In vitro and in vivo experimental investigation Of TSRP reverses imatinib resistance through the PI3K / Akt pathway in chronic myeloid leukemia

In vitro and in vivo experimental investigation Of TSRP reverses imatinib resistance through the PI3K / Akt pathway in chronic myeloid leukemia | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article In vitro and in vivo experimental investigation Of TSRP reverses imatinib resistance through the PI3K / Akt pathway in chronic myeloid leukemia Ying He, Jiyuan Ding, Liqin Liu, Jiajun Chen, Hong Zhong, Changyu Li, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3223174/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Chronic myelogenous leukemia (CML) is a malignant tumor of the blood system, so far there is no effective cure. Imatinib (IM), as the first-line drug for the clinical targeted treatment of CML, has some limiting factors such as drug resistance and relapse, and drug resistance has also emerged in combination with other drugs. At present, traditional Chinese medicine combined with targeted drugs in the treatment of tumor is a research hotspot. The total saponin (TSRP) of the Chinese herb Citraria sinensis has an effective anti-tumor activity. Our previous in vitro experiments showed that TSRP can effectively inhibit the proliferation and promote apoptosis of CML cells K562, suggesting that TSRP can effectively reverse the drug resistance of IM, but the mechanism of drug resistance remains unclear. Studies have shown that the PI3K/AKT pathway is the main activation pathway of IM secondary resistance, and is considered to be an innovative therapeutic strategy for targeted cancer treatment, which may be an important mechanism of IM resistance. This project aims to reveal the possible mechanism of TSRP reversing IM resistance through PI3K/AKT signaling pathway through both in vitro and in vivo experiments, providing experimental basis for TSRP combined with IM treatment of CML. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Chronic myelogenous leukemia (CML) is a blood system disease that originates from the malignant proliferation of bone marrow hematopoietic stem cells. The global incidence is about 1.6 ~ 2.0/100,000, and the domestic incidence is about 0.36/100,000, accounting for the third place of leukemia. So far, there is no effective radical cure 1 . The characteristic cytogenetic marker of CML is the Bcr/Abl fusion gene produced by the translocation of chromosomes 9 and 22. The fusion protein P210 encoded by this gene has sustained active tyrosine kinase activity, which can activate multiple downstream signaling pathways and induc e malignant proliferation of myeloid cells 2 . imatinib (IM) is a small molecule tyrosine kinase inhibitor, which can competitively occupy the ATP-binding site of Bcr/Abl and target to inhibit the activity of Bcr/Abl tyrosine kinase, thereby preventing signal transduction of CML cells, resulting in cell proliferation inhibition or apoptosis. At present, it has become a first-line drug in the clinical treatment of CML 3 . However, with the clinical application of IM, drug resistance and relapse have become the main reasons limiting its efficacy. Studies have shown that at least 25% of patients discontinue treatment of IM within 5 years due to drug intolerance or other reasons 4 . Previous researchers have found that IM combined with the new tyrosine kinase inhibitor Src/Abl family can reverse its drug resistance, but with the progress of clinical trials, these drugs have gradually shown resistance 5 , 6 . Therefore, it is urgent to study the mechanism of IM resistance, search for new targets and new combination drugs in the treatment of CML. Traditional Chinese medicine has been paid more and more attention by researchers because of its advantages such as multi-efficacy, multi-target, low toxicity, delay of relapse and easy to produce drug resistance. Traditional Chinese medicine combined with targeted drugs in the treatment of tumor is a new hot spot in the current drug resistance research 7 . CML belongs to the categories of traditional Chinese medicine "vacuous strain", "blood syndrome", "warm disease", "disease accumulation", and so on. It is caused by the internal invasion of heat toxicity and damage to the viscera and bone marrow. It should be treated with the method of nourishing Yin and clearing heat, dispelling evil and fuzheng, benefiting Qi and activating blood. The dried roots, stems or leaves of Rubus parvifolius L., a plant of the genus Rubus parvifolius, have the effects of "clearing heat and cooling blood, dispersing and relieving pain, diuretic and swelling". Recent studies have shown that the raspberry and its active extracts play a certain role in the treatment of blood diseases, and the main active component of the raspberry total saponin (TSRP) has shown strong anti-tumor activity 8 , 9 .The previous experimental study of the research group 10 – 16 found that: TSRP inhibited the growth and colony-forming ability of K562 cells in vitro, induced apoptosis, enhanced the expression of pro-apoptotic proteins Caspase3 and Caspase9, and inhibited the expression of anti-apoptotic proteins Survivin, Bcl-2 and Mcl-1. In vivo, the tumor volume of K562 tumor-bearing mice can be effectively reduced and the life quality of mice can be improved. Studies have shown that abnormal activation of specific downstream pathways is common in patients with IM tolerance, including Ras/MAPK pathway, JAK/STAT pathway, and P13K/AKT pathway 17 . The study of downstream pathway regulation is of great significance for understanding and overcoming IM resistance. Among them, PI3K/AKT pathway is the main activation pathway of IM secondary drug resistance, and is considered to be an innovative therapeutic strategy for targeted cancer treatment 18 . Therefore, we speculate that the activation of PI3K/AKT pathway may be an important mechanism of IM resistance. In summary, we propose the following hypothesis: TSRP may reverse IM resistance by regulating the PI3K/AKT signaling pathway. Therefore, based on previous studies, this project intends to conduct validation in vitro and in vivo: In vitro experiment: K562 cells and K562R cells were studied. After LY294002 (PI3K inhibitor) and MK-2206(AKT inhibitor) were interfered with the PI3K/AKT signaling pathway, apoptosis detection by flow cytometry and Western blot were performed. To analyze whether TSRP reverses IM resistance through PI3K/AKT signaling pathway. In vivo experiment: A nude mouse transplanted tumor model was constructed, and immunohistochemistry, Western blot and other experimental methods were used to verify whether the mechanism of its effect in vivo was consistent with that in vitro. The research results of this project will help to further interpret the role of PI3K/AKT signaling pathway in IM resistance, and is expected to provide theoretical support for TSRP intervention in anti-tumor therapy of IM resistance. Results Successful construction of drug-resistant cell line K562R. According to the survival rate of K562 and K562R cells, IC50 of imatinib on K562 and K562 cells could be calculated as 0.5234µM and 10.339µM, respectively (Fig. 1 a). After adding 0.5µM imatinib to K562 and K562R cells for 48h, the cell membrane of K562 was shrunked and the cytoplasmic particles increased. The membrane surface of K562R was smooth, and no significant morphological changes were observed in most cells (Fig. 1 b). Finally, we used qPCR to detect Bcr/Abl gene expression to verify whether K562R was successfully constructed. As shown in Fig. 1 c, compared with the normal group, the expression level of Bcr/Abl in the cells of the drug-resistant strain group was significantly increased ( P < 0.01). Effects of TSRP combined with IM on proliferation and apoptosis of K562R cells. To observe the effects of TSRP combined with IM on cell proliferation, K562R cells were treated with different concentrations of TSRP (0, 50, 100, 200, 300 or 400 µg/ml) and IM (0, 0.1, 0.2, 0.4, 0.8 or 1.6 µM) for 48h. TSRP at 200µg/ml and above significantly decreased the survival rate of K562R cells ( P < 0.01), 0.2µM and above concentrations of IM significantly decreased the survival rate of K562R cells ( P < 0.01). According to the survival rate of K562R cells, the IC10 of TSRP was 79.8499µg/ml and the IC50 of IM was 0.8525µM (Fig. 2 a). The IC10 value of TSRP and IC50 value of IM were used to administer K562R cells in groups. As shown in Fig. 2 b, compared with the control group, there was no significant change in cell survival rate in TSRP group ( P > 0.05), the survival rate of cells in IM group and TSRP + IM group was significantly decreased ( P < 0.01). To investigate whether the inhibitory effect of TSRP combined with IM on K562R cells is related to apoptosis. We cultured K562R cells with the same dose concentration as described above and evaluated apoptosis rate by flow cytometry with Annexin V-FITC/PI assay. As shown in Fig. 2 c and Fig. 2 d, apoptosis rates in all groups were significantly higher than those in the control group ( P < 0.05 or P < 0.01), Among them, TSRP + IM group had the best apoptosis effect and the highest apoptosis rate. TSRP combined with IM inhibited the expression of PI3K/AKT pathway related proteins in K562R cells. The PI3K/AKT pathway is a major activation pathway for secondary IM resistance and is considered to be a classical pathway for targeted cancer therapy 18 . In order to further explore the mechanism of TSRP reversing IM resistance in chronic myelogenous leukemia, we detected the expressions of PI3K/AKT pathway related proteins PI3K, p-PI3K, AKT and p-AKT by Western blot. The results (Fig. 3 a and Fig. 3 b) showed that, The expression levels of p-PI3K and p-AKT in K562R cells in IM group and TSRP + IM group were significantly decreased compared with control group ( P < 0.05 or P < 0.01). In order to further verify that the mechanism of TSRP reversal of drug resistance is related to the PI3K/AKT pathway, we added PI3K inhibitor and AKT inhibitor respectively, and found that compared with the control group, the expression levels of p-PI3K and p-AKT protein in K562R cells in the PI3K inhibitor group and PI3K inhibitor + TSRP group were significantly decreased. Moreover, the phosphorylation level of histone in PI3K inhibitor + TSRP group was significantly lower than that in PI3K inhibitor only treatment ( P < 0.05 or P < 0.01) (Fig. 3 c,d). After AKT inhibitor treatment, the expression levels of p-PI3K and p-AKT protein in K562R cells of all groups were significantly decreased, and the histone phosphorylation levels of AKT inhibitor + TSRP were significantly decreased ( P < 0.05 or P < 0.01) (Fig. 3 e,f). The results of GO enrichment analysis and KEGG enrichment analysis were shown in Fig. 4 a-c. After selecting intersection targets of TSRP and CML, the PI3K/AKT pathway was enriched by KEGG analysis, which was consistent with our hypothesis. TSRP combined with IM inhibited the growth of transplanted tumor in nude mice. In order to verify whether TSRP can also reverse IM resistance in vivo and explore whether the mechanism of its effect in vivo is the same as in vitro, we constructed a nude mouse transplanted tumor model, and injected K562R cell suspension with logarithmic growth phase subcutaneously into the left armpit of nude mice. When the transplanted tumor volume was close to 30mm 3 , the drug was administered in experimental groups. IM was given 50mg/kg by intragastric injection and TSRP was given 100mg/kg by intraperitoneal injection. The control group was injected intraperitoneally with the same amount of normal saline every day for 3 consecutive weeks(Fig. 5 a). The survival rate of nude mice was observed and the tumor volume of nude mice was measured. Tumor weight and volume of nude mice in each administration group were significantly decreased ( P < 0.01). Among them, TSRP + IM group had the best tumor inhibition effect(Fig. 5 b-d). TSRP combined with IM inhibited the expression of PI3K/AKT pathway related proteins in tumor tissue of nude mice. We further used immunohistochemistry and Western blot to detect the effects of TSRP combined with IM on the expression of PI3K/AKT pathway related proteins in nude mouse tumor tissues t(Fig. 6 a,f). Results As shown in Fig. 6 b-e and Fig. 6 g-h, protein expression levels of p-PI3K and p-AKT in tumor tissue of nude mice in TSRP group, IM group and TSRP + IM group were significantly decreased compared with the control group ( P < 0.05 or P < 0.01), the results of the two detection methods were consistent, and the results of cell experiments were also consistent. Discussion IM is the first-generation BCR/ABL inhibitor approved by FDA in 2001 20 and is the first-line drug for the treatment of CML 21 , 22 . With the wide application of IM in clinical practice, about 20%-30% of patients have drug resistance, and at present, IM drug resistance has become a major problem troubling clinical treatment 23 . Although the second generation of BCR/ABL inhibitors such as Nilotinib, dasatinib, Bonatinib and other targeted therapeutic drugs are on the market. However, drug resistance and serious adverse reactions remain a problem 24 – 26 . More and more studies have shown that TCM combined with targeted drugs to treat tumor is a new hot spot in drug resistance research 27 . TSRP is the main active component of Chinese medicine Maomei, which has strong anti-tumor activity 8 , 9 . Our previous experimental study 10 – 16 found that TSRP can significantly inhibit the growth and colony-forming ability of K562 cells in vitro, induce apoptosis of K562 cells, and enhance the expression of pro-apoptotic proteins Caspase3 and Caspase9. The expression of anti-apoptotic proteins Survivin, Bcl-2 and Mcl-1 was inhibited. In vivo, the tumor volume of K562 tumor-bearing mice can be effectively reduced and the life quality of mice can be improved. The results of this study found that TSRP and IM had a synergistic effect, and the combination of TSRP and IM was significantly better than the single drug group. TSRP combined with IM could inhibit the proliferation of K562R cells and promote the apoptosis of K562R cells in vitro. In vivo, it can inhibit the growth of transplanted tumors in nude mice. Abnormal increase of BCR/ABL tyrosine kinase can activate several downstream pathways, including Ras/MAPK pathway, JAK/STAT pathway, P13K/AKT pathway, etc. 17 . Among them, the PI3K/AKT pathway is a relatively classical pathway, which is one of the main activation pathways for secondary drug resistance of IM 28 , 29 . PI3K/AKT activation is mainly related to phosphorylation, cytoplasmic cycling and FOXO inactivation, leading to proliferation and anti-apoptosis of CML cells 30 , 31 . We speculate that the activation of PI3K/AKT pathway may be an important mechanism of IM resistance, and TSRP may play a role in reversing drug resistance by inhibiting the activation of this pathway. In order to verify this hypothesis, in vitro experiments, Western blot was used to detect the expression of PI3K/AKT pathway related proteins PI3K, p-PI3K, AKT and p-AKT. The results (Fig. 3 A and Fig. 3 B) showed that, The expression levels of p-PI3K and p-AKT protein in K562R cells in TSRP + IM group were significantly decreased compared with control group( P < 0.05 or P < 0.01). After adding PI3K inhibitor and AKT inhibitor, it was found that compared with the control group, the phosphorylation levels of PI3K and AKT protein in inhibitor + TSRP group decreased significantly ( P < 0.05 or P < 0.01). These experimental results agree with our conjecture. We further verified this by using bioinformatics analysis. The results of KEGG enrichment analysis of the common target of TSRP and CML (Fig. 4 A-C) showed that PI3K/AKT pathway was the main pathway of drug action on disease, which was also consistent with our hypothesis. In summary, we believe that TSRP and IM have a synergistic effect, and TSRP may reverse IM resistance in CML through the PI3K/AKT pathway. But the mechanism still needs to be further explored. Conclusions In summary, our results suggest that TSRP has a synergistic effect with IM, and TSRP may reverse IM resistance in CML through the PI3K/AKT pathway. The results of this study are expected to provide experimental basis for the development of TSRP, and provide a new clinical treatment idea for CML IM resistance. Materials and Methods Cell, animal culture and reagents. Imatinib-sensitive CML cells (K562 cells, purchased from TRANSGEN BIOTECH Co., LTD., Shanghai, China) were cultured in RPMI 1640 (TRANSGEN BIOTECH, Beijing, China) medium containing 10% fetal bovine serum; Imatinib-resistant cells (K562R cells) were maintained and cultured in RPMI1640 medium containing 5µM imatinib. The cells were cultured in a 5%CO2 incubator at 37℃. Nude mice were provided by Shanghai Sipple-Bikai Laboratory Animal Co., LTD., Animal production license No. SCXK (Shanghai) 2013-0016. Feeding conditions: constant temperature, temperature 22 ± 2°C, humidity 50%-60%, light and dark environment of 14 h light and 10h dark alternating, wind change times 15–20 times/hour. It is raised by Animal Experimental Research Center of Zhejiang Eyong Pharmaceutical Research & Development Co., Ltd. All animal studies / procedures have been approved by China Ethics Committee and performed in accordance with the ethical standards. This animal experiment program was approved by the Ethics Committee of Zhejiang Eyong Pharmaceutical Research & Development Co., Ltd (Approval No.: ZJEY-20230420-06). TSRP was isolated and extracted from Rubus parvifolius, a traditional Chinese medicine, and was provided by Professor Yang Bo from Pharmaceutical Laboratory of Zhejiang Chinese Medicine University. IM was acquired from Shanghai Maclin Biochemical Technology Co., LTD. CCK8 kit was purchased from Shanghai Biyuntian Biotechnology Co., LTD. Trizol was acquired from Shenggong BioEngineering Shanghai Co., LTD. The reverse transcription kit was purchased from Beijing Kangwei Century Biotechnology Co., LTD. The SYBR Premix Ex TaqII kit is a Japanese Takara brand; The apoptosis kit is the American BD brand; Both RIPA lysate and PMSF were purchased from Shanghai Biyuntian Biotechnology Co., LTD. BCA kit and chemiluminescence detection reagent were purchased from Beijing Solaibao Technology Co., LTD. The antibodies are from Affnity Reagents. Construction of drug-resistant cell lines. K562R was constructed by limiting gradient dilution method, that is, K562 was cultured by continuously and gradually increasing the concentration of imatinib solution. The concentration of imatinib ranged from 0.1 to 5µM, increasing by 200 nM every 14 days, and then maintained in RPMI1640 culture medium containing 5µM imatinib. Cell grouping and administration K562 cells were divided into control group and imatinib treatment group (0.25µM, 0.50µM, 0.75µM, 1.00µM and 2µM). K562R cells were divided into control group and imatinib treatment group (5.0µM, 7.5µM, 10.0µM, 15.0µM and 20 µM). K562 cells at logarithmic growth stage were taken, digested and counted to make 8x105/ml cell suspension, and 100ul cell suspension was added into each well of the 96-well plate. After the well plates were cultured in an incubator for 24h, the culture medium of the well plates was removed, and the drug intervention was carried out according to the groups. After 48 hours of administration, 10µL CCK-8 solution was added to each well and incubated in the incubator for 30min. The absorbance at 450nm was measured by enzyme labeling (MD, CMaxPlus, USA), and the cell survival rate was calculated. Six compound pores were measured in parallel in each cell group. Cell morphology observation K562 and K562R cells were inoculated into a conventional 12-well plate with imatinib (IC50 concentration of imatinib in K562 cells) at the growth stage. The cells were treated with 3 multiple pores in each concentration group. After induction for 48h, the cell morphology was observed under inverted microscope (Motic, AE2000, CHINA). RT-qPCR assays. The cells were divided into control group and drug-resistant strain group. 1000µl of Trizol was added into homogenate tube for every 1×107 cells, and total RNA was extracted according to the kit procedure. Reverse transcription reaction was performed according to the steps of reverse transcription kit. Reaction conditions were 42℃, 15min; 85℃, 5min; Real-time fluorescence quantitative PCR reaction was performed according to SYBR Premix Ex TaqII kit instructions. Real time PCR instrument (BIO RAD, CFX Connect, USA) Real-time fluorescence quantitative PCR instrument, made in USA. PCR procedures have been optimized. The finished 8 tubes were placed on the Realtime PCR instrument for PCR reaction. Reaction conditions: 95℃, 10min denaturation; 95℃, 15s; 60℃, 60s; 40 cycles. Primer sequence information is shown in Table 1 . Table 1 Primers sequence Gene Forward Primer Reverse Primer Human Bcr/Abl TCCTCGTCCTCCAGCTGTTA GCAACGAAAAGGTTGGGGTC Human GAPDH GGAGCGAGATCCCTCCAAAAT GGCTGTTGTCATACTTCTCATGG Cell Proliferation assays(CCK8 assays). First, we divided K562R cells into TSRP treated groups (0, 50, 100, 200, 300 or 400 µg/ml) and IM treated groups (0, 0.1, 0.2, 0.4, 0.8 or 1.6 µM). IC10 of TSRP and IC50 of IM were detected by CCK8. The effects of TSRP combined with IM on the proliferation of K562R cells were divided into the following groups: control group, TSRP group, IM group, and TSRP + IM group. K562R cell suspension at logarithmic growth stage was administered in groups and inoculated into 96-well plates. After 48h of culture, 10µL CCK8 solution was added to each well and incubated in the incubator. The absorbance of MD, CMaxPlus, USA at 450nm was measured by enzyme labeling, and the cell survival rate was calculated. Six compound pores were measured in parallel in each group of cells. Cell apoptosis analysis. K562R cells of logarithmic growth stage were planted in 6-well plates with a working volume of 2ml per well, and the cell inoculation density was 1.2×106 cells per well. After 24 hours of treatment in the above groups, cells were collected, pre-cooled and washed twice with PBS, and the cell concentration was adjusted to 1×106 cells /ml. Add 500µL binding buffer, centrifuge and discard supernatant, then add 100µL binding buffer and mix well, add 5µL Annexin V-FITC and 10µL PI respectively, mix well; The reaction was kept away from light at room temperature for 15min. Finally, 400µL binding buffer was added, and the apoptosis rate was detected by BD, C6, USA at 1h. The experiment was repeated three times. Western blot assay. Cell protein preparation: the supernatant was removed by centrifugation, 600 µL RIPA lysate (including PMSF and protease inhibitor) was added, cracked on ice, and then the supernatant was removed by centrifugation and transferred to a new pre-cooled centrifuge tube. Preparation of histocin: 100mg tissue sample was Lysis, split and added to 1mL cold homogenate. The supernatant was centrifuged and measured by BCA kit. The protein was denatalized and stored in Loading buffer for later use. Appropriate amount of sample supernatant was absorbed and added into the sample hole, separated by SDS-PAGE gel electrophoresis at 80V for 2h, and wet-transferred to PVDF membrane at 350mA and 90min. Closed with 5% skim milk powder BSA for 2 hours, cut the film, added primary antibody, incubated at 4℃ overnight. After TBST film washing, the corresponding secondary antibodies were added and incubated at room temperature for 1h away from light. After TBST film washing, the ECL chemiluminescence instrument (Shanghai Qinxiang Scientific Instrument Co., LTD., 610020-9Q, Shanghai, China) was developed. Image Studio Ver 2.0 software was used for semi-quantitative analysis of protein gray scale. Bioinformatics analysis. Query by literature, the main composition of TSRP including raspberries glycosides, carrot glycosides, bitter mei glycosides, rose acid, beta sitosterol 19 , we through the PubChem database ( http://pubchem.ncbi.nlm.nih.gov/ ) of main ingredients primer name, Import the Swiss Target Prediction ( http://www.swisstargetprediction.ch/ ) in the database for the active ingredient of targets, remove all the ingredients of targets duplicates as TSRP gene pool. CML disease targets from Gene Cards (( http://www.genecards.org/ )) and OMIM database ( http://www.omim.org/ ), the two merged duplication targets to establish CML Gene pool, Through Venny 2.1.0 ( http://bioinfo.cnb.csic.es/tools/venny/index.html ) for TSRP and CML intersection of genes, Using annotations, visualization and comprehensive database of DAVID ( https://david.ncifcrf.gov/ ), which USES the gene ontology (GO) and enrichment of the Kyoto encyclopedia (KEGG) gene and genome analysis to evaluate intersection genes, species, type is set to "Homo sapiens", When adjusted for P < 0.05, the difference was statistically significant. bioinformatics( http://www.Bioinformatics.com.cn/ ) was used to analyze the significant enrichment results of GO analysis and KEGG analysis to draw bubble maps respectively. Construction of transplanted tumor model in nude mice. K562R cells of logarithmic growth stage were digested, washed and centrifuged in a 1.5ml centrifuge tube with pancreatic enzyme. The cells were suspended and counted with normal saline, and then the cell suspension was adjusted to 5×10 7 cells /ml with normal saline. A 6-week-old female nude mouse was taken, the left armpit skin was disinfected with 75% alcohol, and 100ul cell suspension was injected subcutaneously into the left armpit with a disposable 1ml syringe. The conditions of nude mice were observed twice a week, including the volume of transplanted tumor (volume = length × width 2/2), weight and survival of nude mice. Animals were grouped and administered The nude mice were divided into model group, TSRP group, IM group and TSRP + IM group. When the graft volume of each experimental group was close to 30mm3, the drug was administered according to the experimental group, with 50mg/kg IM and 100mg/kg TSRP by intraperitoneal injection every day, and the control group was injected intraperitoneally with the same amount of normal saline every day for consecutive 3 weeks. The naked mice were stripped of the neck and dissected, the tumor tissue was weighed, and the long diameter and short diameter of the tumor tissue were measured with a vernier caliper, and the volume was calculated (volume = long diameter * short diameter 2/2). Immunohistochemical detection Tissue sections were routinely dewaxed, hydrated, antigen-repaired with citrate buffer solution by microwave, incubated with 3% H2O2 for 10min to eliminate endogenous peroxidase activity, and rinsed with PBS 3 times. Drop the sealing solution (5%BSA) and leave it in a wet box at room temperature for 30min. Wipe off the sealing solution with filter paper, add a suitable concentration of primary antibody (all 1:50), incubate in a wet box at 4℃ overnight, and wash off the primary antibody with PBS. Biotin was added to the secondary antibody solution, incubated in a wet box at room temperature for 20min, and the secondary antibody was washed with PBS. Streptomyces ovialbumin working solution labeled with horseradish enzyme was added, incubated in a wet box at room temperature for 20min, and washed off with PBS. DAB color development agent, rinse fully with tap water. Hematoxylin redyeing, dehydration, transparent, neutral gum seal. The tumor tissue of nude mice was randomly selected under section microscope and the 6 fields were not repeated. Statistical analysis. SPSS 16.0 statistical software was used for data analysis, and all data were expressed as mean ± standard deviation ( ), P< 0.05 was considered statistically significant. For pairwise comparison between groups, t test of two independent samples was used for homogeneity of variance, and Kruskal-Wallis H test was used for heterogeneity of variance. Declarations Acknowledgments This study was supported by Zhejiang Provincial Traditional Chinese Medicine Science and Technology Project (NO: 2021ZQ069). Author contributions Xiaofeng Xu and Ying He designed the study. Ying He analyzed and interpreted the data, and wrote the manuscript. Xiaofeng Xu and Changyu Li participated in the design of experimental procedures and revised the manuscript. Ying He, Jiyuan Ding, Liqing Liu, Jiajun Chen and Hong Zhong participated in the experimental research. All authors have read and agreed to the published version of the manuscript. Data availability statement The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Conflicts of Interest The authors declare no conflict of interest. Ethics statements This study is reported in accordance with ARRIVE guidelines. All animal studies / procedures have been approved by China Ethics Committee and performed in accordance with the ethical standards. The Animal experiment protocol listed below has been reviewed and approved by Laboratory animal of Zhejiang Eyong Pharmaceutical Research & Development Co., Ltd (protocol code: ZJEY-20230420-06 and the date of approval: April 20, 2023). References Cortes J, Goldman JM, Hughes T. Current issues in chronic myeloid leukemia: monitoring, resistance, and functional cure. J Natl Compr Canc Netw. 10 , S1-S13(2012). Ferreira AF, Moura LG, Tojal I. ApoptomiRs expression modulated by BCR-ABL is linked to CML progression and imatinib resistance. Blood Cells Molecules and Diseases. 53,47-55(2014). Almeida TP, Ferreira J, Vettorazzi A. Cytotoxic activity of fucoxanthin, alone and in combination with the cancer drugs imatinib and doxorubicin, in CML cell lines[J]. Environ Toxicol Pharmacol. 59, 24-33(2018). Kantarjian H, O’Brien S, Jabbour E, et al. Impact of treatment end point definitions on perceived differences in long-term outcome with tyrosine kinase inhibitor therapy in chronic myeloid leukemia. J Clin Oncol. 29 , 3173-3178(2011). Jabbour E, Jones D, Kantarjian HM, et al. Long-term outcome of patients chronic myeloid leukemia treated with second-generation tyrosine kinase inhibitors after imatinib failure is predicted by the in vitro sensitivity of BCR-ABL kinase domain mutations. Blood. 114, 2037-2043(2009). Gruber FX, Ernst T, Porkka K, et al. Dynamics of the emergence of dasatinib and nilotinib resistance in imatinib-resistant CML patients. Leukemia. 26, 172-177(2011). Qun Dai, Yuqing Ge. Inhibition of proliferation and mechanism of platycodon platycodon D combined with imatinib on K562 /R cells with leukemia resistance. Chinese journal of traditional Chinese Medicine. 43 , 385-389(2018). Gao J, Sun CR, Yang JH, et al. Evaluation of the hepatoprotective and antioxidant activities of Rubus parvifolius L. J Zhejiang Univ Sci B. 12 , 135-142(2011). Zhenjiao Zheng, Linju Zhang, Changxin Huang, et al. Study on the antitumor effect of total saponins of Cymbidium japonicum on melanoma. Chinese journal of traditional Chinese Medicine. 32 , 2055-2058(2007). Xiaofeng Xu, Xuejing Zhang, Jian Feng. Experimental study on the inhibitory effect of Maomaoberry and its drug-containing serum on K562 leukemia cells. Chinese medicine science and technology. 5 , 408-410(2011). Xiaofeng Xu, Xuejin Zhang, Jian Feng. Experimental study on the effects of berry and its total saponins on K562 leukemia cells. Journal of Chinese Medicine. 8 , 1790-1794(2011). Xiaofeng Xu, Rubin Chen, Bo Yang, et al. Study on the mechanism of apoptosis induced by total saponins, homoharringtonine and cytarabine in leukemia cells in vitro. Journal of Chinese Medicine . 33 , 1659-1663(2015). Xiaofeng Xu, Wei Yang, Xuejin Zhang. Study on the synergistic induction of apoptosis of leukemia HL-60 cells by total saponins combined with chemotherapeutics through Fas pathway. Journal of Chinese Medicine . 4 , 923-926(2017). Ge YQ, Xu XF, Yang B, et al. Saponins from Rubus parvifolius L. induce apoptosis in human chronic myeloid leukemia cells through AMPK activation and STAT3 inhibition. Asian Pac J Cancer Prev. 15 , 5455-5461(2014). ZHANG Xue-jin, XU Xiao-feng, GAO Rui-lan, et al. Rubus Parvifolius L.Inhibited the Growth of Leukemia K562 Cells in Vitro and in Vivo. Chin J Integr Med. 20 , 36-42(2014). Xu XF, Cheng RB, Zhang XJ. Total Saponins of Rubus Parvifolius L Exhibited Anti-Leukemia Effect in vivo through STAT3 and elF4E Signaling Pathways. Chin J Inter Med. doi: 10.1007/s 11655-018-2563-8(2018). Fornaro L, Vasile E, Falcone A. Apatinib in Advanced Gastric Cancer: A Doubtful Step Forward. J Clin Oncol. 34 , 3822-3833(2016). Ma H, Cheng L, Hao K, et al. Reversal effect of ST6GAL1 on multidrug resistance in human leukemia by regulating the PI3K /Akt pathway and the expression of P-gp and MRP1. PLoS ONE. 9 , e85113(2014). Jisheng Wang，Zhongmeng Yin. Research progress on chemical constituents and pharmacology of Rubus parvifolius L.China Pharmacy. 18 , 463-464(2007). Druker B.J, Talpaz M, Resta D.J, et al. Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N. Engl. J. Med. 344 , 1031–1037(2001). Jabbour E, Kantarjian H. Chronic myeloid leukemia: 2016 update on diagnosis, therapy, and monitoring. Am J Hematol. 91 , 252-265(2016). Tabarestani S, Movafagh A. New developments in chronic myeloid leukemia: implications for therapy. Iran J Cancer Prev. 9 , e3961(2016). Pophali PA, Patnaik MM. The role of new tyrosine kinase inhitors in chronic myeloid leukemia. Cancer J. 22 , 40-50(2016). J.F. Apperley, Chronic myeloid leukaemia, Lancet. 385, 1447–1459(2015). O. Frankfurt, J.D. Licht, Ponatinib-a step forward in overcoming resistance in chronic myeloid leukemia. Clin. Cancer Res. 19 , 5828–5834(2013). J.E. Cortes, H. Kantarjian, N.P. Shah, D. Bixby, M.J. Mauro, I. Flinn, et al., Ponatinib in refractory Philadelphia chromosome-positive leukemias. N. Engl. J. Med. 367 , 2075–2088(2012). Le-Yi Zhang , Jun-Gang Zhang , Xue Yang. Targeting Tumor Immuno-suppressive Microenvironment for the Prevention of Hepatic Cancer: Applications of Traditional Chinese Medicines in Targeted Delivery. Curr Top Med Chem. 20 , 2789-2800(2020). Burchert, A; Wang, Y; Cai, D; von Bubnoff, N; . Compensatory PI3-kinase/Akt/mTor activation regulates imatinib resistance development. LEUKEMIA. 19 , 1774-1782(2005). Yap, Ernie; Norziha, Zainul Abidin; Simbun, Alfred; . Downregulation of Mir-146a-5p, Mir-99b-5p, Mir-143-3p, Mir-10a-5p and Mir-151a-3p Associated with PI3K/AKT, p53, NF-Kb, and Fanconi Anemia/BRCA Signaling Pathways Are Observed in Imatinib-Resistant Chronic Myeloid Leukemia Patients without Detectable BCR-ABL kinase Domain Mutations. BLOOD. 128 , 3060-3060(2016). Naughton,R; Quiney, C; Turner, S D,. Bcr-Abl-mediated redox regulation of the PI3K/AKT pathway. LEUKEMIA. 23, 432-1440(2009). Okabe, Seiichi; Tauchi, Tetsuzo; Tanaka, Yuko;. Efficacy of the dual PI3K and mTOR inhibitor NVP-BEZ235 in combination with nilotinib against BCR-ABL-positive leukemia cells involves the ABL kinase domain mutation. CANCER BIOL THER. 15 , 207-215(2014,). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3223174","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":280932775,"identity":"1cb25f5e-3398-43e9-932a-6534f75890cd","order_by":0,"name":"Ying He","email":"","orcid":"","institution":"Affiliated Hangzhou Chest Hospital, Zhejiang University School of Medicine.","correspondingAuthor":false,"prefix":"","firstName":"Ying","middleName":"","lastName":"He","suffix":""},{"id":280932776,"identity":"60439377-0cd9-4675-a35b-4ee2ea3b1387","order_by":1,"name":"Jiyuan Ding","email":"","orcid":"","institution":"Affiliated Hangzhou Chest Hospital, Zhejiang University School of Medicine.","correspondingAuthor":false,"prefix":"","firstName":"Jiyuan","middleName":"","lastName":"Ding","suffix":""},{"id":280932777,"identity":"142f3349-da11-43c4-866f-05599aa79b55","order_by":2,"name":"Liqin Liu","email":"","orcid":"","institution":"Affiliated Hangzhou Chest Hospital, Zhejiang University School of Medicine.","correspondingAuthor":false,"prefix":"","firstName":"Liqin","middleName":"","lastName":"Liu","suffix":""},{"id":280932778,"identity":"4f8bcae4-d0d5-4764-8576-77156823fac4","order_by":3,"name":"Jiajun Chen","email":"","orcid":"","institution":"Affiliated Hangzhou Chest Hospital, Zhejiang University School of Medicine.","correspondingAuthor":false,"prefix":"","firstName":"Jiajun","middleName":"","lastName":"Chen","suffix":""},{"id":280932779,"identity":"94b431c4-32d0-4ace-9848-7ff198798d1f","order_by":4,"name":"Hong Zhong","email":"","orcid":"","institution":"Affiliated Hangzhou Chest Hospital, Zhejiang University School of Medicine.","correspondingAuthor":false,"prefix":"","firstName":"Hong","middleName":"","lastName":"Zhong","suffix":""},{"id":280932780,"identity":"8a4f2c6b-06bc-42fc-91b1-e6ce7d8ba371","order_by":5,"name":"Changyu Li","email":"","orcid":"","institution":"College of Pharmacy, Zhejiang Chinese Medical University","correspondingAuthor":false,"prefix":"","firstName":"Changyu","middleName":"","lastName":"Li","suffix":""},{"id":280932781,"identity":"d22e0411-7b23-4408-94c7-79cb7daed04f","order_by":6,"name":"Xiaofeng XU","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5ElEQVRIiWNgGAWjYBACAwkwycDA3gCkPxjYyBGvhecAAwPjjII0YyK1MEC0MPN8OJxIUIu5dI+ZNE+BnRwPe+/h1zYGzAkM7IePbsCnxXLOsTTJGQbJxjw859KscwzY8hh40tJu4HXYjeRjEh8MmBP3S+SYGecY8BQzSPCYEdCS2CaRYFCf2CP/xszYwkAisYGwFrAthxN7JHiMHzMYGBCjJS3ZcobBcaBfcswYewwSjNkI+yXH8DbPn2pgiJ0x/vDjz385fvbDx/BqQQZs4DhiI1Y5CDB/IEX1KBgFo2AUjBwAAAobRJ3mTZQWAAAAAElFTkSuQmCC","orcid":"","institution":"Affiliated Hangzhou Chest Hospital, Zhejiang University School of Medicine.","correspondingAuthor":true,"prefix":"","firstName":"Xiaofeng","middleName":"","lastName":"XU","suffix":""}],"badges":[],"createdAt":"2023-08-01 07:14:13","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3223174/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3223174/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":52983355,"identity":"1750de6f-2d65-4e50-9034-cd93eebc2cec","added_by":"auto","created_at":"2024-03-19 10:42:35","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2711494,"visible":true,"origin":"","legend":"\u003cp\u003eConstruction of K562R drug-resistant cell line. (a) K562 and K562R cells were treated with a specified concentration of IM for 48 h, and cell viability was measured by CCK-8 assay. (b) The cell morphology of K562 and K562R was observed under microscope after 48h of 0.5(M imatinib) culture (scale bar =200μm and 100μm). (c) Real-Time PCR was used to detect Bcr/Abl gene expression to verify whether K562R was successfully constructed. **\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.01 vs. the K562 group.\u003c/p\u003e","description":"","filename":"fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-3223174/v1/90ba3dd9309af3fee8a63d31.png"},{"id":52982659,"identity":"97f1bf19-077b-4045-8f48-0c73417c864a","added_by":"auto","created_at":"2024-03-19 10:34:36","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":507565,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of TSRP combined with IM on proliferation and apoptosis of K562R cells. (a) IC10 of TSRP and IC50 of IM were detected by CCK8 and treated with different concentrations of TSRP (0, 50, 100, 200, 300 or 400 μg/ml) and IM (0, 0.1, 0.2, 0.4, 0.8 or 1.6 μM) for 48h, respectively. (b) The effect of TSRP combined with IM on the proliferation of K562R cells was detected by CCK8. (c) The effect of TSRP combined with IM on apoptosis of K562R cells was detected by flow cytometry. (d) Cell apoptosis rate analysis. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 vs. the Control group.\u003c/p\u003e","description":"","filename":"fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-3223174/v1/ee15391ad356ce8c39b1adb9.png"},{"id":52982658,"identity":"3c395241-3823-474e-a180-86249a117fe6","added_by":"auto","created_at":"2024-03-19 10:34:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":660475,"visible":true,"origin":"","legend":"\u003cp\u003eTSRP combined with IM inhibited the expression of PI3K/AKT pathway related proteins in K562R cells. (a) Western blot analysis of the effects of TSRP combined with IM on the expression of PI3K, p-PI3K, AKT and p-AKT in K562R cells. (b) Effects of TSRP combined with IM on phosphorylation levels of PI3K and AKT. (c) Western blot analysis of the effects of TSRP combined with PI3K inhibitor LY294002 on the expression of PI3K, p-PI3K, AKT and p-AKT in K562R cells. (d) Effects of TSRP combined with PI3K inhibitor LY294002 on phosphorylation levels of PI3K and AKT. (e) Western blot analysis of the effects of TSRP combined with AKT inhibitor MK-2206 on the expression of PI3K, p-PI3K, AKT and p-AKT in cells. (F) Effects of TSRP combined with AKT inhibitor MK-2206 on PI3K and AKT phosphorylation levels. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 vs. the Control group.\u003c/p\u003e","description":"","filename":"fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-3223174/v1/f8c39733a0705a7d16a4fc8c.png"},{"id":52982656,"identity":"3fa70a8c-015b-40d3-9d61-e4aeccc711d5","added_by":"auto","created_at":"2024-03-19 10:34:35","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":496249,"visible":true,"origin":"","legend":"\u003cp\u003eResults of bioinformatics analysis. (a) GO enrichment analysis triad. The first 10 biological processes (BP), cell components (CC) and molecular functions (MF) of GO enrichment analysis. (b) KEGG enrichment analysis results, bubble maps of the top 20 pathways based on KEGG enrichment analysis. (c) The types of the top 20 pathways based on KEGG enrichment analysis.\u003c/p\u003e","description":"","filename":"fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-3223174/v1/3afb32ab33bb441ac5fad010.png"},{"id":52983356,"identity":"ea287a7d-724c-418a-aff6-8c0a44da3a04","added_by":"auto","created_at":"2024-03-19 10:42:36","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":875195,"visible":true,"origin":"","legend":"\u003cp\u003eTSRP combined with IM inhibited tumor growth in nude mice. (a) Schematic diagram of in vivo experiment design. When the graft volume of each experimental group was close to 30mm\u003csup\u003e3\u003c/sup\u003e, the drug was administered according to the experimental group, with 50mg/kg IM and 100mg/kg TSRP by intraperitoneal injection every day, and the control group was injected intraperitoneally with the same amount of normal saline every day for consecutive 3 weeks. (b) Nude mouse tumor picture. (c) Tumor size of nude mice in different treatment groups(unit=mm\u003csup\u003e3\u003c/sup\u003e). (d) Quantification of the tumor weight of nude mice in each treatment group (unit = g).\u003c/p\u003e","description":"","filename":"fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-3223174/v1/ccef125a9da054fe52b3461c.png"},{"id":52982661,"identity":"1424691d-89c6-4403-bd13-80aa377b1944","added_by":"auto","created_at":"2024-03-19 10:34:36","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2180560,"visible":true,"origin":"","legend":"\u003cp\u003eTSRP combined with IM can inhibit the expression of PI3K/AKT pathway related proteins in tumor tissue of nude mice. (a) The effects of TSRP combined with IM on the expression of PI3K, p-PI3K, AKT and p-AKT in K562R nude mouse tumor tissue were detected by immunohistochemistry. (b-e) Statistical results of IOD of PI3K, p-PI3K, AKT and p-AKT protein integral optical density. (f) Western blot analysis of the effects of TSRP combined with IM on the expression of PI3K, p-PI3K, AKT and p-AKT in K562R nude mouse tumor tissue. (g) PI3K phosphorylation levels in different treatment groups. (h) AKT phosphorylation levels in each group. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 vs. the Control group.\u003c/p\u003e","description":"","filename":"fig6.png","url":"https://assets-eu.researchsquare.com/files/rs-3223174/v1/4d656dbfb1ecc1920eba8969.png"},{"id":53542083,"identity":"364111b7-74a3-4e4e-bc7c-7f842eb48883","added_by":"auto","created_at":"2024-03-27 08:58:22","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4103152,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3223174/v1/74863c65-633d-4714-baeb-f0b87421d3e0.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"In vitro and in vivo experimental investigation Of TSRP reverses imatinib resistance through the PI3K / Akt pathway in chronic myeloid leukemia","fulltext":[{"header":"Introduction","content":"\u003cp\u003eChronic myelogenous leukemia (CML) is a blood system disease that originates from the malignant proliferation of bone marrow hematopoietic stem cells. The global incidence is about 1.6\u0026thinsp;~\u0026thinsp;2.0/100,000, and the domestic incidence is about 0.36/100,000, accounting for the third place of leukemia. So far, there is no effective radical cure \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. The characteristic cytogenetic marker of CML is the Bcr/Abl fusion gene produced by the translocation of chromosomes 9 and 22. The fusion protein P210 encoded by this gene has sustained active tyrosine kinase activity, which can activate multiple downstream signaling pathways and induc\u003cb\u003ee\u003c/b\u003e malignant proliferation of myeloid cells\u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e\u003c/sup\u003e. imatinib (IM) is a small molecule tyrosine kinase inhibitor, which can competitively occupy the ATP-binding site of Bcr/Abl and target to inhibit the activity of Bcr/Abl tyrosine kinase, thereby preventing signal transduction of CML cells, resulting in cell proliferation inhibition or apoptosis. At present, it has become a first-line drug in the clinical treatment of CML\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. However, with the clinical application of IM, drug resistance and relapse have become the main reasons limiting its efficacy. Studies have shown that at least 25% of patients discontinue treatment of IM within 5 years due to drug intolerance or other reasons\u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e. Previous researchers have found that IM combined with the new tyrosine kinase inhibitor Src/Abl family can reverse its drug resistance, but with the progress of clinical trials, these drugs have gradually shown resistance \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Therefore, it is urgent to study the mechanism of IM resistance, search for new targets and new combination drugs in the treatment of CML.\u003c/p\u003e \u003cp\u003eTraditional Chinese medicine has been paid more and more attention by researchers because of its advantages such as multi-efficacy, multi-target, low toxicity, delay of relapse and easy to produce drug resistance. Traditional Chinese medicine combined with targeted drugs in the treatment of tumor is a new hot spot in the current drug resistance research\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. CML belongs to the categories of traditional Chinese medicine \"vacuous strain\", \"blood syndrome\", \"warm disease\", \"disease accumulation\", and so on. It is caused by the internal invasion of heat toxicity and damage to the viscera and bone marrow. It should be treated with the method of nourishing Yin and clearing heat, dispelling evil and fuzheng, benefiting Qi and activating blood. The dried roots, stems or leaves of Rubus parvifolius L., a plant of the genus Rubus parvifolius, have the effects of \"clearing heat and cooling blood, dispersing and relieving pain, diuretic and swelling\". Recent studies have shown that the raspberry and its active extracts play a certain role in the treatment of blood diseases, and the main active component of the raspberry total saponin (TSRP) has shown strong anti-tumor activity \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e.The previous experimental study of the research group \u003csup\u003e\u003cspan additionalcitationids=\"CR11 CR12 CR13 CR14 CR15\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003efound that: TSRP inhibited the growth and colony-forming ability of K562 cells in vitro, induced apoptosis, enhanced the expression of pro-apoptotic proteins Caspase3 and Caspase9, and inhibited the expression of anti-apoptotic proteins Survivin, Bcl-2 and Mcl-1. In vivo, the tumor volume of K562 tumor-bearing mice can be effectively reduced and the life quality of mice can be improved.\u003c/p\u003e \u003cp\u003eStudies have shown that abnormal activation of specific downstream pathways is common in patients with IM tolerance, including Ras/MAPK pathway, JAK/STAT pathway, and P13K/AKT pathway\u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. The study of downstream pathway regulation is of great significance for understanding and overcoming IM resistance. Among them, PI3K/AKT pathway is the main activation pathway of IM secondary drug resistance, and is considered to be an innovative therapeutic strategy for targeted cancer treatment \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Therefore, we speculate that the activation of PI3K/AKT pathway may be an important mechanism of IM resistance.\u003c/p\u003e \u003cp\u003eIn summary, we propose the following hypothesis: TSRP may reverse IM resistance by regulating the PI3K/AKT signaling pathway. Therefore, based on previous studies, this project intends to conduct validation in vitro and in vivo: In vitro experiment: K562 cells and K562R cells were studied. After LY294002 (PI3K inhibitor) and MK-2206(AKT inhibitor) were interfered with the PI3K/AKT signaling pathway, apoptosis detection by flow cytometry and Western blot were performed. To analyze whether TSRP reverses IM resistance through PI3K/AKT signaling pathway. In vivo experiment: A nude mouse transplanted tumor model was constructed, and immunohistochemistry, Western blot and other experimental methods were used to verify whether the mechanism of its effect in vivo was consistent with that in vitro. The research results of this project will help to further interpret the role of PI3K/AKT signaling pathway in IM resistance, and is expected to provide theoretical support for TSRP intervention in anti-tumor therapy of IM resistance.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eSuccessful construction of drug-resistant cell line K562R.\u003c/b\u003e According to the survival rate of K562 and K562R cells, IC50 of imatinib on K562 and K562 cells could be calculated as 0.5234\u0026micro;M and 10.339\u0026micro;M, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). After adding 0.5\u0026micro;M imatinib to K562 and K562R cells for 48h, the cell membrane of K562 was shrunked and the cytoplasmic particles increased. The membrane surface of K562R was smooth, and no significant morphological changes were observed in most cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). Finally, we used qPCR to detect Bcr/Abl gene expression to verify whether K562R was successfully constructed. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec, compared with the normal group, the expression level of Bcr/Abl in the cells of the drug-resistant strain group was significantly increased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e \u003cp\u003e \u003cb\u003eEffects of TSRP combined with IM on proliferation and apoptosis of K562R cells.\u003c/b\u003e To observe the effects of TSRP combined with IM on cell proliferation, K562R cells were treated with different concentrations of TSRP (0, 50, 100, 200, 300 or 400 \u0026micro;g/ml) and IM (0, 0.1, 0.2, 0.4, 0.8 or 1.6 \u0026micro;M) for 48h. TSRP at 200\u0026micro;g/ml and above significantly decreased the survival rate of K562R cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), 0.2\u0026micro;M and above concentrations of IM significantly decreased the survival rate of K562R cells (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). According to the survival rate of K562R cells, the IC10 of TSRP was 79.8499\u0026micro;g/ml and the IC50 of IM was 0.8525\u0026micro;M (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). The IC10 value of TSRP and IC50 value of IM were used to administer K562R cells in groups. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, compared with the control group, there was no significant change in cell survival rate in TSRP group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026gt;\u0026thinsp;0.05), the survival rate of cells in IM group and TSRP\u0026thinsp;+\u0026thinsp;IM group was significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e \u003cp\u003eTo investigate whether the inhibitory effect of TSRP combined with IM on K562R cells is related to apoptosis. We cultured K562R cells with the same dose concentration as described above and evaluated apoptosis rate by flow cytometry with Annexin V-FITC/PI assay. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec and Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed, apoptosis rates in all groups were significantly higher than those in the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), Among them, TSRP\u0026thinsp;+\u0026thinsp;IM group had the best apoptosis effect and the highest apoptosis rate.\u003c/p\u003e \u003cp\u003e \u003cb\u003eTSRP combined with IM inhibited the expression of PI3K/AKT pathway related proteins in K562R cells.\u003c/b\u003e The PI3K/AKT pathway is a major activation pathway for secondary IM resistance and is considered to be a classical pathway for targeted cancer therapy\u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. In order to further explore the mechanism of TSRP reversing IM resistance in chronic myelogenous leukemia, we detected the expressions of PI3K/AKT pathway related proteins PI3K, p-PI3K, AKT and p-AKT by Western blot. The results (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea and Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb) showed that, The expression levels of p-PI3K and p-AKT in K562R cells in IM group and TSRP\u0026thinsp;+\u0026thinsp;IM group were significantly decreased compared with control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e \u003cp\u003eIn order to further verify that the mechanism of TSRP reversal of drug resistance is related to the PI3K/AKT pathway, we added PI3K inhibitor and AKT inhibitor respectively, and found that compared with the control group, the expression levels of p-PI3K and p-AKT protein in K562R cells in the PI3K inhibitor group and PI3K inhibitor\u0026thinsp;+\u0026thinsp;TSRP group were significantly decreased. Moreover, the phosphorylation level of histone in PI3K inhibitor\u0026thinsp;+\u0026thinsp;TSRP group was significantly lower than that in PI3K inhibitor only treatment (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ec,d). After AKT inhibitor treatment, the expression levels of p-PI3K and p-AKT protein in K562R cells of all groups were significantly decreased, and the histone phosphorylation levels of AKT inhibitor\u0026thinsp;+\u0026thinsp;TSRP were significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ee,f).\u003c/p\u003e \u003cp\u003eThe results of GO enrichment analysis and KEGG enrichment analysis were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea-c. After selecting intersection targets of TSRP and CML, the PI3K/AKT pathway was enriched by KEGG analysis, which was consistent with our hypothesis.\u003c/p\u003e \u003cp\u003e \u003cb\u003eTSRP combined with IM inhibited the growth of transplanted tumor in nude mice.\u003c/b\u003e In order to verify whether TSRP can also reverse IM resistance in vivo and explore whether the mechanism of its effect in vivo is the same as in vitro, we constructed a nude mouse transplanted tumor model, and injected K562R cell suspension with logarithmic growth phase subcutaneously into the left armpit of nude mice. When the transplanted tumor volume was close to 30mm\u003csup\u003e\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e, the drug was administered in experimental groups. IM was given 50mg/kg by intragastric injection and TSRP was given 100mg/kg by intraperitoneal injection. The control group was injected intraperitoneally with the same amount of normal saline every day for 3 consecutive weeks(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). The survival rate of nude mice was observed and the tumor volume of nude mice was measured. Tumor weight and volume of nude mice in each administration group were significantly decreased (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Among them, TSRP\u0026thinsp;+\u0026thinsp;IM group had the best tumor inhibition effect(Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb-d).\u003c/p\u003e \u003cp\u003e \u003cb\u003eTSRP combined with IM inhibited the expression of PI3K/AKT pathway related proteins in tumor tissue of nude mice.\u003c/b\u003e We further used immunohistochemistry and Western blot to detect the effects of TSRP combined with IM on the expression of PI3K/AKT pathway related proteins in nude mouse tumor tissues t(Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003ea,f). Results As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eb-e and Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eg-h, protein expression levels of p-PI3K and p-AKT in tumor tissue of nude mice in TSRP group, IM group and TSRP\u0026thinsp;+\u0026thinsp;IM group were significantly decreased compared with the control group (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01), the results of the two detection methods were consistent, and the results of cell experiments were also consistent.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIM is the first-generation BCR/ABL inhibitor approved by FDA in 2001\u003csup\u003e20\u003c/sup\u003eand is the first-line drug for the treatment of CML \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e,\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e. With the wide application of IM in clinical practice, about 20%-30% of patients have drug resistance, and at present, IM drug resistance has become a major problem troubling clinical treatment \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e. Although the second generation of BCR/ABL inhibitors such as Nilotinib, dasatinib, Bonatinib and other targeted therapeutic drugs are on the market. However, drug resistance and serious adverse reactions remain a problem \u003csup\u003e\u003cspan additionalcitationids=\"CR25\" citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. More and more studies have shown that TCM combined with targeted drugs to treat tumor is a new hot spot in drug resistance research\u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e\u003c/sup\u003e. TSRP is the main active component of Chinese medicine Maomei, which has strong anti-tumor activity \u003csup\u003e\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e,\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u003c/sup\u003e. Our previous experimental study \u003csup\u003e\u003cspan additionalcitationids=\"CR11 CR12 CR13 CR14 CR15\" citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003efound that TSRP can significantly inhibit the growth and colony-forming ability of K562 cells in vitro, induce apoptosis of K562 cells, and enhance the expression of pro-apoptotic proteins Caspase3 and Caspase9. The expression of anti-apoptotic proteins Survivin, Bcl-2 and Mcl-1 was inhibited. In vivo, the tumor volume of K562 tumor-bearing mice can be effectively reduced and the life quality of mice can be improved. The results of this study found that TSRP and IM had a synergistic effect, and the combination of TSRP and IM was significantly better than the single drug group. TSRP combined with IM could inhibit the proliferation of K562R cells and promote the apoptosis of K562R cells in vitro. In vivo, it can inhibit the growth of transplanted tumors in nude mice.\u003c/p\u003e \u003cp\u003eAbnormal increase of BCR/ABL tyrosine kinase can activate several downstream pathways, including Ras/MAPK pathway, JAK/STAT pathway, P13K/AKT pathway, etc. \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e. Among them, the PI3K/AKT pathway is a relatively classical pathway, which is one of the main activation pathways for secondary drug resistance of IM \u003csup\u003e\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. PI3K/AKT activation is mainly related to phosphorylation, cytoplasmic cycling and FOXO inactivation, leading to proliferation and anti-apoptosis of CML cells \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. We speculate that the activation of PI3K/AKT pathway may be an important mechanism of IM resistance, and TSRP may play a role in reversing drug resistance by inhibiting the activation of this pathway. In order to verify this hypothesis, in vitro experiments, Western blot was used to detect the expression of PI3K/AKT pathway related proteins PI3K, p-PI3K, AKT and p-AKT. The results (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB) showed that, The expression levels of p-PI3K and p-AKT protein in K562R cells in TSRP\u0026thinsp;+\u0026thinsp;IM group were significantly decreased compared with control group(\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). After adding PI3K inhibitor and AKT inhibitor, it was found that compared with the control group, the phosphorylation levels of PI3K and AKT protein in inhibitor\u0026thinsp;+\u0026thinsp;TSRP group decreased significantly (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.01). These experimental results agree with our conjecture. We further verified this by using bioinformatics analysis. The results of KEGG enrichment analysis of the common target of TSRP and CML (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-C) showed that PI3K/AKT pathway was the main pathway of drug action on disease, which was also consistent with our hypothesis.\u003c/p\u003e \u003cp\u003eIn summary, we believe that TSRP and IM have a synergistic effect, and TSRP may reverse IM resistance in CML through the PI3K/AKT pathway. But the mechanism still needs to be further explored.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eIn summary, our results suggest that TSRP has a synergistic effect with IM, and TSRP may reverse IM resistance in CML through the PI3K/AKT pathway. The results of this study are expected to provide experimental basis for the development of TSRP, and provide a new clinical treatment idea for CML IM resistance.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e\u003cstrong\u003eCell, animal culture and reagents.\u003c/strong\u003e Imatinib-sensitive CML cells (K562 cells, purchased from TRANSGEN BIOTECH Co., LTD., Shanghai, China) were cultured in RPMI 1640 (TRANSGEN BIOTECH, Beijing, China) medium containing 10% fetal bovine serum; Imatinib-resistant cells (K562R cells) were maintained and cultured in RPMI1640 medium containing 5\u0026micro;M imatinib. The cells were cultured in a 5%CO2 incubator at 37℃.\u003c/p\u003e\n\u003cp\u003eNude mice were provided by Shanghai Sipple-Bikai Laboratory Animal Co., LTD., Animal production license No. SCXK (Shanghai) 2013-0016. Feeding conditions: constant temperature, temperature 22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, humidity 50%-60%, light and dark environment of 14 h light and 10h dark alternating, wind change times 15\u0026ndash;20 times/hour. It is raised by Animal Experimental Research Center of Zhejiang Eyong Pharmaceutical Research \u0026amp; Development Co., Ltd. All animal studies / procedures have been approved by China Ethics Committee and performed in accordance with the ethical standards. This animal experiment program was approved by the Ethics Committee of Zhejiang Eyong Pharmaceutical Research \u0026amp; Development Co., Ltd (Approval No.: ZJEY-20230420-06).\u003c/p\u003e\n\u003cp\u003eTSRP was isolated and extracted from Rubus parvifolius, a traditional Chinese medicine, and was provided by Professor Yang Bo from Pharmaceutical Laboratory of Zhejiang Chinese Medicine University. IM was acquired from Shanghai Maclin Biochemical Technology Co., LTD. CCK8 kit was purchased from Shanghai Biyuntian Biotechnology Co., LTD. Trizol was acquired from Shenggong BioEngineering Shanghai Co., LTD. The reverse transcription kit was purchased from Beijing Kangwei Century Biotechnology Co., LTD. The SYBR Premix Ex TaqII kit is a Japanese Takara brand; The apoptosis kit is the American BD brand; Both RIPA lysate and PMSF were purchased from Shanghai Biyuntian Biotechnology Co., LTD. BCA kit and chemiluminescence detection reagent were purchased from Beijing Solaibao Technology Co., LTD. The antibodies are from Affnity Reagents.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConstruction of drug-resistant cell lines.\u003c/strong\u003eK562R was constructed by limiting gradient dilution method, that is, K562 was cultured by continuously and gradually increasing the concentration of imatinib solution. The concentration of imatinib ranged from 0.1 to 5\u0026micro;M, increasing by 200 nM every 14 days, and then maintained in RPMI1640 culture medium containing 5\u0026micro;M imatinib.\u003c/p\u003e\n\u003cp\u003eCell grouping and administration\u003c/p\u003e\n\u003cp\u003eK562 cells were divided into control group and imatinib treatment group (0.25\u0026micro;M, 0.50\u0026micro;M, 0.75\u0026micro;M, 1.00\u0026micro;M and 2\u0026micro;M). K562R cells were divided into control group and imatinib treatment group (5.0\u0026micro;M, 7.5\u0026micro;M, 10.0\u0026micro;M, 15.0\u0026micro;M and 20 \u0026micro;M). K562 cells at logarithmic growth stage were taken, digested and counted to make 8x105/ml cell suspension, and 100ul cell suspension was added into each well of the 96-well plate. After the well plates were cultured in an incubator for 24h, the culture medium of the well plates was removed, and the drug intervention was carried out according to the groups. After 48 hours of administration, 10\u0026micro;L CCK-8 solution was added to each well and incubated in the incubator for 30min. The absorbance at 450nm was measured by enzyme labeling (MD, CMaxPlus, USA), and the cell survival rate was calculated. Six compound pores were measured in parallel in each cell group.\u003c/p\u003e\n\u003cp\u003eCell morphology observation\u003c/p\u003e\n\u003cp\u003eK562 and K562R cells were inoculated into a conventional 12-well plate with imatinib (IC50 concentration of imatinib in K562 cells) at the growth stage. The cells were treated with 3 multiple pores in each concentration group. After induction for 48h, the cell morphology was observed under inverted microscope (Motic, AE2000, CHINA).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRT-qPCR assays.\u003c/strong\u003e The cells were divided into control group and drug-resistant strain group. 1000\u0026micro;l of Trizol was added into homogenate tube for every 1\u0026times;107 cells, and total RNA was extracted according to the kit procedure. Reverse transcription reaction was performed according to the steps of reverse transcription kit. Reaction conditions were 42℃, 15min; 85℃, 5min; Real-time fluorescence quantitative PCR reaction was performed according to SYBR Premix Ex TaqII kit instructions. Real time PCR instrument (BIO RAD, CFX Connect, USA) Real-time fluorescence quantitative PCR instrument, made in USA. PCR procedures have been optimized. The finished 8 tubes were placed on the Realtime PCR instrument for PCR reaction. Reaction conditions: 95℃, 10min denaturation; 95℃, 15s; 60℃, 60s; 40 cycles. Primer sequence information is shown in Table\u0026nbsp;\u003cspan\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003cdiv\u003e\n \u003ctable id=\"Tab1\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv\u003eTable 1\u003c/div\u003e\n \u003cdiv\u003e\n \u003cp\u003ePrimers sequence\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eGene\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eForward Primer\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eReverse Primer\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHuman Bcr/Abl\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCCTCGTCCTCCAGCTGTTA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGCAACGAAAAGGTTGGGGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eHuman GAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGAGCGAGATCCCTCCAAAAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGCTGTTGTCATACTTCTCATGG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003cstrong\u003eCell Proliferation assays(CCK8 assays).\u003c/strong\u003e First, we divided K562R cells into TSRP treated groups (0, 50, 100, 200, 300 or 400 \u0026micro;g/ml) and IM treated groups (0, 0.1, 0.2, 0.4, 0.8 or 1.6 \u0026micro;M). IC10 of TSRP and IC50 of IM were detected by CCK8.\u003c/p\u003e\n\u003cp\u003eThe effects of TSRP combined with IM on the proliferation of K562R cells were divided into the following groups: control group, TSRP group, IM group, and TSRP\u0026thinsp;+\u0026thinsp;IM group. K562R cell suspension at logarithmic growth stage was administered in groups and inoculated into 96-well plates. After 48h of culture, 10\u0026micro;L CCK8 solution was added to each well and incubated in the incubator. The absorbance of MD, CMaxPlus, USA at 450nm was measured by enzyme labeling, and the cell survival rate was calculated. Six compound pores were measured in parallel in each group of cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell apoptosis analysis.\u003c/strong\u003e K562R cells of logarithmic growth stage were planted in 6-well plates with a working volume of 2ml per well, and the cell inoculation density was 1.2\u0026times;106 cells per well. After 24 hours of treatment in the above groups, cells were collected, pre-cooled and washed twice with PBS, and the cell concentration was adjusted to 1\u0026times;106 cells /ml. Add 500\u0026micro;L binding buffer, centrifuge and discard supernatant, then add 100\u0026micro;L binding buffer and mix well, add 5\u0026micro;L Annexin V-FITC and 10\u0026micro;L PI respectively, mix well; The reaction was kept away from light at room temperature for 15min. Finally, 400\u0026micro;L binding buffer was added, and the apoptosis rate was detected by BD, C6, USA at 1h. The experiment was repeated three times.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blot assay.\u003c/strong\u003e Cell protein preparation: the supernatant was removed by centrifugation, 600 \u0026micro;L RIPA lysate (including PMSF and protease inhibitor) was added, cracked on ice, and then the supernatant was removed by centrifugation and transferred to a new pre-cooled centrifuge tube. Preparation of histocin: 100mg tissue sample was Lysis, split and added to 1mL cold homogenate. The supernatant was centrifuged and measured by BCA kit. The protein was denatalized and stored in Loading buffer for later use. Appropriate amount of sample supernatant was absorbed and added into the sample hole, separated by SDS-PAGE gel electrophoresis at 80V for 2h, and wet-transferred to PVDF membrane at 350mA and 90min. Closed with 5% skim milk powder BSA for 2 hours, cut the film, added primary antibody, incubated at 4℃ overnight. After TBST film washing, the corresponding secondary antibodies were added and incubated at room temperature for 1h away from light. After TBST film washing, the ECL chemiluminescence instrument (Shanghai Qinxiang Scientific Instrument Co., LTD., 610020-9Q, Shanghai, China) was developed. Image Studio Ver 2.0 software was used for semi-quantitative analysis of protein gray scale.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eBioinformatics analysis.\u003c/strong\u003e Query by literature, the main composition of TSRP including raspberries glycosides, carrot glycosides, bitter mei glycosides, rose acid, beta sitosterol\u003csup\u003e\u003cspan\u003e19\u003c/span\u003e\u003c/sup\u003e, we through the PubChem database (\u003cspan\u003e\u003cspan\u003ehttp://pubchem.ncbi.nlm.nih.gov/\u003c/span\u003e\u003c/span\u003e) of main ingredients primer name, Import the Swiss Target Prediction (\u003cspan\u003e\u003cspan\u003ehttp://www.swisstargetprediction.ch/\u003c/span\u003e\u003c/span\u003e) in the database for the active ingredient of targets, remove all the ingredients of targets duplicates as TSRP gene pool. CML disease targets from Gene Cards ((\u003cspan\u003e\u003cspan\u003ehttp://www.genecards.org/\u003c/span\u003e\u003c/span\u003e)) and OMIM database (\u003cspan\u003e\u003cspan\u003ehttp://www.omim.org/\u003c/span\u003e\u003c/span\u003e), the two merged duplication targets to establish CML Gene pool, Through Venny 2.1.0 (\u003cspan\u003e\u003cspan\u003ehttp://bioinfo.cnb.csic.es/tools/venny/index.html\u003c/span\u003e\u003c/span\u003e) for TSRP and CML intersection of genes, Using annotations, visualization and comprehensive database of DAVID (\u003cspan\u003e\u003cspan\u003ehttps://david.ncifcrf.gov/\u003c/span\u003e\u003c/span\u003e), which USES the gene ontology (GO) and enrichment of the Kyoto encyclopedia (KEGG) gene and genome analysis to evaluate intersection genes, species, type is set to \u0026quot;Homo sapiens\u0026quot;, When adjusted for \u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05, the difference was statistically significant. bioinformatics(\u003cspan\u003e\u003cspan\u003ehttp://www.Bioinformatics.com.cn/\u003c/span\u003e\u003c/span\u003e) was used to analyze the significant enrichment results of GO analysis and KEGG analysis to draw bubble maps respectively.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConstruction of transplanted tumor model in nude mice.\u003c/strong\u003e K562R cells of logarithmic growth stage were digested, washed and centrifuged in a 1.5ml centrifuge tube with pancreatic enzyme. The cells were suspended and counted with normal saline, and then the cell suspension was adjusted to 5\u0026times;10\u003csup\u003e7\u003c/sup\u003e cells /ml with normal saline. A 6-week-old female nude mouse was taken, the left armpit skin was disinfected with 75% alcohol, and 100ul cell suspension was injected subcutaneously into the left armpit with a disposable 1ml syringe. The conditions of nude mice were observed twice a week, including the volume of transplanted tumor (volume\u0026thinsp;=\u0026thinsp;length \u0026times; width 2/2), weight and survival of nude mice.\u003c/p\u003e\n\u003cp\u003eAnimals were grouped and administered\u003c/p\u003e\n\u003cp\u003eThe nude mice were divided into model group, TSRP group, IM group and TSRP\u0026thinsp;+\u0026thinsp;IM group. When the graft volume of each experimental group was close to 30mm3, the drug was administered according to the experimental group, with 50mg/kg IM and 100mg/kg TSRP by intraperitoneal injection every day, and the control group was injected intraperitoneally with the same amount of normal saline every day for consecutive 3 weeks. The naked mice were stripped of the neck and dissected, the tumor tissue was weighed, and the long diameter and short diameter of the tumor tissue were measured with a vernier caliper, and the volume was calculated (volume\u0026thinsp;=\u0026thinsp;long diameter * short diameter 2/2).\u003c/p\u003e\n\u003cp\u003eImmunohistochemical detection\u003c/p\u003e\n\u003cp\u003eTissue sections were routinely dewaxed, hydrated, antigen-repaired with citrate buffer solution by microwave, incubated with 3% H2O2 for 10min to eliminate endogenous peroxidase activity, and rinsed with PBS 3 times. Drop the sealing solution (5%BSA) and leave it in a wet box at room temperature for 30min. Wipe off the sealing solution with filter paper, add a suitable concentration of primary antibody (all 1:50), incubate in a wet box at 4℃ overnight, and wash off the primary antibody with PBS. Biotin was added to the secondary antibody solution, incubated in a wet box at room temperature for 20min, and the secondary antibody was washed with PBS. Streptomyces ovialbumin working solution labeled with horseradish enzyme was added, incubated in a wet box at room temperature for 20min, and washed off with PBS. DAB color development agent, rinse fully with tap water. Hematoxylin redyeing, dehydration, transparent, neutral gum seal. The tumor tissue of nude mice was randomly selected under section microscope and the 6 fields were not repeated.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis.\u003c/strong\u003e SPSS 16.0 statistical software was used for data analysis, and all data were expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (\u003cimg src=\"https://myfiles.space/user_files/122228_c8a1650c59388082/122228_custom_files/img1710844078.png\"\u003e), P\u0026amp;lt; 0.05 was considered statistically significant. For pairwise comparison between groups, t test of two independent samples was used for homogeneity of variance, and Kruskal-Wallis H test was used for heterogeneity of variance.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was supported by Zhejiang Provincial Traditional Chinese Medicine Science and Technology Project (NO: 2021ZQ069).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXiaofeng Xu and Ying He designed the study. Ying He analyzed and interpreted the data, and wrote the manuscript. Xiaofeng Xu and Changyu Li participated in the design of experimental procedures and revised the manuscript. Ying He, Jiyuan Ding, Liqing Liu, Jiajun Chen and Hong Zhong participated in the experimental research. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability statement\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u0026nbsp; \u0026nbsp; The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics statements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study is reported in accordance with ARRIVE guidelines. All animal studies / procedures have been approved by China Ethics Committee and performed in accordance with the ethical standards. The Animal experiment protocol listed below has been reviewed and approved by Laboratory animal of Zhejiang Eyong Pharmaceutical Research \u0026amp; Development Co., Ltd (protocol code:\u003c/p\u003e\n\u003cp\u003eZJEY-20230420-06 and the date of approval: April 20, 2023).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eCortes J, Goldman JM, Hughes T. Current issues in chronic myeloid leukemia: monitoring, resistance, and functional cure. J Natl Compr Canc Netw. \u003cstrong\u003e10\u003c/strong\u003e, S1-S13(2012).\u003c/li\u003e\n\u003cli\u003eFerreira AF, Moura LG, Tojal I. ApoptomiRs expression modulated by BCR-ABL is linked to CML progression and imatinib resistance. Blood Cells Molecules and Diseases. 53,47-55(2014).\u003c/li\u003e\n\u003cli\u003eAlmeida TP, Ferreira J, Vettorazzi A. Cytotoxic activity of fucoxanthin, alone and in combination with the cancer drugs imatinib and doxorubicin, in CML cell lines[J]. Environ Toxicol Pharmacol. 59, 24-33(2018).\u003c/li\u003e\n\u003cli\u003eKantarjian H, O\u0026rsquo;Brien S, Jabbour E, et al. Impact of treatment end point definitions on perceived differences in long-term outcome with tyrosine kinase inhibitor therapy in chronic myeloid leukemia. J Clin Oncol. \u003cstrong\u003e29\u003c/strong\u003e, 3173-3178(2011).\u003c/li\u003e\n\u003cli\u003eJabbour E, Jones D, Kantarjian HM, et al. Long-term outcome of patients chronic myeloid leukemia treated with second-generation tyrosine kinase inhibitors after imatinib failure is predicted by the in vitro sensitivity of BCR-ABL kinase domain mutations. Blood.\u003cstrong\u003e 114,\u003c/strong\u003e 2037-2043(2009).\u003c/li\u003e\n\u003cli\u003eGruber FX, Ernst T, Porkka K, et al. Dynamics of the emergence of dasatinib and nilotinib resistance in imatinib-resistant CML patients. Leukemia. 26, 172-177(2011).\u003c/li\u003e\n\u003cli\u003eQun Dai, Yuqing Ge. Inhibition of proliferation and mechanism of platycodon platycodon D combined with imatinib on K562 /R cells with leukemia resistance. Chinese journal of traditional Chinese Medicine. \u003cstrong\u003e43\u003c/strong\u003e, 385-389(2018).\u003c/li\u003e\n\u003cli\u003eGao J, Sun CR, Yang JH, et al. Evaluation of the hepatoprotective and antioxidant activities of Rubus parvifolius L. J Zhejiang Univ Sci B. \u003cstrong\u003e12\u003c/strong\u003e, 135-142(2011).\u003c/li\u003e\n\u003cli\u003eZhenjiao Zheng, Linju Zhang, Changxin Huang, et al. Study on the antitumor effect of total saponins of Cymbidium japonicum on melanoma. Chinese journal of traditional Chinese Medicine. \u003cstrong\u003e32\u003c/strong\u003e, 2055-2058(2007).\u003c/li\u003e\n\u003cli\u003eXiaofeng Xu, Xuejing Zhang, Jian Feng. Experimental study on the inhibitory effect of Maomaoberry and its drug-containing serum on K562 leukemia cells. Chinese medicine science and technology. \u003cstrong\u003e5\u003c/strong\u003e, 408-410(2011).\u003c/li\u003e\n\u003cli\u003eXiaofeng Xu, Xuejin Zhang, Jian Feng. Experimental study on the effects of berry and its total saponins on K562 leukemia cells. Journal of Chinese Medicine. \u003cstrong\u003e8\u003c/strong\u003e, 1790-1794(2011).\u003c/li\u003e\n\u003cli\u003eXiaofeng Xu, Rubin Chen, Bo Yang, et al. Study on the mechanism of apoptosis induced by total saponins, homoharringtonine and cytarabine in leukemia cells in vitro. Journal of Chinese Medicine . \u003cstrong\u003e33\u003c/strong\u003e, 1659-1663(2015).\u003c/li\u003e\n\u003cli\u003eXiaofeng Xu, Wei Yang, Xuejin Zhang. Study on the synergistic induction of apoptosis of leukemia HL-60 cells by total saponins combined with chemotherapeutics through Fas pathway. Journal of Chinese Medicine . \u003cstrong\u003e4\u003c/strong\u003e, 923-926(2017).\u003c/li\u003e\n\u003cli\u003eGe YQ, Xu XF, Yang B, et al. Saponins from Rubus parvifolius L. induce apoptosis in human chronic myeloid leukemia cells through AMPK activation and STAT3 inhibition. Asian Pac J Cancer Prev.\u003cstrong\u003e 15\u003c/strong\u003e, 5455-5461(2014).\u003c/li\u003e\n\u003cli\u003eZHANG Xue-jin, XU Xiao-feng, GAO Rui-lan, et al. Rubus Parvifolius L.Inhibited the Growth of Leukemia K562 Cells in Vitro and in Vivo. Chin J Integr Med. \u003cstrong\u003e20\u003c/strong\u003e, 36-42(2014).\u003c/li\u003e\n\u003cli\u003eXu XF, Cheng RB, Zhang XJ. Total Saponins of Rubus Parvifolius L Exhibited Anti-Leukemia Effect in vivo through STAT3 and elF4E Signaling Pathways. Chin J Inter Med. doi: 10.1007/s 11655-018-2563-8(2018).\u003c/li\u003e\n\u003cli\u003eFornaro L, Vasile E, Falcone A. Apatinib in Advanced Gastric Cancer: A Doubtful Step Forward. J Clin Oncol. \u003cstrong\u003e34\u003c/strong\u003e, 3822-3833(2016).\u003c/li\u003e\n\u003cli\u003eMa H, Cheng L, Hao K, et al. Reversal effect of ST6GAL1 on multidrug resistance in human leukemia by regulating the PI3K /Akt pathway and the expression of P-gp and MRP1. PLoS ONE. \u003cstrong\u003e9\u003c/strong\u003e, e85113(2014).\u003c/li\u003e\n\u003cli\u003eJisheng Wang，Zhongmeng Yin. Research progress on chemical constituents and pharmacology of Rubus parvifolius L.China Pharmacy. \u003cstrong\u003e18\u003c/strong\u003e, 463-464(2007).\u003c/li\u003e\n\u003cli\u003eDruker B.J, Talpaz M, Resta D.J, et al. Efficacy and safety of a specific inhibitor of the BCR-ABL tyrosine kinase in chronic myeloid leukemia. N. Engl. J. Med. \u003cstrong\u003e344\u003c/strong\u003e, 1031\u0026ndash;1037(2001).\u003c/li\u003e\n\u003cli\u003eJabbour E, Kantarjian H. Chronic myeloid leukemia: 2016 update on diagnosis, therapy, and monitoring. Am J Hematol. \u003cstrong\u003e91\u003c/strong\u003e, 252-265(2016).\u003c/li\u003e\n\u003cli\u003eTabarestani S, Movafagh A. New developments in chronic myeloid leukemia: implications for therapy. Iran J Cancer Prev. \u003cstrong\u003e9\u003c/strong\u003e, e3961(2016).\u003c/li\u003e\n\u003cli\u003ePophali PA, Patnaik MM. The role of new tyrosine kinase inhitors in chronic myeloid leukemia. Cancer J. \u003cstrong\u003e22\u003c/strong\u003e, 40-50(2016). \u003c/li\u003e\n\u003cli\u003eJ.F. Apperley, Chronic myeloid leukaemia, Lancet. \u003cstrong\u003e385,\u003c/strong\u003e 1447\u0026ndash;1459(2015).\u003c/li\u003e\n\u003cli\u003eO. Frankfurt, J.D. Licht, Ponatinib-a step forward in overcoming resistance in chronic myeloid leukemia. Clin. Cancer Res. \u003cstrong\u003e19\u003c/strong\u003e, 5828\u0026ndash;5834(2013).\u003c/li\u003e\n\u003cli\u003eJ.E. Cortes, H. Kantarjian, N.P. Shah, D. Bixby, M.J. Mauro, I. Flinn, et al., Ponatinib in refractory Philadelphia chromosome-positive leukemias. N. Engl. J. Med. \u003cstrong\u003e367\u003c/strong\u003e, 2075\u0026ndash;2088(2012).\u003c/li\u003e\n\u003cli\u003eLe-Yi Zhang , Jun-Gang Zhang , Xue Yang. Targeting Tumor Immuno-suppressive Microenvironment for the Prevention of Hepatic Cancer: Applications of Traditional Chinese Medicines in Targeted Delivery. Curr Top Med Chem.\u003cstrong\u003e 20\u003c/strong\u003e, 2789-2800(2020).\u003c/li\u003e\n\u003cli\u003eBurchert, A; Wang, Y; Cai, D; von Bubnoff, N; . Compensatory PI3-kinase/Akt/mTor activation regulates imatinib resistance development. LEUKEMIA. \u003cstrong\u003e19\u003c/strong\u003e, 1774-1782(2005).\u003c/li\u003e\n\u003cli\u003eYap, Ernie; Norziha, Zainul Abidin; Simbun, Alfred; . Downregulation of Mir-146a-5p, Mir-99b-5p, Mir-143-3p, Mir-10a-5p and Mir-151a-3p Associated with PI3K/AKT, p53, NF-Kb, and Fanconi Anemia/BRCA Signaling Pathways Are Observed in Imatinib-Resistant Chronic Myeloid Leukemia Patients without Detectable BCR-ABL kinase Domain Mutations. BLOOD. \u003cstrong\u003e128\u003c/strong\u003e, 3060-3060(2016).\u003c/li\u003e\n\u003cli\u003eNaughton,R; Quiney, C; Turner, S D,. Bcr-Abl-mediated redox regulation of the PI3K/AKT pathway. LEUKEMIA. 23, 432-1440(2009).\u003c/li\u003e\n\u003cli\u003eOkabe, Seiichi; Tauchi, Tetsuzo; Tanaka, Yuko;. Efficacy of the dual PI3K and mTOR inhibitor NVP-BEZ235 in combination with nilotinib against BCR-ABL-positive leukemia cells involves the ABL kinase domain mutation. CANCER BIOL THER. \u003cstrong\u003e15\u003c/strong\u003e, 207-215(2014,).\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-3223174/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3223174/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Chronic myelogenous leukemia (CML) is a malignant tumor of the blood system, so far there is no effective cure. Imatinib (IM), as the first-line drug for the clinical targeted treatment of CML, has some limiting factors such as drug resistance and relapse, and drug resistance has also emerged in combination with other drugs. At present, traditional Chinese medicine combined with targeted drugs in the treatment of tumor is a research hotspot. The total saponin (TSRP) of the Chinese herb Citraria sinensis has an effective anti-tumor activity. Our previous in vitro experiments showed that TSRP can effectively inhibit the proliferation and promote apoptosis of CML cells K562, suggesting that TSRP can effectively reverse the drug resistance of IM, but the mechanism of drug resistance remains unclear. Studies have shown that the PI3K/AKT pathway is the main activation pathway of IM secondary resistance, and is considered to be an innovative therapeutic strategy for targeted cancer treatment, which may be an important mechanism of IM resistance. This project aims to reveal the possible mechanism of TSRP reversing IM resistance through PI3K/AKT signaling pathway through both in vitro and in vivo experiments, providing experimental basis for TSRP combined with IM treatment of CML.","manuscriptTitle":"In vitro and in vivo experimental investigation Of TSRP reverses imatinib resistance through the PI3K / Akt pathway in chronic myeloid leukemia","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-03-19 10:34:31","doi":"10.21203/rs.3.rs-3223174/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"ca07ea91-c64d-4758-ba24-31f062cf31ed","owner":[],"postedDate":"March 19th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-03-27T08:50:14+00:00","versionOfRecord":[],"versionCreatedAt":"2024-03-19 10:34:31","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3223174","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3223174","identity":"rs-3223174","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}