNA according to the manufacturer's instructions. Quantitative PCR was performed with the ABI StepOnePlus Real-Time PCR System (Applied Biosystems, Inc. USA) using 2 \u0026times; SYBR green PCR mix (QIAGEN, Shanghai, China). To analyze the expression of \u003cem\u003eJcGAST1\u003c/em\u003e in flower development, the flower bud samples were divided into eight development phases as previously described (Xu et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). To quantify the transcriptional levels of \u003cem\u003eJcGAST1\u003c/em\u003e in response to phytohormones treatment, three-month-old \u003cem\u003eJatropha curcas\u003c/em\u003e seedlings were treated with 100 \u0026micro;M MeJA, 100 \u0026micro;M GA\u003csub\u003e3\u003c/sub\u003e, 100 \u0026micro;M IAA or 100 \u0026micro;M SA, respectively, and leaves that collected at 3 h and 24 h after phytohormones treatment were used for total RNA extraction. The primers used for qPCR are listed in Supporting Information Table S1. \u003cem\u003eJcTUB\u003c/em\u003e was used as an internal positive control.\u003c/p\u003e\n\u003ch3\u003ePlasmid Construction And Plant Transformation\u003c/h3\u003e\n\u003cp\u003eThe full-length coding sequence (CDS) of \u003cem\u003eJcGAST1\u003c/em\u003e was cloned from \u003cem\u003eJatropha curcas\u003c/em\u003e cDNA and inserted into the pCAMBIA1305 vector to generate the \u003cem\u003e35S::JcGAST1\u003c/em\u003e construct. The construct was transformed into \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e GV3101 through heat shock transformation. To generate stable tobacco transgenic plants, plants were transformed by Agrobacterium-mediated transformation through the leaf disc transformation regeneration method. The \u003cem\u003eJcGAST1\u003c/em\u003e promoter fragments of different lengths were inserted upstream of the \u003cem\u003eGUS\u003c/em\u003e gene coding region of the pCAMBIA1304 vector to replace the cauliflower mosaic virus (CaMV) 35S promoter, obtaining a series of \u003cem\u003eproJcGAST1-GUS\u003c/em\u003e constructs named FL (-2249/-1, 2249 bp), P1 (-1799/-1, 1799 bp), P2 (-1215/-1, 1215 bp), P3 (-713/-1, 713 bp) and P4 (-359/-1, 359 bp). The promoter constructs were transformed into tobacco leaves using the transient transformation method for the GUS activity assay.\u003c/p\u003e\n\u003ch3\u003eProtein Extraction And Immunoblotting\u003c/h3\u003e\n\u003cp\u003eTotal proteins of \u003cem\u003eJ. curcas\u003c/em\u003e flower buds were extracted using a Plant Total Protein Extraction Kit (Sangon Biotech, China) according to the manufacturer's instructions. For immunoblotting, the proteins were separated by sodium dodecyl sulfate‒polyacrylamide gel electrophoresis (SDS‒PAGE) and then transferred to a 0.22 \u0026micro;m PVDF membrane. The membrane was incubated with an anti-JcGAST1 antibody (DetaiBio, China). The blot was developed using an enhanced chemiluminescent kit (Biosharp) and detected by a Tanon-5500 system.\u003c/p\u003e\n\u003ch3\u003eGus Histochemical And Fluorometric Assay\u003c/h3\u003e\n\u003cp\u003eFor histochemical GUS staining, tobacco leaf discs expressing various \u003cem\u003ePromoter-GUS\u003c/em\u003e were immersed in GUS staining solution and incubated at 37\u0026deg;C overnight. The chlorophyll was removed by immersion of the leaf disc samples in 70% ethanol. Images were taken using a stereomicroscope (Leica M80). A fluorometric assay of GUS activity was performed as previously described (Jefferson et al., 1987) by using 4-methylumbelliferyl-b-glucuronide (4-MUG) as a substrate. The tobacco leaves transformed with various \u003cem\u003epromoter-GUS\u003c/em\u003e vectors were treated with 100 \u0026micro;M MeJA, 100 \u0026micro;M GA\u003csub\u003e3\u003c/sub\u003e, 100 \u0026micro;M IAA or 100 \u0026micro;M SA and then collected for protein extraction. The protein concentration was quantified using the Bradford protein assay. Fluorescence was measured by using a Thermo Varioskan\u0026trade; LUX Microplate Reader.\u003c/p\u003e\n\u003ch3\u003eYeast One-hybrid Assay\u003c/h3\u003e\n\u003cp\u003eThe coding sequences of \u003cem\u003eJcRF2a\u003c/em\u003e, \u003cem\u003eJcIAA9\u003c/em\u003e, \u003cem\u003eJcAHL9\u003c/em\u003e, \u003cem\u003eERF106\u003c/em\u003e, \u003cem\u003eJcbZIP11\u003c/em\u003e, \u003cem\u003eJcPAT1\u003c/em\u003e, \u003cem\u003eJcSAP8\u003c/em\u003e and \u003cem\u003eJcRAG1\u003c/em\u003e were cloned into the pGADT7 vector. The primer pairs used for gene cloning are listed in Supplemental Table S1. The cis-elements of the \u003cem\u003eJcGAST1\u003c/em\u003e promoter, like 3\u0026times;CCTTTT and 3\u0026times;CGTCA, were inserted into the pHIS2 vector, respectively. All of the constructs were transformed into the yeast Y187 strain using the lithium acetate method. The transformed cells were harvested and evenly coated on minimal synthetic dextrose medium lacking leucine, tryptophan and histidine (SD/-LWH) containing 3-amino-1,2,4-triazole (3-AT) and grown at 30\u0026deg;C for three days.\u003c/p\u003e\n\u003ch3\u003eDual-luciferase Assay\u003c/h3\u003e\n\u003cp\u003eA dual-LUC assay was performed as previously described (Zhang et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Briefly, the cis-elements of the \u003cem\u003eJcGAST1\u003c/em\u003e promoter, like 3\u0026times;CCTTTT and 3\u0026times;CGTCA, were inserted into the pGreenII 0800-LUC plasmid to generate the reporter vectors, respectively. The coding sequences of \u003cem\u003eJcRF2a\u003c/em\u003e, \u003cem\u003eJcIAA9\u003c/em\u003e, \u003cem\u003eJcAHL9\u003c/em\u003e, \u003cem\u003eERF106\u003c/em\u003e, \u003cem\u003eJcbZIP11\u003c/em\u003e, \u003cem\u003eJcPAT1\u003c/em\u003e, \u003cem\u003eJcSAP8\u003c/em\u003e and \u003cem\u003eJcRAG1\u003c/em\u003e were cloned into the pCAMBIA1305 plasmid driven by the CaMV 35S promoter as the effector vectors, respectively, and \u003cem\u003e35S::YFP\u003c/em\u003e served as a negative control. The resultant constructs were subsequently transiently expressed in tobacco leaves. The relative LUC/REN activity was examined using a Dual-Luciferase Assay System Kit (Promega).\u003c/p\u003e\n\u003ch3\u003eAccession Numbers\u003c/h3\u003e\n\u003cp\u003eSequence data of this article can be found in the NCBI database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) under the following accession numbers: \u003cem\u003eJcGAST1\u003c/em\u003e (XM_012234671.3), \u003cem\u003eJcTUB\u003c/em\u003e (XM_012218402.3), \u003cem\u003eJcRF2a\u003c/em\u003e (XM_012229037.3), \u003cem\u003eJcERF106\u003c/em\u003e (XM_012235114.3), \u003cem\u003eJcIAA9\u003c/em\u003e (XM_012212698.3), \u003cem\u003eJcAHL9\u003c/em\u003e (XM_012228026.3), \u003cem\u003eJcbZIP11\u003c/em\u003e (XM_012211837.3), \u003cem\u003eJcPAT1\u003c/em\u003e (XM_012232033.3), \u003cem\u003eJcSAP8\u003c/em\u003e (XM_012234577.3), \u003cem\u003eJcRAG1\u003c/em\u003e (XM_012212711.2) and \u003cem\u003eNt18S\u003c/em\u003e (HQ384692.1).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eCharacterization of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eJcGAST1\u003c/span\u003e\u003c/p\u003e \u003cp\u003eBased on the gene expression profile of developing flowers in \u003cem\u003eJ. curcas\u003c/em\u003e, a homolog of the tomato GA-stimulated transcript 1 (\u003cem\u003eGAST1\u003c/em\u003e) gene was isolated from differentially expressed genes, termed \u003cem\u003eJcGAST1\u003c/em\u003e. The cDNA of the \u003cem\u003eJcGAST1\u003c/em\u003e gene is composed of a 348 bp ORF that encodes a protein of 115 amino acids. Sequence comparisons showed that JcGAST1 shares 76% identity and 80% similarity with SlGAST1. Similar to SlGAST1, JcGAST1 also contains a GASA domain at the C-terminus (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The GASA domain could be found in all GASA proteins, and its impairment would result in loss of function (Rubinovich and Weiss. 2010). In addition, phylogenetic analysis demonstrated significant evolutionary relevance between JcGAST1 and its homologs in 10 plant species (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). To investigate the function of JcGAST1 during floral development in \u003cem\u003eJ. curcas\u003c/em\u003e, we first performed quantitative PCR (qPCR) to monitor the expression of \u003cem\u003eJcGAST1\u003c/em\u003e at nine different stages for sex differentiation and floral development. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, the transcripts of \u003cem\u003eJcGAST1\u003c/em\u003e could be detected in all of the development phases, and the JCFIII stage had the highest level, followed by the JCFII stage. Compared to the JCUN stage, \u003cem\u003eJcGAST1\u003c/em\u003e expression was higher at the four developmental stages of the male flower but lower at the other four developmental stages of the female flower. Subsequently, we examined the accumulation of JcGAST1 protein at the nine stages of \u003cem\u003eJ. curcas\u003c/em\u003e flowering. Immunoblot analysis showed that the amount of JcGAST1 protein was highest at the JCFII stage. Furthermore, the protein levels of JcGAST1 in male flowers were higher than those in female flowers (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). These results indicated that JcGAST1 may play an opposite role during male and female flower development in \u003cem\u003eJ. curcas\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eOverexpression of\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eJcGAST1\u003c/span\u003e \u003cb\u003einhibits the development of stigma in transgenic tobacco\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo further investigate the function of JcGAST1 during flower development and sex differentiation, the \u003cem\u003eJcGAST1\u003c/em\u003e gene was overexpressed in tobacco plants (cultivar K326). RT‒PCR analysis showed that \u003cem\u003eJcGAST1\u003c/em\u003e transcripts were undetectable in wild-type (WT) tobacco plants but could be detected in the three transgenic lines (\u003cem\u003e35S::JcGAST1\u003c/em\u003e #1, #2 and #3), which were selected for further study (Fig. S1). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, the \u003cem\u003e35S::JcGAST1\u003c/em\u003e plants showed increased growth compared with the WT plants. To determine the extent of increased growth of \u003cem\u003e35S::JcGAST1\u003c/em\u003e plants, the plant height, leaf length and leaf width were measured. We found that there was a significant elevation in the plant height, leaf length and leaf width of \u003cem\u003e35S::JcGAST1\u003c/em\u003e plants compared with those of WT plants (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC\u0026ndash;E), suggesting that overexpression of the \u003cem\u003eJcGAST1\u003c/em\u003e gene could promote the growth of plants. Significantly, the stigma development of these selected \u003cem\u003e35S::JcGAST1\u003c/em\u003e plants was obviously inhibited (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Compared to 0.97\u0026thinsp;\u0026plusmn;\u0026thinsp;0.11 of that of the WT plants, the filament/stigma length ratio of \u003cem\u003e35S::JcGAST1\u003c/em\u003e plants was enhanced to 1.13\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06, 1.12\u0026thinsp;\u0026plusmn;\u0026thinsp;0.09 and 1.47\u0026thinsp;\u0026plusmn;\u0026thinsp;0.15, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). These results indicated that JcGAST1 may be involved in the regulation of flower development.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eSequence and deletion analysis of the\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eJcGAST1\u003c/span\u003e \u003cb\u003epromoter\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo predict the potential regulatory mechanism mediated by JcGAST1 during flower development, the cis-acting elements of the promoter were analyzed. Except for the basic elements CAAT box and TATA box, the \u003cem\u003eJcGAST1\u003c/em\u003e promoter also contains the light response elements (G box and Box 4), the meristem expression element (CAT box) and the stress responsive element (TC-rich repeats). Some hormone response elements were also found in the \u003cem\u003eJcGAST1\u003c/em\u003e promoter, including the TCA element (salicylic acid responsiveness), the GARE motif (gibberellin responsiveness), the TGA element (auxin responsiveness), the CGTCA motif (MeJA responsiveness), and the ABRE motif (abscisic acid responsiveness) (Fig. S2 and Table S2). Moreover, pollen-specific elements (GTGANTG10 and POLLEN1LELAT52) and embryo-specific elements (DPBFCOREDCDC3) were present in the \u003cem\u003eJcGAST1\u003c/em\u003e promoter. The coordination of phytohormone signaling plays an important role in the regulation of flower development (Ma et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Considering that the \u003cem\u003eJcGAST1\u003c/em\u003e promoter contains hormone response elements, the effects of phytohormones on \u003cem\u003eJcGAST1\u003c/em\u003e expression were investigated. qPCR showed that the expression of \u003cem\u003eJcGAST1\u003c/em\u003e could be induced by IAA, GA and SA treatment but inhibited by MeJA treatment (Fig. S3).\u003c/p\u003e \u003cp\u003eTo determine the regulatory effects of different regions of the \u003cem\u003eJcGAST1\u003c/em\u003e promoter, a series of 5\u0026rsquo;-deleted fragments of the promoter were fused with the \u003cem\u003eGUS\u003c/em\u003e gene (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). As Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB shows, except for P4 (-359/-1 region), the GUS activity of these deleted promoter constructs was detectable, and P3 had the highest GUS activity. Consistently, the GUS staining intensity was notably enhanced in P3 compared with FL, indicating that P3 (-713/-319 region) may contain the core region of the \u003cem\u003eJcGAST1\u003c/em\u003e promoter. Using GUS staining and the 5\u0026rsquo;-deleted constructs of P3, we further identified the core region of the \u003cem\u003eJcGAST1\u003c/em\u003e promoter and found that the \u0026minus;\u0026thinsp;381/-1 region had the highest GUS activity. These results suggest that the 22-bp region (AATAACCAGTGAAATTTGTTGT) may be the core region of the \u003cem\u003eJcGAST1\u003c/em\u003e promoter.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eGA and MeJA response analysis of the\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eJcGAST1\u003c/span\u003e \u003cb\u003epromoter\u003c/b\u003e\u003c/p\u003e \u003cp\u003eDue to the hormone response elements were predicted in the \u003cem\u003eJcGAST1\u003c/em\u003e promoter, the effects of GA, MeJA, IAA and SA on the activity of the \u003cem\u003eJcGAST1\u003c/em\u003e promoter were investigated. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, there were no obvious differences in GUS activity in FL and P1 upon treatment with these phytohormones. However, the GUS activity was significantly increased in P2 after GA treatment and decreased with SA treatment. Additionally, significantly decreased GUS activity was also observed in P3 after IAA, SA and MeJA treatment. Considering that the expression of \u003cem\u003eJcGAST1\u003c/em\u003e was induced by GA treatment but downregulated with MeJA treatment (Fig. S3), we further identified the GA- and MeJA-responsive cis-acting element of the \u003cem\u003eJcGAST1\u003c/em\u003e promoter. We found that P2 contains a predicted GA responsive element (pyrimidine box, CCTTTT), and a MeJA responsive element (CGTCA motif) was predicated in P3. We substituted the CCTTTT motif in P2 with CCGTTT to generate the mP2-GUS construct. In the presence of GA\u003csub\u003e3\u003c/sub\u003e, the GUS activity of P2 was approximately 2-fold higher than that of mP2 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Meanwhile, CGGCA was substituted for the CGTCA motif of P3 to generate the mP3-GUS construct. In the presence of MeJA, the GUS activity of mP3 was approximately 9-fold higher than that of P3 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). These results suggest that the transcripts of \u003cem\u003eJcGAST1\u003c/em\u003e regulated by GA and MeJA are associated with the pyrimidine box and CGTCA motif.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eIdentify the interactors of GA- and MeJA-responsive elements in\u003c/b\u003e \u003cspan type=\"BoldItalic\" class=\"BoldItalic\" name=\"Emphasis\"\u003eJ. curcas\u003c/span\u003e\u003c/p\u003e \u003cp\u003eTo identify potential regulators acting upstream of GA- and MeJA-responsive elements of the \u003cem\u003eJcGAST1\u003c/em\u003e promoter, the 3\u0026times;CCTTTT and 3\u0026times;CGTCA motifs were inserted into a pHis2 vector for yeast one-hybrid (Y1H) screening using a cDNA library of \u003cem\u003eJ. curcas\u003c/em\u003e flowers. As a result, some cDNA fragments for 3\u0026times;CCTTTT screening or 3\u0026times;CGTCA screening were obtained. Using the NCBI database, these cDNA fragments were matched with \u003cem\u003eJ. curcas\u003c/em\u003e genes. The potential transcription factors are listed in Table S4, including six proteins for 3\u0026times;CCTTTT screening (JcRF2a, JcIAA9, JcPAT1, JcERF106, JcAHL19 and JcbZIP11) and three proteins for 3\u0026times;CGTCA screening (JcIAA9, JcAHL19 and JcSAP8). Subsequently, the interaction between these proteins and GA- or MeJA-responsive elements was verified with a Y1H assay. The results showed that yeast cells containing the construct pairs pHis2-CCTTTT and pGADT7-JcRF2a/JcERF106/JcAHL19/JcbZIP11/JcIAA9/JcPAT1 or pHis2-CGTCA and pGADT7-JcAHL19/JcSAP8/JcIAA9 grew well on SD/-Trp/-His/-Leu media supplemented with 3-AT, suggesting the potential interaction between these proteins and the two motifs (Fig. S6A). To determine the effects of the interaction between GA- or MeJA-responsive elements and their interactors on gene transcription, a dual-luciferase assay was performed. The 3\u0026times;CCTTTT and 3\u0026times;CGTCA motifs were fused to the \u003cem\u003eLUC\u003c/em\u003e gene as the reporter. The coding sequences of the interactors were inserted into the pCAMBIA1305 vector as the effector constructs, and the \u003cem\u003eYFP\u003c/em\u003e gene was used as the control (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). The dual-LUC assay results showed that the LUC/REN value was increased by coexpression with the \u003cem\u003e35S::JcRF2a/JcAHL19/JcbZIP11\u003c/em\u003e and 3\u0026times;CCTTTT-LUC constructs or the \u003cem\u003e35S:: JcAHL19/JcSAP8\u003c/em\u003e and 3\u0026times;CGTCA-LUC constructs. These results indicated that these element interactors could bind to the CCTTTT or CGTCA motif to enhance the transcription of downstream genes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eMembers of the GASA gene family play an important role in the regulation of plant growth (Zhang and Wang. 2017). A large number of GASA genes have been identified in some plant species, but there have been no studies on the GASA gene in \u003cem\u003eJ. curcas\u003c/em\u003e. In this study, \u003cem\u003eJcGAST1\u003c/em\u003e was cloned from \u003cem\u003eJ. curcas\u003c/em\u003e, which encodes a protein containing a highly conserved GASA domain (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The regulative function of GASA genes in floral development has been described in previous studies, most of which were in bisexual flower plants (Kotilainen et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Roxrud et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). \u003cem\u003eJ. curcas\u003c/em\u003e is a monoecious plant, and sex differentiation of flowers occurs after the initiation of five petal primordia. Xu et al. reported that the development of \u003cem\u003eJ. curcas\u003c/em\u003e female flowers requires a hermaphroditic period: stamens first develop with carpels and then gradually degenerate as the three carpels to be fused (Xu et al. \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In contrast to the female flowers, the male flowers of \u003cem\u003eJ. curcas\u003c/em\u003e did not undergo a hermaphroditic period. Our transcriptome data indicate that the \u003cem\u003eJcGAST1\u003c/em\u003e gene is differentially expressed in female and male flowers (data not shown). Both the transcript and protein levels of \u003cem\u003eJcGAST1\u003c/em\u003e were higher in the male flowers than in the female flowers (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). This means that \u003cem\u003eJcGAST1\u003c/em\u003e may play different roles in female and male flowers. In \u003cem\u003eArabidopsis\u003c/em\u003e, AtGASA14 is speculated to function in the promotion of cell elongation, and overexpression of \u003cem\u003eAtGASA14\u003c/em\u003e promotes an increase in leaf size (Sun et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Additionally, we observed that transgenic tobacco plants overexpressing the \u003cem\u003eJcGAST1\u003c/em\u003e gene increased leaf size and plant height (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, C-E), suggesting that \u003cem\u003eJcGAST1\u003c/em\u003e might be a contributor to vegetative growth in plants. Although \u003cem\u003eJcGAST1\u003c/em\u003e showed a high level of expression in the male flowers (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), the development of stamens was not influenced in \u003cem\u003e35S::JcGAST1\u003c/em\u003e transgenic tobacco plants. In contrast, significant inhibition was observed in the stigmas of transgenic tobacco plants (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, F). These phenotypic studies revealed a negative role for JcGAST1 in the development of female organs, which may be the reason why \u003cem\u003eJ. curcas\u003c/em\u003e female flowers had a lower \u003cem\u003eJcGAST1\u003c/em\u003e expression level. In gynoecious plants, GA treatment represses pistil development in female flowers to produce neutral flowers but does not resume the development of stamens (Chen et al. 2013). Most GASA genes were upregulated by GA, such as tomato \u003cem\u003eSlGAST1\u003c/em\u003e, \u003cem\u003eArabidopsis AtGASA4\u003c/em\u003e, \u003cem\u003eAtGASA6\u003c/em\u003e, \u003cem\u003eAtGASA7\u003c/em\u003e, \u003cem\u003eAtGASA8\u003c/em\u003e and \u003cem\u003eAtGASA13\u003c/em\u003e, and beech \u003cem\u003eFsGASA4\u003c/em\u003e. (Shi et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e1992\u003c/span\u003e; Zhang and Wang. 2008; Alonso-Ram\u0026iacute;rez et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Rubinovich and Weiss. 2010). Similar to these genes, \u003cem\u003eJcGAST1\u003c/em\u003e expression was also induced by GA. These results implied that the regulatory role of JcGAST1 in plant reproductive growth was largely associated with the GA signaling pathway.\u003c/p\u003e \u003cp\u003eGASA family genes are thought to be integrators of phytohormone signals. In Arabidopsis, all GASA genes contain GA signaling-associated GARE and ABA signaling-related ABRE elements (Zhang and Wang. 2008). The promoter sequence analysis showed that the \u003cem\u003eJcGAST1\u003c/em\u003e promoter not only contains GARE and ABRE elements but also contains TCA-element (SA responsive element), TGA-element (Auxin responsive element) and CGTCA-motif (MeJA responsive element). Our deletion analysis found that the promoter region containing the GARE element was nonessential for the GA response. However, substitution of a base in the pyrimidine box decreased the activity of the \u003cem\u003eJcGAST1\u003c/em\u003e promoter upon GA treatment, suggesting that the pyrimidine box may be the key element for the GA response. The pyrimidine box was first found in cereal, and mutations in the pyrimidine box caused a reduction in GA induction (Huang et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e1990\u003c/span\u003e; Gubler and Jacobsen. 1992; Rogers and Rogers. 1992). Previous studies reported that the transcription factors of the DNA Binding with One Finger (DOF) class could interact with the pyrimidine box (Mena et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). DOF transcription factors have been confirmed to be involved in the regulation of pollen development in maize (Yanagisawa. 2000; Chen et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Except for the pyrimidine box, we noticed that the \u003cem\u003eJcGAST1\u003c/em\u003e promoter also contains the GTGANTG10 and POLLEN1LELAT52 motifs, which are both pollen-specific expression elements. These results prompted us to speculate that, perhaps, there is a DOF-GAST1 module that regulates pollen development in \u003cem\u003eJ. curcas\u003c/em\u003e. This possibility should be addressed in the future. JA and MeJA are naturally occurring plant hormones that function as key signaling molecules in response to biotic and abiotic stresses. In strawberry, \u003cem\u003eFaGAST2\u003c/em\u003e expression was not affected by MeJA (Moyano-Ca\u0026ntilde;ete et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). However, in \u003cem\u003eArabidopsis\u003c/em\u003e, the expression of \u003cem\u003eAtGASA4\u003c/em\u003e and \u003cem\u003eAtGASA6\u003c/em\u003e was downregulated by JA (Qu et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The \u003cem\u003eJcGAST1\u003c/em\u003e promoter contains a CGTCA motif, and both qPCR and GUS activity assays proved that MeJA plays a negative role in \u003cem\u003eJcGAST1\u003c/em\u003e transcription. Using a Y1H screen, we found that the three transcription factors JcIAA9, JcSAP8 and JcAHL19 interacted with the CGTCA motif. IAA9 has been reported to act as a transcriptional repressor of auxin signaling in tomato (Wang et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). AHL19 and SAP8 have been described to be involved in stress resistance in \u003cem\u003eArabidopsis\u003c/em\u003e and barley, respectively (Yadeta et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Baidyussen et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Due to the promotional effect of \u003cem\u003eJcGAST1\u003c/em\u003e on plant growth, there may be some regulatory factors that repress GAST1 to maintain energy to ensure that the organism can survive in adverse environments. Significantly, JcIAA9 and JcAHL19 were also found in the Y1H screen of the pyrimidine box, suggesting that they may cross-link GA and MeJA signaling to regulate \u003cem\u003eJcGAST1\u003c/em\u003e. Additionally, we found that four other transcription factors, JcbZIP11, JcERF106, JcRF2a and JcPAT1, all interact with the pyrimidine box. JcbZIP11 and JcRF2a are members of the bZIP transcription factor family, and their homologs in other species have been described to be involved in pathogen resistance (Dai et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Prior et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Homologs of JcERF106 and JcPAT1 have been reported to be involved in ethylene and JA signaling (Feng et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). However, the regulatory relationship between these transcription factors and \u003cem\u003eJcGAST1\u003c/em\u003e requires further investigation.\u003c/p\u003e \u003cp\u003eIn summary, our results indicate that JcGAST1 plays an important role in the regulation of plant vegetative growth and inhibition of the development of female organs. GA and MeJA act as inducers and inhibitors of the expression of \u003cem\u003eJcGAST1\u003c/em\u003e, respectively. Our present research provides valuable insight into the potential regulatory mechanisms of JcGAST1 during floral development. Further studies will focus on the upstream transcriptional regulators of \u003cem\u003eJcGAST1\u003c/em\u003e.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by the National Natural Science Foundation of China (grant No, 31760198).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eGX designed and managed this study; SL, LZ and YC performed the experiments; LZ and YC analyzed the data; SL and GX wrote the manuscript; all authors read and approved the manuscript.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no conflicts of interest to declare.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAhmad MZ, Sana A, Jamil A, Nasir JA, Ahmed S, Hameed MU, Abdullah (2019) A genome-wide approach to the comprehensive analysis of GASA gene family in \u003cem\u003eGlycine max\u003c/em\u003e. Plant Mol Biol 100:607\u0026ndash;620\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlonso-Ram\u0026iacute;rez A, Rodr\u0026iacute;guez D, Reyes D, Jim\u0026eacute;nez JA, Nicol\u0026aacute;s G, L\u0026oacute;pez-Climent M, G\u0026oacute;mez-Cadenas A, Nicol\u0026aacute;s C (2009) Evidence for a role of gibberellins in salicylic acid-modulated early plant responses to abiotic stress in Arabidopsis seeds. Plant Physiol 150:1335\u0026ndash;1344\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaidyussen A, Jatayev S, Khassanova G, Amantayev B, Sereda G, Sereda S, Gupta NK, Gupta S, Schramm C, Anderson P, Jenkins CLD, Soole KL, Langridge P, Shavrukov Y (2021) Expression of specific alleles of Zinc-Finger transcription factors, HvSAP8 and HvSAP16, and corresponding SNP markers, are associated with drought tolerance in barley populations. Int J Mol Sci 22:12156\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBao S, Hua C, Shen L, Yu H (2020) New insights into gibberellin signaling in regulating flowering in \u003cem\u003eArabidopsis\u003c/em\u003e. J Integr Plant Biol 62:118\u0026ndash;131\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBen-Nissan G, Weiss D (1996) The petunia homologue of tomato gast1: transcript accumulation coincides with gibberellin-induced corolla cell elongation. Plant Mol Biol 32:1067\u0026ndash;1074\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen MS, Pan BZ, Fu Q, Tao YB, Mart\u0026iacute;nez-Herrera J, Niu L, Ni J, Dong Y, Zhao ML, Xu ZF (2017) Comparative transcriptome analysis between gynoecious and monoecious plants identifies regulatory networks controlling sex determination in \u003cem\u003eJatropha curcas\u003c/em\u003e. Front Plant Sci 7:1953\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen XY, Wang DX, Liu C, Wang MZ, Wang T, Zhao Q, Yu JJ (2012) Maize transcription factor Zmdof1 involves in the regulation of \u003cem\u003eZm401\u003c/em\u003e gene. Plant Growth Regul 66:271\u0026ndash;284\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDai S, Zhang Z, Chen S, Beachy RN (2004) RF2b, a rice bZIP transcription activator, interacts with RF2a and is involved in symptom development of rice tungro disease. Proc Natl Acad Sci U S A 101:687\u0026ndash;692\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng K, Hou XL, Xing GM, Liu JX, Duan AQ, Xu ZS, Li MY, Zhuang J, Xiong AS (2020) Advances in AP2/ERF super-family transcription factors in plant. Crit Rev Biotechnol 40:750\u0026ndash;776\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFurukawa T, Sakaguchi N, Shimada H (2006) Two \u003cem\u003eOsGASR\u003c/em\u003e genes, rice GAST homologue genes that are abundant in proliferating tissues, show different expression patterns in developing panicles. Genes Genet Syst 81:171\u0026ndash;180\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eG\u0026uuml;bitz GM, Mittelbach M, Trabi M (1999) Exploitation of the tropical oil seed plant J\u003cem\u003eatropha curcas\u003c/em\u003e L. Bioresour Technol 67:73\u0026ndash;82\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGubler F, Jacobsen JV Gibberellin-responsive elements in the promoter of a barley high-pI alpha-amylase gene.Plant Cell4:1435\u0026ndash;1441\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan S, Jiao Z, Niu MX, Yu X, Huang M, Liu C, Wang HL, Zhou Y, Mao W, Wang X, Yin W, Xia X (2021) Genome-wide comprehensive analysis of the GASA gene family in \u003cem\u003ePopulus\u003c/em\u003e. Int J Mol Sci 22:12336\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHerzog M, Dorne AM, Grellet F (1995) \u003cem\u003eGASA\u003c/em\u003e, a gibberellin-regulated gene family from \u003cem\u003eArabidopsis thaliana\u003c/em\u003e related to the tomato \u003cem\u003eGAST1\u003c/em\u003e gene. Plant Mol Biol 27:743\u0026ndash;752\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang N, Sutliff TD, Litts JC, Rodriguez RL (1990) Classification and characterization of the rice alpha-amylase multigene family. Plant Mol Biol 14:655\u0026ndash;668\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIzawa T (2021) What is going on with the hormonal control of flowering in plants? Plant J 105:431\u0026ndash;445\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKing RW, Evans LT (2003) Gibberellins and flowering of grasses and cereals: prizing open the lid of the \u0026ldquo;florigen\u0026rdquo; black box. Annu Rev Plant Biol 54:307\u0026ndash;328\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKotilainen M, Helariutta Y, Mehto M, Pollanen E, Albert VA, Elomaa P, Teeri TH (1999) GEG participates in the regulation of cell and organ shape during corolla and carpel development in gerbera hybrida. Plant Cell 11:1093\u0026ndash;1104\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Z, Gao J, Wang G, Wang S, Chen K, Pu W, Wang Y, Xia Q, Fan X (2022) Genome-wide identification and characterization of \u003cem\u003eGASA\u003c/em\u003e Gene family in \u003cem\u003eNicotiana tabacum\u003c/em\u003e. Front Genet 12:768942\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa N, Ma C, Liu Y, Shahid MO, Wang C, Gao J (2018) Petal senescence: a hormone view. J Exp Bot 69:719\u0026ndash;732\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaghuly F, Laimer M (2013) \u003cem\u003eJatropha curcas\u003c/em\u003e, a biofuel crop: functional genomics for understanding metabolic pathways and genetic improvement. Biotechnol J 8:1172\u0026ndash;1182\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMena M, Cejudo FJ, Isabel-Lamoneda I, Carbonero P (2002) A role for the DOF transcription factor BPBF in the regulation of gibberellin-responsive genes in barley aleurone. Plant Physiol 130:111\u0026ndash;119\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoyano-Ca\u0026ntilde;ete E, Bellido ML, Garc\u0026iacute;a-Caparr\u0026oacute;s N, Medina-Puche L, Amil-Ruiz F, Gonz\u0026aacute;lez-Reyes JA, Caballero JL, Mu\u0026ntilde;oz-Blanco J, Blanco-Portales R (2013) \u003cem\u003eFaGAST2\u003c/em\u003e, a strawberry ripening-related gene, acts together with \u003cem\u003eFaGAST1\u003c/em\u003e to determine cell size of the fruit receptacle. Plant Cell Physiol 54:218\u0026ndash;236\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNahir\u0026ntilde;ak V, Almasia NI, Hopp HE, Vazquez-Rovere C (2012) Snakin/GASA proteins: involvement in hormone crosstalk and redox homeostasis. Plant Signal Behav 7:1004\u0026ndash;1008\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOpenshaw K (2000) A review of Jatropha curcas: An oil plant of unfulfilled promise. Biomass Bioenergy 19:1\u0026ndash;15\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePan BZ, Chen MS, Ni J, Xu ZF (2014) Transcriptome of the inflorescence meristems of the biofuel plant Jatropha curcas treated with cytokinin. BMC Genomics 15:974\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePi X, Pan B, Xu Z (2013) Induction of bisexual flowers by gibberellins in monoecious biofuel plant \u003cem\u003eJatropha curcas\u003c/em\u003e (Euphorbiaceae). Plant Divers Resour 35:26\u0026ndash;32\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePrior MJ, Selvanayagam J, Kim JG, Tomar M, Jonikas M, Mudgett MB, Smeekens S, Hanson J, Frommer WB (2021) \u003cem\u003eArabidopsis\u003c/em\u003e bZIP11 is a susceptibility factor during Pseudomonas syringae infection. Mol Plant Microbe Interact 34:439\u0026ndash;447\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eQu J, Kang SG, Hah C, Jang JC (2016) Molecular and cellular characterization of GA-stimulated transcripts GASA4 and GASA6 in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e. Plant Sci 246:1\u0026ndash;10\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRaju AJS, Ezradanam V (2002) Pollination ecology and fruiting behaviour in a monoe-cious species, \u003cem\u003eJatropha curcas\u003c/em\u003e L. (Euphorbiaceae). Current Science 83:13951398\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRogers JC, Rogers SW (1992) Definition and functional implications of gibberellin and abscisic acid cis-acting hormone response complexes. Plant Cell 4:1443\u0026ndash;1451\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoxrud I, Lid SE, Fletcher JC, Schmidt ED, Opsahl-Sorteberg HG (2007) GASA4, one of the 14-member \u003cem\u003eArabidopsis\u003c/em\u003e GASA family of small polypeptides, regulates flowering and seed development. Plant Cell Physiol 48:471\u0026ndash;483\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRubinovich L, Weiss D (2010) The Arabidopsis cysteine-rich protein GASA4 promotes GA responses and exhibits redox activity in bacteria and \u003cem\u003ein planta\u003c/em\u003e. Plant J 64:1018\u0026ndash;1027\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi L, Gast RT, Gopalraj M, Olszewski NE (1992) Characterization of a shoot specific, GA3- and ABA-regulated gene from tomato. Plant J 2:153\u0026ndash;159\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSun S, Wang H, Yu H, Zhong C, Zhang X, Peng J, Wang X (2013) GASA14 regulates leaf expansion and abiotic stress resistance by modulating reactive oxygen species accumulation. J Exp Bot 64:1637\u0026ndash;1647\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThomas R, Sah NK, Sharma PB (2008) Therapeutic biology of Jatropha curcas: a mini review. Curr Pharm Biotechnol 9:315\u0026ndash;324\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang H, Jones B, Li Z, Frasse P, Delalande C, Regad F, Chaabouni S, Latch\u0026eacute; A, Pech JC, Bouzayen M (2005) The tomato Aux/IAA transcription factor IAA9 is involved in fruit development and leaf morphogenesis. Plant Cell 17:2676\u0026ndash;2692\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang L, Wang Z, Xu Y, Joo SH, Kim SK, Xue Z, Xu Z, Wang Z, Chong K (2009) OsGSR1 is involved in crosstalk between gibberellins and brassinosteroids in rice. Plant J 57:498\u0026ndash;510\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z, Wong DCJ, Wang Y, Xu G, Ren C, Liu Y, Kuang Y, Fan P, Li S, Xin H, Liang Z (2021) GRAS-domain transcription factor PAT1 regulates jasmonic acid biosynthesis in grape cold stress response. Plant Physiol 186:1660\u0026ndash;1678\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu G, Huang J, Lei SK, Sun XG, Li X (2019) Comparative gene expression profile analysis of ovules provides insights into \u003cem\u003eJatropha curcas\u003c/em\u003e L. ovule development. Sci Rep 9:15973\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu G, Huang J, Yang Y, Yao YA (2016) Transcriptome analysis of flower sex differentiation in \u003cem\u003eJatropha curcas\u003c/em\u003e L. using RNA sequencing. PLoS ONE 11:e0145613\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYadeta KA, Hanemian M, Smit P, Hiemstra JA, Pereira A, Marco Y, Thomma BP (2011) The \u003cem\u003eArabidopsis thaliana\u003c/em\u003e DNA-binding protein AHL19 mediates verticillium wilt resistance. Mol Plant Microbe Interact 24:1582\u0026ndash;1591\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYanagisawa S (2000) Dof1 and Dof2 transcription factors are associated with expression of multiple genes involved in carbon metabolism in maize. Plant J 21:281\u0026ndash;288\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang F, Fu X, Lv Z, Lu X, Shen Q, Zhang L, Zhu M, Wang G, Sun X, Liao Z, Tang K (2015) A basic leucine zipper transcription factor, AabZIP1, connects abscisic acid signaling with artemisinin biosynthesis in \u003cem\u003eArtemisia annua\u003c/em\u003e. Mol Plant 8:163\u0026ndash;175\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S, Wang X (2017) One new kind of phytohormonal signaling integrator: Up-and-coming GASA family genes. Plant Signal Behav 12:e1226453\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S, Yang C, Peng J, Sun S, Wang X (2009) \u003cem\u003eGASA5\u003c/em\u003e, a regulator of flowering time and stem growth in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e. Plant Mol Biol 69:745\u0026ndash;759\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang SC, Wang XJ (2008) Expression pattern of \u003cem\u003eGASA\u003c/em\u003e, downstream genes of DELLA, in \u003cem\u003eArabidopsis\u003c/em\u003e. Chin Sci Bull 53:3839\u0026ndash;3846\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhong C, Xu H, Ye S, Wang S, Li L, Zhang S, Wang X (2015) Gibberellic acid-stimulated Arabidopsis6 serves as an integrator of gibberellin, abscisic acid, and glucose signaling during seed germination in Arabidopsis. Plant Physiol 169:2288\u0026ndash;2303\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"GAST1, GA, MeJA, promoter, flower, Jatropha curcas","lastPublishedDoi":"10.21203/rs.3.rs-2303234/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2303234/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMembers of Gibberellic acid-stimulated Arabidopsis (GASA) gene family play roles in plant growth and development, particularly in flower induction and seed development. However, there is still relatively limited knowledge of GASA genes in \u003cem\u003eJatropha curcas\u003c/em\u003e. Herein, we identified a GASA family gene from\u003cem\u003e Jatropha curcas\u003c/em\u003e, namely \u003cem\u003eJcGAST1\u003c/em\u003e, which encodes a protein containing a conserved GASA domain. Sequence alignment showed that JcGASAT1 protein shares 76% sequence identity and 80% sequence similarity with SlGAST1. \u003cem\u003eJcGAST1\u003c/em\u003ehad higher expression and protein levels in the male flowers than in the female flowers. Overexpression of \u003cem\u003eJcGAST1\u003c/em\u003e in tobacco promotes plant growth but inhibits pistil development. \u003cem\u003eJcGAST1\u003c/em\u003e expression was upregulated by GA and downregulated by MeJA. Promoter analysis indicated that the pyrimidine box and CGTCA motif were the GA-and MeJA-responsive elements of the \u003cem\u003eJcGAST1 \u003c/em\u003epromoter. Using a Y1H screen, six transcription factors were found to interact with the pyrimidine box, and three transcription factors were found to interact with theCGTCA motif. Overall, the results of this study improve our understanding of the \u003cem\u003eJcGAST1\u003c/em\u003e gene and provide useful information for further studies.\u003c/p\u003e","manuscriptTitle":"Identification and promoter analysis of a GA-stimulated transcript 1 gene from Jatropha curcas","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-12-07 17:09:30","doi":"10.21203/rs.3.rs-2303234/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f225309f-93da-499b-a240-ec920de42af0","owner":[],"postedDate":"December 7th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2023-01-15T00:12:06+00:00","versionOfRecord":[],"versionCreatedAt":"2022-12-07 17:09:30","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-2303234","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2303234","identity":"rs-2303234","version":["v1"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.