Mechanistic insights into the activity of a plant-based compound against Alternaria solani

Mechanistic insights into the activity of a plant-based compound against Alternaria solani | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Mechanistic insights into the activity of a plant-based compound against Alternaria solani Farzaneh Lak, Azad Omrani, Mogens Nicolaisen, Jawameer Hama, Amir Mirzadi Gohari, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8194037/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Early blight, caused by the fungal pathogen Alternaria solani , is one of the most destructive diseases of tomato, resulting in severe yield losses worldwide. Here, we show that CC2020, a plant-based formulation enriched with savory essential oil, exhibits potent antifungal activity against A. solani through multiple complementary mechanisms. Under in vitro conditions, treatment with CC2020 at a concentration of 300 ppm effectively suppressed the effector gene expression AsCEP50 and downregulated the melanin-biosynthesis gene pks , both of which are essential determinants of fungal virulence. Furthermore, treatment markedly increased intracellular glutathione (GSH) levels, indicating activation of the fungi’s antioxidant defense machinery. Collectively, these findings demonstrate the high efficacy of CC2020 and establish it as a sustainable, eco-friendly, and potent bioformulation for early blight management. This work underscores the potential of plant-derived formulations as effective, sustainable, and environmentally responsible components of integrated disease management strategies in crops. Biological sciences/Biotechnology Biological sciences/Microbiology Biological sciences/Plant sciences Plant-based formulation fungal virulence effector gene pks gene oxidative stress Alternaria solani Figures Figure 1 Figure 2 Figure 3 Introduction Early blight, caused by the necrotrophic fungus A. solani , is one of the most destructive diseases affecting tomato crops worldwide, leading to significant yield losses and economic damage [ 1 , 2 ]. The pathogen induces characteristic necrotic lesions on leaves, stems, and fruits, ultimately impairing photosynthesis and reducing fruit quality. Conventional management relies heavily on synthetic fungicides; however, extensive use of these chemicals has raised concerns regarding environmental pollution, toxicity to non-target organisms, and the rapid emergence of fungicide-resistant strains [ 3 , 4 ]. These limitations highlight the urgent need for sustainable and eco-friendly alternatives for disease management. Recently, attention has shifted toward essential oils, bio-inoculants, and green-synthesized nanoparticles as promising approaches for controlling A. solani [ 1 , 4 , 5 ]. Among these, plant-based compounds, including essential oils and other bioactive phytochemicals, have attracted considerable interest due to their broad-spectrum antimicrobial activity and environmental compatibility [ 6 – 8 ]. Although these compounds have demonstrated antifungal activity in vitro and in plant, the precise molecular and biochemical mechanisms underlying their effects remain largely unresolved, representing a critical knowledge gap [ 9 ]. The biocompatible compound investigated in this study, CC2020, has undergone prior screening, including pathogenicity assays and morphological evaluations after application on A. solani , and was shown to reduce fungal virulence and induce stress-related responses under greenhouse and laboratory conditions (manuscript under review). Building on these findings, the present study aims to elucidate the molecular mechanisms of CC2020’s antifungal activity, focusing on the expression of key pathogenicity including AsCEP50 [ 10 ] and the polyketide synthase (pks) gene involved in melanin biosynthesis [ 11 ]. Understanding these mechanisms will provide novel insights into how plant-based compounds interfere with fungal pathogenicity and stress responses, highlighting their potential as effective biocontrol agents. To further investigate the mechanism of this compound, this study focuses on one of the most important cellular stress markers, glutathione (GSH). GSH, a tripeptide composed of glutamate, cysteine, and glycine, plays a central role in the antioxidant defense system of fungi by detoxifying reactive oxygen species (ROS) and maintaining redox balance, and it can therefore be considered a reliable indicator of cellular oxidative stress [ 12 ]. GSH also participates in signaling pathways that regulate the expression of defense-related genes. Alterations in glutathione levels have been linked to plant responses against necrotrophic pathogens such as Alternaria spp. [ 1 , 13 ]. Plant-based compounds, such as linalool and camphor, can induce oxidative stress in Alternaria species by disrupting redox homeostasis [ 1 , 14 ]. Therefore, monitoring GSH levels during A. solani infection after CC2020 treatment provides key insights into the molecular basis of fungal suppression and host defense [ 15 , 16 ]. By integrating molecular, biochemical, and pathogenicity assays, this study aims to elucidate the mode of action of CC2020, a plant-based formulation enriched with savory essential oil. We hypothesize that CC2020 suppresses key fungal virulence factors, including the effector gene expression AsCEP50 and the melanin biosynthesis gene pks , while modulating intracellular (GSH) levels to enhance antioxidant defenses. Understanding these mechanisms are crucial for optimizing the formulation, application, and efficacy of CC2020 as a sustainable, eco-friendly fungicide, providing an effective alternative to conventional chemical treatments and contributing to environmentally responsible disease management in tomato crops. Results Effect of CC2020 on effector gene expression ( AsCEP50 ) The effect of CC2020 on the effector gene expression AsCEP50 in A. solani was evaluated at 24, 48, and 72 hours post-treatment using qRT-PCR. Treatment with CC2020 caused a strong suppression of AsCEP50 expression at 24 hours compared with the untreated control, and the reduction was statistically significant. At 48 hours, expression remained suppressed and the difference was still statistically significant due to low variability among replicates. By 72 hours, expression showed a reduction compared with the control, but the difference was not statistically significant. These results indicate a time-dependent inhibitory effect of CC2020 on AsCEP50 , with the strongest suppression observed at early exposure. Fold Change dynamics are indicated in Fig. 1 . Early Enhancement of Antioxidant Capacity in A. solani by CC2020: GSH Accumulation The effects of CC2020 on glutathione (GSH) accumulation in A. solani cultures were evaluated at 24, 48, and 72 h post-treatment (Fig. 3 ). At 24 h, treated samples exhibited a significant increase in GSH content (~ 550 µg/g) compared with untreated controls (~ 140 µg/g), indicating early induction of the antioxidant system. A similar trend was observed at 48 h, with treated cultures maintaining elevated GSH levels (~ 270 µg/g) relative to controls (~ 140 µg/g), suggesting sustained activation of cellular thiol metabolism. By 72 h, GSH levels in treated samples (~ 540 µg/g) were comparable to those in untreated cultures (~ 580 µg/g), indicating convergence over time. Overall, these results demonstrate that CC2020 can transiently enhance GSH and boost antioxidant capacity during the initial stress response. Statistical analysis (denoted by different letters above bars) confirmed that differences between treated and control groups at 24 and 48 h were significant (p < 0.05), whereas no significant difference was observed at 72 h. These findings suggest that the effect of the treatment is most pronounced during early exposure, highlighting the potential of CC2020 to modulate oxidative stress-related pathways in A. solani . Discussion Although essential oils have been extensively studied against A alternata , investigations focusing on A. solani — particularly on host-pathogen interactions, oxidative stress responses, melanin biosynthesis, and ion leakage — remain limited [ 17 , 18 ]. The present study addresses this gap by examining these specific molecular and physiological pathways that underpin fungal pathogenicity and stress tolerance. Insights into how an eco-friendly, plant-based compound modulates these processes provide a mechanistic understanding of fungal inhibition and inform the development of more effective, targeted biocontrol strategies against A. solani in solanaceous crops such as tomato. This approach not only expands the range of antifungal mechanisms investigated but also emphasizes the importance of targeting key virulence factors and stress-response pathways critical for fungal survival and infection. To the best of our knowledge, this study provides one of the first applications of a mycelial-plug inoculation approach on detached tomato leaves to examine effector gene expression in A. solani under controlled laboratory conditions. This setup enabled precise monitoring of AsCEP50 expression during host-tissue colonization and its response to the plant-based compound CC2020. In parallel, pks expression—associated with melanin biosynthesis—was assessed using in vitro fungal cultures independently exposed to CC2020, allowing evaluation of melanin-related metabolic pathways without host tissue influence. CC2020 markedly suppressed AsCEP50 expression, suggesting interference with virulence-associated processes, and significantly reduced pks expression, indicating inhibition of melanin production. Together, these results reveal that CC2020 affects multiple pathogenicity-related pathways. Additionally, the combined use of detached-leaf inoculation and in vitro culture provides a flexible and reliable framework for studying gene-expression dynamics in necrotrophic fungi and supports future efforts toward plant-derived antifungal strategies. Recent studies have demonstrated the antifungal efficacy of Satureja hortensis essential oil against A. solani , the causative agent of early blight in tomato. In vitro assays revealed that concentrations as low as 140 µL/L significantly inhibited mycelial growth, with inhibition rates ranging from 77.6% to 88% across various isolates [ 19 ]. These findings are consistent with previous reports on its activity against A. citri [ 20 ]. The primary bioactive compounds identified, including carvacrol and thymol, are known to disrupt fungal cell membranes and induce oxidative stress [ 21 ]. Carvacrol, a major component of oregano essential oil, has been extensively studied for its antifungal properties. Recent research demonstrates that carvacrol exhibits potent inhibitory effects against A. solani , with a minimum inhibitory concentration of 50 µg/mL, comparable to the commercial fungicide chlorothalonil [ 21 ]. Mechanistically, carvacrol disrupts plasma membrane integrity, leading to cytoplasmic leakage and increased ion efflux, and induces intracellular oxidative stress, contributing to cellular damage and growth inhibition [ 20 ]. Similarly, studies on A. alternata have shown that carvacrol interferes with fungal metabolism and reduces mycotoxin production [ 22 ]. In our study, where CC2020 contains carvacrol among its principal components, treatment resulted in significant suppression of pks and AsCEP50 gene expression in A. solani , suggesting that impairment of virulence factors—underlie its antifungal activity in pathogenic contexts. These findings highlight the broad-spectrum potential of carvacrol-based treatments in managing early blight disease in tomatoes. The application of essential oils, such as those derived from Satureja (savory), has been shown to reduce mycelial growth of A. solani and decrease leaf spot diameter under greenhouse conditions. Both in vitro application into culture media and foliar spraying in the greenhouse were effective in disease control [ 19 ]. In addition, the effects of essential oils, including those from _Satureja hortensis, on _ Alternaria alternata infecting tomato were investigated [ 23 ]. Treatment with the essential oil induced morphological changes in the hyphal cell wall, reduced spore production, decreased mycelial growth, and effectively controlled disease under greenhouse conditions. Both incorporation into culture media and foliar spraying were compared with the fungicide combination metalaxyl + mancozeb. While the fungicide treatment reduced disease severity to 1.6 % (eaf-surface contamination), the S. hortensis essential oil treatment achieved a disease severity of 16.6 %. hese findings further support the potential of savory essential oil as a natural antifungal agent. One of the most common and potent antifungal mechanisms of essential oil components is disruption of the fungal plasma membrane. Compounds such as carvacrol and thymol interfere with ergosterol biosynthesis or disrupt the lipid bilayer, leading to leakage of ions and intracellular constituents (ATP, proteins) and ultimately to cell death or growth arrest. Laboratory studies have demonstrated reduced ergosterol content and release of cytoplasmic materials after exposure to essential oil constituents. This mechanism is also effective against several plant-pathogenic fungi including Alternaria and Botrytis species [ 21 , 24 ]. Several plant compounds increase the generation ROS in fungal cells, damaging membranes, nucleic acids, and proteins. Mitochondria are a key target of ROS, leading to impaired respiration, ATP depletion, and activation of cell-death pathways. This effect is particularly pronounced with volatile aldehydes such as cinnamaldehyde and citral [ 24 , 25 ], Similarly, in our experiment, a significant elevation in GSH levels was detected in A. solani cells exposed to CC2020, which reflects enhanced oxidative stress and supports the involvement of ROS-mediated damage in fungal inhibition. Recent experimental studies, including assays on A. alternata , reveal that essential oils of cinnamon, clove, eucalyptus, thyme, and oregano (rich in cinnamaldehyde, eugenol, carvacrol, or thymol) exhibit the strongest inhibitory effects. However, sensitivity varies among species and strains, and environmental factors such as temperature, water activity, and substrate composition markedly influence outcomes [ 24 , 26 ]. Essential oils compound can also inhibit drug efflux pumps, enhancing fungal susceptibility to conventional fungicides. Reports of synergistic effects between essential oils (or their major components) and azoles or strobilurins are increasing. To overcome limitations such as volatility, poor water solubility, and oxidative instability, strategies including nanoemulsions, encapsulation, vapor-phase applications, and active coatings have been developed, significantly improving efficacy and stability [ 24 , 25 ]. Many essential oils not only inhibit mycelial growth but also reduce spore germination and fungal reproduction. Some compounds interfere with biosynthetic pathways of mycotoxins (e.g., aflatoxins) or suppress the expression of related genes, resulting in toxin reduction even at subinhibitory concentrations. This mechanism is of particular importance for postharvest disease control and food safety [ 25 ], our previous work demonstrated that an essential-oil–based formulation from Satureja spp. markedly inhibited mycelial growth and sporulation of A. solani , accompanied by distinct structural deformations of the mycelium (manuscript under review). Previous studies have identified several effectors in A. solani that are expressed during the early stages of infection in Solanaceae plants and play key roles in pathogenicity. Notable examples include AsCEP19 and AsCEP20 , which facilitate infection prior to activation of host defense mechanisms [ 27 ], and AsCEP112 , which localizes to the host cell membrane and promotes leaf chlorosis [ 28 ]. Our findings indicate that CC2020 exerts a time-dependent inhibitory effect on the effector gene AsCEP50 in A. solani , which has been reported to contribute to early infection and disease development [ 10 ]. The strongest suppression was observed at 24 and 48 hours post-treatment, highlighting the compound’s capacity to interfere with fungal virulence during initial host colonization. Notably, while expression remained somewhat reduced at 72 hours, the difference was not statistically significant, suggesting partial recovery over time. These results support the notion that early disruption of effector expression may be a key mechanism by which CC2020 limits pathogen establishment. The transient nature of suppression at later time points also underscores the importance of timing in antifungal interventions and may reflect compensatory regulatory mechanisms within the fungus. Overall, targeting AsCEP50 early during infection could contribute substantially to the efficacy of CC2020 as a plant-protective agent [ 10 ]. These findings are consistent with previous work (manuscript under review), which reported that CC2020 effectively reduced A. solani pathogenicity in both in vitro and in vivo assays. Although A. solani is traditionally classified as a necrotrophic pathogen, the early expression of effectors such as AsCEP50 indicates that it may actively manipulate host physiology during initial infection. This observation raises the hypothesis that A. solani could exhibit a semi-biotrophic lifestyle, initially maintaining host cell viability to facilitate colonization before inducing necrosis. This possibility warrants further experimental investigation to elucidate the pathogen’s infection strategy and the timing of effector deployment. Treatment with CC2020 significantly reduced the expression of the polyketide synthase ( pks ) gene, which is responsible for melanin biosynthesis in A. solani . Melanin, synthesized via pks enzymes, is critical for fungal secondary metabolism, contributing to virulence and protection against environmental stresses. Downregulation of pks by CC2020 suggests interference with these pathways, potentially diminishing fungal pathogenicity. These results are consistent with previous reports highlighting the essential role of PKS -mediated melanin production in fungal development and virulence [ 29 ]. Furthermore, treatment with this compound was shown to reduce melanin content in A. solani , with a significant decrease confirmed through direct quantification (manuscript under review). Treatment with the plant-based compound led to a time-dependent increase in glutathione (GSH) levels in A. solani , with significant elevations observed at 24 and 48 hours post-treatment compared to controls. GSH, a central antioxidant, plays a key role in mitigating oxidative stress and maintaining cellular redox balance. The early accumulation of GSH suggests that the compound acts as a priming agent, triggering rapid defense responses in the fungus. These findings are consistent with recent studies in filamentous fungi and plants. For instance, previous studies [ 15 ] demonstrated that GSH biosynthesis is essential for oxidative stress resistance and pathogenicity in Fusarium graminearum , while upregulation of glutathione-related genes under oxidative stress has been reported in Talaromyces marneffei [ 30 ]. Similarly, an earlier report [ 31 ] showed that elevated GSH levels in plants prime early defense responses against parasitic cyst nematodes. Collectively, these observations indicate that the plant-derived compound induces a rapid oxidative stress response in A. solani , highlighting GSH as a reliable marker of early defense activation. According to our results, glutathione (GSH) levels in the control group were lower than in the treated group at 24 and 48 hours but increased significantly by 72 hours. This biphasic response indicates that at later stages, A. solani activated its intrinsic defense mechanisms, including GSH biosynthesis, are enhanced to maintain redox homeostasis and mitigate oxidative stress [ 32 ]. These findings highlight the inherent capacity of A. solani to activate protective responses independent of treatment. Such a pattern is consistent with transient chemically induced resistance, where early effects are most pronounced, but later stages are dominated by endogenous defense pathways [ 33 ]. Overall, these results indicate that the plant-based compound accelerated the onset of defense in A. solani during the initial stages, while at later time points, the pathogen’s own defense systems became more prominent. These findings highlight glutathione as a reliable marker of oxidative stress and early induced resistance, consistent with previous reports on glutathione-mediated defense responses [ 32 ]. Collectively, this study advances our understanding of A. solani pathogenicity by demonstrating that CC2020 can directly modulate key virulence-associated genes, including the effector AsCEP50 and the melanin-related pks gene. Notably, one of the strengths of this work lies in the targeted evaluation of virulence factors under controlled in vitro conditions, providing a mechanistic perspective that is rarely explored in early blight research. The temporal patterns observed in glutathione dynamics further suggest that CC2020 influences fungal stress responses alongside virulence regulation. These findings highlight the promise of plant-based formulations as environmentally sustainable antifungal strategies. Future work should aim to unravel the molecular pathways underlying these effects and assess their broader relevance across diverse fungal pathogens. Methods Plant, isolate materials The fungal isolate of A. solani was obtained from the Plant Diseases Department, National Research Institute of Iran. Detached leaves of tomato ( Solanum lycopersicum ) cultivar 4129, a widely cultivated greenhouse variety in Iran. This cultivar was obtained from Department of Greenhouse Research, Tehran Agricultural and Natural Resources Research and Training Center, Agricultural Research, Education and Extension Organization (AREEO), Tehran, Iran. Plants were maintained under controlled greenhouse conditions (25 ± 2°C, 16 h light/8 h dark photoperiod, 60–70% relative humidity) prior to sample collection. Detached tomato leaves were collected from greenhouse-grown plants. Sample preparation, including any sterilization or processing, was performed in the laboratory prior to experiments. Plant-based formulation The plant-based formulation CC2020 was derived from the essential oil of Satureja spp., previously identified as highly active against A. solani through comprehensive screening of various plant essential oils (manuscript under review). The chemical composition of CC2020 was characterized by GC–MS analysis in our previous study. In the present work, the pre-formulated CC2020 was used directly. Identity and composition of the formulation were confirmed according to the GC–MS data, and the formulation was used as received for all biological assays. Candidate genes selection and primers design The effector candidate gene AsPE50 and the melanin biosynthesis gene pks were selected based on their previously reported roles in fungal pathogenicity [ 10 , 34 ]. β-tubulin (TUB) was used as a reference gene for normalization of gene expression [ 35 ]. Gene sequences were retrieved from the NCBI GenBank database (accession numbers: AsCEP50 – OM735615.1, pks – AEH76763.1). Detailed functional annotations, including GO biological process terms, are provided in Supplementary Table S1.” Specific primers for AsPE50 , pks , and β-tubulin were designed using the Primer3Plus web interface ( https://www.primer3plus.com ) , which implements the Primer3 algorithm to optimize primer selection. Primer parameters, including melting temperature (Tm), GC content, and amplicon size, were set according to standard guidelines, targeting amplicons of 100–200 bp (Table 1 ). Primer specificity was confirmed via in silico PCR and BLAST analysis against the A. solani genome to avoid off-target amplification. Primers were synthesized by Eurofins Genomics (Ebersberg, Germany). Table 1 Primer sequences and amplicon information for target genes used in this study. This table lists the target genes, their biological functions, corresponding forward and reverse primer sequences (5′→3′), amplicon lengths, and literature references used for qRT-PCR analysis. Gene Purpose GO biological process description Forward primers (5′→3′) Reverse primer (3′→5′) Amplicon length References AsCEP50 Target Biological process (GO): pathogenesis (GO:0009405) CGGTACCACTGGAAACACCT AGAAAGAACCGCCAGAGTCA 100–120 ~ [ 10 ] pks Target Biological process (GO): polyketide biosynthetic process (GO:0030639), melanin biosynthetic process (GO:0042438) TCTGTCACGAATGCTTTTGC GGGACCTGTGTCGTTGAGAT 100–120 ~ [ 34 ] β-tubulin Normalization Biological process (GO): microtubule-based process (GO:0007017), cell division (GO:0051301) 100–120 ~ [ 35 ] Table 1 Primer sequences and relevant information for target genes used in this study. The table lists the target genes, corresponding forward and reverse primer sequences, amplicon sizes, and melting temperatures (Tm) used for qRT-PCR analyses. Gene Purpose GO biological process description Forward primers (5′→3′) Reverse primer (3′→5′) Amplicon length References AsCEP50 Target Biological process (GO): pathogenesis (GO:0009405) CGGTACCACTGGAAACACCT AGAAAGAACCGCCAGAGTCA 100–120 ~ Wang et al., 2023 pks Target Biological process (GO): polyketide biosynthetic process (GO:0030639), melanin biosynthetic process (GO:0042438) TCTGTCACGAATGCTTTTGC GGGACCTGTGTCGTTGAGAT 100–120 ~ Izumi et al., 2012 β-tubulin Normalization Biological process (GO): microtubule-based process (GO:0007017), cell division (GO:0051301) 100–120 ~ Teifoori et at., 2018 Treatment with plant-based compound for effector gene analysis Fungal isolates were identified based on morphological characteristics [ 36 ]. Mycelial plugs (5 mm) from actively growing cultures were inoculated onto detached leaves of tomato, following a modified procedure of [ 37 ]. Each treatment and control consisted of three biological replicates, with each biological replicate containing three technical replicates. Inoculated leaves were treated with the plant-based compound CC2020 at a sub-minimum inhibitory concentration (sub-MIC) of 300 ppm. This concentration was chosen based on preliminary screenings that determined the minimum inhibitory concentration (MIC) of CC2020 against A. solani . Using a sub-MIC allows the fungus to remain viable, enabling the assessment of stress responses and other sub-lethal effects induced by the treatment. Treatments were applied using 100 mL spray bottles (≈ 50 µL per puff, three puffs per leaf) to ensure uniform coverage. Petri dishes were incubated at 25°C in the dark, and samples were collected at 24, 48, and 72 h post-treatment for downstream analyses. Control leaves received sterile distilled water. Extraction of RNA and One-Step Quantitative PCR for effector gene analysis Leaf samples were ground in liquid nitrogen to ensure complete cell disruption. Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany; Cat. No. 74094) following the manufacturer’s instructions and treated with RNase-free DNase I (Qiagen, Hilden, Germany) to remove contaminating genomic DNA. RNA quantity and purity were assessed spectrophotometrically using a NanoDrop ND-1000 (Thermo Scientific, Wilmington, DE, USA). Concentrations were calculated directly by the instrument based on absorbance at 260 nm, and an A260/280 ratio of 1.8–2.0 indicated acceptable purity. Gene expression analysis was performed using a one-step SYBR Green qRT-PCR kit (qPCRBIO SyGreen 1-step Detect Lo-ROX; Batch No. 190F325K07), allowing reverse transcription and PCR amplification in a single reaction. Each 12 µL reaction contained 2 ng of RNA template and 0.8 µL of each primer, with the remaining volume adjusted with nuclease-free water. Assays were performed in triplicate using an Applied Biosystems StepOnePlus under the manufacturer’s cycling conditions: 50°C for 2 min, 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 59.5°C for 60 s. Fluorescence signals were recorded at each cycle and analyzed using QuantStudio software. Relative gene expression was determined using the 2 −ΔΔCt method [ 38 ]. Each treatment was analyzed once, with three technical replicates per sample to ensure reproducibility. Fold changes (FCs) were calculated relative to the control. Treatment with plant-based compound for pks gene analysis Potato Dextrose Agar (PDA) medium was supplemented with the plant-based compound at a final concentration of 300 ppm and poured into Petri dishes. A 5 mm agar plug of A. solani was placed onto the surface of the solidified medium, and cultures were incubated at 25°C for fungal growth. After 7 days, fungal mycelia were harvested, frozen in liquid nitrogen, and processed for RNA extraction and subsequent gene expression analysis [ 39 ]. Each treatment was analyzed once, with three technical replicates per sample to ensure reproducibility. Extraction of RNA and One-Step Quantitative PCR for pks gene Fungal mycelia from treated and untreated PDA cultures were harvested, immediately frozen in liquid nitrogen, and ground to a fine powder. Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen) with on-column DNase I treatment. RNA purity and concentration were assessed using a NanoDrop spectrophotometer (A260/280 = 1.8–2.0). Gene expression of pks was quantified using a one-step SYBR Green qRT-PCR kit (qPCRBIO SyGreen 1-step Detect Lo-ROX). Each 12 µL reaction contained 2 ng RNA template and 0.8 µL of each primer. Reactions were run in triplicate on an Applied Biosystems StepOnePlus under the manufacturer’s cycling conditions: 50°C for 2 min, 95°C for 2 min, followed by 40 cycles of 95°C for 15 s and 59.5°C for 60 s. Relative expression was calculated using the 2 − ΔΔCt method, with untreated samples normalized to 1. Three technical replicates per treatment ensured reproducibility Preparation of samples for glutathione quantification A. solani was cultured on potato dextrose agar (PDA) plates and incubated at 25°C until sufficient mycelial biomass was observed (typically 4–5 days). Selected plant-based compounds were applied to the surface of the culture plates using a sterile spray, and plates were incubated further. Mycelia were harvested at 24, 48, and 72 h post-treatment by carefully scraping from the agar surface with a sterile scalpel. To minimize contamination from the medium, harvested biomass was gently rinsed with cold sterile distilled water. The washed mycelial biomass was immediately frozen in liquid nitrogen and ground into a fine powder using a pre-chilled mortar and pestle. The powder was stored at − 75°C until extraction. Approximately 30–50 mg of frozen fungal powder was transferred into 1.5–2 mL Eppendorf tubes, and extraction solvent of 1 mL of 80% methanol was added. The mixture was sonicated for 45 min, vortexed for 1 min, and centrifuged at 4,500 × g for 10 min. The supernatant was collected into a new tube. The extraction procedure was repeated on the remaining pellet with 1 mL of the same solvent, and both supernatants were combined, diluted 1:1 with Milli-Q water, and filtered through a 0.22 µm PTFE syringe filter into HPLC vials. Extracts were stored at − 20°C until Liquid Chromatography–Tandem Mass Spectrometry (LC–MS/MS) analysis[ 40 ]. Quantification of glutathione content by LC–MS/MS Glutathione (GSH) quantification was performed using a triple quadrupole mass spectrometer (e.g., AB Sciex QTRAP 5500) coupled to a HPLC system (Agilent 1260 Infinity II) [ 41 ], with minor modifications. Separation was achieved on Synergi Fusion-RP C18, 80A column (250 mm × 2 mm i.d., 4 µm, Phenomenex) at 35°C, using a mobile phase of solvent A (100% MilliQ) and solvent B (100% Methanol) at 0.3 mL min⁻¹. The elution gradient was set as follows: 5 min, 50% B; 5–12 min, 100% B; 12–14 min, 100% B; 15-14.5 min 0% B followed by re-equilibration for 10 min. GSH was detected in negative electrospray ionization (ESI⁺) mode using multiple reaction monitoring (MRM) with a precursor-to-product ion transition of Q1 m/z 305.9 → 142.8, Q3 m/z 305.9 → 271. Quantification was based on external calibration curves constructed from GSH standards. All experiments were performed in triplicate, and results were normalized to sample dry weight. To prevent oxidation and degradation, all procedures were conducted under cold and dark conditions, and pre-cooled glassware and plasticware were used throughout. Statistical analysis Fold changes in gene expression and glutathione levels were calculated relative to the untreated control. Relative gene expression data for pks were analyzed using one-way ANOVA with Group (treated vs. untreated) as a fixed factor. Relative gene expression data for AsCEP50 were analyzed using two-way ANOVA with Group (treated vs. untreated) and Time (24, 48, 72 h) as fixed factors, followed by Tukey’s HSD post-hoc test to identify significant differences between groups. Glutathione levels were analyzed using two-way ANOVA with Group (treated vs. untreated) and Time (24, 48, 72 h) as fixed factors, followed by Duncan’s multiple range test for post-hoc comparisons. All statistical analyses were performed using SAS software, and differences were considered significant at p < 0.05. Declarations Author contributions Farzaneh Lak: Conducted all laboratory and greenhouse experiments, designed the study, analyzed the data, and prepared the initial draft of the manuscript. Azad Omrani: Provided some laboratory facilities, prepared materials, formulated the plant-based compounds, assisted in interpreting the results Mongens Nicolaisen: Provided laboratory resources, and technical guidance that facilitated the experiments Jawameer Hama: Contributed to the analysis and interpretation of glutathione-related data. Amir Mirzadi Gohari: Provided critical revisions and contributed to the final manuscript editing Masoud Ahmadzadeh: Supervised parts of the project and served as the corresponding author Funding declaration The authors declare that no funds, grants, or other support were received during the preparation of this manuscript. Data availability statement The datasets generated during the current study are available from the corresponding author upon reasonable request. No separate supplementary files were prepared for this submission. Competing interests The authors have no relevant financial or non-financial interests to disclose. References Singh, D. P. et al. Metabolomics of early blight (Alternaria solani) susceptible tomato ( Solanum lycopersicum ) unfolds key biomarker metabolites and involved metabolic pathways. Sci. Rep. 13 , 21023 (2023). El-Nagar, A., Elzaawely, A. A., Taha, N. A. & Nehela, Y. The antifungal activity of gallic acid and its derivatives against Alternaria solani , the causal agent of tomato early blight. Agronomy 10 , 1402 (2020). Gikas, G. D., Parlakidis, P., Mavropoulos, T. & Vryzas, Z. Particularities of fungicides and factors affecting their fate and removal efficacy: A review. Sustainability 14 , 4056 (2022). Philip, B. et al. Trichoderma afroharzianum TRI07 metabolites inhibit Alternaria alternata growth and induce tomato defense-related enzymes. Sci. Rep. 14 , 1874 (2024). Hyder, S. et al. Use of ginger extract and bacterial inoculants for the suppression of Alternaria solani causing early blight disease in Tomato. BMC Plant. Biol. 24 , 131 (2024). Deresa, E. M. & Diriba, T. F. Phytochemicals as alternative fungicides for controlling plant diseases: A comprehensive review of their efficacy, commercial representatives, advantages, challenges for adoption, and possible solutions. Heliyon 9 , (2023). Rasheed, H. A. et al. A comprehensive insight into plant-derived extracts/bioactives: Exploring their antimicrobial mechanisms and potential for high-performance food applications. Food Biosci. 59 , 104035 (2024). Al-Otibi, F., Alshahrani, R. A., Alharbi, R. I. & Yassin, M. T. Phytochemical analysis and antifungal efficiency of Origanum majorana extracts against some phytopathogenic fungi causing tomato damping-off diseases. Open. Chem. 21 , 20230181 (2023). McMaster, C. A., Plummer, K. M., Porter, I. J. & Donald, E. C. Antimicrobial activity of essential oils and pure oil compounds against soilborne pathogens of vegetables. Australas. Plant Pathol. 42 , 385–392 (2013). Wang, C. et al. Identification and functional analysis of protein secreted by Alternaria solani . PLoS One . 18 , e0281530–e0281530 (2023). Woo, P. C. Y. et al. High diversity of polyketide synthase genes and the melanin biosynthesis gene cluster in Penicillium marneffei . FEBS J. 277 , 3750–3758 (2010). Noctor, G., Mhamdi, A. & Foyer, C. H. The roles of reactive oxygen metabolism in drought: not so cut and dried. Plant. Physiol. 164 , 1636–1648 (2014). Datta, R., Mandal, K., Boro, P., Sultana, A. & Chattopadhyay, S. Glutathione imparts stress tolerance against Alternaria brassicicola infection via miRNA mediated gene regulation. Plant. Signal. Behav. 17 , 2047352 (2022). Zhang, H. et al. The role of linalool in managing Alternaria alternata infection and delaying black mold rot in goji berry. Postharvest Biol. Technol. 219 , 113240 (2025). Park, J. et al. Sulfur metabolism-mediated fungal glutathione biosynthesis is essential for oxidative stress resistance and pathogenicity in the plant pathogenic fungus Fusarium graminearum. mBio 15, e02401-23 (2024). Zhang, H. et al. Glutathione peroxidase LtGPX3 contributes to oxidative stress tolerance, virulence, and plant defense suppression in the peach gummosis fungus Lasiodiplodia theobromae. Phytopathol. Res. 6 , 6 (2024). Ragupathi, K. P., Renganayaki, P. R., Sundareswaran, S., Kumar, S. M. & Kamalakannan, A. Evaluation of essential oils against early blight ( Alternaria solani ) of tomato. Int. Res. J. Pure Appl. Chem. 21 , 164–169 (2020). Bahraminejad, S., Seifolahpour, B. & Amiri, R. Antifungal effects of some medicinal and aromatic plant essential oils against Alternaria solani . J. Crop Prot. 5 , 603–616 (2016). Omar, M. S. & Kordalı, Ş. Exploring the Antifungal Efficacy of Essential Oils against Alternaria solani , the Causative Pathogen of Early Leaf Blight in Tomato Plants. Erciyes Tarım ve Hayvan Bilimleri Dergisi 7 , 12–23 . Li, H. et al. Carvacrol treatment reduces decay and maintains the postharvest quality of red grape fruits (Vitis vinifera L.) inoculated with Alternaria alternata . Foods 12 , 4305 (2023). Mączka, W., Twardawska, M., Grabarczyk, M. & Wińska, K. Carvacrol—A natural phenolic compound with antimicrobial properties. Antibiotics 12 , 824 (2023). Wang, J. et al. Inhibitory effect and mechanism of carvacrol against black mold disease agent Alternaria alternata in Goji Berries. J. Fungi . 10 , 402 (2024). Babagoli, M. A. & BEHDAD, E. Effects of three essential oils on the growth of the fungus Alternaria solani . (2012). Silva-Beltran, N. P., Boon, S. A., Ijaz, M. K., McKinney, J. & Gerba, C. P. Antifungal activity and mechanism of action of natural product derivates as potential environmental disinfectants. J. Ind. Microbiol. Biotechnol. 50 , kuad036–kuad036 (2023). Tian, F. et al. Antifungal activity of essential oil and plant-derived natural compounds against Aspergillus flavus. Antibiotics 11 , 1727 (2022). Allagui, M. B., Moumni, M. & Romanazzi, G. Antifungal activity of thirty essential oils to control pathogenic fungi of postharvest decay. Antibiotics 13 , 28 (2023). Xiao, S. et al. Alternaria solani effectors AsCEP19 and AsCEP20 reveal novel functions in pathogenicity and conidiogenesis. Microbiol. Spectr. 12 , e04214–e04223 (2024). Wang, C. et al. Identification of effector CEP112 that promotes the infection of necrotrophic Alternaria solani. BMC Plant. Biol. 22 , 466 (2022). Li, R. et al. Melanin synthesis gene Aapks contributes to appressorium formation, stress response, cell well integrity and virulence in Alternaria alternata . Postharvest Biol. Technol. 198 , 112247 (2023). Wangsanut, T., Sukantamala, P. & Pongpom, M. Identification of glutathione metabolic genes from a dimorphic fungus Talaromyces marneffei and their gene expression patterns under different environmental conditions. Sci. Rep. 13 , 13888 (2023). Hasan, M. S. et al. Glutathione contributes to plant defence against parasitic cyst nematodes. Mol. Plant. Pathol. 23 , 1048–1059 (2022). do Carmo Santos, M. L. et al. The family of glutathione peroxidase proteins and their role against biotic stress in plants: a systematic review. Front. Plant. Sci. 16 , 1425880 (2025). Kranner, I. Determination of glutathione, glutathione disulphide and two related enzymes, glutathione reductase and glucose-6-phosphate dehydrogenase, in fungal and plant cells. in Mycorrhiza manual 227–241 (Springer, (1998). Izumi, Y. et al. A polyketide synthase gene, ACRTS2, is responsible for biosynthesis of host-selective ACR-toxin in the rough lemon pathotype of Alternaria alternata. Mol. Plant Microbe Interact. 25 , 1419–1429 (2012). Teifoori, F., Shams-Ghahfarokhi, M., Razzaghi-Abyaneh, M. & Martinez, J. Gene profiling and expression of major allergen Alt a 1 in Alternaria alternata and related members of the Pleosporaceae family. Rev. Iberoam Micol . 36 , 66–71 (2019). Simmons, E. G. Alternaria an identification manual, fully illustrated and with catalogue raisonné 1796–2007. (No Title) (2007). Dučkena, L. & Bimšteine, G. Morphological characteristics and pathogenicity of Alternaria and Stemphylium isolates on tomato in vitro. in XXXI International Horticultural Congress (IHC2022): International Symposium on Sustainable Control of Pests and Diseases 1378 325–332 (2022). Pfaffl, M. W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 29 , e45–e45 (2001). Fernandes, C. et al. Activation of melanin synthesis in Alternaria infectoria by antifungal drugs. Antimicrob. Agents Chemother. 60 , 1646–1655 (2016). Hama, J. R., Fomsgaard, I. S., Topalović, O. & Vestergård, M. Root uptake of cereal benzoxazinoids grants resistance to root-knot nematode invasion in white clover. Plant Physiol. Biochem. 210 , 108636 (2024). Chwatko, G. et al. Determination of cysteine and glutathione in cucumber leaves by HPLC with UV detection. Anal. Methods . 6 , 8039–8044 (2014). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8194037","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":563574879,"identity":"af1748db-2010-4dd1-8595-74cbef06d8db","order_by":0,"name":"Farzaneh Lak","email":"","orcid":"","institution":"University of Tehran","correspondingAuthor":false,"prefix":"","firstName":"Farzaneh","middleName":"","lastName":"Lak","suffix":""},{"id":563574881,"identity":"afd4ce4e-c2d6-46b8-9df2-a1cd6489c97b","order_by":1,"name":"Azad Omrani","email":"","orcid":"","institution":"Middle East Fruit Science Company","correspondingAuthor":false,"prefix":"","firstName":"Azad","middleName":"","lastName":"Omrani","suffix":""},{"id":563574882,"identity":"cab264c1-9686-454b-a927-b13a0caef0a3","order_by":2,"name":"Mogens Nicolaisen","email":"","orcid":"","institution":"Aarhus University","correspondingAuthor":false,"prefix":"","firstName":"Mogens","middleName":"","lastName":"Nicolaisen","suffix":""},{"id":563574883,"identity":"bb4d971b-1238-46fc-8c47-0e7ab32babf6","order_by":3,"name":"Jawameer Hama","email":"","orcid":"","institution":"Aarhus University","correspondingAuthor":false,"prefix":"","firstName":"Jawameer","middleName":"","lastName":"Hama","suffix":""},{"id":563574887,"identity":"d5e46b42-07f6-44d2-86d9-1df989595df1","order_by":4,"name":"Amir Mirzadi Gohari","email":"","orcid":"","institution":"University of Tehran","correspondingAuthor":false,"prefix":"","firstName":"Amir","middleName":"Mirzadi","lastName":"Gohari","suffix":""},{"id":563574889,"identity":"9a0bbee3-1d02-43ce-83fc-4940459e6c7a","order_by":5,"name":"Masoud Ahmadzadeh","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAArElEQVRIiWNgGAWjYDACCSDmYbCB8gyI15IGxCRqOQzVQgzgn92d+OHNn/OJ+xmYH35gKLhHhCV3zm6WnMNzO7GHgc1YgsGgmAhrbuRukOaRAGlhMAP6JYGwDvkbuZt/8xicA2ph/0acFoMbudukeRIOALXwEGmLIVCL5ZwDycY9h3mKJRKI0SIHdNiNN3/sZNvb2zd++PCHCC0IwAzEJGkYBaNgFIyCUYAbAAAooDSGc7Tn8wAAAABJRU5ErkJggg==","orcid":"","institution":"University of Tehran","correspondingAuthor":true,"prefix":"","firstName":"Masoud","middleName":"","lastName":"Ahmadzadeh","suffix":""}],"badges":[],"createdAt":"2025-11-24 13:38:22","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8194037/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8194037/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":99307381,"identity":"0a469bb2-b6a0-4c06-b67e-50aabdcaab49","added_by":"auto","created_at":"2025-12-31 16:06:07","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":283926,"visible":true,"origin":"","legend":"","description":"","filename":"Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-8194037/v1/c886dd86492b3a0efa69b32a.docx"},{"id":98817899,"identity":"a9930b6e-0a16-45bb-8e46-2e5368f5bdbc","added_by":"auto","created_at":"2025-12-22 16:47:35","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":7473,"visible":true,"origin":"","legend":"","description":"","filename":"f4a3442a3cee4906860a5d7c459f57f7.json","url":"https://assets-eu.researchsquare.com/files/rs-8194037/v1/b05fd371e5c40a3fc6f73d43.json"},{"id":98817903,"identity":"d4281a23-48f7-49f4-9f6b-339c0ca7208d","added_by":"auto","created_at":"2025-12-22 16:47:35","extension":"xml","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":113268,"visible":true,"origin":"","legend":"","description":"","filename":"f4a3442a3cee4906860a5d7c459f57f71enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8194037/v1/2caa283645d36f93f3ad5fab.xml"},{"id":98817900,"identity":"88b43051-1a54-44c8-aba2-582672018688","added_by":"auto","created_at":"2025-12-22 16:47:35","extension":"xml","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":111274,"visible":true,"origin":"","legend":"","description":"","filename":"f4a3442a3cee4906860a5d7c459f57f71structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8194037/v1/b7f4120566e4b9ef798086f8.xml"},{"id":98817904,"identity":"34fc3afa-6896-4b7f-9e4e-38f088f807ce","added_by":"auto","created_at":"2025-12-22 16:47:35","extension":"html","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":126704,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8194037/v1/70d2c4f13e13565b65768ba6.html"},{"id":98817897,"identity":"0e5c01f5-6a2b-4d67-9e7a-6b3dfbebf37f","added_by":"auto","created_at":"2025-12-22 16:47:35","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":30459,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of CC2020 on \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAsCEP50\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e gene expression in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e. \u003c/strong\u003eRelative expression levels at 24, 48, and 72 h post-treatment are shown as mean ± SD (n = 3). At 24 h, \u003cem\u003eAsCEP50\u003c/em\u003eexpression was markedly reduced in all treatment groups (Fold Change: Treatment 1 = 0.059–0.082; Treatment 2 = 0.406–0.486; Treatment 3 = 0.284–0.721), and all reductions were statistically significant. At 48 h, expression remained below the control and reductions were still significant. By 72 h, expression partially recovered (Fold Change = 0.059–0.721), and differences from the untreated control were no longer significant. Asterisks (*) indicate significant differences from the control (p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8194037/v1/455edd30c4651c8d77f5293e.png"},{"id":99307164,"identity":"1e17685e-9193-4023-9c93-8ff4178b049a","added_by":"auto","created_at":"2025-12-31 16:05:44","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":26290,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of CC2020 on \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003epks\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e gene expression in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAlternaria solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003eRelative \u003cem\u003epks\u003c/em\u003e expression in treated and untreated samples is shown as mean ± SD (n = 3). CC2020 strongly suppressed \u003cem\u003epks \u003c/em\u003eexpression, with a marked reduction in fold change (≈ 0.045) compared with the untreated control. Error bars represent standard deviations, indicating low variability among replicates. An asterisk (*) denotes statistically significant differences compared with the untreated control (p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8194037/v1/d9850e89f412f47a175934e2.png"},{"id":98817902,"identity":"9a52545a-ada3-4bf6-86fe-0e6bfcfcfb81","added_by":"auto","created_at":"2025-12-22 16:47:35","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":28893,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of CC2020 on glutathione levels in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eA. solani\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e.\u003c/strong\u003e Fungal mycelia were exposed to CC2020, and glutathione levels were measured at 24, 48, and 72 h. Mean values (± SD, n = 3) are shown for treated and control groups. CC2020 induced an early increase in glutathione at 24 h, followed by a reduction at 48 h and a rebound at 72 h, while the control group showed lower initial values and a delayed rise. Error bars represent standard deviations. Different letters indicate statistically significant differences between treatments at each time point, according to Duncan’s multiple range test (p \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8194037/v1/ce3fdd234bd2ff622ba95aef.png"},{"id":105035923,"identity":"21f8ab04-a8e6-4920-8cb7-71cb4acd48e1","added_by":"auto","created_at":"2026-03-20 07:26:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1153579,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8194037/v1/d369205d-d540-4314-9fe2-e31a4e91d757.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mechanistic insights into the activity of a plant-based compound against Alternaria solani","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEarly blight, caused by the necrotrophic fungus \u003cem\u003eA. solani\u003c/em\u003e, is one of the most destructive diseases affecting tomato crops worldwide, leading to significant yield losses and economic damage [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The pathogen induces characteristic necrotic lesions on leaves, stems, and fruits, ultimately impairing photosynthesis and reducing fruit quality. Conventional management relies heavily on synthetic fungicides; however, extensive use of these chemicals has raised concerns regarding environmental pollution, toxicity to non-target organisms, and the rapid emergence of fungicide-resistant strains [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. These limitations highlight the urgent need for sustainable and eco-friendly alternatives for disease management.\u003c/p\u003e \u003cp\u003eRecently, attention has shifted toward essential oils, bio-inoculants, and green-synthesized nanoparticles as promising approaches for controlling \u003cem\u003eA. solani\u003c/em\u003e [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Among these, plant-based compounds, including essential oils and other bioactive phytochemicals, have attracted considerable interest due to their broad-spectrum antimicrobial activity and environmental compatibility [\u003cspan additionalcitationids=\"CR7\" citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Although these compounds have demonstrated antifungal activity in vitro and in plant, the precise molecular and biochemical mechanisms underlying their effects remain largely unresolved, representing a critical knowledge gap [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe biocompatible compound investigated in this study, CC2020, has undergone prior screening, including pathogenicity assays and morphological evaluations after application on \u003cem\u003eA. solani\u003c/em\u003e, and was shown to reduce fungal virulence and induce stress-related responses under greenhouse and laboratory conditions (manuscript under review). Building on these findings, the present study aims to elucidate the molecular mechanisms of CC2020\u0026rsquo;s antifungal activity, focusing on the expression of key pathogenicity including \u003cem\u003eAsCEP50\u003c/em\u003e [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e] and the polyketide synthase (pks) gene involved in melanin biosynthesis [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Understanding these mechanisms will provide novel insights into how plant-based compounds interfere with fungal pathogenicity and stress responses, highlighting their potential as effective biocontrol agents.\u003c/p\u003e \u003cp\u003eTo further investigate the mechanism of this compound, this study focuses on one of the most important cellular stress markers, glutathione (GSH). GSH, a tripeptide composed of glutamate, cysteine, and glycine, plays a central role in the antioxidant defense system of fungi by detoxifying reactive oxygen species (ROS) and maintaining redox balance, and it can therefore be considered a reliable indicator of cellular oxidative stress [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. GSH also participates in signaling pathways that regulate the expression of defense-related genes. Alterations in glutathione levels have been linked to plant responses against necrotrophic pathogens such as \u003cem\u003eAlternaria\u003c/em\u003e spp. [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Plant-based compounds, such as linalool and camphor, can induce oxidative stress in \u003cem\u003eAlternaria\u003c/em\u003e species by disrupting redox homeostasis [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Therefore, monitoring GSH levels during \u003cem\u003eA. solani\u003c/em\u003e infection after CC2020 treatment provides key insights into the molecular basis of fungal suppression and host defense [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBy integrating molecular, biochemical, and pathogenicity assays, this study aims to elucidate the mode of action of CC2020, a plant-based formulation enriched with savory essential oil. We hypothesize that CC2020 suppresses key fungal virulence factors, including the effector gene expression \u003cem\u003eAsCEP50\u003c/em\u003e and the melanin biosynthesis gene \u003cem\u003epks\u003c/em\u003e, while modulating intracellular (GSH) levels to enhance antioxidant defenses. Understanding these mechanisms are crucial for optimizing the formulation, application, and efficacy of CC2020 as a sustainable, eco-friendly fungicide, providing an effective alternative to conventional chemical treatments and contributing to environmentally responsible disease management in tomato crops.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eEffect of CC2020 on effector gene expression (\u003c/b\u003e \u003cb\u003eAsCEP50\u003c/b\u003e \u003cb\u003e)\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe effect of CC2020 on the effector gene expression \u003cem\u003eAsCEP50\u003c/em\u003e in \u003cem\u003eA. solani\u003c/em\u003e was evaluated at 24, 48, and 72 hours post-treatment using qRT-PCR. Treatment with CC2020 caused a strong suppression of \u003cem\u003eAsCEP50\u003c/em\u003e expression at 24 hours compared with the untreated control, and the reduction was statistically significant. At 48 hours, expression remained suppressed and the difference was still statistically significant due to low variability among replicates. By 72 hours, expression showed a reduction compared with the control, but the difference was not statistically significant. These results indicate a time-dependent inhibitory effect of CC2020 on \u003cem\u003eAsCEP50\u003c/em\u003e, with the strongest suppression observed at early exposure. Fold Change dynamics are indicated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eEarly Enhancement of Antioxidant Capacity in\u003c/b\u003e \u003cb\u003eA. solani\u003c/b\u003e \u003cb\u003eby CC2020: GSH Accumulation\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe effects of CC2020 on glutathione (GSH) accumulation in \u003cem\u003eA. solani\u003c/em\u003e cultures were evaluated at 24, 48, and 72 h post-treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). At 24 h, treated samples exhibited a significant increase in GSH content (~\u0026thinsp;550 \u0026micro;g/g) compared with untreated controls (~\u0026thinsp;140 \u0026micro;g/g), indicating early induction of the antioxidant system. A similar trend was observed at 48 h, with treated cultures maintaining elevated GSH levels (~\u0026thinsp;270 \u0026micro;g/g) relative to controls (~\u0026thinsp;140 \u0026micro;g/g), suggesting sustained activation of cellular thiol metabolism. By 72 h, GSH levels in treated samples (~\u0026thinsp;540 \u0026micro;g/g) were comparable to those in untreated cultures (~\u0026thinsp;580 \u0026micro;g/g), indicating convergence over time. Overall, these results demonstrate that CC2020 can transiently enhance GSH and boost antioxidant capacity during the initial stress response. Statistical analysis (denoted by different letters above bars) confirmed that differences between treated and control groups at 24 and 48 h were significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), whereas no significant difference was observed at 72 h. These findings suggest that the effect of the treatment is most pronounced during early exposure, highlighting the potential of CC2020 to modulate oxidative stress-related pathways in \u003cem\u003eA. solani\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eAlthough essential oils have been extensively studied against \u003cem\u003eA alternata\u003c/em\u003e, investigations focusing on \u003cem\u003eA. solani\u003c/em\u003e \u0026mdash; particularly on host-pathogen interactions, oxidative stress responses, melanin biosynthesis, and ion leakage \u0026mdash; remain limited [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The present study addresses this gap by examining these specific molecular and physiological pathways that underpin fungal pathogenicity and stress tolerance. Insights into how an eco-friendly, plant-based compound modulates these processes provide a mechanistic understanding of fungal inhibition and inform the development of more effective, targeted biocontrol strategies against \u003cem\u003eA. solani\u003c/em\u003e in solanaceous crops such as tomato. This approach not only expands the range of antifungal mechanisms investigated but also emphasizes the importance of targeting key virulence factors and stress-response pathways critical for fungal survival and infection.\u003c/p\u003e \u003cp\u003eTo the best of our knowledge, this study provides one of the first applications of a mycelial-plug inoculation approach on detached tomato leaves to examine effector gene expression in \u003cem\u003eA. solani\u003c/em\u003e under controlled laboratory conditions. This setup enabled precise monitoring of \u003cem\u003eAsCEP50\u003c/em\u003e expression during host-tissue colonization and its response to the plant-based compound CC2020. In parallel, \u003cem\u003epks\u003c/em\u003e expression\u0026mdash;associated with melanin biosynthesis\u0026mdash;was assessed using in vitro fungal cultures independently exposed to CC2020, allowing evaluation of melanin-related metabolic pathways without host tissue influence. CC2020 markedly suppressed \u003cem\u003eAsCEP50\u003c/em\u003e expression, suggesting interference with virulence-associated processes, and significantly reduced \u003cem\u003epks\u003c/em\u003e expression, indicating inhibition of melanin production. Together, these results reveal that CC2020 affects multiple pathogenicity-related pathways. Additionally, the combined use of detached-leaf inoculation and in vitro culture provides a flexible and reliable framework for studying gene-expression dynamics in necrotrophic fungi and supports future efforts toward plant-derived antifungal strategies.\u003c/p\u003e \u003cp\u003eRecent studies have demonstrated the antifungal efficacy of \u003cem\u003eSatureja hortensis\u003c/em\u003e essential oil against \u003cem\u003eA. solani\u003c/em\u003e, the causative agent of early blight in tomato. In vitro assays revealed that concentrations as low as 140 \u0026micro;L/L significantly inhibited mycelial growth, with inhibition rates ranging from 77.6% to 88% across various isolates [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. These findings are consistent with previous reports on its activity against \u003cem\u003eA. citri\u003c/em\u003e [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The primary bioactive compounds identified, including carvacrol and thymol, are known to disrupt fungal cell membranes and induce oxidative stress [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCarvacrol, a major component of oregano essential oil, has been extensively studied for its antifungal properties. Recent research demonstrates that carvacrol exhibits potent inhibitory effects against \u003cem\u003eA. solani\u003c/em\u003e, with a minimum inhibitory concentration of 50 \u0026micro;g/mL, comparable to the commercial fungicide chlorothalonil [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Mechanistically, carvacrol disrupts plasma membrane integrity, leading to cytoplasmic leakage and increased ion efflux, and induces intracellular oxidative stress, contributing to cellular damage and growth inhibition [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Similarly, studies on \u003cem\u003eA. alternata\u003c/em\u003e have shown that carvacrol interferes with fungal metabolism and reduces mycotoxin production [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In our study, where CC2020 contains carvacrol among its principal components, treatment resulted in significant suppression of \u003cem\u003epks\u003c/em\u003e and \u003cem\u003eAsCEP50\u003c/em\u003e gene expression in \u003cem\u003eA. solani\u003c/em\u003e, suggesting that impairment of virulence factors\u0026mdash;underlie its antifungal activity in pathogenic contexts. These findings highlight the broad-spectrum potential of carvacrol-based treatments in managing early blight disease in tomatoes.\u003c/p\u003e \u003cp\u003eThe application of essential oils, such as those derived from \u003cem\u003eSatureja\u003c/em\u003e (savory), has been shown to reduce mycelial growth of \u003cem\u003eA. solani\u003c/em\u003e and decrease leaf spot diameter under greenhouse conditions. Both in vitro application into culture media and foliar spraying in the greenhouse were effective in disease control [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn addition, the effects of essential oils, including those from _Satureja hortensis, on _\u003cem\u003eAlternaria alternata\u003c/em\u003e infecting tomato were investigated [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Treatment with the essential oil induced morphological changes in the hyphal cell wall, reduced spore production, decreased mycelial growth, and effectively controlled disease under greenhouse conditions. Both incorporation into culture media and foliar spraying were compared with the fungicide combination metalaxyl\u0026thinsp;+\u0026thinsp;mancozeb. While the fungicide treatment reduced disease severity to 1.6 % (eaf-surface contamination), the \u003cem\u003eS. hortensis\u003c/em\u003e essential oil treatment achieved a disease severity of 16.6 %. hese findings further support the potential of savory essential oil as a natural antifungal agent.\u003c/p\u003e \u003cp\u003eOne of the most common and potent antifungal mechanisms of essential oil components is disruption of the fungal plasma membrane. Compounds such as carvacrol and thymol interfere with ergosterol biosynthesis or disrupt the lipid bilayer, leading to leakage of ions and intracellular constituents (ATP, proteins) and ultimately to cell death or growth arrest. Laboratory studies have demonstrated reduced ergosterol content and release of cytoplasmic materials after exposure to essential oil constituents. This mechanism is also effective against several plant-pathogenic fungi including \u003cem\u003eAlternaria\u003c/em\u003e and \u003cem\u003eBotrytis\u003c/em\u003e species [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSeveral plant compounds increase the generation ROS in fungal cells, damaging membranes, nucleic acids, and proteins. Mitochondria are a key target of ROS, leading to impaired respiration, ATP depletion, and activation of cell-death pathways. This effect is particularly pronounced with volatile aldehydes such as cinnamaldehyde and citral [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], Similarly, in our experiment, a significant elevation in GSH levels was detected in \u003cem\u003eA. solani\u003c/em\u003e cells exposed to CC2020, which reflects enhanced oxidative stress and supports the involvement of ROS-mediated damage in fungal inhibition.\u003c/p\u003e \u003cp\u003eRecent experimental studies, including assays on \u003cem\u003eA. alternata\u003c/em\u003e, reveal that essential oils of cinnamon, clove, eucalyptus, thyme, and oregano (rich in cinnamaldehyde, eugenol, carvacrol, or thymol) exhibit the strongest inhibitory effects. However, sensitivity varies among species and strains, and environmental factors such as temperature, water activity, and substrate composition markedly influence outcomes [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eEssential oils compound can also inhibit drug efflux pumps, enhancing fungal susceptibility to conventional fungicides. Reports of synergistic effects between essential oils (or their major components) and azoles or strobilurins are increasing. To overcome limitations such as volatility, poor water solubility, and oxidative instability, strategies including nanoemulsions, encapsulation, vapor-phase applications, and active coatings have been developed, significantly improving efficacy and stability [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMany essential oils not only inhibit mycelial growth but also reduce spore germination and fungal reproduction. Some compounds interfere with biosynthetic pathways of mycotoxins (e.g., aflatoxins) or suppress the expression of related genes, resulting in toxin reduction even at subinhibitory concentrations. This mechanism is of particular importance for postharvest disease control and food safety [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], our previous work demonstrated that an essential-oil\u0026ndash;based formulation from \u003cem\u003eSatureja\u003c/em\u003e spp. markedly inhibited mycelial growth and sporulation of \u003cem\u003eA. solani\u003c/em\u003e, accompanied by distinct structural deformations of the mycelium (manuscript under review).\u003c/p\u003e \u003cp\u003ePrevious studies have identified several effectors in \u003cem\u003eA. solani\u003c/em\u003e that are expressed during the early stages of infection in Solanaceae plants and play key roles in pathogenicity. Notable examples include \u003cem\u003eAsCEP19\u003c/em\u003e and \u003cem\u003eAsCEP20\u003c/em\u003e, which facilitate infection prior to activation of host defense mechanisms [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], and \u003cem\u003eAsCEP112\u003c/em\u003e, which localizes to the host cell membrane and promotes leaf chlorosis [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOur findings indicate that CC2020 exerts a time-dependent inhibitory effect on the effector gene \u003cem\u003eAsCEP50\u003c/em\u003e in \u003cem\u003eA. solani\u003c/em\u003e, which has been reported to contribute to early infection and disease development [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The strongest suppression was observed at 24 and 48 hours post-treatment, highlighting the compound\u0026rsquo;s capacity to interfere with fungal virulence during initial host colonization. Notably, while expression remained somewhat reduced at 72 hours, the difference was not statistically significant, suggesting partial recovery over time. These results support the notion that early disruption of effector expression may be a key mechanism by which CC2020 limits pathogen establishment. The transient nature of suppression at later time points also underscores the importance of timing in antifungal interventions and may reflect compensatory regulatory mechanisms within the fungus. Overall, targeting \u003cem\u003eAsCEP50\u003c/em\u003e early during infection could contribute substantially to the efficacy of CC2020 as a plant-protective agent [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. These findings are consistent with previous work (manuscript under review), which reported that CC2020 effectively reduced \u003cem\u003eA. solani\u003c/em\u003e pathogenicity in both in vitro and in vivo assays.\u003c/p\u003e \u003cp\u003eAlthough \u003cem\u003eA. solani\u003c/em\u003e is traditionally classified as a necrotrophic pathogen, the early expression of effectors such as \u003cem\u003eAsCEP50\u003c/em\u003e indicates that it may actively manipulate host physiology during initial infection. This observation raises the hypothesis that \u003cem\u003eA. solani\u003c/em\u003e could exhibit a semi-biotrophic lifestyle, initially maintaining host cell viability to facilitate colonization before inducing necrosis. This possibility warrants further experimental investigation to elucidate the pathogen\u0026rsquo;s infection strategy and the timing of effector deployment.\u003c/p\u003e \u003cp\u003eTreatment with CC2020 significantly reduced the expression of the polyketide synthase (\u003cem\u003epks\u003c/em\u003e) gene, which is responsible for melanin biosynthesis in \u003cem\u003eA. solani\u003c/em\u003e. Melanin, synthesized via \u003cem\u003epks\u003c/em\u003e enzymes, is critical for fungal secondary metabolism, contributing to virulence and protection against environmental stresses. Downregulation of \u003cem\u003epks\u003c/em\u003e by CC2020 suggests interference with these pathways, potentially diminishing fungal pathogenicity. These results are consistent with previous reports highlighting the essential role of \u003cem\u003ePKS\u003c/em\u003e-mediated melanin production in fungal development and virulence [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Furthermore, treatment with this compound was shown to reduce melanin content in \u003cem\u003eA. solani\u003c/em\u003e, with a significant decrease confirmed through direct quantification (manuscript under review).\u003c/p\u003e \u003cp\u003eTreatment with the plant-based compound led to a time-dependent increase in glutathione (GSH) levels in \u003cem\u003eA. solani\u003c/em\u003e, with significant elevations observed at 24 and 48 hours post-treatment compared to controls. GSH, a central antioxidant, plays a key role in mitigating oxidative stress and maintaining cellular redox balance. The early accumulation of GSH suggests that the compound acts as a priming agent, triggering rapid defense responses in the fungus. These findings are consistent with recent studies in filamentous fungi and plants. For instance, previous studies [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] demonstrated that GSH biosynthesis is essential for oxidative stress resistance and pathogenicity in \u003cem\u003eFusarium graminearum\u003c/em\u003e, while upregulation of glutathione-related genes under oxidative stress has been reported in \u003cem\u003eTalaromyces marneffei\u003c/em\u003e [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Similarly, an earlier report [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] showed that elevated GSH levels in plants prime early defense responses against parasitic cyst nematodes. Collectively, these observations indicate that the plant-derived compound induces a rapid oxidative stress response in \u003cem\u003eA. solani\u003c/em\u003e, highlighting GSH as a reliable marker of early defense activation.\u003c/p\u003e \u003cp\u003eAccording to our results, glutathione (GSH) levels in the control group were lower than in the treated group at 24 and 48 hours but increased significantly by 72 hours. This biphasic response indicates that at later stages, \u003cem\u003eA. solani\u003c/em\u003e activated its intrinsic defense mechanisms, including GSH biosynthesis, are enhanced to maintain redox homeostasis and mitigate oxidative stress [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. These findings highlight the inherent capacity of \u003cem\u003eA. solani\u003c/em\u003e to activate protective responses independent of treatment. Such a pattern is consistent with transient chemically induced resistance, where early effects are most pronounced, but later stages are dominated by endogenous defense pathways [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOverall, these results indicate that the plant-based compound accelerated the onset of defense in \u003cem\u003eA. solani\u003c/em\u003e during the initial stages, while at later time points, the pathogen\u0026rsquo;s own defense systems became more prominent. These findings highlight glutathione as a reliable marker of oxidative stress and early induced resistance, consistent with previous reports on glutathione-mediated defense responses [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCollectively, this study advances our understanding of \u003cem\u003eA. solani\u003c/em\u003e pathogenicity by demonstrating that CC2020 can directly modulate key virulence-associated genes, including the effector \u003cem\u003eAsCEP50\u003c/em\u003e and the melanin-related \u003cem\u003epks\u003c/em\u003e gene. Notably, one of the strengths of this work lies in the targeted evaluation of virulence factors under controlled in vitro conditions, providing a mechanistic perspective that is rarely explored in early blight research. The temporal patterns observed in glutathione dynamics further suggest that CC2020 influences fungal stress responses alongside virulence regulation. These findings highlight the promise of plant-based formulations as environmentally sustainable antifungal strategies. Future work should aim to unravel the molecular pathways underlying these effects and assess their broader relevance across diverse fungal pathogens.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePlant, isolate materials\u003c/h2\u003e \u003cp\u003eThe fungal isolate of \u003cem\u003eA. solani\u003c/em\u003e was obtained from the Plant Diseases Department, National Research Institute of Iran. Detached leaves of tomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e) cultivar 4129, a widely cultivated greenhouse variety in Iran. This cultivar was obtained from Department of Greenhouse Research, Tehran Agricultural and Natural Resources Research and Training Center, Agricultural Research, Education and Extension Organization (AREEO), Tehran, Iran. Plants were maintained under controlled greenhouse conditions (25\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, 16 h light/8 h dark photoperiod, 60\u0026ndash;70% relative humidity) prior to sample collection. Detached tomato leaves were collected from greenhouse-grown plants. Sample preparation, including any sterilization or processing, was performed in the laboratory prior to experiments.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003ePlant-based formulation\u003c/h3\u003e\n\u003cp\u003eThe plant-based formulation CC2020 was derived from the essential oil of \u003cem\u003eSatureja\u003c/em\u003e spp., previously identified as highly active against \u003cem\u003eA. solani\u003c/em\u003e through comprehensive screening of various plant essential oils (manuscript under review). The chemical composition of CC2020 was characterized by GC\u0026ndash;MS analysis in our previous study. In the present work, the pre-formulated CC2020 was used directly. Identity and composition of the formulation were confirmed according to the GC\u0026ndash;MS data, and the formulation was used as received for all biological assays.\u003c/p\u003e\n\u003ch3\u003eCandidate genes selection and primers design\u003c/h3\u003e\n\u003cp\u003eThe effector candidate gene \u003cem\u003eAsPE50\u003c/em\u003e and the melanin biosynthesis gene \u003cem\u003epks\u003c/em\u003e were selected based on their previously reported roles in fungal pathogenicity [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. \u003cem\u003eβ-tubulin\u003c/em\u003e (TUB) was used as a reference gene for normalization of gene expression [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Gene sequences were retrieved from the NCBI GenBank database (accession numbers: \u003cem\u003eAsCEP50\u003c/em\u003e \u0026ndash; OM735615.1, \u003cem\u003epks\u003c/em\u003e \u0026ndash; AEH76763.1). Detailed functional annotations, including GO biological process terms, are provided in Supplementary Table S1.\u0026rdquo; Specific primers for \u003cem\u003eAsPE50\u003c/em\u003e, \u003cem\u003epks\u003c/em\u003e, and \u003cem\u003eβ-tubulin\u003c/em\u003e were designed using the Primer3Plus web interface (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.primer3plus.com\u003c/span\u003e\u003cspan address=\"https://www.primer3plus.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003e)\u003c/span\u003e, which implements the Primer3 algorithm to optimize primer selection. Primer parameters, including melting temperature (Tm), GC content, and amplicon size, were set according to standard guidelines, targeting amplicons of 100\u0026ndash;200 bp (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Primer specificity was confirmed via in silico PCR and BLAST analysis against the \u003cem\u003eA. solani\u003c/em\u003e genome to avoid off-target amplification. Primers were synthesized by Eurofins Genomics (Ebersberg, Germany).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cb\u003ePrimer sequences and amplicon information for target genes used in this study.\u003c/b\u003e This table lists the target genes, their biological functions, corresponding forward and reverse primer sequences (5\u0026prime;\u0026rarr;3\u0026prime;), amplicon lengths, and literature references used for qRT-PCR analysis.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePurpose\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGO biological process description\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eForward primers \u0026nbsp;(5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReverse primer (3\u0026prime;\u0026rarr;5\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAmplicon length\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eReferences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAsCEP50\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBiological process (GO): \u003cem\u003epathogenesis\u003c/em\u003e (GO:0009405)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGGTACCACTGGAAACACCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAGAAAGAACCGCCAGAGTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100\u0026ndash;120 ~\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003epks\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBiological process (GO): \u003cem\u003epolyketide biosynthetic process\u003c/em\u003e (GO:0030639), \u003cem\u003emelanin biosynthetic process\u003c/em\u003e (GO:0042438)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCTGTCACGAATGCTTTTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGGGACCTGTGTCGTTGAGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100\u0026ndash;120 ~\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eβ-tubulin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormalization\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBiological process (GO): \u003cem\u003emicrotubule-based process\u003c/em\u003e (GO:0007017), \u003cem\u003ecell division\u003c/em\u003e (GO:0051301)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100\u0026ndash;120 ~\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003e\u003cb\u003ePrimer sequences and relevant information for target genes used in this study.\u003c/b\u003e The table lists the target genes, corresponding forward and reverse primer sequences, amplicon sizes, and melting temperatures (Tm) used for qRT-PCR analyses.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePurpose\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGO biological process description\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eForward primers \u0026nbsp;(5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReverse primer (3\u0026prime;\u0026rarr;5\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eAmplicon length\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eReferences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAsCEP50\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBiological process (GO): \u003cem\u003epathogenesis\u003c/em\u003e (GO:0009405)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCGGTACCACTGGAAACACCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAGAAAGAACCGCCAGAGTCA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100\u0026ndash;120 ~\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eWang et al., 2023\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003epks\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTarget\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBiological process (GO): \u003cem\u003epolyketide biosynthetic process\u003c/em\u003e (GO:0030639), \u003cem\u003emelanin biosynthetic process\u003c/em\u003e (GO:0042438)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCTGTCACGAATGCTTTTGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGGGACCTGTGTCGTTGAGAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100\u0026ndash;120 ~\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eIzumi et al., 2012\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eβ-tubulin\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eNormalization\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBiological process (GO): \u003cem\u003emicrotubule-based process\u003c/em\u003e (GO:0007017), \u003cem\u003ecell division\u003c/em\u003e (GO:0051301)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e100\u0026ndash;120 ~\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eTeifoori et at., 2018\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eTreatment with plant-based compound for effector gene analysis\u003c/h2\u003e \u003cp\u003eFungal isolates were identified based on morphological characteristics [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Mycelial plugs (5 mm) from actively growing cultures were inoculated onto detached leaves of tomato, following a modified procedure of [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Each treatment and control consisted of three biological replicates, with each biological replicate containing three technical replicates. Inoculated leaves were treated with the plant-based compound CC2020 at a sub-minimum inhibitory concentration (sub-MIC) of 300 ppm. This concentration was chosen based on preliminary screenings that determined the minimum inhibitory concentration (MIC) of CC2020 against \u003cem\u003eA. solani\u003c/em\u003e. Using a sub-MIC allows the fungus to remain viable, enabling the assessment of stress responses and other sub-lethal effects induced by the treatment. Treatments were applied using 100 mL spray bottles (\u0026asymp;\u0026thinsp;50 \u0026micro;L per puff, three puffs per leaf) to ensure uniform coverage. Petri dishes were incubated at 25\u0026deg;C in the dark, and samples were collected at 24, 48, and 72 h post-treatment for downstream analyses. Control leaves received sterile distilled water.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003e\u003cb\u003eExtraction of RNA and One-Step Quantitative PCR for effector gene analysis\u003c/b\u003e\u003c/div\u003e \u003cp\u003eLeaf samples were ground in liquid nitrogen to ensure complete cell disruption. Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany; Cat. No. 74094) following the manufacturer\u0026rsquo;s instructions and treated with RNase-free DNase I (Qiagen, Hilden, Germany) to remove contaminating genomic DNA. RNA quantity and purity were assessed spectrophotometrically using a NanoDrop ND-1000 (Thermo Scientific, Wilmington, DE, USA). Concentrations were calculated directly by the instrument based on absorbance at 260 nm, and an A260/280 ratio of 1.8\u0026ndash;2.0 indicated acceptable purity.\u003c/p\u003e \u003cp\u003eGene expression analysis was performed using a one-step SYBR Green qRT-PCR kit (qPCRBIO SyGreen 1-step Detect Lo-ROX; Batch No. 190F325K07), allowing reverse transcription and PCR amplification in a single reaction. Each 12 \u0026micro;L reaction contained 2 ng of RNA template and 0.8 \u0026micro;L of each primer, with the remaining volume adjusted with nuclease-free water. Assays were performed in triplicate using an Applied Biosystems StepOnePlus under the manufacturer\u0026rsquo;s cycling conditions: 50\u0026deg;C for 2 min, 95\u0026deg;C for 2 min, followed by 40 cycles of 95\u0026deg;C for 15 s and 59.5\u0026deg;C for 60 s. Fluorescence signals were recorded at each cycle and analyzed using QuantStudio software. Relative gene expression was determined using the 2\u003csup\u003e\u0026minus;ΔΔCt\u003c/sup\u003e method [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Each treatment was analyzed once, with three technical replicates per sample to ensure reproducibility. Fold changes (FCs) were calculated relative to the control.\u003c/p\u003e \u003cp\u003e \u003cb\u003eTreatment with plant-based compound for\u003c/b\u003e \u003cb\u003epks\u003c/b\u003e \u003cb\u003egene analysis\u003c/b\u003e\u003c/p\u003e \u003cp\u003ePotato Dextrose Agar (PDA) medium was supplemented with the plant-based compound at a final concentration of 300 ppm and poured into Petri dishes. A 5 mm agar plug of \u003cem\u003eA. solani\u003c/em\u003e was placed onto the surface of the solidified medium, and cultures were incubated at 25\u0026deg;C for fungal growth. After 7 days, fungal mycelia were harvested, frozen in liquid nitrogen, and processed for RNA extraction and subsequent gene expression analysis [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Each treatment was analyzed once, with three technical replicates per sample to ensure reproducibility.\u003c/p\u003e \u003cp\u003e \u003cb\u003eExtraction of RNA and One-Step Quantitative PCR for\u003c/b\u003e \u003cb\u003epks\u003c/b\u003e \u003cb\u003egene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eFungal mycelia from treated and untreated PDA cultures were harvested, immediately frozen in liquid nitrogen, and ground to a fine powder. Total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen) with on-column DNase I treatment. RNA purity and concentration were assessed using a NanoDrop spectrophotometer (A260/280\u0026thinsp;=\u0026thinsp;1.8\u0026ndash;2.0). Gene expression of \u003cem\u003epks\u003c/em\u003e was quantified using a one-step SYBR Green qRT-PCR kit (qPCRBIO SyGreen 1-step Detect Lo-ROX). Each 12 \u0026micro;L reaction contained 2 ng RNA template and 0.8 \u0026micro;L of each primer. Reactions were run in triplicate on an Applied Biosystems StepOnePlus under the manufacturer\u0026rsquo;s cycling conditions: 50\u0026deg;C for 2 min, 95\u0026deg;C for 2 min, followed by 40 cycles of 95\u0026deg;C for 15 s and 59.5\u0026deg;C for 60 s. Relative expression was calculated using the 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔΔCt method, with untreated samples normalized to 1. Three technical replicates per treatment ensured reproducibility\u003c/p\u003e \u003cp\u003e \u003cb\u003ePreparation of samples for glutathione quantification\u003c/b\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eA. solani\u003c/em\u003e was cultured on potato dextrose agar (PDA) plates and incubated at 25\u0026deg;C until sufficient mycelial biomass was observed (typically 4\u0026ndash;5 days). Selected plant-based compounds were applied to the surface of the culture plates using a sterile spray, and plates were incubated further. Mycelia were harvested at 24, 48, and 72 h post-treatment by carefully scraping from the agar surface with a sterile scalpel. To minimize contamination from the medium, harvested biomass was gently rinsed with cold sterile distilled water. The washed mycelial biomass was immediately frozen in liquid nitrogen and ground into a fine powder using a pre-chilled mortar and pestle. The powder was stored at \u0026minus;\u0026thinsp;75\u0026deg;C until extraction. Approximately 30\u0026ndash;50 mg of frozen fungal powder was transferred into 1.5\u0026ndash;2 mL Eppendorf tubes, and extraction solvent of 1 mL of 80% methanol was added. The mixture was sonicated for 45 min, vortexed for 1 min, and centrifuged at 4,500 \u0026times; g for 10 min. The supernatant was collected into a new tube. The extraction procedure was repeated on the remaining pellet with 1 mL of the same solvent, and both supernatants were combined, diluted 1:1 with Milli-Q water, and filtered through a 0.22 \u0026micro;m PTFE syringe filter into HPLC vials. Extracts were stored at \u0026minus;\u0026thinsp;20\u0026deg;C until Liquid Chromatography\u0026ndash;Tandem Mass Spectrometry (LC\u0026ndash;MS/MS) analysis[\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e].\u003c/p\u003e\n\u003ch3\u003eQuantification of glutathione content by LC–MS/MS\u003c/h3\u003e\n\u003cp\u003eGlutathione (GSH) quantification was performed using a triple quadrupole mass spectrometer (e.g., AB Sciex QTRAP 5500) coupled to a HPLC system (Agilent 1260 Infinity II) [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], with minor modifications. Separation was achieved on Synergi Fusion-RP C18, 80A column (250 mm \u0026times; 2 mm i.d., 4 \u0026micro;m, Phenomenex) at 35\u0026deg;C, using a mobile phase of solvent A (100% MilliQ) and solvent B (100% Methanol) at 0.3 mL min⁻\u0026sup1;. The elution gradient was set as follows: 5 min, 50% B; 5\u0026ndash;12 min, 100% B; 12\u0026ndash;14 min, 100% B; 15-14.5 min 0% B followed by re-equilibration for 10 min.\u003c/p\u003e \u003cp\u003eGSH was detected in negative electrospray ionization (ESI⁺) mode using multiple reaction monitoring (MRM) with a precursor-to-product ion transition of Q1 m/z 305.9 \u0026rarr; 142.8, Q3 m/z 305.9 \u0026rarr; 271. Quantification was based on external calibration curves constructed from GSH standards. All experiments were performed in triplicate, and results were normalized to sample dry weight. To prevent oxidation and degradation, all procedures were conducted under cold and dark conditions, and pre-cooled glassware and plasticware were used throughout.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eFold changes in gene expression and glutathione levels were calculated relative to the untreated control. Relative gene expression data for \u003cem\u003epks\u003c/em\u003e were analyzed using one-way ANOVA with Group (treated vs. untreated) as a fixed factor. Relative gene expression data for \u003cem\u003eAsCEP50\u003c/em\u003e were analyzed using two-way ANOVA with Group (treated vs. untreated) and Time (24, 48, 72 h) as fixed factors, followed by Tukey\u0026rsquo;s HSD post-hoc test to identify significant differences between groups. Glutathione levels were analyzed using two-way ANOVA with Group (treated vs. untreated) and Time (24, 48, 72 h) as fixed factors, followed by Duncan\u0026rsquo;s multiple range test for post-hoc comparisons. All statistical analyses were performed using SAS software, and differences were considered significant at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFarzaneh Lak:\u003c/strong\u003e Conducted all laboratory and greenhouse experiments, designed the study, analyzed the data, and prepared the initial draft of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAzad Omrani:\u003c/strong\u003e Provided some laboratory facilities, prepared materials, formulated the plant-based compounds, assisted in interpreting the results\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMongens Nicolaisen:\u003c/strong\u003e Provided laboratory resources, and technical guidance that facilitated the experiments\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eJawameer Hama:\u003c/strong\u003e Contributed to the analysis and interpretation of glutathione-related data.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAmir Mirzadi Gohari:\u003c/strong\u003e Provided critical revisions and contributed to the final manuscript editing\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMasoud Ahmadzadeh:\u003c/strong\u003e Supervised parts of the project\u003cspan dir=\"RTL\"\u003e\u0026nbsp;\u003c/span\u003eand served as the corresponding author\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding declaration\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that no funds, grants, or other support were received during the preparation of this manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated during the current study are available from the corresponding author upon reasonable request. No separate supplementary files were prepared for this submission.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have no relevant financial or non-financial interests to disclose.\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eSingh, D. P. et al. Metabolomics of early blight (Alternaria solani) susceptible tomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e) unfolds key biomarker metabolites and involved metabolic pathways. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 21023 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Nagar, A., Elzaawely, A. A., Taha, N. A. \u0026amp; Nehela, Y. The antifungal activity of gallic acid and its derivatives against \u003cem\u003eAlternaria solani\u003c/em\u003e, the causal agent of tomato early blight. \u003cem\u003eAgronomy\u003c/em\u003e \u003cb\u003e10\u003c/b\u003e, 1402 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGikas, G. D., Parlakidis, P., Mavropoulos, T. \u0026amp; Vryzas, Z. Particularities of fungicides and factors affecting their fate and removal efficacy: A review. \u003cem\u003eSustainability\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 4056 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePhilip, B. et al. Trichoderma afroharzianum TRI07 metabolites inhibit \u003cem\u003eAlternaria alternata\u003c/em\u003e growth and induce tomato defense-related enzymes. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e14\u003c/b\u003e, 1874 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHyder, S. et al. Use of ginger extract and bacterial inoculants for the suppression of \u003cem\u003eAlternaria solani\u003c/em\u003e causing early blight disease in Tomato. \u003cem\u003eBMC Plant. Biol.\u003c/em\u003e \u003cb\u003e24\u003c/b\u003e, 131 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeresa, E. M. \u0026amp; Diriba, T. F. Phytochemicals as alternative fungicides for controlling plant diseases: A comprehensive review of their efficacy, commercial representatives, advantages, challenges for adoption, and possible solutions. \u003cem\u003eHeliyon\u003c/em\u003e \u003cb\u003e9\u003c/b\u003e, (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRasheed, H. A. et al. A comprehensive insight into plant-derived extracts/bioactives: Exploring their antimicrobial mechanisms and potential for high-performance food applications. \u003cem\u003eFood Biosci.\u003c/em\u003e \u003cb\u003e59\u003c/b\u003e, 104035 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAl-Otibi, F., Alshahrani, R. A., Alharbi, R. I. \u0026amp; Yassin, M. T. Phytochemical analysis and antifungal efficiency of Origanum majorana extracts against some phytopathogenic fungi causing tomato damping-off diseases. \u003cem\u003eOpen. Chem.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e, 20230181 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcMaster, C. A., Plummer, K. M., Porter, I. J. \u0026amp; Donald, E. C. Antimicrobial activity of essential oils and pure oil compounds against soilborne pathogens of vegetables. \u003cem\u003eAustralas. Plant Pathol.\u003c/em\u003e \u003cb\u003e42\u003c/b\u003e, 385\u0026ndash;392 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, C. et al. Identification and functional analysis of protein secreted by \u003cem\u003eAlternaria solani\u003c/em\u003e. \u003cem\u003ePLoS One\u003c/em\u003e. \u003cb\u003e18\u003c/b\u003e, e0281530\u0026ndash;e0281530 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWoo, P. C. Y. et al. High diversity of polyketide synthase genes and the melanin biosynthesis gene cluster \u003cem\u003ein Penicillium marneffei\u003c/em\u003e. \u003cem\u003eFEBS J.\u003c/em\u003e \u003cb\u003e277\u003c/b\u003e, 3750\u0026ndash;3758 (2010).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoctor, G., Mhamdi, A. \u0026amp; Foyer, C. H. The roles of reactive oxygen metabolism in drought: not so cut and dried. \u003cem\u003ePlant. Physiol.\u003c/em\u003e \u003cb\u003e164\u003c/b\u003e, 1636\u0026ndash;1648 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDatta, R., Mandal, K., Boro, P., Sultana, A. \u0026amp; Chattopadhyay, S. Glutathione imparts stress tolerance against \u003cem\u003eAlternaria brassicicola\u003c/em\u003e infection via miRNA mediated gene regulation. \u003cem\u003ePlant. Signal. Behav.\u003c/em\u003e \u003cb\u003e17\u003c/b\u003e, 2047352 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, H. et al. The role of linalool in managing \u003cem\u003eAlternaria alternata\u003c/em\u003e infection and delaying black mold rot in goji berry. \u003cem\u003ePostharvest Biol. Technol.\u003c/em\u003e \u003cb\u003e219\u003c/b\u003e, 113240 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePark, J. et al. Sulfur metabolism-mediated fungal glutathione biosynthesis is essential for oxidative stress resistance and pathogenicity in the plant pathogenic fungus Fusarium graminearum. \u003cem\u003emBio\u003c/em\u003e 15, e02401-23 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, H. et al. Glutathione peroxidase LtGPX3 contributes to oxidative stress tolerance, virulence, and plant defense suppression in the peach gummosis fungus Lasiodiplodia theobromae. \u003cem\u003ePhytopathol. Res.\u003c/em\u003e \u003cb\u003e6\u003c/b\u003e, 6 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRagupathi, K. P., Renganayaki, P. R., Sundareswaran, S., Kumar, S. M. \u0026amp; Kamalakannan, A. Evaluation of essential oils against early blight (\u003cem\u003eAlternaria solani\u003c/em\u003e) of tomato. \u003cem\u003eInt. Res. J. Pure Appl. Chem.\u003c/em\u003e \u003cb\u003e21\u003c/b\u003e, 164\u0026ndash;169 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBahraminejad, S., Seifolahpour, B. \u0026amp; Amiri, R. Antifungal effects of some medicinal and aromatic plant essential oils against \u003cem\u003eAlternaria solani\u003c/em\u003e. \u003cem\u003eJ. Crop Prot.\u003c/em\u003e \u003cb\u003e5\u003c/b\u003e, 603\u0026ndash;616 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOmar, M. S. \u0026amp; Kordalı, Ş. Exploring the Antifungal Efficacy of Essential Oils against \u003cem\u003eAlternaria solani\u003c/em\u003e, the Causative Pathogen of Early Leaf Blight in Tomato Plants. \u003cem\u003eErciyes Tarım ve Hayvan Bilimleri Dergisi\u003c/em\u003e \u003cb\u003e7\u003c/b\u003e, 12\u0026ndash;23 .\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, H. et al. Carvacrol treatment reduces decay and maintains the postharvest quality of red grape fruits (Vitis vinifera L.) inoculated with \u003cem\u003eAlternaria alternata\u003c/em\u003e. \u003cem\u003eFoods\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 4305 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMączka, W., Twardawska, M., Grabarczyk, M. \u0026amp; Wińska, K. Carvacrol\u0026mdash;A natural phenolic compound with antimicrobial properties. \u003cem\u003eAntibiotics\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, 824 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, J. et al. Inhibitory effect and mechanism of carvacrol against black mold disease agent \u003cem\u003eAlternaria alternata\u003c/em\u003e in Goji Berries. \u003cem\u003eJ. Fungi\u003c/em\u003e. \u003cb\u003e10\u003c/b\u003e, 402 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBabagoli, M. A. \u0026amp; BEHDAD, E. Effects of three essential oils on the growth of the fungus \u003cem\u003eAlternaria solani\u003c/em\u003e. (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSilva-Beltran, N. P., Boon, S. A., Ijaz, M. K., McKinney, J. \u0026amp; Gerba, C. P. Antifungal activity and mechanism of action of natural product derivates as potential environmental disinfectants. \u003cem\u003eJ. Ind. Microbiol. Biotechnol.\u003c/em\u003e \u003cb\u003e50\u003c/b\u003e, kuad036\u0026ndash;kuad036 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTian, F. et al. Antifungal activity of essential oil and plant-derived natural compounds against Aspergillus flavus. \u003cem\u003eAntibiotics\u003c/em\u003e \u003cb\u003e11\u003c/b\u003e, 1727 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAllagui, M. B., Moumni, M. \u0026amp; Romanazzi, G. Antifungal activity of thirty essential oils to control pathogenic fungi of postharvest decay. \u003cem\u003eAntibiotics\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 28 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao, S. et al. \u003cem\u003eAlternaria solani\u003c/em\u003e effectors \u003cem\u003eAsCEP19\u003c/em\u003e and \u003cem\u003eAsCEP20\u003c/em\u003e reveal novel functions in pathogenicity and conidiogenesis. \u003cem\u003eMicrobiol. Spectr.\u003c/em\u003e \u003cb\u003e12\u003c/b\u003e, e04214\u0026ndash;e04223 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, C. et al. Identification of effector \u003cem\u003eCEP112\u003c/em\u003e that promotes the infection of necrotrophic Alternaria solani. \u003cem\u003eBMC Plant. Biol.\u003c/em\u003e \u003cb\u003e22\u003c/b\u003e, 466 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, R. et al. Melanin synthesis gene Aapks contributes to appressorium formation, stress response, cell well integrity and virulence in \u003cem\u003eAlternaria alternata\u003c/em\u003e. \u003cem\u003ePostharvest Biol. Technol.\u003c/em\u003e \u003cb\u003e198\u003c/b\u003e, 112247 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWangsanut, T., Sukantamala, P. \u0026amp; Pongpom, M. Identification of glutathione metabolic genes from a dimorphic fungus Talaromyces marneffei and their gene expression patterns under different environmental conditions. \u003cem\u003eSci. Rep.\u003c/em\u003e \u003cb\u003e13\u003c/b\u003e, 13888 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHasan, M. S. et al. Glutathione contributes to plant defence against parasitic cyst nematodes. \u003cem\u003eMol. Plant. Pathol.\u003c/em\u003e \u003cb\u003e23\u003c/b\u003e, 1048\u0026ndash;1059 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003edo Carmo Santos, M. L. et al. The family of glutathione peroxidase proteins and their role against biotic stress in plants: a systematic review. \u003cem\u003eFront. Plant. Sci.\u003c/em\u003e \u003cb\u003e16\u003c/b\u003e, 1425880 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKranner, I. Determination of glutathione, glutathione disulphide and two related enzymes, glutathione reductase and glucose-6-phosphate dehydrogenase, in fungal and plant cells. in Mycorrhiza manual 227\u0026ndash;241 (Springer, (1998).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIzumi, Y. et al. A polyketide synthase gene, ACRTS2, is responsible for biosynthesis of host-selective ACR-toxin in the rough lemon pathotype of Alternaria alternata. \u003cem\u003eMol. Plant Microbe Interact.\u003c/em\u003e \u003cb\u003e25\u003c/b\u003e, 1419\u0026ndash;1429 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTeifoori, F., Shams-Ghahfarokhi, M., Razzaghi-Abyaneh, M. \u0026amp; Martinez, J. Gene profiling and expression of major allergen Alt a 1 in Alternaria alternata and related members of the Pleosporaceae family. \u003cem\u003eRev. Iberoam Micol\u003c/em\u003e. \u003cb\u003e36\u003c/b\u003e, 66\u0026ndash;71 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimmons, E. G. Alternaria an identification manual, fully illustrated and with catalogue raisonn\u0026eacute; 1796\u0026ndash;2007. \u003cem\u003e(No Title)\u003c/em\u003e (2007).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDučkena, L. \u0026amp; Bimšteine, G. Morphological characteristics and pathogenicity of Alternaria and Stemphylium isolates on tomato in vitro. in \u003cem\u003eXXXI International Horticultural Congress (IHC2022): International Symposium on Sustainable Control of Pests and Diseases 1378\u003c/em\u003e 325\u0026ndash;332 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePfaffl, M. W. A new mathematical model for relative quantification in real-time RT\u0026ndash;PCR. \u003cem\u003eNucleic Acids Res.\u003c/em\u003e \u003cb\u003e29\u003c/b\u003e, e45\u0026ndash;e45 (2001).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFernandes, C. et al. Activation of melanin synthesis in \u003cem\u003eAlternaria infectoria\u003c/em\u003e by antifungal drugs. \u003cem\u003eAntimicrob. Agents Chemother.\u003c/em\u003e \u003cb\u003e60\u003c/b\u003e, 1646\u0026ndash;1655 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHama, J. R., Fomsgaard, I. S., Topalović, O. \u0026amp; Vesterg\u0026aring;rd, M. Root uptake of cereal benzoxazinoids grants resistance to root-knot nematode invasion in white clover. \u003cem\u003ePlant Physiol. Biochem.\u003c/em\u003e \u003cb\u003e210\u003c/b\u003e, 108636 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChwatko, G. et al. Determination of cysteine and glutathione in cucumber leaves by HPLC with UV detection. \u003cem\u003eAnal. Methods\u003c/em\u003e. \u003cb\u003e6\u003c/b\u003e, 8039\u0026ndash;8044 (2014).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Plant-based formulation, fungal virulence, effector gene, pks gene, oxidative stress, Alternaria solani","lastPublishedDoi":"10.21203/rs.3.rs-8194037/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8194037/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEarly blight, caused by the fungal pathogen \u003cem\u003eAlternaria solani\u003c/em\u003e, is one of the most destructive diseases of tomato, resulting in severe yield losses worldwide. Here, we show that CC2020, a plant-based formulation enriched with savory essential oil, exhibits potent antifungal activity against \u003cem\u003eA. solani\u003c/em\u003e through multiple complementary mechanisms. Under in vitro conditions, treatment with CC2020 at a concentration of 300 ppm effectively suppressed the effector gene expression \u003cem\u003eAsCEP50\u003c/em\u003e and downregulated the melanin-biosynthesis gene \u003cem\u003epks\u003c/em\u003e, both of which are essential determinants of fungal virulence. Furthermore, treatment markedly increased intracellular glutathione (GSH) levels, indicating activation of the fungi\u0026rsquo;s antioxidant defense machinery. Collectively, these findings demonstrate the high efficacy of CC2020 and establish it as a sustainable, eco-friendly, and potent bioformulation for early blight management. This work underscores the potential of plant-derived formulations as effective, sustainable, and environmentally responsible components of integrated disease management strategies in crops.\u003c/p\u003e","manuscriptTitle":"Mechanistic insights into the activity of a plant-based compound against Alternaria solani","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-22 16:47:30","doi":"10.21203/rs.3.rs-8194037/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"78f184ed-1746-4fd6-8b84-19c36bec6c15","owner":[],"postedDate":"December 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":60013659,"name":"Biological sciences/Biotechnology"},{"id":60013660,"name":"Biological sciences/Microbiology"},{"id":60013661,"name":"Biological sciences/Plant sciences"}],"tags":[],"updatedAt":"2026-03-20T06:25:35+00:00","versionOfRecord":[],"versionCreatedAt":"2025-12-22 16:47:30","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8194037","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8194037","identity":"rs-8194037","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}