Fecal carriage of ESBL-, carbapenemase- and AmpC- producing Escherichia coli in cattle and sheep in Algeria: Emergence of NDM and OXA-181

Fecal carriage of ESBL-, carbapenemase- and AmpC- producing Escherichia coli in cattle and sheep in Algeria: Emergence of NDM and OXA-181 | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Fecal carriage of ESBL-, carbapenemase- and AmpC- producing Escherichia coli in cattle and sheep in Algeria: Emergence of NDM and OXA-181 Hassina KIRAT, Hamza RAHAB, Zohra CHEKROUD, Mohamed Salah ABBASSI, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5999651/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 01 Aug, 2025 Read the published version in BMC Microbiology → Version 1 posted 9 You are reading this latest preprint version Abstract Introduction: The spread of third-generation cephalosporin (3GC)-resistant Escherichia coli in food-producing animals poses a significant threat to public health, with limited data from cattle and sheep in Algeria. This study investigated the prevalence of 3GC-resistant E. coli in cattle and sheep in Guelma, northeast Algeria. Methodology: 285 fecal samples were collected from cattle (n=145) and sheep (n=140) on 28 farms. Samples were screened for 3GC-resistant E. coli . Antibiotic susceptibility was tested, and ESBL and carbapenemase production were evaluated using double disc and EDTA tests. PCR identified resistance and integron genes. Results: Twenty-seven cefotaxime-resistant E. coli isolates were detected in 17% of bovine and 1% of ovine samples, spanning 43% of the farms. Multidrug resistance was observed in 85% of isolates, with high resistance to β-lactams, tetracyclines, fluoroquinolones, and trimethoprim-sulfamethoxazole. The following beta-lactamase genes were detected: bla CTX-M (74%), bla CMY (44%), bla NDM-1 (37%), and bla OXA-181 (4%) were identified. Class 1 integrons were also detected in ten isolates. Conclusions: These findings emphasize the presence of ESBL-, AmpC-, and carbapenemase-producing E. coli among Algerian livestock, highlighting the need for comprehensive monitoring and control to manage the spread of these resistant bacteria. Algeria cattle sheep 3GC-resistant E. coli ESBL carbapenemases Figures Figure 1 Figure 2 1. Introduction Beta-lactams are the main antibiotics used to combat bacterial infections in human and veterinary medicine, owing to their large spectrum and low toxicity [ 1 , 2 ]. Great attention is given to 3rd generation cephalosporins (3GC) and carbapenems, which the World Health Organization (WHO) has regarded as critically important, considering their crucial role in treating severe bacterial infections, including those from zoonotic origin [ 3 ]. Nevertheless, 3GC are extensively used in human and veterinary sectors [ 2 ]. This overuse has led to the emergence of resistant bacteria and compromised the therapeutic efficiency of 3GC, which increased the need for carbapenems and further induced resistance to those antibiotics [ 4 ]. Recently, the WHO has classified carbapenem-resistant and 3GC-resistant Enterobacterales among the critical groups of the Bacterial Priority Pathogen List due to their highest risk to public health [ 5 ]. The primary resistance mechanism to beta-lactams in Enterobacterales , including Escherichia coli , is the production of beta-lactamase enzymes, mainly extended spectrum ß-lactamases (ESBL), carbapenemases and AmpC cephalosporinases [ 6 , 7 ]. ESBL and AmpC enzymes confer resistance to penicillins, third and later-generation cephalosporins, and monobactams. AmpC can hydrolyse cephamycin antibiotics, while carbapenemase enzymes are active against a larger spectrum of beta-lactams, including carbapenems [ 7 ]. 3GC are widely used in veterinary medicine, which has led to the emergence and propagation of resistant bacteria and their genes in livestock [ 8 ]. It was statistically reported that the consumption of 3GC in food-producing animals is correlated with the high prevalence of ESBL- and AmpC-producing E. coli [ 9 ]. On the other hand, carbapenemases are not authorized for veterinary use [ 9 , 10 ]. However, the pressure exerted by the high consumption of 3GC might promote the selection of carbapenem-resistant strains in animals [ 9 , 10 ]. The global growth of livestock production in the last decade, especially in intensive farming systems, has increased animals' vulnerability to bacterial infections and thus raised the consumption of antibiotics in this sector [ 11 , 12 ]. Antibiotics in intensive farming have boosted animal growth and thus helped confront the increasing need for animal proteins [ 13 ]. Cattle and sheep are fundamental to the food chain. Hence, the emergence of antimicrobial-resistant bacteria in their intestines or among their food products can spread to humans through direct or indirect routes [ 14 , 15 ]. The presence of 3GC- resistance Enterobacterales in cattle has been widely reported [ 16 – 18 ]. Conversely, there are fewer investigations on disseminating this resistance in sheep [ 17 , 19 ]. Several studies in Algeria have identified ESBL, carbapenemase, and AmpC-producing bacteria from animal sources, especially poultry [ 20 – 22 ]. However, there is a significant knowledge gap regarding the fecal carriage of these bacteria in cattle and sheep. Therefore, we aimed to investigate the presence of 3GC-resistant Escherichia coli in bovine and ovine fecal samples among 28 farms in Guelma City, northeast of Algeria, and to assess their resistance genes further. 2. Materials and methods 2.1. Institutional Review Board Statement The experimental protocol was approved by the University ethics committee (N°Ethi/UMMTO/26-MAR-2024). 2.2. Study area and sampling From September 2021 to May 2022, 285 fresh fecal samples were collected with sterile cotton swabs from healthy cattle (n = 145) and sheep (n = 140) among 28 farms in Guelma City, northeast of Algeria. All farms were randomly selected and situated in four different regions in Guelma: Heliopolis (7 bovine farms), Bouati Mahmoud (11 bovine farms and six ovine farms), Hammam Debagh (3 bovine farms) and Medjez Ammar (1 ovine farm) (Figure S1 ). Farms sampled in Heliopolice and Medjez Ammar are located in urban zones (n = 8), while those of Bouati Mahmoud and Hammam Debagh are based in rural zones (n = 20). Moreover, six farms in the Heliopolis region were managed under intensive farming, whereas the 22 other farms were semi-extensive. Samples were immediately transferred to the laboratory and processed on the day of sampling. Farms and sample information are illustrated in Table S1 . 2.3. Isolate collection and identification Each sample swab was enriched overnight in 10 ml of Mueller Hinton-broth (MHB). Then, 10 µl of the MHB culture was inoculated on MacConkey agar (TM Media ® , India) supplemented with 1 µg/ml of cefotaxime [ 23 ]. After incubation, presumptive Escherichia coli colonies were selected and identified on CHROMagar orientation medium (CHROMagar ™, Paris, France), then confirmed with Gram coloration, oxidase disc test and API 20 E biochemical gallery (Biomérieux, France). 2.4. Antibiotic susceptibility testing Antibiotic susceptibility profiles were determined with the disc diffusion method against 16 antibiotics following the Clinical and Laboratory Standards Institute (CLSI) guidelines [ 24 ]. Used antibiotics were: cefotaxime (CTX, 30µg), ceftazidime (CAZ, 30µg), aztreonam (ATM, 30µg), cefepime (FEP, 30µg), cefoxitin (FOX, 30µg), amoxicillin-clavulanic acid (AMC, 20/10 µg), amoxicillin (AMX, 25 µg), ertapenem (ETP, 10µg), imipenem (IMP, 10µg), ciprofloxacin (CIP, 30µg), ofloxacin (OFX, 5µg), tetracycline (TE, 10µg), doxycycline (DO, 30µg), gentamicin (CN, 120µg), amikacin (AK, 30µg), and trimethoprim-sulfamethoxazole (SXT, 25µg). Colistin Minimum Inhibitory Concentration (MIC) was also determined using the broth microdilution method [ 25 ]. Results were interpreted according to CLSI breakpoints [ 24 ]. 2.5. Phenotypic characterization of resistance mechanisms For all cefotaxime-resistant isolates screened on the selective agar, the Double-Disk Synergy Test (DDST) was used to detect ESBL production by placing each of the CTX (30 µg) and ceftazidime (30 µg) discs at a distance of 3 cm from the central disc of amoxicillin-clavulanic acid (20/10 µg) [ 26 ]. E. coli ATCC 25922 and Klebsiella pneumoniae ATCC 700603 were used as ESBL-negative and positive reference strains, respectively. Metallo-ß-lactamases production was evaluated using the EDTA method for isolates showing resistance to ertapenem or imipenem [ 26 ]. 2.6. Molecular characterization of resistance mechanisms Genomic DNA was extracted following the boiling method [ 27 ]. DNA quality was evaluated using NanoDrop™ 8000 spectrophotometer (Thermo Fisher Scientific, California, USA). Afterwards, ten antimicrobial resistance genes were investigated with standard PCR targeting genes encoding ESBL ( bla CTX-M ), plasmidic AmpC (pAmpC) ( bla CMY , bla DHA ), carbapenemases ( bla NDM-1 , bla OXA-48 , bla VIM) , tetracyclines ( tet A and tetB), and fluoroquinolones ( aac(6’)-Ib ). Finally, integron genes intI1 and intI2 were inspected by PCR multiplex, and the 3’ conserved segment of class 1 integron ( qacEΔ1-sul1 ) was further amplified. Primer sequences, amplicon sizes, and PCR amplification conditions are presented in Table 1 . PCR results were revealed by electrophoresis on 2% agarose gel at 120V. Moreover, bla OXA-48 positive PCR products were sequenced with a 3500 XL Genetic Analyzer (Thermo Fisher Scientific, California, USA). The obtained sequences were confirmed using the NCBI BLAST program ( http://www.ncbi.nlm.nih.gov/BLAST ). Table 1 Target genes and PCR amplification conditions Genes Sequences (5 − 3’) PCR conditions Size (bp) References bla CTX−M F-TTTGCGATGTGCAGTACCAGTAA R-CGATATCGTTGGTGGTGCCATA 94°C/10 min, 30 cycles (94°C/40s, 59°C/40s, 72°C/1 min), 72°C/7 min 500 [ 48 ] bla CMY F-ATGATGAAAAAATCGTTATGC R-TTGCAGCTTTTCAAGAATGCGC 95°C/15 min, 30 cycles (94°C/30s, 50°C/30s, 72°C/2 min), 72°C/10 min 1200 [ 48 ] bla DHA F-TGATGGCACAGCAGGATATTC R-GCTTTGACTCTTTCGGTATTCG 94°C/10 min; 30 cycles (94°C/40 s, 60°C/40s, 72°C/1 min), 72°C/7 min 997 [ 49 ] bla NDM−1 F-GCTTTGGCGATCTGGTTTTC R-CGGAATGGCTCATCACGATC 94°C/10 min, 36 cycles (94°C/30s, 52°C/40s, 72°C/50 s), 72°C/5 min 621 [ 50 ] bla OXA−48 F-TTGGTGGCATCGATTATCGG R- GAGCACTTCTTTTGTGATGGC 95°C/15 min, 30 cycles (94°C/30s, 54°C/30s, 72°C/2min), 72°C/10 min 744 [ 51 ] bla VIM F-GATGGTGTTTGGTCGCATA R-CGAATGCGCAGCACCAG 94°C/10 min, 30 cycles (94°C/40s, 55°C/40s, 72°C/1 min), 72°C/7 min 390 [ 49 ] tet A F-GTAATTCTGAGCACTGTCGC R-CTGCCTGGACAACATTGCTT 95°C/5 min, 25 cycles (94°C/30s, 62/30s, 72°C 45s), 72°C 7min 937 [ 52 ] tet B F-CTCAGTATTCCAGCCTTTG R-CTAAGCACTTGTCTCCTGTT 95°C/5 min, 25 cycles (95°C/30s, 57°C/30s 72°C 20s), 72°C 7 min 416 [ 52 ] tet C F-TCTAACAATGCGCTCATCGT R-GGTTGAAGGCTCTCAAGGGC 95°C/5 min, 25 cycles (94°C/30s, 62/30s, 72°C 45s), 72°C 7min 570 [ 52 ] aac(6’)-Ib F-TTGCGATGCTCTATGAGTGGCTA R-CTCGAATGCCTGGCGTGTTT 95°C/5 min, 34 cycles (94°C/45s, 55°C/45s, 72°C/45s), 72°C/7 min 482 [ 53 ] intI1 F-GGGTCAAGGATCTGGATTTCG R-ACATGGGTGTAAATCATCGTC 95°C/5 min, 30 cycles (94°C/30s, 62°C/30s, 72°C/1 min), 72°C/5 min 483 [ 54 ] intI2 F-CACGGATATGCGACAAAAAGGT R-GTAGCAAACGAGTGACGAAATG 788 [ 54 ] qacΔE-sul1 F-GGCTGGCTTTTTCTTGTTATCG R-GCGAGGGTTTCCGAGAAGGTG 94°C/5 min, 30 cycles (94°C/30s, 63°C/30s, 72°C/1 min), 72°C/8 min 1125 [ 55 ] 3. Results 3.1. Detection and identification of cefotaxime-resistant strains Twenty-seven cefotaxime-resistant E. coli isolates were detected in cattle (n = 25) and sheep (n = 2) samples. The overall rate of positive samples was 9% (27/285), while 17% (25/145) and 1% (2/140) of cattle and sheep samples, respectively, were positive. The cefotaxime-resistant E. coli isolates were distributed among 12 of the 28 investigated farms (43%). The prevalence of positive farms fluctuated over animal species and regions. The total rate of positive bovine farms was 48% (10/21), while 29% (2/7) of the ovine farms were positive. As for regions, Heliopolis has the highest prevalence with five positive farms over 7 (71%), followed by Bouati Mahmoud and Hammam Debagh with 35% (06/17) and 33% (01/03) rates, respectively, while the only sampled farm in Medjez Ammar was negative. Regarding the farming system, 83% of the intensive farms were positive (5/6), while 32% of the semi-extensive farms were positive (7/22). Finally, regarding the nature of sampling regions, 5 of 8 farms located in urban zones were positive (63%), while 7 of the 20 farms in rural areas were positive (35%) (Table 2 ). Table 2 Phenotypic and genotypic traits of the 27 cefotaxime-resistant E. coli isolates Code of isolates* Farms Origins Resistance profiles** Detected genes** EC1* F12 Cattle CTX; AMC; AMX; CAZ; FEP; ATM; CIP; OFX; TE; DO; AK; SXT bla CTX−M ; tet A; intI1 ; qacΔE-sul1 EC2* F13 Sheep CTX; AMC; AMX; FEP; ATM; TE; SXT bla CTX−M ; intI1 EC 4* F18 Sheep CTX; AMC; AMX; CAZ; FEP; ATM bla CTX−M EC 8* F7 Cattle CTX; AMC; AMX; CAZ; FEP; ATM; ETP ; CIP; OFX; TE; DO; CN; AK; SXT bla CTX−M ; tet A; aac(6’)-Ib EC9 F7 Cattle CTX; AMC; AMX; CAZ; FOX; FEP; ATM; ETP ; IMP ; CIP; OFX; TE; DO; AK; SXT bla CTX−M ; bla NDM−1 ; bla CMY EC10 F7 Cattle CTX; AMC; AMX; CAZ; FOX; FEP; ATM; ETP ; IMP ; CIP; OFX; TE; DO; AK; SXT bla CTX−M ; bla NDM−1 ; bla CMY EC11* F7 Cattle CTX; AMC; AMX; CAZ; FEP; ATM; CIP; OFX; TE; DO; CN; AK; SXT bla CTX−M ; tet A; aac(6’)-Ib ; intI1 ; qacΔE-sul1 EC12 F7 Cattle CTX; AMC; AMX; CAZ; FOX; FEP; ATM; CIP; OFX; SXT bla CTX−M ; bla CMY ; aac(6’)-Ib ; intI1 EC13* F7 Cattle CTX; AMC; AMX; CAZ; FEP; ATM; SXT bla CTX−M ; intI1 EC14 F7 Cattle CTX; AMC; AMX; CAZ; FOX; FEP; ATM; ETP ; IMP ; CIP; OFX; TE; DO; SXT bla CTX−M ; bla NDM−1 ; bla CMY ; tet A; intI1 ; qacΔE-sul1, however , EC15* F7 Cattle CTX; AMC; AMX; CAZ; FEP; ATM; CIP; OFX; TE; DO; CN; AK; SXT bla CTX−M ; tet A; aac(6’)-Ib EC 16 F7 Cattle CTX; AMC; AMX; CAZ; FOX; FEP; ATM; ETP ; CIP; OFX; TE; CN; AK; SXT bla CTX−M ; bla CMY ; aac(6’)-Ib EC17 F6 Cattle CTX; AMC; AMX; CAZ; FOX; FEP; ATM; ETP ; IMP ; CIP; OFX; TE; DO; SXT bla NDM−1 ; bla CMY EC 18 F6 Cattle CTX; AMC; AMX; CAZ; FOX; FEP; ATM; ETP ; IMP ; CIP; OFX; TE; DO; SXT bla NDM−1 ; bla CMY EC19 F6 Cattle CTX; AMC; AMX; CAZ; FOX; FEP; ATM; ETP ; IMP ; CIP; OFX; TE; DO; SXT bla NDM−1 ; bla CMY EC20 F6 Cattle CTX; AMC; AMX; CAZ; FOX; FEP; ATM; ETP ; IMP ; CIP; OFX; TE; DO; SXT bla NDM−1 ; bla CMY ; tet B EC21 F6 Cattle CTX; AMC; AMX; CAZ; FOX; FEP; ATM; ETP ; IMP ; CIP; OFX; TE; DO; SXT bla NDM−1 ; bla CMY ; tet B EC22 F4 Cattle CTX; AMC; AMX; CAZ; FOX; FEP; ATM; ETP ; IMP ; CIP; OFX; TE; DO; SXT bla NDM−1 ; bla CMY EC23 F4 Cattle CTX; AMC; AMX; CAZ; FOX; FEP; ATM; ETP ; IMP ; CIP; OFX; TE; DO; SXT bla NDM−1 ; bla CMY EC24* F4 Cattle CTX; AMC; AMX; CAZ; FEP; ATM; ETP ; CN; SXT bla CTX−M ; intI1 ; qacΔE-sul1 EC26* F1 Cattle CTX; AMC; AMX; FEP; ATM; SXT bla CTX−M ; intI1 EC27* F2 Cattle CTX; AMC; AMX; CAZ; FEP; ATM; OFX; TE; DO bla CTX−M EC28* F2 Cattle CTX; AMC; AMX; CAZ; FEP; ATM; ETP ; IMP ; CIP; OFX; TE; DO; AK bla CTX−M ; bla OXA−181 EC30* F20 Cattle CTX; AMC; AMX; FEP; ATM; TE; CN; AK; SXT bla CTX−M ; intI1 EC49* F23 Cattle CTX; AMC; AMX; CAZ; FEP; ATM; TE; DO; SXT bla CTX−M ; intI1 ; qacΔE-sul1 EC50* F24 Cattle CTX; AMC; AMX; FEP; ATM bla CTX−M EC 51 F27 Cattle CTX; AMC; AMX; CAZ; FOX; FEP; ATM; OFX; TE; DO bla CTX−M ; bla DHA Abbreviation: Cefotaxime (CTX), ceftazidime (CAZ), aztreonam (ATM), cefepime (FEP), cefoxitin (FOX), amoxicillin/clavulanic acid (AMC), amoxicillin (AMX), ertapenem (ETP), imipenem (IMP), ciprofloxacin (CIP), ofloxacin (OFX), tetracycline (TE), doxycycline (DO), gentamicin (CN), amikacin (AK), trimethoprim-sulfamethoxazole (SXT, 25mg). * ESBL-producing E. coli isolates by the DDST. ** Resistance to imipenem/and or ertapenem and carbapenemase genes are in bold. 3.2. Antibiotic susceptibility profiles By analyzing the antibiotic resistance profile of each screened E. coli isolate, 85% of the isolates were multidrug-resistant (MDR), i.e., resistant against at least one agent in three antimicrobial categories or more, and highly resistant to beta-lactams. All isolates were resistant to cefotaxime, cefepime, aztreonam, amoxicillin-clavulanic acid, and amoxicillin. Ceftazidime and cefoxitin resistance were observed in 85% and 48% of isolates, respectively. Interestingly, 52% and 41% of isolates were resistant to ertapenem and imipenem, respectively, among which 11 (all imipenem-resistant isolates) were co-resistant to both antibiotics. Resistance frequencies to fluoroquinolones and tetracyclines were also high being 63% for ciprofloxacin and 70% for ofloxacin, while 78% and 67% were resistant to tetracycline and doxycycline, respectively. Moreover, 81% of isolates displayed resistance to trimethoprim-sulfamethoxazole. Resistance to aminoglycosides was low, with 22% and 33% resistance rates for gentamicin and amikacin, respectively. Finally, the colistin MIC was intermediate (≤ 2 µg/ml) for all the isolates (Table 2 , Fig. 1 ). According to the DDST, ESBL production was observed in 14 (14/27; 52%) cefotaxime-resistant isolates, and the remaining 13 isolates displayed AmpC-phenotype. Among the carbapenem-resistant isolates, ten (10/27; 37%) were positive for the EDTA test and thus considered metallo-carbapenemase producers. 3.3. Resistance genes detection The bla CTX−M gene was detected in 20 isolates (74%). Moreover, ten isolates carried the bla NDM−1 gene (37%), and one harboured a bla OXA−48−like gene (4%), which was later identified by sequencing as a bla OXA−181 . However, the bla VIM gene was not detected. The bla CMY gene was identified in 12 isolates (44%), while bla DHA was found in one (4%). Furthermore, tet A and tet B genes were identified in five (19%) and two (7%) cefotaxime-resistant isolates, respectively. The tet gene was not detected. The aac(6’)-Ib gene was detected in five E. coli isolates (19%). Finally, ten isolates (37%) harbored the class 1 integron gene intI1 , of which five also included the conserved sequence qacEΔ1-sul1 , while no int I2 gene was identified (Table 2 and Fig. 2 ). 4. Discussion In the present study, we aimed to investigate the dissemination of third-generation cephalosporin-resistant E. coli among bovine and ovine farms in Guelma, northeast of Algeria. Our results showed that 43% of the investigated farms harbored 3GC-resistant E. coli , with 27 isolates collected from cattle and sheep fecal samples. The isolates displayed various antimicrobial resistance genes encoding ESBL, carbapenemase, and AmpC. A notable variation in the prevalence of 3GC-resistant E. coli across farms was observed in this study and was mainly related to animal species, farming systems, and sampling regions. The significant difference in positive samples in cattle (17%) compared to sheep samples (1%) is in concordance with a previous study in northern Spain [ 17 ]. However, unlike these findings, a recent study from the USA reported a higher percentage of cefotaxime-resistant and ESBL-producing E. coli in sheep than in cattle [ 19 ]. However, it should be noted that the number of the investigated ovine herds in our study (n = 7) is much lower than the bovine ones (n = 21), and thus, the obtained results cannot be comparable. Furthermore, the farming system affects the variation of positive farms with a prevalence of 83% in intensive production and 32% in semi-extensive farming, which aligns with previous results [ 17 , 28 ]. Animals reared in intensive farms are confined and thus more influenced by the farm conditions, including hygiene, airing, food and water quality, animal density, and proximity [ 29 ]. In addition, antibiotic consumption tends to be higher in intensive production to fulfil therapeutic and prophylactic purposes and accelerate animal growth [ 30 ]. Such practice mainly enhances the selection and spread of antibiotic-resistant isolates as well as the dissemination of mobile genetic elements carrying resistance genes. On the other hand, the geographical fluctuation of positive farm prevalence and the high percentage obtained in urban regions (63%) compared to rural regions (35%) might be explained by the clonal spread of resistant isolates from the human environment through contaminated water, waste products and the movement of humans and contaminated vehicles [ 18 , 31 ]. Population pressure, the presence of industries, and wastewater treatment plants are well-known hotspots for antimicrobial-resistant bacteria. This finding implies the spread of 3GC-resistant isolates across interconnected niches, including humans, animals and the environment. The antibiotic susceptibility profiles of the collected isolates are alarming, considering the high prevalence of multidrug-resistant isolates (85%) detected. Moreover, the isolates showed high resistance rates against beta-lactams, including second-, third-, and fourth-generation cephalosporins. Significant resistance rates to ertapenem and imipenem were also observed, although carbapenems are not used in animal production. Notably, the carbapenem-resistant E. coli isolates were detected in four farms in the same urban region and managed under an intensive farming system. This underscores the possible spread of carbapenem-resistant strains from the human environment in this urban zone and the potential role of intensive production practices in farm maintenance. High resistance percentages were also shown against tetracyclines, fluoroquinolones, and trimethoprim-sulfamethoxazole, similar to previous studies [ 17 , 19 ]. The broad resistance to tetracyclines could be attributed to their extensive use in animal production [ 13 ]. Besides, it was previously described that ESBL-producing E. coli is commonly resistant to fluoroquinolones and trimethoprim-sulfamethoxazole, which might justify these findings [ 19 ]. Trimethoprim and sulfonamides are among the ancient antibiotics used in livestock and human medicine; therefore, high resistance rates to both antibiotics are commonly reported globally, and it seems that their genetic supports ( dhf and sul genes) have been established as intrinsic markers in the majority of E. coli isolates. One of the study's most important findings is the relatively high resistance rates to ertapenem (52%) and to imipenem (41%) among the 3GC-resistant isolates. Globally, carbapenem resistance remains scarce in Gram-negative bacteria, including E. coli , of animal origin; therefore, this phenomenon is a cause of concern to human, animal, and environmental health [ 32 ]. Indeed, this is of particular concern since the isolates are ESBL and/or pAmpC producers, which dramatically reduces the therapeutic options against such isolates. The detected MDR phenotypes are considered common traits of ESBL-producing Gram-negative bacteria, including E. coli. Indeed, in ESBL-producing isolates, genes encoded by ESBL enzymes are mainly plasmid-borne. Those plasmids are commonly conjugative plasmids with large molecular sizes and harboring several genes encoding antibiotic resistance where insertion sequences (e.g., IS 26 , IS 1133 , IS 903 , IS Ecp1 , IS CR ) have been implicated in their co-association in close position. Furthermore, integrons also play an important role in the collection of various antimicrobial resistance genes. Several antimicrobial resistance genes were identified in this study and aligned with the phenotypic resistance profiles. The bla CTX−M gene was the most frequent (74%) detected in 18 bovine and two ovine isolates. The first report of an ESBL gene in cattle was in Japan in 2000, where a bla CTX−M−2 -producing E. coli was isolated from a bovine fecal sample [ 33 ]. Later, several studies have identified ESBL genes in cattle worldwide [ 16 , 34 , 35 ]. In contrast, reports of ESBL genes from ovine origin are less frequent [ 17 , 28 ], but this is likely because of the need for more studies in this sector rather than the actual infrequency. In Algeria, ESBL genes from animal sources have been previously reported [ 20 , 35 – 37 ]. However, only one recent study has described the presence of ESBL-producing E. coli in bovine and ovine abscesses [ 39 ], with no previous reports on the fecal carriage of those isolates in cattle or sheep to date. Alarmingly, ten bla NDM−1 - and one bla OXA−181 -producing E. coli were identified in our study among four bovine farms ( bla NDM−1 in 3 farms and bla OXA−181 in one farm). Several studies have identified cattle's bla NDM−1 and bla OXA−181 genes [ 17 , 40 ]. Regarding Algeria, carbapenemase-producing E. coli have been previously reported in companion animals [ 41 ], wild animals [ 37 , 42 ], and animal products [ 43 ]. An earlier study reported the carriage of K. pneumoniae harboring the bla OXA−48 gene in cattle and sheep [ 22 ]. Nevertheless, to our knowledge, this is the first report of carbapenemase-producing E. coli in cattle. Molecular investigation of the genetic relatedness (such as by Multilocus Sequence typing) of these isolates was not performed owing to many financial limitations; however, according to the phenotypic resistance profiles and the gene contents of those isolates, especially those from the same farm, the clonal relationship of isolates is quite possible. Further studies are needed to prove this hypothesis. AmpC genes have been detected only in bovine samples. The bla CMY gene was found in 12 isolates, while the bla DHA was only carried by one isolate. AmpC genes have been previously reported in cattle [ 44 , 45 ] and sheep [ 17 ] worldwide. Prior studies have described AmpC genes' presence in Algeria's animal sources [ 36 , 41 ]. However, as far as we know, this is the first detection of AmpC genes in Algerian bovine farms. Tetracycline-resistance genes tet A and tet B were also identified in our study. These genes have been previously reported in bovine and ovine samples [ 39 ]. Additionally, the aac(6’)-Ib gene was detected in five E. coli isolates (19%), which aligns with their phenotypic resistance to amikacin. Moreover, in the absence of sequencing, aac(6’)-Ib can be the aac(6’)-Ib-cr variant encoding not only aminoglycoside resistance but also fluoroquinolone resistance, a variant commonly reported in ESBL/pAmpC-producing E. coli isolates of various origins. Finally, the intI1 gene of class 1 integron was identified in ten isolates, 5 of which amplified the qacEΔ1-sul1 conserved region. The class 1 integrons are frequently located on plasmids and thus significantly transmit antimicrobial resistance genes in humans and food-producing animals [ 46 , 47 ]. While our study provides valuable insights into the prevalence of third-generation cephalosporin-resistant E. coli in cattle and sheep in Algeria, several limitations must be acknowledged. A key limitation of the study is the absence of Whole Genome Sequencing (WGS), which would have significantly enhanced our ability to determine the clonal relationships between isolates and track the dissemination of antimicrobial resistance (AMR) genes. WGS is crucial for understanding the genetic diversity of E. coli strains and the mechanisms of resistance, such as clonal expansion or horizontal gene transfer, which are fundamental for comprehensively assessing the spread of resistance in the studied populations. Although we employed PCR-based detection of resistance genes and phenotypic resistance profiling, these methods do not provide insights into resistance genes' plasmid or chromosomal localization. The absence of WGS limits our ability to investigate the role of genetic elements such as plasmids in the transfer and spread of resistance, particularly for genes like bla NDM− 1 and bla OXA−181 . Furthermore, the lack of genetic characterization makes it difficult to determine whether the observed resistance is primarily due to clonal expansion of resistant strains or the result of horizontal gene transfer across different environments. Another limitation noted by the reviewer is the lack of further genetic characterization to support the observed differences in resistance prevalence between intensive and semi-extensive farming systems and the urban-rural differences in resistance prevalence. While these findings are statistically significant, the absence of genetic data leaves the potential epidemiological links between these systems speculative. Specifically, the potential contamination from human sources in rural areas, as suggested by the observed urban-rural differences in resistance prevalence, requires further investigation through genetic analyses to confirm whether human-related contamination plays a role in the spread of resistant strains. Due to these limitations, the current study primarily offers epidemiological insights into the prevalence of AMR in livestock without the depth of genetic analysis needed to characterize the underlying mechanisms fully. While helpful, we acknowledge that the reliance on PCR and phenotypic resistance profiling does not provide a complete picture of the genetic underpinnings of AMR in E. coli . As such, we recommend that future studies incorporate WGS to enhance the characterization of E. coli strains and their resistance mechanisms. WGS would allow for a more thorough investigation of the clonal relationships, genetic diversity, and potential pathways for disseminating AMR genes across different environments. In conclusion, our results highlight the presence and the spread of ESBL-, AmpC- and carbapenemase-producing E. coli among bovine and ovine herds. Carrying such strains in food-producing animals threatens public health, considering the potential risk of their zoonotic transmission to humans. In addition, this study underscores the impact of intensive farming systems and the proximity of farms to urban areas on the detection and selection of resistant bacteria and their genes in animals. However, more extensive studies are needed to confirm those observations. It is, therefore, crucial to implement efficient monitoring programs within an integrated “One Health” approach and enhance hygiene measures, especially in intensive farms, to mitigate the propagation of these bacteria. Further studies are required to assess better the circulation of resistant bacteria and their genetic determinants among animals and determine the risk factors contributing to their dissemination and maintenance in the farm environment. Declarations Ethics approval and consent to participate Not applicable Consent for publication Not applicable Data Availability Statement: The data presented in this study are available within the article. Raw data supporting this study are available from the corresponding author upon reasonable request. Conflicts of Interest: None of the authors has financial or personal relationships that could inappropriately influence or bias the paper's content. Funding Statement This work was supported and funded by the Deanship of Scientific Research at Imam Mohammad Ibn Saud Islamic University (IMSIU). (grant number IMSIU-DDRSP2502 ). Author Contributions: Conceptualization, H.K. and A.T.; methodology, H.K. and A.T.; software, H.R. and M.S.A.; validation, A.T. and Z.C.; formal analysis, H.R. and M.S.A.; investigation, H.K. and Z.C.; resources, H.K. and A.T.; data curation, Z.C. and H.K. and A.T.; writing—original draft preparation, H.K. and A.T.; writing—review and editing, A.T. and N.A.I.; visualization, A.T., N.A.I. and N.S.B.; supervision, A.T.; project administration, A.T. and M.S.A.; funding acquisition, N.A.I. and N.S.B. All authors have read and agreed to the published version of the manuscript. Acknowledgements: We are grateful to the veterinarians and farmers who contributed to the sampling and data collection; we also thank Mr Ali Boumegoura for his contribution to the sequencing. Conflict of Interests: The authors declare that they have no conflict of interest. References Ouchar Mahamat, O.; Kempf, M.; Lounnas, M.; Tidjani, A.; Hide, M.; Benavides, J.A.; Carrière, C.; Bañuls, A.-L.; Jean-Pierre, H.; Ouedraogo, A.-S.; et al. Epidemiology and Prevalence of Extended-Spectrum β-Lactamase- and Carbapenemase-Producing Enterobacteriaceae in Humans, Animals and the Environment in West and Central Africa. International Journal of Antimicrobial Agents 2021 , 57 , 106203, doi:10.1016/j.ijantimicag.2020.106203. Palmeira, J.D.; Cunha, M.V.; Carvalho, J.; Ferreira, H.; Fonseca, C.; Torres, R.T. Emergence and Spread of Cephalosporinases in Wildlife: A Review. Animals 2021 , 11 , 1765, doi:10.3390/ani11061765. WHO, W.H.O. WHO List of Medically Important Antimicrobials: A Risk Management Tool for Mitigating Antimicrobial Resistance Due to Non-Human Use ; World Health Organization: Geneva, 2024; ISBN 978-92-4-008461-2. Hammoudi Halat, D.; Ayoub Moubareck, C. The Current Burden of Carbapenemases: Review of Significant Properties and Dissemination among Gram-Negative Bacteria. Antibiotics 2020 , 9 , 186, doi:10.3390/antibiotics9040186. WHO, W.H.O. WHO Bacterial Priority Pathogens List 2024: Bacterial Pathogens of Public Health Importance, to Guide Research, Development, and Strategies to Prevent and Control Antimicrobial Resistance ; 1st ed.; World Health Organization: Geneva, 2024; ISBN 978-92-4-009346-1. Bush, K.; Bradford, P.A. Epidemiology of β-Lactamase-Producing Pathogens. Clin Microbiol Rev 2020 , 33 , e00047-19, doi:10.1128/CMR.00047-19. Tello, M.; Ocejo, M.; Oporto, B.; Lavín, J.L.; Hurtado, A. Within-Farm Dynamics of ESBL-Producing Escherichia Coli in Dairy Cattle: Resistance Profiles and Molecular Characterization by Long-Read Whole-Genome Sequencing. Front. Microbiol. 2022 , 13 , 936843, doi:10.3389/fmicb.2022.936843. Gelalcha, B.D.; Kerro Dego, O. Extended-Spectrum Beta-Lactamases Producing Enterobacteriaceae in the USA Dairy Cattle Farms and Implications for Public Health. Antibiotics 2022 , 11 , 1313, doi:10.3390/antibiotics11101313. ECDC, (European Centre for Disease Prevention and Control); EFSA, (European Food Safety Authority); EMA, (European Medicines Agency) Third Joint Inter‐agency Report on Integrated Analysis of Consumption of Antimicrobial Agents and Occurrence of Antimicrobial Resistance in Bacteria from Humans and Food‐producing Animals in the EU/EEA. EFS2 2021 , 19 , doi:10.2903/j.efsa.2021.6712. Ramírez-Castillo, F.Y.; Guerrero-Barrera, A.L.; Avelar-González, F.J. An Overview of Carbapenem-Resistant Organisms from Food-Producing Animals, Seafood, Aquaculture, Companion Animals, and Wildlife. Front. Vet. Sci. 2023 , 10 , 1158588, doi:10.3389/fvets.2023.1158588. Mairi, A.; Pantel, A.; Sotto, A.; Lavigne, J.-P.; Touati, A. OXA-48-like Carbapenemases Producing Enterobacteriaceae in Different Niches. Eur J Clin Microbiol Infect Dis 2018 , 37 , 587–604, doi:10.1007/s10096-017-3112-7. Benavides, J.A.; Salgado-Caxito, M.; Opazo-Capurro, A.; González Muñoz, P.; Piñeiro, A.; Otto Medina, M.; Rivas, L.; Munita, J.; Millán, J. ESBL-Producing Escherichia Coli Carrying CTX-M Genes Circulating among Livestock, Dogs, and Wild Mammals in Small-Scale Farms of Central Chile. Antibiotics 2021 , 10 , 510, doi:10.3390/antibiotics10050510. Mulchandani, R.; Wang, Y.; Gilbert, M.; Van Boeckel, T.P. Global Trends in Antimicrobial Use in Food-Producing Animals: 2020 to 2030. PLOS Glob Public Health 2023 , 3 , e0001305, doi:10.1371/journal.pgph.0001305. Hassen, B.; Saloua, B.; Abbassi, M.S.; Ruiz-Ripa, L.; Mama, O.M.; Hassen, A.; Hammami, S.; Torres, C. Mcr-1 Encoding Colistin Resistance in CTX-M-1/CTX-M-15- Producing Escherichia Coli Isolates of Bovine and Caprine Origins in Tunisia. First Report of CTX-M-15-ST394/D E. Coli from Goats. Comp Immunol Microbiol Infect Dis 2019 , 67 , 101366, doi:10.1016/j.cimid.2019.101366. Rahman, S.; Hollis, A. The Effect of Antibiotic Usage on Resistance in Humans and Food-Producing Animals: A Longitudinal, One Health Analysis Using European Data. Front. Public Health 2023 , 11 , 1170426, doi:10.3389/fpubh.2023.1170426. Braun, S.D.; Ahmed, M.F.E.; El-Adawy, H.; Hotzel, H.; Engelmann, I.; Weiß, D.; Monecke, S.; Ehricht, R. Surveillance of Extended-Spectrum Beta-Lactamase-Producing Escherichia Coli in Dairy Cattle Farms in the Nile Delta, Egypt. Front. Microbiol. 2016 , 7 , doi:10.3389/fmicb.2016.01020. Tello, M.; Ocejo, M.; Oporto, B.; Hurtado, A. Prevalence of Cefotaxime-Resistant Escherichia Coli Isolates from Healthy Cattle and Sheep in Northern Spain: Phenotypic and Genome-Based Characterization of Antimicrobial Susceptibility. Appl Environ Microbiol 2020 , 86 , e00742-20, doi:10.1128/AEM.00742-20. Gelalcha, B.D.; Mohamed, R.I.; Gelgie, A.E.; Kerro Dego, O. Molecular Epidemiology of Extended-Spectrum Beta-Lactamase-Producing-Klebsiella Species in East Tennessee Dairy Cattle Farms. Front. Microbiol. 2024 , 15 , 1439363, doi:10.3389/fmicb.2024.1439363. Mandujano, A.; Cortés-Espinosa, D.V.; Vásquez-Villanueva, J.; Guel, P.; Rivera, G.; Juárez-Rendón, K.; Cruz-Pulido, W.L.; Aguilera-Arreola, G.; Guerrero, A.; Bocanegra-García, V.; et al. Extended-Spectrum β-Lactamase-Producing Escherichia Coli Isolated from Food-Producing Animals in Tamaulipas, Mexico. Antibiotics 2023 , 12 , 1010, doi:10.3390/antibiotics12061010. Yousfi, M.; Mairi, A.; Touati, A.; Hassissene, L.; Brasme, L.; Guillard, T.; De Champs, C. Extended Spectrum β-Lactamase and Plasmid Mediated Quinolone Resistance in Escherichia Coli Fecal Isolates from Healthy Companion Animals in Algeria. Journal of Infection and Chemotherapy 2016 , 22 , 431–435, doi:10.1016/j.jiac.2016.03.005. Chabou, S.; Leulmi, H.; Davoust, B.; Aouadi, A.; Rolain, J.-M. Prevalence of Extended-Spectrum β-Lactamase- and Carbapenemase-Encoding Genes in Poultry Faeces from Algeria and Marseille, France. Journal of Global Antimicrobial Resistance 2018 , 13 , 28–32, doi:10.1016/j.jgar.2017.11.002. Mairi, A.; Pantel, A.; Ousalem, F.; Sotto, A.; Touati, A.; Lavigne, J.-P. OXA-48-Producing Enterobacterales in Different Ecological Niches in Algeria: Clonal Expansion, Plasmid Characteristics and Virulence Traits. Journal of Antimicrobial Chemotherapy 2019 , 74 , 1848–1855, doi:10.1093/jac/dkz146. Mezhoud, H.; Boyen, F.; Touazi, L.; Garmyn, A.; Moula, N.; Smet, A.; Haesbrouck, F.; Martel, A.; Iguer-Ouada, M.; Touati, A. Extended Spectrum β-Lactamase Producing Escherichia Coli in Broiler Breeding Roosters: Presence in the Reproductive Tract and Effect on Sperm Motility. Animal Reproduction Science 2015 , 159 , 205–211, doi:10.1016/j.anireprosci.2015.06.021. CLSI Performance Standards for Antimicrobial Susceptibility Testing M100 ; 30th ed.; Clinical and laboratory standards institute (CLSI), 2020; ISBN 978-1-68440-066-9. NCDC, N.C. for D.C. Broth-Microdilution Colistin Susceptibility Test for Aerobic Gram-Negative Bacteria 2020. EUCAST EUCAST Guidelines for Detection of Resistance Mechanisms and Specific Resistances of Clinical and/or Epidemiological Importance 2017. Nguyen, N.T.; Nguyen, H.M.; Nguyen, C.V.; Nguyen, T.V.; Nguyen, M.T.; Thai, H.Q.; Ho, M.H.; Thwaites, G.; Ngo, H.T.; Baker, S.; et al. Use of Colistin and Other Critical Antimicrobials on Pig and Chicken Farms in Southern Vietnam and Its Association with Resistance in Commensal Escherichia Coli Bacteria. Appl Environ Microbiol 2016 , 82 , 3727–3735, doi:10.1128/AEM.00337-16. Zhao, X.; Zhao, H.; Zhou, Z.; Miao, Y.; Li, R.; Yang, B.; Cao, C.; Xiao, S.; Wang, X.; Liu, H.; et al. Characterization of Extended-Spectrum β-Lactamase-Producing Escherichia Coli Isolates That Cause Diarrhea in Sheep in Northwest China. Microbiol Spectr 2022 , 10 , e01595-22, doi:10.1128/spectrum.01595-22. Gharieb, R.; Saad, M.; Khedr, M.; El Gohary, A.; Ibrahim, H. Occurrence, Virulence, Carbapenem Resistance, Susceptibility to Disinfectants and Public Health Hazard of Pseudomonas Aeruginosa Isolated from Animals, Humans and Environment in Intensive Farms. J of Applied Microbiology 2022 , 132 , 256–267, doi:10.1111/jam.15191. Prack McCormick, B.; Quiroga, M.P.; Álvarez, V.E.; Centrón, D.; Tittonell, P. Antimicrobial Resistance Dissemination Associated with Intensive Animal Production Practices in Argentina: A Systematic Review and Meta-Analysis. Revista Argentina de Microbiología 2023 , 55 , 25–42, doi:10.1016/j.ram.2022.07.001. Sanou, S.; Ouedraogo, A.S.; Lounnas, M.; Zougmore, A.; Pooda, A.; Zoungrana, J.; Ouedraogo, G.A.; Traore-Ouedraogo, R.; Ouchar, O.; Jean-Pierre, H.; et al. Epidemiology and Molecular Characterization of Enterobacteriaceae Producing Extended-Spectrum β-Lactamase in Intensive and Extensive Breeding Animals in Burkina Faso. PAMJ-OH 2022 , 8 , doi:10.11604/pamj-oh.2022.8.4.33553. Dandachi, I.; Chabou, S.; Daoud, Z.; Rolain, J.-M. Prevalence and Emergence of Extended-Spectrum Cephalosporin-, Carbapenem- and Colistin-Resistant Gram Negative Bacteria of Animal Origin in the Mediterranean Basin. Front. Microbiol. 2018 , 9 , 2299, doi:10.3389/fmicb.2018.02299. Shiraki, Y.; Shibata, N.; Doi, Y.; Arakawa, Y. Escherichia Coli Producing CTX-M-2 β-Lactamase in Cattle, Japan. Emerg. Infect. Dis. 2004 , 10 , 69–75, doi:10.3201/eid1001.030219. Börjesson, S.; Ny, S.; Egervärn, M.; Bergström, J.; Rosengren, Å.; Englund, S.; Löfmark, S.; Byfors, S. Limited Dissemination of Extended-Spectrum β-Lactamase– and Plasmid-Encoded AmpC–Producing Escherichia Coli from Food and Farm Animals, Sweden. Emerg. Infect. Dis. 2016 , 22 , 634–640, doi:10.3201/eid2204.151142. Ben Haj Yahia, A.; Tayh, G.; Landolsi, S.; Maamar, E.; Galai, N.; Landoulsi, Z.; Messadi, L. First Report of OXA-48 and IMP Genes Among Extended-Spectrum Beta-Lactamase-Producing Escherichia Coli Isolates from Diarrheic Calves in Tunisia. Microbial Drug Resistance 2023 , 29 , 150–162, doi:10.1089/mdr.2022.0129. Belmahdi, M.; Bakour, S.; Al Bayssari, C.; Touati, A.; Rolain, J.-M. Molecular Characterisation of Extended-Spectrum β-Lactamase- and Plasmid AmpC-Producing Escherichia Coli Strains Isolated from Broilers in Béjaïa, Algeria. Journal of Global Antimicrobial Resistance 2016 , 6 , 108–112, doi:10.1016/j.jgar.2016.04.006. Bachiri, T.; Bakour, S.; Ladjouzi, R.; Thongpan, L.; Rolain, J.M.; Touati, A. High Rates of CTX-M-15-Producing Escherichia Coli and Klebsiella Pneumoniae in Wild Boars and Barbary Macaques in Algeria. Journal of Global Antimicrobial Resistance 2017 , 8 , 35–40, doi:10.1016/j.jgar.2016.10.005. Brahmi, S.; Touati, A.; Dunyach-Remy, C.; Sotto, A.; Pantel, A.; Lavigne, J.-P. High Prevalence of Extended-Spectrum β-Lactamase-Producing Enterobacteriaceae in Wild Fish from the Mediterranean Sea in Algeria. Microbial Drug Resistance 2018 , 24 , 290–298, doi:10.1089/mdr.2017.0149. Yousfi, C.; Oueslati, S.; Daaboul, D.; Girlich, D.; Proust, A.; Bentchouala, C.; Naas, T. Antibiotic Susceptibility Profiles of Bacterial Isolates Recovered from Abscesses in Cattle and Sheep at a Slaughterhouse in Algeria. Microorganisms 2024 , 12 , 524, doi:10.3390/microorganisms12030524. Carfora, V.; Diaconu, E.L.; Ianzano, A.; Di Matteo, P.; Amoruso, R.; Dell’Aira, E.; Sorbara, L.; Bottoni, F.; Guarneri, F.; Campana, L.; et al. The Hazard of Carbapenemase (OXA-181)-Producing Escherichia Coli Spreading in Pig and Veal Calf Holdings in Italy in the Genomics Era: Risk of Spill over and Spill Back between Humans and Animals. Front. Microbiol. 2022 , 13 , 1016895, doi:10.3389/fmicb.2022.1016895. Yousfi, M.; Touati, A.; Mairi, A.; Brasme, L.; Gharout-Sait, A.; Guillard, T.; De Champs, C. Emergence of Carbapenemase-Producing Escherichia Coli Isolated from Companion Animals in Algeria. Microbial Drug Resistance 2016 , 22 , 342–346, doi:10.1089/mdr.2015.0196. Bouaziz, A.; Loucif, L.; Ayachi, A.; Guehaz, K.; Bendjama, E.; Rolain, J.-M. Migratory White Stork ( Ciconia Ciconia ): A Potential Vector of the OXA-48-Producing Escherichia Coli ST38 Clone in Algeria. Microbial Drug Resistance 2018 , 24 , 461–468, doi:10.1089/mdr.2017.0174. Yaici, L.; Haenni, M.; Métayer, V.; Saras, E.; Mesbah Zekar, F.; Ayad, M.; Touati, A.; Madec, J.-Y. Spread of ESBL/AmpC-Producing Escherichia Coli and Klebsiella Pneumoniae in the Community through Ready-to-Eat Sandwiches in Algeria. International Journal of Food Microbiology 2017 , 245 , 66–72, doi:10.1016/j.ijfoodmicro.2017.01.011. Collis, R.M.; Biggs, P.J.; Burgess, S.A.; Midwinter, A.C.; Brightwell, G.; Cookson, A.L. Prevalence and Distribution of Extended-Spectrum β-Lactamase and AmpC-Producing Escherichia Coli in Two New Zealand Dairy Farm Environments. Front. Microbiol. 2022 , 13 , 960748, doi:10.3389/fmicb.2022.960748. Nossair, M.A.; Abd El Baqy, F.A.; Rizk, M.S.Y.; Elaadli, H.; Mansour, A.M.; Abd El-Aziz, A.H.; Alkhedaide, A.; Soliman, M.M.; Ramadan, H.; Shukry, M.; et al. Prevalence and Molecular Characterization of Extended-Spectrum β-Lactamases and AmpC β-Lactamase-Producing Enterobacteriaceae among Human, Cattle, and Poultry. Pathogens 2022 , 11 , 852, doi:10.3390/pathogens11080852. Singh, R.; Schroeder, C.M.; Meng, J.; White, D.G.; McDermott, P.F.; Wagner, D.D.; Yang, H.; Simjee, S.; DebRoy, C.; Walker, R.D.; et al. Identification of Antimicrobial Resistance and Class 1 Integrons in Shiga Toxin-Producing Escherichia Coli Recovered from Humans and Food Animals. Journal of Antimicrobial Chemotherapy 2005 , 56 , 216–219, doi:10.1093/jac/dki161. Sabbagh, P.; Rajabnia, M.; Maali, Am.; Ferdosi-Shahandashti, E. Integron and Its Role in Antimicrobial Resistance: A Literature Review on Some Bacterial Pathogens. Iranian Journal of Basic Medical Sciences 2021 , 24 , doi:10.22038/ijbms.2020.48905.11208. Kiiru, J.; Kariuki, S.; Goddeeris, B.M.; Butaye, P. Analysis of β-Lactamase Phenotypes and Carriage of Selected β-Lactamase Genes among Escherichia Coli Strains Obtained from Kenyan Patients during an 18-Year Period. BMC Microbiol 2012 , 12 , 155, doi:10.1186/1471-2180-12-155. Dallenne, C.; Da Costa, A.; Decré, D.; Favier, C.; Arlet, G. Development of a Set of Multiplex PCR Assays for the Detection of Genes Encoding Important β-Lactamases in Enterobacteriaceae. Journal of Antimicrobial Chemotherapy 2010 , 65 , 490–495, doi:10.1093/jac/dkp498. Poirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for Detection of Acquired Carbapenemase Genes. Diagnostic Microbiology and Infectious Disease 2011 , 70 , 119–123, doi:10.1016/j.diagmicrobio.2010.12.002. Mellouk, F.Z.; Bakour, S.; Meradji, S.; Al-Bayssari, C.; Bentakouk, M.C.; Zouyed, F.; Djahoudi, A.; Boutefnouchet, N.; Rolain, J.M. First Detection of VIM-4-Producing Pseudomonas Aeruginosa and OXA-48-Producing Klebsiella Pneumoniae in Northeastern (Annaba, Skikda) Algeria. Microbial Drug Resistance 2017 , 23 , 335–344, doi:10.1089/mdr.2016.0032. Guardabassi, L.; Dijkshoorn, L.; Collard, J.-M.; Olsen, J.E.; Dalsgaard, A. Distribution and In-Vitro Transfer of Tetracycline Resistance Determinants in Clinical and Aquatic Acinetobacter Strains. Journal of Medical Microbiology 2000 , 49 , 929–936, doi:10.1099/0022-1317-49-10-929. Park, C.H.; Robicsek, A.; Jacoby, G.A.; Sahm, D.; Hooper, D.C. Prevalence in the United States of Aac(6 ′ ) - Ib - Cr Encoding a Ciprofloxacin-Modifying Enzyme. Antimicrob Agents Chemother 2006 , 50 , 3953–3955, doi:10.1128/AAC.00915-06. Mazel, D.; Dychinco, B.; Webb, V.A.; Davies, J. Antibiotic Resistance in the ECOR Collection: Integrons and Identification of a Novel Aad Gene. Antimicrob Agents Chemother 2000 , 44 , 1568–1574, doi:10.1128/AAC.44.6.1568-1574.2000. Sáenz, Y.; Briñas, L.; Domínguez, E.; Ruiz, J.; Zarazaga, M.; Vila, J.; Torres, C. Mechanisms of Resistance in Multiple-Antibiotic-Resistant Escherichia Coli Strains of Human, Animal, and Food Origins. Antimicrob Agents Chemother 2004 , 48 , 3996–4001, doi:10.1128/AAC.48.10.3996-4001.2004. Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterials3GCpaper15042025.docx Cite Share Download PDF Status: Published Journal Publication published 01 Aug, 2025 Read the published version in BMC Microbiology → Version 1 posted Editorial decision: Revision requested 23 May, 2025 Reviews received at journal 22 May, 2025 Reviewers agreed at journal 16 May, 2025 Reviews received at journal 04 May, 2025 Reviewers agreed at journal 28 Apr, 2025 Reviewers agreed at journal 25 Apr, 2025 Reviewers invited by journal 21 Apr, 2025 Submission checks completed at journal 20 Apr, 2025 First submitted to journal 19 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5999651","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":445581772,"identity":"6e20a0bb-436e-4906-92d6-e45b1af6cf58","order_by":0,"name":"Hassina KIRAT","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Hassina","middleName":"","lastName":"KIRAT","suffix":""},{"id":445581776,"identity":"d29e6142-5da7-4b80-95ff-bcabd364fe6a","order_by":1,"name":"Hamza RAHAB","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Hamza","middleName":"","lastName":"RAHAB","suffix":""},{"id":445581778,"identity":"92d7d019-21d4-4c83-a18d-d8ce1d14c76b","order_by":2,"name":"Zohra CHEKROUD","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Zohra","middleName":"","lastName":"CHEKROUD","suffix":""},{"id":445581781,"identity":"7edb9897-3ad7-4f5a-8de8-8555b21b432a","order_by":3,"name":"Mohamed Salah ABBASSI","email":"","orcid":"","institution":"Université de Tunis El Manar, Institut de la recherche vétérinaire de Tunisie","correspondingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"Salah","lastName":"ABBASSI","suffix":""},{"id":445581786,"identity":"ac53fca2-f5d7-4693-b390-7b513ee99ad0","order_by":4,"name":"Nosiba S BASHER","email":"","orcid":"","institution":"Imam Mohammad Ibn Saud Islamic University (IMSIU)","correspondingAuthor":false,"prefix":"","firstName":"Nosiba","middleName":"S","lastName":"BASHER","suffix":""},{"id":445581787,"identity":"a69ec698-29ce-4c99-8600-3ffb64e6264e","order_by":5,"name":"Nasir Adam IBRAHIM","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABAklEQVRIiWNgGAWjYHACNgYeBgsGBmYGxgcJUCEJIrRIgLQwG5CoBciAq8SrxZz98LMHb2ok8vjZudMqHubYRRscYD54m4ehTh6XFsueNHPDOcckiiWbebfdSNyWnLvhAFuyNQ/DYcMGHFoMDiSYSfOwSSRuOAzWwgzUwgMUYTjAiFPL+effpHn+SSTuB2opSNxWD9TCDxRhqLPHqeVGjpk0bxvQFmbebQyJ2w6DbGEDamFOxK3lTbnh3D6JxBmHeTdLJG47njvzMJux5RyDw8m4HZa+7cGbbzaJ/f1nN378ua06t+9488MbbyrqbHFpwQKYwUYRr34UjIJRMApGASYAAAY0V+Q8FhXOAAAAAElFTkSuQmCC","orcid":"","institution":"Imam Mohammad Ibn Saud Islamic University (IMSIU)","correspondingAuthor":true,"prefix":"","firstName":"Nasir","middleName":"Adam","lastName":"IBRAHIM","suffix":""},{"id":445581788,"identity":"7a3b5aab-615f-4469-8f6a-8724ad99c550","order_by":6,"name":"Abdelaziz TOUATI","email":"","orcid":"","institution":"Université de Bejaia, FSNV","correspondingAuthor":false,"prefix":"","firstName":"Abdelaziz","middleName":"","lastName":"TOUATI","suffix":""}],"badges":[],"createdAt":"2025-02-10 13:38:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5999651/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5999651/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12866-025-04174-2","type":"published","date":"2025-08-01T16:21:32+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":81101217,"identity":"8ccdf354-1802-4cc0-8a1f-960f6a23fef9","added_by":"auto","created_at":"2025-04-22 08:51:13","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":120700,"visible":true,"origin":"","legend":"\u003cp\u003eAntibiotic susceptibility rates in the 27 cefotaxime-resistant \u003cem\u003eE. coli \u003c/em\u003eisolates\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAbbreviation:\u003c/strong\u003e Cefotaxime (CTX), ceftazidime (CAZ), aztreonam (ATM), cefepime (FEP), cefoxitin (FOX), amoxicillin/clavulanic acid (AMC), amoxicillin (AMX), ertapenem (ETP), imipenem (IMP), ciprofloxacin (CIP), ofloxacin (OFX), tetracycline (TE), doxycycline (DO), gentamicin (CN), amikacin (AK), trimethoprim-sulfamethoxazole (SXT, 25mg).\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-5999651/v1/be64a768c84347c4d6f2e8f6.png"},{"id":81101218,"identity":"8c2bea68-451a-4e70-a2fe-c5f34a35c120","added_by":"auto","created_at":"2025-04-22 08:51:13","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":65070,"visible":true,"origin":"","legend":"\u003cp\u003eOccurrence of genes encoding antimicrobial resistance and genes of class 1 and 2 integrons.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-5999651/v1/3f7fb8b238d8cf83840aba39.png"},{"id":88268879,"identity":"e3ccd58d-716d-4a00-bced-f94bc6e079e9","added_by":"auto","created_at":"2025-08-04 16:52:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1515942,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5999651/v1/702fb2eb-fb3c-4bee-94f4-f89ebebab196.pdf"},{"id":81101225,"identity":"140e0c74-e5bd-44e0-8e68-df717ff2c3ad","added_by":"auto","created_at":"2025-04-22 08:51:13","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":151452,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterials3GCpaper15042025.docx","url":"https://assets-eu.researchsquare.com/files/rs-5999651/v1/30dc494a5643ec3ecac097ba.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Fecal carriage of ESBL-, carbapenemase- and AmpC- producing Escherichia coli in cattle and sheep in Algeria: Emergence of NDM and OXA-181","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eBeta-lactams are the main antibiotics used to combat bacterial infections in human and veterinary medicine, owing to their large spectrum and low toxicity [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Great attention is given to 3rd generation cephalosporins (3GC) and carbapenems, which the World Health Organization (WHO) has regarded as critically important, considering their crucial role in treating severe bacterial infections, including those from zoonotic origin [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. Nevertheless, 3GC are extensively used in human and veterinary sectors [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. This overuse has led to the emergence of resistant bacteria and compromised the therapeutic efficiency of 3GC, which increased the need for carbapenems and further induced resistance to those antibiotics [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Recently, the WHO has classified carbapenem-resistant and 3GC-resistant Enterobacterales among the critical groups of the Bacterial Priority Pathogen List due to their highest risk to public health [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe primary resistance mechanism to beta-lactams in \u003cem\u003eEnterobacterales\u003c/em\u003e, including \u003cem\u003eEscherichia coli\u003c/em\u003e, is the production of beta-lactamase enzymes, mainly extended spectrum \u0026szlig;-lactamases (ESBL), carbapenemases and AmpC cephalosporinases [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. ESBL and AmpC enzymes confer resistance to penicillins, third and later-generation cephalosporins, and monobactams. AmpC can hydrolyse cephamycin antibiotics, while carbapenemase enzymes are active against a larger spectrum of beta-lactams, including carbapenems [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003e3GC are widely used in veterinary medicine, which has led to the emergence and propagation of resistant bacteria and their genes in livestock [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. It was statistically reported that the consumption of 3GC in food-producing animals is correlated with the high prevalence of ESBL- and AmpC-producing \u003cem\u003eE. coli\u003c/em\u003e [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. On the other hand, carbapenemases are not authorized for veterinary use [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. However, the pressure exerted by the high consumption of 3GC might promote the selection of carbapenem-resistant strains in animals [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe global growth of livestock production in the last decade, especially in intensive farming systems, has increased animals' vulnerability to bacterial infections and thus raised the consumption of antibiotics in this sector [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Antibiotics in intensive farming have boosted animal growth and thus helped confront the increasing need for animal proteins [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCattle and sheep are fundamental to the food chain. Hence, the emergence of antimicrobial-resistant bacteria in their intestines or among their food products can spread to humans through direct or indirect routes [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The presence of 3GC- resistance \u003cem\u003eEnterobacterales\u003c/em\u003e in cattle has been widely reported [\u003cspan additionalcitationids=\"CR17\" citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Conversely, there are fewer investigations on disseminating this resistance in sheep [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSeveral studies in Algeria have identified ESBL, carbapenemase, and AmpC-producing bacteria from animal sources, especially poultry [\u003cspan additionalcitationids=\"CR21\" citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. However, there is a significant knowledge gap regarding the fecal carriage of these bacteria in cattle and sheep. Therefore, we aimed to investigate the presence of 3GC-resistant \u003cem\u003eEscherichia coli\u003c/em\u003e in bovine and ovine fecal samples among 28 farms in Guelma City, northeast of Algeria, and to assess their resistance genes further.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Institutional Review Board Statement\u003c/h2\u003e \u003cp\u003eThe experimental protocol was approved by the University ethics committee (N\u0026deg;Ethi/UMMTO/26-MAR-2024).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Study area and sampling\u003c/h2\u003e \u003cp\u003eFrom September 2021 to May 2022, 285 fresh fecal samples were collected with sterile cotton swabs from healthy cattle (n\u0026thinsp;=\u0026thinsp;145) and sheep (n\u0026thinsp;=\u0026thinsp;140) among 28 farms in Guelma City, northeast of Algeria. All farms were randomly selected and situated in four different regions in Guelma: Heliopolis (7 bovine farms), Bouati Mahmoud (11 bovine farms and six ovine farms), Hammam Debagh (3 bovine farms) and Medjez Ammar (1 ovine farm) (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eFarms sampled in Heliopolice and Medjez Ammar are located in urban zones (n\u0026thinsp;=\u0026thinsp;8), while those of Bouati Mahmoud and Hammam Debagh are based in rural zones (n\u0026thinsp;=\u0026thinsp;20). Moreover, six farms in the Heliopolis region were managed under intensive farming, whereas the 22 other farms were semi-extensive. Samples were immediately transferred to the laboratory and processed on the day of sampling. Farms and sample information are illustrated in Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Isolate collection and identification\u003c/h2\u003e \u003cp\u003eEach sample swab was enriched overnight in 10 ml of Mueller Hinton-broth (MHB). Then, 10 \u0026micro;l of the MHB culture was inoculated on MacConkey agar (TM Media\u003csup\u003e\u0026reg;\u003c/sup\u003e, India) supplemented with 1 \u0026micro;g/ml of cefotaxime [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. After incubation, presumptive \u003cem\u003eEscherichia coli\u003c/em\u003e colonies were selected and identified on CHROMagar orientation medium (CHROMagar \u0026trade;, Paris, France), then confirmed with Gram coloration, oxidase disc test and API 20 E biochemical gallery (Biom\u0026eacute;rieux, France).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Antibiotic susceptibility testing\u003c/h2\u003e \u003cp\u003eAntibiotic susceptibility profiles were determined with the disc diffusion method against 16 antibiotics following the Clinical and Laboratory Standards Institute (CLSI) guidelines [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Used antibiotics were: cefotaxime (CTX, 30\u0026micro;g), ceftazidime (CAZ, 30\u0026micro;g), aztreonam (ATM, 30\u0026micro;g), cefepime (FEP, 30\u0026micro;g), cefoxitin (FOX, 30\u0026micro;g), amoxicillin-clavulanic acid (AMC, 20/10 \u0026micro;g), amoxicillin (AMX, 25 \u0026micro;g), ertapenem (ETP, 10\u0026micro;g), imipenem (IMP, 10\u0026micro;g), ciprofloxacin (CIP, 30\u0026micro;g), ofloxacin (OFX, 5\u0026micro;g), tetracycline (TE, 10\u0026micro;g), doxycycline (DO, 30\u0026micro;g), gentamicin (CN, 120\u0026micro;g), amikacin (AK, 30\u0026micro;g), and trimethoprim-sulfamethoxazole (SXT, 25\u0026micro;g). Colistin Minimum Inhibitory Concentration (MIC) was also determined using the broth microdilution method [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. Results were interpreted according to CLSI breakpoints [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Phenotypic characterization of resistance mechanisms\u003c/h2\u003e \u003cp\u003eFor all cefotaxime-resistant isolates screened on the selective agar, the Double-Disk Synergy Test (DDST) was used to detect ESBL production by placing each of the CTX (30 \u0026micro;g) and ceftazidime (30 \u0026micro;g) discs at a distance of 3 cm from the central disc of amoxicillin-clavulanic acid (20/10 \u0026micro;g) [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. \u003cem\u003eE. coli\u003c/em\u003e ATCC 25922 and \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e ATCC 700603 were used as ESBL-negative and positive reference strains, respectively. Metallo-\u0026szlig;-lactamases production was evaluated using the EDTA method for isolates showing resistance to ertapenem or imipenem [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Molecular characterization of resistance mechanisms\u003c/h2\u003e \u003cp\u003eGenomic DNA was extracted following the boiling method [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. DNA quality was evaluated using NanoDrop\u0026trade; 8000 spectrophotometer (Thermo Fisher Scientific, California, USA). Afterwards, ten antimicrobial resistance genes were investigated with standard PCR targeting genes encoding ESBL (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M\u003c/sub\u003e), plasmidic AmpC (pAmpC) (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eDHA\u003c/sub\u003e), carbapenemases (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM-1\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eOXA-48\u003c/sub\u003e, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eVIM)\u003c/sub\u003e, tetracyclines (\u003cem\u003etet\u003c/em\u003eA and tetB), and fluoroquinolones (\u003cem\u003eaac(6\u0026rsquo;)-Ib\u003c/em\u003e). Finally, integron genes \u003cem\u003eintI1\u003c/em\u003e and \u003cem\u003eintI2\u003c/em\u003e were inspected by PCR multiplex, and the 3\u0026rsquo; conserved segment of class 1 integron (\u003cem\u003eqacEΔ1-sul1\u003c/em\u003e) was further amplified. Primer sequences, amplicon sizes, and PCR amplification conditions are presented in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. PCR results were revealed by electrophoresis on 2% agarose gel at 120V. Moreover, \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eOXA-48\u003c/sub\u003e positive PCR products were sequenced with a 3500 XL Genetic Analyzer (Thermo Fisher Scientific, California, USA). The obtained sequences were confirmed using the NCBI BLAST program (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.ncbi.nlm.nih.gov/BLAST\u003c/span\u003e\u003cspan address=\"http://www.ncbi.nlm.nih.gov/BLAST\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eTarget genes and PCR amplification conditions\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequences (5\u0026thinsp;\u0026minus;\u0026thinsp;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePCR conditions\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eSize (bp)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eReferences\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-TTTGCGATGTGCAGTACCAGTAA\u003c/p\u003e \u003cp\u003eR-CGATATCGTTGGTGGTGCCATA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e94\u0026deg;C/10 min, 30 cycles (94\u0026deg;C/40s, 59\u0026deg;C/40s, 72\u0026deg;C/1 min), 72\u0026deg;C/7 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e500\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-ATGATGAAAAAATCGTTATGC\u003c/p\u003e \u003cp\u003eR-TTGCAGCTTTTCAAGAATGCGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e95\u0026deg;C/15 min, 30 cycles (94\u0026deg;C/30s, 50\u0026deg;C/30s, 72\u0026deg;C/2 min), 72\u0026deg;C/10 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1200\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eDHA\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-TGATGGCACAGCAGGATATTC\u003c/p\u003e \u003cp\u003eR-GCTTTGACTCTTTCGGTATTCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e94\u0026deg;C/10 min; 30 cycles (94\u0026deg;C/40 s, 60\u0026deg;C/40s, 72\u0026deg;C/1 min), 72\u0026deg;C/7 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e997\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;1\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-GCTTTGGCGATCTGGTTTTC\u003c/p\u003e \u003cp\u003eR-CGGAATGGCTCATCACGATC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e94\u0026deg;C/10 min, 36 cycles (94\u0026deg;C/30s, 52\u0026deg;C/40s, 72\u0026deg;C/50 s), 72\u0026deg;C/5 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e621\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eOXA\u0026minus;48\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-TTGGTGGCATCGATTATCGG\u003c/p\u003e \u003cp\u003eR- GAGCACTTCTTTTGTGATGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e95\u0026deg;C/15 min, 30 cycles (94\u0026deg;C/30s, 54\u0026deg;C/30s, 72\u0026deg;C/2min), 72\u0026deg;C/10 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e744\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eVIM\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-GATGGTGTTTGGTCGCATA\u003c/p\u003e \u003cp\u003eR-CGAATGCGCAGCACCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e94\u0026deg;C/10 min, 30 cycles (94\u0026deg;C/40s, 55\u0026deg;C/40s, 72\u0026deg;C/1 min), 72\u0026deg;C/7 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e390\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etet\u003c/em\u003eA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-GTAATTCTGAGCACTGTCGC\u003c/p\u003e \u003cp\u003eR-CTGCCTGGACAACATTGCTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e95\u0026deg;C/5 min, 25 cycles (94\u0026deg;C/30s, 62/30s, 72\u0026deg;C 45s), 72\u0026deg;C 7min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e937\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etet\u003c/em\u003eB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-CTCAGTATTCCAGCCTTTG\u003c/p\u003e \u003cp\u003eR-CTAAGCACTTGTCTCCTGTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e95\u0026deg;C/5 min, 25 cycles (95\u0026deg;C/30s, 57\u0026deg;C/30s 72\u0026deg;C 20s), 72\u0026deg;C 7 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e416\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003etet\u003c/em\u003eC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-TCTAACAATGCGCTCATCGT\u003c/p\u003e \u003cp\u003eR-GGTTGAAGGCTCTCAAGGGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e95\u0026deg;C/5 min, 25 cycles (94\u0026deg;C/30s, 62/30s, 72\u0026deg;C 45s), 72\u0026deg;C 7min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e570\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eaac(6\u0026rsquo;)-Ib\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-TTGCGATGCTCTATGAGTGGCTA\u003c/p\u003e \u003cp\u003eR-CTCGAATGCCTGGCGTGTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e95\u0026deg;C/5 min, 34 cycles (94\u0026deg;C/45s, 55\u0026deg;C/45s, 72\u0026deg;C/45s), 72\u0026deg;C/7 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e482\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eintI1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-GGGTCAAGGATCTGGATTTCG\u003c/p\u003e \u003cp\u003eR-ACATGGGTGTAAATCATCGTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e95\u0026deg;C/5 min, 30 cycles (94\u0026deg;C/30s, 62\u0026deg;C/30s, 72\u0026deg;C/1 min), 72\u0026deg;C/5 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e483\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eintI2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-CACGGATATGCGACAAAAAGGT\u003c/p\u003e \u003cp\u003eR-GTAGCAAACGAGTGACGAAATG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e788\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eqacΔE-sul1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF-GGCTGGCTTTTTCTTGTTATCG\u003c/p\u003e \u003cp\u003eR-GCGAGGGTTTCCGAGAAGGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e94\u0026deg;C/5 min, 30 cycles (94\u0026deg;C/30s, 63\u0026deg;C/30s, 72\u0026deg;C/1 min), 72\u0026deg;C/8 min\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e1125\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\n \u003ch2\u003e3.1. Detection and identification of cefotaxime-resistant strains\u003c/h2\u003e\n \u003cp\u003eTwenty-seven cefotaxime-resistant \u003cem\u003eE. coli\u003c/em\u003e isolates were detected in cattle (n\u0026thinsp;=\u0026thinsp;25) and sheep (n\u0026thinsp;=\u0026thinsp;2) samples. The overall rate of positive samples was 9% (27/285), while 17% (25/145) and 1% (2/140) of cattle and sheep samples, respectively, were positive.\u003c/p\u003e\n \u003cp\u003eThe cefotaxime-resistant \u003cem\u003eE. coli\u003c/em\u003e isolates were distributed among 12 of the 28 investigated farms (43%). The prevalence of positive farms fluctuated over animal species and regions. The total rate of positive bovine farms was 48% (10/21), while 29% (2/7) of the ovine farms were positive. As for regions, Heliopolis has the highest prevalence with five positive farms over 7 (71%), followed by Bouati Mahmoud and Hammam Debagh with 35% (06/17) and 33% (01/03) rates, respectively, while the only sampled farm in Medjez Ammar was negative. Regarding the farming system, 83% of the intensive farms were positive (5/6), while 32% of the semi-extensive farms were positive (7/22). Finally, regarding the nature of sampling regions, 5 of 8 farms located in urban zones were positive (63%), while 7 of the 20 farms in rural areas were positive (35%) (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u0026nbsp;\u003c/p\u003e\n \u003ctable id=\"Tab2\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003ePhenotypic and genotypic traits of the 27 cefotaxime-resistant \u003cem\u003eE. coli\u003c/em\u003e isolates\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eCode of isolates*\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eFarms\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eOrigins\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eResistance profiles**\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eDetected genes**\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC1*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FEP; ATM; CIP; OFX; TE; DO; AK; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cem\u003etet\u003c/em\u003eA; \u003cem\u003eintI1\u003c/em\u003e; \u003cem\u003eqac\u0026Delta;E-sul1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC2*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF13\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; FEP; ATM; TE; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cem\u003eintI1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC 4*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSheep\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FEP; ATM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC 8*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FEP; ATM; \u003cstrong\u003eETP\u003c/strong\u003e; CIP; OFX; TE; DO; CN; AK; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cem\u003etet\u003c/em\u003eA; \u003cem\u003eaac(6\u0026rsquo;)-Ib\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC9\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FOX; FEP; ATM; \u003cstrong\u003eETP\u003c/strong\u003e; \u003cstrong\u003eIMP\u003c/strong\u003e; CIP; OFX; TE; DO; AK; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cstrong\u003ebla\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eNDM\u0026minus;1\u003c/strong\u003e\u003c/sub\u003e; \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FOX; FEP; ATM; \u003cstrong\u003eETP\u003c/strong\u003e; \u003cstrong\u003eIMP\u003c/strong\u003e; CIP; OFX; TE; DO; AK; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cstrong\u003ebla\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eNDM\u0026minus;1\u003c/strong\u003e\u003c/sub\u003e; \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC11*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FEP; ATM; CIP; OFX; TE; DO; CN; AK; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cem\u003etet\u003c/em\u003eA; \u003cem\u003eaac(6\u0026rsquo;)-Ib\u003c/em\u003e; \u003cem\u003eintI1\u003c/em\u003e; \u003cem\u003eqac\u0026Delta;E-sul1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC12\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FOX; FEP; ATM; CIP; OFX; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e; \u003cem\u003eaac(6\u0026rsquo;)-Ib\u003c/em\u003e; \u003cem\u003eintI1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC13*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FEP; ATM; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cem\u003eintI1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC14\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FOX; FEP; ATM; \u003cstrong\u003eETP\u003c/strong\u003e; \u003cstrong\u003eIMP\u003c/strong\u003e; CIP; OFX; TE; DO; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cstrong\u003ebla\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eNDM\u0026minus;1\u003c/strong\u003e\u003c/sub\u003e; \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e; \u003cem\u003etet\u003c/em\u003eA; \u003cem\u003eintI1\u003c/em\u003e; \u003cem\u003eqac\u0026Delta;E-sul1, however\u003c/em\u003e,\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC15*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FEP; ATM; CIP; OFX; TE; DO; CN; AK; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cem\u003etet\u003c/em\u003eA; \u003cem\u003eaac(6\u0026rsquo;)-Ib\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC 16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FOX; FEP; ATM; \u003cstrong\u003eETP\u003c/strong\u003e; CIP; OFX; TE; CN; AK; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e; \u003cem\u003eaac(6\u0026rsquo;)-Ib\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC17\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FOX; FEP; ATM; \u003cstrong\u003eETP\u003c/strong\u003e; \u003cstrong\u003eIMP\u003c/strong\u003e; CIP; OFX; TE; DO; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ebla\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eNDM\u0026minus;1\u003c/strong\u003e\u003c/sub\u003e; \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC 18\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FOX; FEP; ATM; \u003cstrong\u003eETP\u003c/strong\u003e; \u003cstrong\u003eIMP\u003c/strong\u003e; CIP; OFX; TE; DO; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ebla\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eNDM\u0026minus;1\u003c/strong\u003e\u003c/sub\u003e; \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC19\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FOX; FEP; ATM; \u003cstrong\u003eETP\u003c/strong\u003e; \u003cstrong\u003eIMP\u003c/strong\u003e; CIP; OFX; TE; DO; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ebla\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eNDM\u0026minus;1\u003c/strong\u003e\u003c/sub\u003e; \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FOX; FEP; ATM; \u003cstrong\u003eETP\u003c/strong\u003e; \u003cstrong\u003eIMP\u003c/strong\u003e; CIP; OFX; TE; DO; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ebla\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eNDM\u0026minus;1\u003c/strong\u003e\u003c/sub\u003e; \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e; \u003cem\u003etet\u003c/em\u003eB\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC21\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FOX; FEP; ATM; \u003cstrong\u003eETP\u003c/strong\u003e; \u003cstrong\u003eIMP\u003c/strong\u003e; CIP; OFX; TE; DO; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ebla\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eNDM\u0026minus;1\u003c/strong\u003e\u003c/sub\u003e; \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e; \u003cem\u003etet\u003c/em\u003eB\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC22\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FOX; FEP; ATM; \u003cstrong\u003eETP\u003c/strong\u003e; \u003cstrong\u003eIMP\u003c/strong\u003e; CIP; OFX; TE; DO; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ebla\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eNDM\u0026minus;1\u003c/strong\u003e\u003c/sub\u003e; \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FOX; FEP; ATM; \u003cstrong\u003eETP\u003c/strong\u003e; \u003cstrong\u003eIMP\u003c/strong\u003e; CIP; OFX; TE; DO; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003ebla\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eNDM\u0026minus;1\u003c/strong\u003e\u003c/sub\u003e; \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC24*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FEP; ATM; \u003cstrong\u003eETP\u003c/strong\u003e; CN; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cem\u003eintI1\u003c/em\u003e; \u003cem\u003eqac\u0026Delta;E-sul1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC26*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; FEP; ATM; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cem\u003eintI1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC27*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FEP; ATM; OFX; TE; DO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC28*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FEP; ATM; \u003cstrong\u003eETP\u003c/strong\u003e; \u003cstrong\u003eIMP\u003c/strong\u003e; CIP; OFX; TE; DO; AK\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cstrong\u003ebla\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003eOXA\u0026minus;181\u003c/strong\u003e\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC30*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF20\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; FEP; ATM; TE; CN; AK; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cem\u003eintI1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC49*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF23\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FEP; ATM; TE; DO; SXT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cem\u003eintI1\u003c/em\u003e; \u003cem\u003eqac\u0026Delta;E-sul1\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC50*\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF24\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; FEP; ATM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eEC 51\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF27\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCattle\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCTX; AMC; AMX; CAZ; FOX; FEP; ATM; OFX; TE; DO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e; \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eDHA\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eAbbreviation:\u003c/strong\u003e Cefotaxime (CTX), ceftazidime (CAZ), aztreonam (ATM), cefepime (FEP), cefoxitin (FOX), amoxicillin/clavulanic acid (AMC), amoxicillin (AMX), ertapenem (ETP), imipenem (IMP), ciprofloxacin (CIP), ofloxacin (OFX), tetracycline (TE), doxycycline (DO), gentamicin (CN), amikacin (AK), \u0026nbsp; trimethoprim-sulfamethoxazole (SXT, 25mg).\u003c/p\u003e\n \u003cp\u003e* ESBL-producing \u003cem\u003eE. coli\u003c/em\u003e isolates by the DDST.\u003c/p\u003e\n \u003cp\u003e** Resistance to imipenem/and or ertapenem and carbapenemase genes are in bold.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\n \u003ch2\u003e3.2. Antibiotic susceptibility profiles\u003c/h2\u003e\n \u003cp\u003eBy analyzing the antibiotic resistance profile of each screened \u003cem\u003eE. coli\u003c/em\u003e isolate, 85% of the isolates were multidrug-resistant (MDR), i.e., resistant against at least one agent in three antimicrobial categories or more, and highly resistant to beta-lactams. All isolates were resistant to cefotaxime, cefepime, aztreonam, amoxicillin-clavulanic acid, and amoxicillin. Ceftazidime and cefoxitin resistance were observed in 85% and 48% of isolates, respectively. Interestingly, 52% and 41% of isolates were resistant to ertapenem and imipenem, respectively, among which 11 (all imipenem-resistant isolates) were co-resistant to both antibiotics. Resistance frequencies to fluoroquinolones and tetracyclines were also high being 63% for ciprofloxacin and 70% for ofloxacin, while 78% and 67% were resistant to tetracycline and doxycycline, respectively. Moreover, 81% of isolates displayed resistance to trimethoprim-sulfamethoxazole. Resistance to aminoglycosides was low, with 22% and 33% resistance rates for gentamicin and amikacin, respectively. Finally, the colistin MIC was intermediate (\u0026le; 2 \u0026micro;g/ml) for all the isolates (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eAccording to the DDST, ESBL production was observed in 14 (14/27; 52%) cefotaxime-resistant isolates, and the remaining 13 isolates displayed AmpC-phenotype. Among the carbapenem-resistant isolates, ten (10/27; 37%) were positive for the EDTA test and thus considered metallo-carbapenemase producers.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\n \u003ch2\u003e3.3. Resistance genes detection\u003c/h2\u003e\n \u003cp\u003eThe \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e gene was detected in 20 isolates (74%). Moreover, ten isolates carried the \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;1\u003c/sub\u003e gene (37%), and one harboured a \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eOXA\u0026minus;48\u0026minus;like\u003c/sub\u003e gene (4%), which was later identified by sequencing as a \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eOXA\u0026minus;181\u003c/sub\u003e. However, the \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eVIM\u003c/sub\u003e gene was not detected. The \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e gene was identified in 12 isolates (44%), while \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eDHA\u003c/sub\u003e was found in one (4%). Furthermore, \u003cem\u003etet\u003c/em\u003eA and \u003cem\u003etet\u003c/em\u003eB genes were identified in five (19%) and two (7%) cefotaxime-resistant isolates, respectively. The \u003cem\u003etet\u003c/em\u003e gene was not detected. The \u003cem\u003eaac(6\u0026rsquo;)-Ib\u003c/em\u003e gene was detected in five \u003cem\u003eE. coli\u003c/em\u003e isolates (19%). Finally, ten isolates (37%) harbored the class 1 integron gene \u003cem\u003eintI1\u003c/em\u003e, of which five also included the conserved sequence \u003cem\u003eqacE\u0026Delta;1-sul1\u003c/em\u003e, while no int\u003cem\u003eI2\u003c/em\u003e gene was identified (Table \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e and Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\n\u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eIn the present study, we aimed to investigate the dissemination of third-generation cephalosporin-resistant \u003cem\u003eE. coli\u003c/em\u003e among bovine and ovine farms in Guelma, northeast of Algeria. Our results showed that 43% of the investigated farms harbored 3GC-resistant \u003cem\u003eE. coli\u003c/em\u003e, with 27 isolates collected from cattle and sheep fecal samples. The isolates displayed various antimicrobial resistance genes encoding ESBL, carbapenemase, and AmpC. A notable variation in the prevalence of 3GC-resistant \u003cem\u003eE. coli\u003c/em\u003e across farms was observed in this study and was mainly related to animal species, farming systems, and sampling regions.\u003c/p\u003e \u003cp\u003eThe significant difference in positive samples in cattle (17%) compared to sheep samples (1%) is in concordance with a previous study in northern Spain [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. However, unlike these findings, a recent study from the USA reported a higher percentage of cefotaxime-resistant and ESBL-producing \u003cem\u003eE. coli\u003c/em\u003e in sheep than in cattle [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. However, it should be noted that the number of the investigated ovine herds in our study (n\u0026thinsp;=\u0026thinsp;7) is much lower than the bovine ones (n\u0026thinsp;=\u0026thinsp;21), and thus, the obtained results cannot be comparable.\u003c/p\u003e \u003cp\u003eFurthermore, the farming system affects the variation of positive farms with a prevalence of 83% in intensive production and 32% in semi-extensive farming, which aligns with previous results [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Animals reared in intensive farms are confined and thus more influenced by the farm conditions, including hygiene, airing, food and water quality, animal density, and proximity [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. In addition, antibiotic consumption tends to be higher in intensive production to fulfil therapeutic and prophylactic purposes and accelerate animal growth [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Such practice mainly enhances the selection and spread of antibiotic-resistant isolates as well as the dissemination of mobile genetic elements carrying resistance genes.\u003c/p\u003e \u003cp\u003eOn the other hand, the geographical fluctuation of positive farm prevalence and the high percentage obtained in urban regions (63%) compared to rural regions (35%) might be explained by the clonal spread of resistant isolates from the human environment through contaminated water, waste products and the movement of humans and contaminated vehicles [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Population pressure, the presence of industries, and wastewater treatment plants are well-known hotspots for antimicrobial-resistant bacteria. This finding implies the spread of 3GC-resistant isolates across interconnected niches, including humans, animals and the environment.\u003c/p\u003e \u003cp\u003eThe antibiotic susceptibility profiles of the collected isolates are alarming, considering the high prevalence of multidrug-resistant isolates (85%) detected. Moreover, the isolates showed high resistance rates against beta-lactams, including second-, third-, and fourth-generation cephalosporins. Significant resistance rates to ertapenem and imipenem were also observed, although carbapenems are not used in animal production. Notably, the carbapenem-resistant \u003cem\u003eE. coli\u003c/em\u003e isolates were detected in four farms in the same urban region and managed under an intensive farming system. This underscores the possible spread of carbapenem-resistant strains from the human environment in this urban zone and the potential role of intensive production practices in farm maintenance. High resistance percentages were also shown against tetracyclines, fluoroquinolones, and trimethoprim-sulfamethoxazole, similar to previous studies [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The broad resistance to tetracyclines could be attributed to their extensive use in animal production [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Besides, it was previously described that ESBL-producing \u003cem\u003eE. coli\u003c/em\u003e is commonly resistant to fluoroquinolones and trimethoprim-sulfamethoxazole, which might justify these findings [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. Trimethoprim and sulfonamides are among the ancient antibiotics used in livestock and human medicine; therefore, high resistance rates to both antibiotics are commonly reported globally, and it seems that their genetic supports (\u003cem\u003edhf\u003c/em\u003e and \u003cem\u003esul\u003c/em\u003e genes) have been established as intrinsic markers in the majority of \u003cem\u003eE. coli\u003c/em\u003e isolates. One of the study's most important findings is the relatively high resistance rates to ertapenem (52%) and to imipenem (41%) among the 3GC-resistant isolates. Globally, carbapenem resistance remains scarce in Gram-negative bacteria, including \u003cem\u003eE. coli\u003c/em\u003e, of animal origin; therefore, this phenomenon is a cause of concern to human, animal, and environmental health [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Indeed, this is of particular concern since the isolates are ESBL and/or pAmpC producers, which dramatically reduces the therapeutic options against such isolates. The detected MDR phenotypes are considered common traits of ESBL-producing Gram-negative bacteria, including \u003cem\u003eE. coli.\u003c/em\u003e Indeed, in ESBL-producing isolates, genes encoded by ESBL enzymes are mainly plasmid-borne. Those plasmids are commonly conjugative plasmids with large molecular sizes and harboring several genes encoding antibiotic resistance where insertion sequences (e.g., IS\u003cem\u003e26\u003c/em\u003e, IS\u003cem\u003e1133\u003c/em\u003e, IS\u003cem\u003e903\u003c/em\u003e, IS\u003cem\u003eEcp1\u003c/em\u003e, IS\u003cem\u003eCR\u003c/em\u003e) have been implicated in their co-association in close position. Furthermore, integrons also play an important role in the collection of various antimicrobial resistance genes.\u003c/p\u003e \u003cp\u003eSeveral antimicrobial resistance genes were identified in this study and aligned with the phenotypic resistance profiles. The \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u003c/sub\u003e gene was the most frequent (74%) detected in 18 bovine and two ovine isolates. The first report of an ESBL gene in cattle was in Japan in 2000, where a \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX\u0026minus;M\u0026minus;2\u003c/sub\u003e-producing \u003cem\u003eE. coli\u003c/em\u003e was isolated from a bovine fecal sample [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Later, several studies have identified ESBL genes in cattle worldwide [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In contrast, reports of ESBL genes from ovine origin are less frequent [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], but this is likely because of the need for more studies in this sector rather than the actual infrequency. In Algeria, ESBL genes from animal sources have been previously reported [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e, \u003cspan additionalcitationids=\"CR36\" citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. However, only one recent study has described the presence of ESBL-producing \u003cem\u003eE. coli\u003c/em\u003e in bovine and ovine abscesses [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e], with no previous reports on the fecal carriage of those isolates in cattle or sheep to date.\u003c/p\u003e \u003cp\u003eAlarmingly, ten \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;1\u003c/sub\u003e- and one \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eOXA\u0026minus;181\u003c/sub\u003e-producing \u003cem\u003eE. coli\u003c/em\u003e were identified in our study among four bovine farms (\u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;1\u003c/sub\u003e in 3 farms and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eOXA\u0026minus;181\u003c/sub\u003e in one farm). Several studies have identified cattle's \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;1\u003c/sub\u003e and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eOXA\u0026minus;181\u003c/sub\u003e genes [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. Regarding Algeria, carbapenemase-producing \u003cem\u003eE. coli\u003c/em\u003e have been previously reported in companion animals [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], wild animals [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], and animal products [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. An earlier study reported the carriage of \u003cem\u003eK. pneumoniae\u003c/em\u003e harboring the \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eOXA\u0026minus;48\u003c/sub\u003e gene in cattle and sheep [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Nevertheless, to our knowledge, this is the first report of carbapenemase-producing \u003cem\u003eE. coli\u003c/em\u003e in cattle. Molecular investigation of the genetic relatedness (such as by Multilocus Sequence typing) of these isolates was not performed owing to many financial limitations; however, according to the phenotypic resistance profiles and the gene contents of those isolates, especially those from the same farm, the clonal relationship of isolates is quite possible. Further studies are needed to prove this hypothesis.\u003c/p\u003e \u003cp\u003eAmpC genes have been detected only in bovine samples. The \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e gene was found in 12 isolates, while the \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eDHA\u003c/sub\u003e was only carried by one isolate. AmpC genes have been previously reported in cattle [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] and sheep [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] worldwide. Prior studies have described AmpC genes' presence in Algeria's animal sources [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. However, as far as we know, this is the first detection of AmpC genes in Algerian bovine farms.\u003c/p\u003e \u003cp\u003eTetracycline-resistance genes \u003cem\u003etet\u003c/em\u003eA and \u003cem\u003etet\u003c/em\u003eB were also identified in our study. These genes have been previously reported in bovine and ovine samples [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Additionally, the \u003cem\u003eaac(6\u0026rsquo;)-Ib\u003c/em\u003e gene was detected in five \u003cem\u003eE. coli\u003c/em\u003e isolates (19%), which aligns with their phenotypic resistance to amikacin. Moreover, in the absence of sequencing, \u003cem\u003eaac(6\u0026rsquo;)-Ib\u003c/em\u003e can be the \u003cem\u003eaac(6\u0026rsquo;)-Ib-cr\u003c/em\u003e variant encoding not only aminoglycoside resistance but also fluoroquinolone resistance, a variant commonly reported in ESBL/pAmpC-producing \u003cem\u003eE. coli\u003c/em\u003e isolates of various origins. Finally, the \u003cem\u003eintI1\u003c/em\u003e gene of class 1 integron was identified in ten isolates, 5 of which amplified the \u003cem\u003eqacEΔ1-sul1\u003c/em\u003e conserved region. The class 1 integrons are frequently located on plasmids and thus significantly transmit antimicrobial resistance genes in humans and food-producing animals [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWhile our study provides valuable insights into the prevalence of third-generation cephalosporin-resistant \u003cem\u003eE. coli\u003c/em\u003e in cattle and sheep in Algeria, several limitations must be acknowledged. A key limitation of the study is the absence of Whole Genome Sequencing (WGS), which would have significantly enhanced our ability to determine the clonal relationships between isolates and track the dissemination of antimicrobial resistance (AMR) genes. WGS is crucial for understanding the genetic diversity of \u003cem\u003eE. coli\u003c/em\u003e strains and the mechanisms of resistance, such as clonal expansion or horizontal gene transfer, which are fundamental for comprehensively assessing the spread of resistance in the studied populations.\u003c/p\u003e \u003cp\u003eAlthough we employed PCR-based detection of resistance genes and phenotypic resistance profiling, these methods do not provide insights into resistance genes' plasmid or chromosomal localization. The absence of WGS limits our ability to investigate the role of genetic elements such as plasmids in the transfer and spread of resistance, particularly for genes like \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM\u0026minus;\u003c/sub\u003e1 and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eOXA\u0026minus;181\u003c/sub\u003e. Furthermore, the lack of genetic characterization makes it difficult to determine whether the observed resistance is primarily due to clonal expansion of resistant strains or the result of horizontal gene transfer across different environments.\u003c/p\u003e \u003cp\u003eAnother limitation noted by the reviewer is the lack of further genetic characterization to support the observed differences in resistance prevalence between intensive and semi-extensive farming systems and the urban-rural differences in resistance prevalence. While these findings are statistically significant, the absence of genetic data leaves the potential epidemiological links between these systems speculative. Specifically, the potential contamination from human sources in rural areas, as suggested by the observed urban-rural differences in resistance prevalence, requires further investigation through genetic analyses to confirm whether human-related contamination plays a role in the spread of resistant strains.\u003c/p\u003e \u003cp\u003eDue to these limitations, the current study primarily offers epidemiological insights into the prevalence of AMR in livestock without the depth of genetic analysis needed to characterize the underlying mechanisms fully. While helpful, we acknowledge that the reliance on PCR and phenotypic resistance profiling does not provide a complete picture of the genetic underpinnings of AMR in \u003cem\u003eE. coli\u003c/em\u003e. As such, we recommend that future studies incorporate WGS to enhance the characterization of \u003cem\u003eE. coli\u003c/em\u003e strains and their resistance mechanisms. WGS would allow for a more thorough investigation of the clonal relationships, genetic diversity, and potential pathways for disseminating AMR genes across different environments.\u003c/p\u003e \u003cp\u003eIn conclusion, our results highlight the presence and the spread of ESBL-, AmpC- and carbapenemase-producing \u003cem\u003eE. coli\u003c/em\u003e among bovine and ovine herds. Carrying such strains in food-producing animals threatens public health, considering the potential risk of their zoonotic transmission to humans. In addition, this study underscores the impact of intensive farming systems and the proximity of farms to urban areas on the detection and selection of resistant bacteria and their genes in animals. However, more extensive studies are needed to confirm those observations. It is, therefore, crucial to implement efficient monitoring programs within an integrated \u0026ldquo;One Health\u0026rdquo; approach and enhance hygiene measures, especially in intensive farms, to mitigate the propagation of these bacteria. Further studies are required to assess better the circulation of resistant bacteria and their genetic determinants among animals and determine the risk factors contributing to their dissemination and maintenance in the farm environment.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data presented in this study are available within the article. Raw data supporting this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest:\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNone of the authors has financial or personal relationships that could inappropriately influence or bias the paper\u0026apos;s content.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported and funded by the Deanship of Scientific Research at Imam Mohammad Ibn Saud Islamic University (IMSIU). (grant number \u003cstrong\u003eIMSIU-DDRSP2502\u003c/strong\u003e).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u003c/strong\u003e\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eConceptualization, H.K. and A.T.; methodology, H.K. and A.T.; software, H.R. and M.S.A.; validation, A.T. and Z.C.; formal analysis, H.R. and M.S.A.; investigation, H.K. and Z.C.; resources, H.K. and A.T.; data curation, Z.C. and H.K. and A.T.; writing\u0026mdash;original draft preparation, H.K. and A.T.; writing\u0026mdash;review and editing, A.T. and N.A.I.; visualization, A.T., N.A.I. and N.S.B.; supervision, A.T.; project administration, A.T. and M.S.A.; funding acquisition, N.A.I. and N.S.B.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eAll authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are grateful to the veterinarians and farmers who contributed to the sampling and data collection; we also thank Mr Ali Boumegoura for his contribution to the sequencing.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interests:\u0026nbsp;\u003c/strong\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eOuchar Mahamat, O.; Kempf, M.; Lounnas, M.; Tidjani, A.; Hide, M.; Benavides, J.A.; Carri\u0026egrave;re, C.; Ba\u0026ntilde;uls, A.-L.; Jean-Pierre, H.; Ouedraogo, A.-S.; et al. Epidemiology and Prevalence of Extended-Spectrum \u0026beta;-Lactamase- and Carbapenemase-Producing Enterobacteriaceae in Humans, Animals and the Environment in West and Central Africa. \u003cem\u003eInternational Journal of Antimicrobial Agents\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e57\u003c/em\u003e, 106203, doi:10.1016/j.ijantimicag.2020.106203.\u003c/li\u003e\n\u003cli\u003ePalmeira, J.D.; Cunha, M.V.; Carvalho, J.; Ferreira, H.; Fonseca, C.; Torres, R.T. Emergence and Spread of Cephalosporinases in Wildlife: A Review. \u003cem\u003eAnimals\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e11\u003c/em\u003e, 1765, doi:10.3390/ani11061765.\u003c/li\u003e\n\u003cli\u003eWHO, W.H.O. \u003cem\u003eWHO List of Medically Important Antimicrobials: A Risk Management Tool for Mitigating Antimicrobial Resistance Due to Non-Human Use\u003c/em\u003e; World Health Organization: Geneva, 2024; ISBN 978-92-4-008461-2.\u003c/li\u003e\n\u003cli\u003eHammoudi Halat, D.; Ayoub Moubareck, C. The Current Burden of Carbapenemases: Review of Significant Properties and Dissemination among Gram-Negative Bacteria. \u003cem\u003eAntibiotics\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e9\u003c/em\u003e, 186, doi:10.3390/antibiotics9040186.\u003c/li\u003e\n\u003cli\u003eWHO, W.H.O. \u003cem\u003eWHO Bacterial Priority Pathogens List 2024: Bacterial Pathogens of Public Health Importance, to Guide Research, Development, and Strategies to Prevent and Control Antimicrobial Resistance\u003c/em\u003e; 1st ed.; World Health Organization: Geneva, 2024; ISBN 978-92-4-009346-1.\u003c/li\u003e\n\u003cli\u003eBush, K.; Bradford, P.A. Epidemiology of \u0026beta;-Lactamase-Producing Pathogens. \u003cem\u003eClin Microbiol Rev\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e33\u003c/em\u003e, e00047-19, doi:10.1128/CMR.00047-19.\u003c/li\u003e\n\u003cli\u003eTello, M.; Ocejo, M.; Oporto, B.; Lav\u0026iacute;n, J.L.; Hurtado, A. Within-Farm Dynamics of ESBL-Producing Escherichia Coli in Dairy Cattle: Resistance Profiles and Molecular Characterization by Long-Read Whole-Genome Sequencing. \u003cem\u003eFront. Microbiol.\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e13\u003c/em\u003e, 936843, doi:10.3389/fmicb.2022.936843.\u003c/li\u003e\n\u003cli\u003eGelalcha, B.D.; Kerro Dego, O. Extended-Spectrum Beta-Lactamases Producing Enterobacteriaceae in the USA Dairy Cattle Farms and Implications for Public Health. \u003cem\u003eAntibiotics\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e11\u003c/em\u003e, 1313, doi:10.3390/antibiotics11101313.\u003c/li\u003e\n\u003cli\u003eECDC, (European Centre for Disease Prevention and Control); EFSA, (European Food Safety Authority); EMA, (European Medicines Agency) Third Joint Inter‐agency Report on Integrated Analysis of Consumption of Antimicrobial Agents and Occurrence of Antimicrobial Resistance in Bacteria from Humans and Food‐producing Animals in the EU/EEA. \u003cem\u003eEFS2\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e19\u003c/em\u003e, doi:10.2903/j.efsa.2021.6712.\u003c/li\u003e\n\u003cli\u003eRam\u0026iacute;rez-Castillo, F.Y.; Guerrero-Barrera, A.L.; Avelar-Gonz\u0026aacute;lez, F.J. An Overview of Carbapenem-Resistant Organisms from Food-Producing Animals, Seafood, Aquaculture, Companion Animals, and Wildlife. \u003cem\u003eFront. Vet. Sci.\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e, 1158588, doi:10.3389/fvets.2023.1158588.\u003c/li\u003e\n\u003cli\u003eMairi, A.; Pantel, A.; Sotto, A.; Lavigne, J.-P.; Touati, A. OXA-48-like Carbapenemases Producing Enterobacteriaceae in Different Niches. \u003cem\u003eEur J Clin Microbiol Infect Dis\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e37\u003c/em\u003e, 587\u0026ndash;604, doi:10.1007/s10096-017-3112-7.\u003c/li\u003e\n\u003cli\u003eBenavides, J.A.; Salgado-Caxito, M.; Opazo-Capurro, A.; Gonz\u0026aacute;lez Mu\u0026ntilde;oz, P.; Pi\u0026ntilde;eiro, A.; Otto Medina, M.; Rivas, L.; Munita, J.; Mill\u0026aacute;n, J. ESBL-Producing Escherichia Coli Carrying CTX-M Genes Circulating among Livestock, Dogs, and Wild Mammals in Small-Scale Farms of Central Chile. \u003cem\u003eAntibiotics\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e, 510, doi:10.3390/antibiotics10050510.\u003c/li\u003e\n\u003cli\u003eMulchandani, R.; Wang, Y.; Gilbert, M.; Van Boeckel, T.P. Global Trends in Antimicrobial Use in Food-Producing Animals: 2020 to 2030. \u003cem\u003ePLOS Glob Public Health\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, \u003cem\u003e3\u003c/em\u003e, e0001305, doi:10.1371/journal.pgph.0001305.\u003c/li\u003e\n\u003cli\u003eHassen, B.; Saloua, B.; Abbassi, M.S.; Ruiz-Ripa, L.; Mama, O.M.; Hassen, A.; Hammami, S.; Torres, C. Mcr-1 Encoding Colistin Resistance in CTX-M-1/CTX-M-15- Producing Escherichia Coli Isolates of Bovine and Caprine Origins in Tunisia. First Report of CTX-M-15-ST394/D E. Coli from Goats. \u003cem\u003eComp Immunol Microbiol Infect Dis\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e67\u003c/em\u003e, 101366, doi:10.1016/j.cimid.2019.101366.\u003c/li\u003e\n\u003cli\u003eRahman, S.; Hollis, A. The Effect of Antibiotic Usage on Resistance in Humans and Food-Producing Animals: A Longitudinal, One Health Analysis Using European Data. \u003cem\u003eFront. Public Health\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, \u003cem\u003e11\u003c/em\u003e, 1170426, doi:10.3389/fpubh.2023.1170426.\u003c/li\u003e\n\u003cli\u003eBraun, S.D.; Ahmed, M.F.E.; El-Adawy, H.; Hotzel, H.; Engelmann, I.; Wei\u0026szlig;, D.; Monecke, S.; Ehricht, R. Surveillance of Extended-Spectrum Beta-Lactamase-Producing Escherichia Coli in Dairy Cattle Farms in the Nile Delta, Egypt. \u003cem\u003eFront. Microbiol.\u003c/em\u003e \u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e7\u003c/em\u003e, doi:10.3389/fmicb.2016.01020.\u003c/li\u003e\n\u003cli\u003eTello, M.; Ocejo, M.; Oporto, B.; Hurtado, A. Prevalence of Cefotaxime-Resistant Escherichia Coli Isolates from Healthy Cattle and Sheep in Northern Spain: Phenotypic and Genome-Based Characterization of Antimicrobial Susceptibility. \u003cem\u003eAppl Environ Microbiol\u003c/em\u003e \u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e86\u003c/em\u003e, e00742-20, doi:10.1128/AEM.00742-20.\u003c/li\u003e\n\u003cli\u003eGelalcha, B.D.; Mohamed, R.I.; Gelgie, A.E.; Kerro Dego, O. Molecular Epidemiology of Extended-Spectrum Beta-Lactamase-Producing-Klebsiella Species in East Tennessee Dairy Cattle Farms. \u003cem\u003eFront. Microbiol.\u003c/em\u003e \u003cstrong\u003e2024\u003c/strong\u003e, \u003cem\u003e15\u003c/em\u003e, 1439363, doi:10.3389/fmicb.2024.1439363.\u003c/li\u003e\n\u003cli\u003eMandujano, A.; Cort\u0026eacute;s-Espinosa, D.V.; V\u0026aacute;squez-Villanueva, J.; Guel, P.; Rivera, G.; Ju\u0026aacute;rez-Rend\u0026oacute;n, K.; Cruz-Pulido, W.L.; Aguilera-Arreola, G.; Guerrero, A.; Bocanegra-Garc\u0026iacute;a, V.; et al. Extended-Spectrum \u0026beta;-Lactamase-Producing Escherichia Coli Isolated from Food-Producing Animals in Tamaulipas, Mexico. \u003cem\u003eAntibiotics\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, \u003cem\u003e12\u003c/em\u003e, 1010, doi:10.3390/antibiotics12061010.\u003c/li\u003e\n\u003cli\u003eYousfi, M.; Mairi, A.; Touati, A.; Hassissene, L.; Brasme, L.; Guillard, T.; De Champs, C. Extended Spectrum \u0026beta;-Lactamase and Plasmid Mediated Quinolone Resistance in Escherichia Coli Fecal Isolates from Healthy Companion Animals in Algeria. \u003cem\u003eJournal of Infection and Chemotherapy\u003c/em\u003e \u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e22\u003c/em\u003e, 431\u0026ndash;435, doi:10.1016/j.jiac.2016.03.005.\u003c/li\u003e\n\u003cli\u003eChabou, S.; Leulmi, H.; Davoust, B.; Aouadi, A.; Rolain, J.-M. Prevalence of Extended-Spectrum \u0026beta;-Lactamase- and Carbapenemase-Encoding Genes in Poultry Faeces from Algeria and Marseille, France. \u003cem\u003eJournal of Global Antimicrobial Resistance\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e13\u003c/em\u003e, 28\u0026ndash;32, doi:10.1016/j.jgar.2017.11.002.\u003c/li\u003e\n\u003cli\u003eMairi, A.; Pantel, A.; Ousalem, F.; Sotto, A.; Touati, A.; Lavigne, J.-P. OXA-48-Producing Enterobacterales in Different Ecological Niches in Algeria: Clonal Expansion, Plasmid Characteristics and Virulence Traits. \u003cem\u003eJournal of Antimicrobial Chemotherapy\u003c/em\u003e \u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e74\u003c/em\u003e, 1848\u0026ndash;1855, doi:10.1093/jac/dkz146.\u003c/li\u003e\n\u003cli\u003eMezhoud, H.; Boyen, F.; Touazi, L.; Garmyn, A.; Moula, N.; Smet, A.; Haesbrouck, F.; Martel, A.; Iguer-Ouada, M.; Touati, A. Extended Spectrum \u0026beta;-Lactamase Producing Escherichia Coli in Broiler Breeding Roosters: Presence in the Reproductive Tract and Effect on Sperm Motility. \u003cem\u003eAnimal Reproduction Science\u003c/em\u003e \u003cstrong\u003e2015\u003c/strong\u003e, \u003cem\u003e159\u003c/em\u003e, 205\u0026ndash;211, doi:10.1016/j.anireprosci.2015.06.021.\u003c/li\u003e\n\u003cli\u003eCLSI \u003cem\u003ePerformance Standards for Antimicrobial Susceptibility Testing M100\u003c/em\u003e; 30th ed.; Clinical and laboratory standards institute (CLSI), 2020; ISBN 978-1-68440-066-9.\u003c/li\u003e\n\u003cli\u003eNCDC, N.C. for D.C. Broth-Microdilution Colistin Susceptibility Test for Aerobic Gram-Negative Bacteria 2020.\u003c/li\u003e\n\u003cli\u003eEUCAST EUCAST Guidelines for Detection of Resistance Mechanisms and Specific Resistances of Clinical and/or Epidemiological Importance 2017.\u003c/li\u003e\n\u003cli\u003eNguyen, N.T.; Nguyen, H.M.; Nguyen, C.V.; Nguyen, T.V.; Nguyen, M.T.; Thai, H.Q.; Ho, M.H.; Thwaites, G.; Ngo, H.T.; Baker, S.; et al. Use of Colistin and Other Critical Antimicrobials on Pig and Chicken Farms in Southern Vietnam and Its Association with Resistance in Commensal Escherichia Coli Bacteria. \u003cem\u003eAppl Environ Microbiol\u003c/em\u003e \u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e82\u003c/em\u003e, 3727\u0026ndash;3735, doi:10.1128/AEM.00337-16.\u003c/li\u003e\n\u003cli\u003eZhao, X.; Zhao, H.; Zhou, Z.; Miao, Y.; Li, R.; Yang, B.; Cao, C.; Xiao, S.; Wang, X.; Liu, H.; et al. Characterization of Extended-Spectrum \u0026beta;-Lactamase-Producing \u003cem\u003eEscherichia Coli\u003c/em\u003e Isolates That Cause Diarrhea in Sheep in Northwest China. \u003cem\u003eMicrobiol Spectr\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e, e01595-22, doi:10.1128/spectrum.01595-22.\u003c/li\u003e\n\u003cli\u003eGharieb, R.; Saad, M.; Khedr, M.; El Gohary, A.; Ibrahim, H. Occurrence, Virulence, Carbapenem Resistance, Susceptibility to Disinfectants and Public Health Hazard of \u003cem\u003ePseudomonas Aeruginosa\u003c/em\u003e Isolated from Animals, Humans and Environment in Intensive Farms. \u003cem\u003eJ of Applied Microbiology\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e132\u003c/em\u003e, 256\u0026ndash;267, doi:10.1111/jam.15191.\u003c/li\u003e\n\u003cli\u003ePrack McCormick, B.; Quiroga, M.P.; \u0026Aacute;lvarez, V.E.; Centr\u0026oacute;n, D.; Tittonell, P. Antimicrobial Resistance Dissemination Associated with Intensive Animal Production Practices in Argentina: A Systematic Review and Meta-Analysis. \u003cem\u003eRevista Argentina de Microbiolog\u0026iacute;a\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, \u003cem\u003e55\u003c/em\u003e, 25\u0026ndash;42, doi:10.1016/j.ram.2022.07.001.\u003c/li\u003e\n\u003cli\u003eSanou, S.; Ouedraogo, A.S.; Lounnas, M.; Zougmore, A.; Pooda, A.; Zoungrana, J.; Ouedraogo, G.A.; Traore-Ouedraogo, R.; Ouchar, O.; Jean-Pierre, H.; et al. Epidemiology and Molecular Characterization of \u003cem\u003eEnterobacteriaceae\u003c/em\u003e Producing Extended-Spectrum \u0026beta;-Lactamase in Intensive and Extensive Breeding Animals in Burkina Faso. \u003cem\u003ePAMJ-OH\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e8\u003c/em\u003e, doi:10.11604/pamj-oh.2022.8.4.33553.\u003c/li\u003e\n\u003cli\u003eDandachi, I.; Chabou, S.; Daoud, Z.; Rolain, J.-M. Prevalence and Emergence of Extended-Spectrum Cephalosporin-, Carbapenem- and Colistin-Resistant Gram Negative Bacteria of Animal Origin in the Mediterranean Basin. \u003cem\u003eFront. Microbiol.\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e9\u003c/em\u003e, 2299, doi:10.3389/fmicb.2018.02299.\u003c/li\u003e\n\u003cli\u003eShiraki, Y.; Shibata, N.; Doi, Y.; Arakawa, Y. \u003cem\u003eEscherichia Coli\u003c/em\u003e Producing CTX-M-2 \u0026beta;-Lactamase in Cattle, Japan. \u003cem\u003eEmerg. Infect. Dis.\u003c/em\u003e \u003cstrong\u003e2004\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e, 69\u0026ndash;75, doi:10.3201/eid1001.030219.\u003c/li\u003e\n\u003cli\u003eB\u0026ouml;rjesson, S.; Ny, S.; Egerv\u0026auml;rn, M.; Bergstr\u0026ouml;m, J.; Rosengren, \u0026Aring;.; Englund, S.; L\u0026ouml;fmark, S.; Byfors, S. Limited Dissemination of Extended-Spectrum \u0026beta;-Lactamase\u0026ndash; and Plasmid-Encoded AmpC\u0026ndash;Producing \u003cem\u003eEscherichia Coli\u003c/em\u003e from Food and Farm Animals, Sweden. \u003cem\u003eEmerg. Infect. Dis.\u003c/em\u003e \u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e22\u003c/em\u003e, 634\u0026ndash;640, doi:10.3201/eid2204.151142.\u003c/li\u003e\n\u003cli\u003eBen Haj Yahia, A.; Tayh, G.; Landolsi, S.; Maamar, E.; Galai, N.; Landoulsi, Z.; Messadi, L. First Report of \u003cem\u003eOXA-48\u003c/em\u003e and \u003cem\u003eIMP\u003c/em\u003e Genes Among Extended-Spectrum Beta-Lactamase-Producing \u003cem\u003eEscherichia Coli\u003c/em\u003e Isolates from Diarrheic Calves in Tunisia. \u003cem\u003eMicrobial Drug Resistance\u003c/em\u003e \u003cstrong\u003e2023\u003c/strong\u003e, \u003cem\u003e29\u003c/em\u003e, 150\u0026ndash;162, doi:10.1089/mdr.2022.0129.\u003c/li\u003e\n\u003cli\u003eBelmahdi, M.; Bakour, S.; Al Bayssari, C.; Touati, A.; Rolain, J.-M. Molecular Characterisation of Extended-Spectrum \u0026beta;-Lactamase- and Plasmid AmpC-Producing Escherichia Coli Strains Isolated from Broilers in B\u0026eacute;ja\u0026iuml;a, Algeria. \u003cem\u003eJournal of Global Antimicrobial Resistance\u003c/em\u003e \u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e6\u003c/em\u003e, 108\u0026ndash;112, doi:10.1016/j.jgar.2016.04.006.\u003c/li\u003e\n\u003cli\u003eBachiri, T.; Bakour, S.; Ladjouzi, R.; Thongpan, L.; Rolain, J.M.; Touati, A. High Rates of CTX-M-15-Producing Escherichia Coli and Klebsiella Pneumoniae in Wild Boars and Barbary Macaques in Algeria. \u003cem\u003eJournal of Global Antimicrobial Resistance\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e8\u003c/em\u003e, 35\u0026ndash;40, doi:10.1016/j.jgar.2016.10.005.\u003c/li\u003e\n\u003cli\u003eBrahmi, S.; Touati, A.; Dunyach-Remy, C.; Sotto, A.; Pantel, A.; Lavigne, J.-P. High Prevalence of Extended-Spectrum \u0026beta;-Lactamase-Producing \u003cem\u003eEnterobacteriaceae\u003c/em\u003e in Wild Fish from the Mediterranean Sea in Algeria. \u003cem\u003eMicrobial Drug Resistance\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e24\u003c/em\u003e, 290\u0026ndash;298, doi:10.1089/mdr.2017.0149.\u003c/li\u003e\n\u003cli\u003eYousfi, C.; Oueslati, S.; Daaboul, D.; Girlich, D.; Proust, A.; Bentchouala, C.; Naas, T. Antibiotic Susceptibility Profiles of Bacterial Isolates Recovered from Abscesses in Cattle and Sheep at a Slaughterhouse in Algeria. \u003cem\u003eMicroorganisms\u003c/em\u003e \u003cstrong\u003e2024\u003c/strong\u003e, \u003cem\u003e12\u003c/em\u003e, 524, doi:10.3390/microorganisms12030524.\u003c/li\u003e\n\u003cli\u003eCarfora, V.; Diaconu, E.L.; Ianzano, A.; Di Matteo, P.; Amoruso, R.; Dell\u0026rsquo;Aira, E.; Sorbara, L.; Bottoni, F.; Guarneri, F.; Campana, L.; et al. The Hazard of Carbapenemase (OXA-181)-Producing Escherichia Coli Spreading in Pig and Veal Calf Holdings in Italy in the Genomics Era: Risk of Spill over and Spill Back between Humans and Animals. \u003cem\u003eFront. Microbiol.\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e13\u003c/em\u003e, 1016895, doi:10.3389/fmicb.2022.1016895.\u003c/li\u003e\n\u003cli\u003eYousfi, M.; Touati, A.; Mairi, A.; Brasme, L.; Gharout-Sait, A.; Guillard, T.; De Champs, C. Emergence of Carbapenemase-Producing \u003cem\u003eEscherichia Coli\u003c/em\u003e Isolated from Companion Animals in Algeria. \u003cem\u003eMicrobial Drug Resistance\u003c/em\u003e \u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e22\u003c/em\u003e, 342\u0026ndash;346, doi:10.1089/mdr.2015.0196.\u003c/li\u003e\n\u003cli\u003eBouaziz, A.; Loucif, L.; Ayachi, A.; Guehaz, K.; Bendjama, E.; Rolain, J.-M. Migratory White Stork ( \u003cem\u003eCiconia Ciconia\u003c/em\u003e ): A Potential Vector of the OXA-48-Producing \u003cem\u003eEscherichia Coli\u003c/em\u003e ST38 Clone in Algeria. \u003cem\u003eMicrobial Drug Resistance\u003c/em\u003e \u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e24\u003c/em\u003e, 461\u0026ndash;468, doi:10.1089/mdr.2017.0174.\u003c/li\u003e\n\u003cli\u003eYaici, L.; Haenni, M.; M\u0026eacute;tayer, V.; Saras, E.; Mesbah Zekar, F.; Ayad, M.; Touati, A.; Madec, J.-Y. Spread of ESBL/AmpC-Producing Escherichia Coli and Klebsiella Pneumoniae in the Community through Ready-to-Eat Sandwiches in Algeria. \u003cem\u003eInternational Journal of Food Microbiology\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e245\u003c/em\u003e, 66\u0026ndash;72, doi:10.1016/j.ijfoodmicro.2017.01.011.\u003c/li\u003e\n\u003cli\u003eCollis, R.M.; Biggs, P.J.; Burgess, S.A.; Midwinter, A.C.; Brightwell, G.; Cookson, A.L. Prevalence and Distribution of Extended-Spectrum \u0026beta;-Lactamase and AmpC-Producing Escherichia Coli in Two New Zealand Dairy Farm Environments. \u003cem\u003eFront. Microbiol.\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e13\u003c/em\u003e, 960748, doi:10.3389/fmicb.2022.960748.\u003c/li\u003e\n\u003cli\u003eNossair, M.A.; Abd El Baqy, F.A.; Rizk, M.S.Y.; Elaadli, H.; Mansour, A.M.; Abd El-Aziz, A.H.; Alkhedaide, A.; Soliman, M.M.; Ramadan, H.; Shukry, M.; et al. Prevalence and Molecular Characterization of Extended-Spectrum \u0026beta;-Lactamases and AmpC \u0026beta;-Lactamase-Producing Enterobacteriaceae among Human, Cattle, and Poultry. \u003cem\u003ePathogens\u003c/em\u003e \u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e11\u003c/em\u003e, 852, doi:10.3390/pathogens11080852.\u003c/li\u003e\n\u003cli\u003eSingh, R.; Schroeder, C.M.; Meng, J.; White, D.G.; McDermott, P.F.; Wagner, D.D.; Yang, H.; Simjee, S.; DebRoy, C.; Walker, R.D.; et al. Identification of Antimicrobial Resistance and Class 1 Integrons in Shiga Toxin-Producing Escherichia Coli Recovered from Humans and Food Animals. \u003cem\u003eJournal of Antimicrobial Chemotherapy\u003c/em\u003e \u003cstrong\u003e2005\u003c/strong\u003e, \u003cem\u003e56\u003c/em\u003e, 216\u0026ndash;219, doi:10.1093/jac/dki161.\u003c/li\u003e\n\u003cli\u003eSabbagh, P.; Rajabnia, M.; Maali, Am.; Ferdosi-Shahandashti, E. Integron and Its Role in Antimicrobial Resistance: A Literature Review on Some Bacterial Pathogens. \u003cem\u003eIranian Journal of Basic Medical Sciences\u003c/em\u003e \u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e24\u003c/em\u003e, doi:10.22038/ijbms.2020.48905.11208.\u003c/li\u003e\n\u003cli\u003eKiiru, J.; Kariuki, S.; Goddeeris, B.M.; Butaye, P. Analysis of \u0026beta;-Lactamase Phenotypes and Carriage of Selected \u0026beta;-Lactamase Genes among Escherichia Coli Strains Obtained from Kenyan Patients during an 18-Year Period. \u003cem\u003eBMC Microbiol\u003c/em\u003e \u003cstrong\u003e2012\u003c/strong\u003e, \u003cem\u003e12\u003c/em\u003e, 155, doi:10.1186/1471-2180-12-155.\u003c/li\u003e\n\u003cli\u003eDallenne, C.; Da Costa, A.; Decr\u0026eacute;, D.; Favier, C.; Arlet, G. Development of a Set of Multiplex PCR Assays for the Detection of Genes Encoding Important \u0026beta;-Lactamases in Enterobacteriaceae. \u003cem\u003eJournal of Antimicrobial Chemotherapy\u003c/em\u003e \u003cstrong\u003e2010\u003c/strong\u003e, \u003cem\u003e65\u003c/em\u003e, 490\u0026ndash;495, doi:10.1093/jac/dkp498.\u003c/li\u003e\n\u003cli\u003ePoirel, L.; Walsh, T.R.; Cuvillier, V.; Nordmann, P. Multiplex PCR for Detection of Acquired Carbapenemase Genes. \u003cem\u003eDiagnostic Microbiology and Infectious Disease\u003c/em\u003e \u003cstrong\u003e2011\u003c/strong\u003e, \u003cem\u003e70\u003c/em\u003e, 119\u0026ndash;123, doi:10.1016/j.diagmicrobio.2010.12.002.\u003c/li\u003e\n\u003cli\u003eMellouk, F.Z.; Bakour, S.; Meradji, S.; Al-Bayssari, C.; Bentakouk, M.C.; Zouyed, F.; Djahoudi, A.; Boutefnouchet, N.; Rolain, J.M. First Detection of VIM-4-Producing \u003cem\u003ePseudomonas Aeruginosa\u003c/em\u003e and OXA-48-Producing \u003cem\u003eKlebsiella Pneumoniae\u003c/em\u003e in Northeastern (Annaba, Skikda) Algeria. \u003cem\u003eMicrobial Drug Resistance\u003c/em\u003e \u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e23\u003c/em\u003e, 335\u0026ndash;344, doi:10.1089/mdr.2016.0032.\u003c/li\u003e\n\u003cli\u003eGuardabassi, L.; Dijkshoorn, L.; Collard, J.-M.; Olsen, J.E.; Dalsgaard, A. Distribution and In-Vitro Transfer of Tetracycline Resistance Determinants in Clinical and Aquatic Acinetobacter Strains. \u003cem\u003eJournal of Medical Microbiology\u003c/em\u003e \u003cstrong\u003e2000\u003c/strong\u003e, \u003cem\u003e49\u003c/em\u003e, 929\u0026ndash;936, doi:10.1099/0022-1317-49-10-929.\u003c/li\u003e\n\u003cli\u003ePark, C.H.; Robicsek, A.; Jacoby, G.A.; Sahm, D.; Hooper, D.C. Prevalence in the United States of \u003cem\u003eAac(6\u003c/em\u003e \u0026prime; \u003cem\u003e)\u003c/em\u003e - \u003cem\u003eIb\u003c/em\u003e - \u003cem\u003eCr\u003c/em\u003e Encoding a Ciprofloxacin-Modifying Enzyme. \u003cem\u003eAntimicrob Agents Chemother\u003c/em\u003e \u003cstrong\u003e2006\u003c/strong\u003e, \u003cem\u003e50\u003c/em\u003e, 3953\u0026ndash;3955, doi:10.1128/AAC.00915-06.\u003c/li\u003e\n\u003cli\u003eMazel, D.; Dychinco, B.; Webb, V.A.; Davies, J. Antibiotic Resistance in the ECOR Collection: Integrons and Identification of a Novel \u003cem\u003eAad\u003c/em\u003e Gene. \u003cem\u003eAntimicrob Agents Chemother\u003c/em\u003e \u003cstrong\u003e2000\u003c/strong\u003e, \u003cem\u003e44\u003c/em\u003e, 1568\u0026ndash;1574, doi:10.1128/AAC.44.6.1568-1574.2000.\u003c/li\u003e\n\u003cli\u003eS\u0026aacute;enz, Y.; Bri\u0026ntilde;as, L.; Dom\u0026iacute;nguez, E.; Ruiz, J.; Zarazaga, M.; Vila, J.; Torres, C. Mechanisms of Resistance in Multiple-Antibiotic-Resistant \u003cem\u003eEscherichia Coli\u003c/em\u003e Strains of Human, Animal, and Food Origins. \u003cem\u003eAntimicrob Agents Chemother\u003c/em\u003e \u003cstrong\u003e2004\u003c/strong\u003e, \u003cem\u003e48\u003c/em\u003e, 3996\u0026ndash;4001, doi:10.1128/AAC.48.10.3996-4001.2004.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Algeria, cattle, sheep, 3GC-resistant E. coli, ESBL, carbapenemases","lastPublishedDoi":"10.21203/rs.3.rs-5999651/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5999651/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eIntroduction:\u003c/strong\u003e The spread of third-generation cephalosporin (3GC)-resistant \u003cem\u003eEscherichia coli\u003c/em\u003e in food-producing animals poses a significant threat to public health, with limited data from cattle and sheep in Algeria. This study investigated the prevalence of 3GC-resistant \u003cem\u003eE. coli \u003c/em\u003ein cattle and sheep in Guelma, northeast Algeria.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethodology:\u003c/strong\u003e 285 fecal samples were collected from cattle (n=145) and sheep (n=140) on 28 farms. Samples were screened for 3GC-resistant \u003cem\u003eE. coli\u003c/em\u003e. Antibiotic susceptibility was tested, and ESBL and carbapenemase production were evaluated using double disc and EDTA tests. PCR identified resistance and integron genes.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e Twenty-seven cefotaxime-resistant \u003cem\u003eE. coli\u003c/em\u003e isolates were detected in 17% of bovine and 1% of ovine samples, spanning 43% of the farms. Multidrug resistance was observed in 85% of isolates, with high resistance to β-lactams, tetracyclines, fluoroquinolones, and trimethoprim-sulfamethoxazole. The following beta-lactamase genes were detected: \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCTX-M \u003c/sub\u003e(74%), \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eCMY\u003c/sub\u003e (44%), \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eNDM-1 \u003c/sub\u003e(37%), and \u003cem\u003ebla\u003c/em\u003e\u003csub\u003eOXA-181 \u003c/sub\u003e(4%) were identified. Class 1 integrons were also detected in ten isolates.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e These findings emphasize the presence of ESBL-, AmpC-, and carbapenemase-producing \u003cem\u003eE. coli\u003c/em\u003e among Algerian livestock, highlighting the need for comprehensive monitoring and control to manage the spread of these resistant bacteria.\u003c/p\u003e","manuscriptTitle":"Fecal carriage of ESBL-, carbapenemase- and AmpC- producing Escherichia coli in cattle and sheep in Algeria: Emergence of NDM and OXA-181","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-22 08:51:08","doi":"10.21203/rs.3.rs-5999651/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-05-23T05:48:48+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-22T12:55:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"109653260680733360613816751591304571621","date":"2025-05-16T06:31:30+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-04T19:41:36+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"96241549894507569250697274030981060924","date":"2025-04-28T07:00:28+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"219330925290687436353834934261118416319","date":"2025-04-25T16:53:09+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-04-21T06:33:14+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-04-21T02:13:44+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Microbiology","date":"2025-04-19T14:46:46+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"mcro","sideBox":"Learn more about [BMC Microbiology](http://bmcmicrobiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/mcro","title":"BMC Microbiology","twitterHandle":"#bmcmicrobiology","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"78cf79a8-ab4e-4337-b391-6d12dee6b0ec","owner":[],"postedDate":"April 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-08-04T16:49:03+00:00","versionOfRecord":{"articleIdentity":"rs-5999651","link":"https://doi.org/10.1186/s12866-025-04174-2","journal":{"identity":"bmc-microbiology","isVorOnly":false,"title":"BMC Microbiology"},"publishedOn":"2025-08-01 16:21:32","publishedOnDateReadable":"August 1st, 2025"},"versionCreatedAt":"2025-04-22 08:51:08","video":"","vorDoi":"10.1186/s12866-025-04174-2","vorDoiUrl":"https://doi.org/10.1186/s12866-025-04174-2","workflowStages":[]},"version":"v1","identity":"rs-5999651","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5999651","identity":"rs-5999651","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}