G6PD promotes leukemia cell proliferation through mitochondrial inhibition of apoptosis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article G6PD promotes leukemia cell proliferation through mitochondrial inhibition of apoptosis Qiurong Zhang, Lijuan He, Hui Cha This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7512827/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Cancer cells, including leukemia cells, maintain rapid growth and reproduction by promoting biosynthetic processes and metabolic reprogramming. The pentose phosphate pathway (PPP) plays a crucial role in meeting the synthetic metabolic needs of cancer cells, and glucose 6-phosphate dehydrogenase (G6PD) is the first rate-limiting enzyme in the oxidative branch of PPP. However, the molecular mechanism by which G6PD causes leukemia remains unclear. In this study, we found that the proliferation of leukemia cells depends on the presence of G6PD. Knocking down G6PD can cause cell cycle arrest in leukemia cells, thereby inhibiting cell proliferation. G6PD knockdown reduced the NADPH level in leukemia cells and increased the production of intracellular reactive oxygen species (ROS). Moreover, G6PD knockdown can also promote the expression of apoptotic factors and alter the permeability of cell mitochondrial membranes, leading to apoptosis in leukemia cells. Importantly, we also validated in vivo that the knockdown of G6PD could inhibit the growth of leukemia cells. In summary, our study suggests that G6PD is crucial for the growth of leukemia cells and may be a potential biological target for leukemia treatment. Glucose-6-phosphate dehydrogenase (G6PD) leukemia apoptosis REDOX balance Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Leukemia is a type of blood cancer that begins in hematopoietic tissue and is caused by abnormal proliferation of blood cells, usually white blood cells, in the bone marrow (1). Acute leukemia (AL) is a malignant clonal hematopoietic stem cells (2). At the onset of the disease, abnormal primitive and immature cells in the bone marrow proliferate in large quantities, accumulate in the bone marrow, and inhibit normal hematopoiesis, widely infiltrating extramedullary organs such as the liver, spleen, and lymph nodes (3, 4). AL can be categorized into two types, namely acute myelogenous leukemia (AML) and acute lymphoblastic leukemia (ALL). Acute myeloid leukemia (AML) is the most prevalent malignant myeloid disease in adults (5). The pentose phosphate pathway (PPP) provides the nucleotide precursors needed for proliferation and NADPH for intracellular reactive oxygen species (ROS) detoxification and catabolism and has recently been proven to play a vital role in cancer cell proliferation (6-8). Glucose-6-phosphate dehydrogenase (G6PD) is the first rate-limiting enzyme in PPP, which exists in the cytoplasm of red blood cells, protecting them from oxidative damage (9). The biological function of G6PD is crucial for cell survival (10). G6PD is highly expressed in many cancers and is correlated with tumorigenesis and poor prognosis (11). For example, a recent study showed that high G6PD expression enhances aerobic glycolysis and promotes gastric cancer cell proliferation (12). Furthermore, upregulation of the G6PD/HIF1-a/Notch1 axis promotes migration of breast cancer cells (13). Previous studies have also shown that G6PD promotes tumor cell proliferation and tumorigenesis by enhancing the PPP in colorectal carcinoma (14-16). Previous evidence has indicated that leukemia cells rely more heavily on aerobic glycolysis (17). Moreover, glycolysis inhibition results in growth arrest or cell death in AML cells (18). However, the biological functions of G6PD in leukemia progression have not yet been fully explored. In this study, we aimed to explore the role of G6PD in leukemia cells. Through in vitro experiments, we determined that the downregulation of G6PD could suppress the proliferation and cell cycle of four types of leukemia cells. G6PD also decreased NADPH levels and increased intracellular ROS levels. This further leads to the loss of mitochondrial membrane potential and increased permeability of the mitochondrial outer membrane. Subsequently, cytochrome c (cyt c) is released into the cytoplasm, causing apoptosis. Moreover, we used xenograft tumor models to verify the effect of G6PD on leukemia cells in vivo. Taken together, our findings suggest that G6PD is essential for leukemia cell proliferation. Material and methods Cell line and cell culture CCRF-CEM, THP-1, HEL, and HL-60 leukemia cells were purchased from the Procell Cell Bank (Wuhan, China) and cultured in Dulbecco's modified Eagle's medium (Gibco, Life Technologies, Grand Island, NY) with 10% fet bovine serum (FBS, Gibco) and 1% penicillin-streptomycin. The cell lines were verified using the short-tandem repeat profiling method. Three targets were used for the G6PD interference experiments. Lentivirus transfection was performed according to the manufacturer's instructions. Briefly, CCRF-CEM, THP-1, HEL, and HL-60 cells were transfected with siG6PD lentivirus, the transfected cells were selected with puromycin, and the transfected cells were continuously expanded and cultured. The transfection efficiency of the cells was greater than 90% under a fluorescence microscope. The transfection efficiency of the repeatedly frozen culture cells was more than 90%, and the cells in each group were collected for follow-up experiments. Animal experiment For the animal experiment, BALB/c-nu/nu mice (male; body weight, 18-22 g; 6 weeks old) were purchased from Charles River (Beijing, China). BALB/c-nu/nu mice were randomly divided into two groups to establish an experimental subcutaneous tumor model. Each group was injected with 3 × 10 6 stable cell lines. Tumor size (V) was measured every day using a caliper according to the following equation: V = a × b 2 /2, where a and b are the major and minor axes of the tumor, respectively. The mice were anesthetized with pentobarbital sodium and died of cervical dislocation. The investigator remained unaware of group allocation during the assessment. The First Affiliated Hospital of Dali University conducted the animal studies approved by the Laboratory Animal Welfare and Ethics Committee. All animal experiments followed the guidelines of the Animal Care and Use Committee of the First Affiliated Hospital of Dali University. RNA extraction and quantitative real-time PCR Total RNA was extracted from four stable cell lines, and each cell was divided into NC and siG6PD groups. TRIzol reagent (Solarbio, Beijing, China) was used according to the kit instructions. Total RNA was reverse transcribed into cDNA (Vazyme) using a cDNA reverse transcription kit (Takara, Dalian, China). Real-time quantitative PCR (qRT-PCR) was performed using SYBR Mix (Vazyme Biotech, Nanjing, China) and a real-time fluorescent quantitative PCR instrument (Applied Biosystems 7500, United States). The relative expression was evaluated using the 2-∆∆CT method. The primers used are listed in Table 1. Cell viability After screening with puromycin, the stable cell lines were reseeded in 96-well plates, and the relative cell viability was assessed by counting the number of live cells using the Cell Counting Kit-8 (CCK-8, Beyotime Biotechnology, Shanghai, China). CCK-8 was added at 24 and 48 h to determine cell viability. Western blotting Cells were centrifuged and 250 mL protein lysate RIPA buffer (Solarbio) supplemented with 1% PMSF (100 mM) was added. The total protein concentration was determined using a BCA protein assay kit (Solarbio). The samples were denatured at 100°C for 5 min. Total proteins were isolated by SDS-PAGE and transferred to a PVDF membrane (Millipore, Billerica, MA, USA). The transformed PVDF film was placed in 5% skim milk, blocked for 2 h at room temperature, and incubated with the primary antibody (1:1,000) at 4°C overnight. The next day, the film was washed with TBST three times for 10 min each. The membrane was then incubated with a secondary antibody coupled with horseradish peroxidase (HRP) at room temperature for 2 h. Images were analyzed using the Gel Imaging Analysis System (Tanon MINI Space, Shanghai, China). The antibodies used are listed in Table 2. Cell cycle analysis Stable cell lines in each group were transferred to a centrifuge tube, centrifuged at 1,000 rpm for 5 min, and washed with PBS three times. Next, 1 mL of 70% ethanol was added and fixed overnight. The next day, the samples were centrifuged at 1,000 rpm for 5 min and washed three times with PBS. Subsequently, 500 mL of 1× buffer, 10 mL of RNase A, and 25 mL of PI were added to each tube and the cells were incubated at 37°C for 30 min. The cells were then transferred to flow cytometry tubes. The cell cycle was measured using flow cytometry (BD FACS Calibur, United States), and the percentage of G1, S, and G2 cells was analyzed using FlowJo_V10. Cell apoptosis assay Stable cell lines in each group were transferred to a centrifuge tube, centrifuged at 1,000 rpm for 5 min, and washed with PBS three times. Add 500 mL buffer binding solution, 5 mL Annexin V-FITC (BD), and 10 mL PI dyeing solution and mix well. The mixture was incubated at room temperature for 15 min in the dark. The cells were then transferred into flow cytometry tubes, and apoptosis was detected using flow cytometry (BD). Mitochondrial membrane potential Stable cell lines in each group were transferred to a centrifuge tube, centrifuged at 1,000 rpm for 5 min, and washed with PBS three times. JC-1 was assessed using a Mitochondrial Membrane Potential Kit (Beyotime Biotechnology). Add 500 mL JC-1 was solution to the cells and incubated at 37°C for 20 min in the dark. Cells were washed twice with 1 mL of 1× buffer, and then detect JC-1 using flow cytometry (BD). ROS generation Stable cell lines in each group were transferred to a centrifuge tube, centrifuged at 1,000 rpm for 5 min, and washed with PBS three times. ROS generation was assessed using a Reactive Oxygen Species Assay Kit (Beyotime Biotechnology). DCFH-DA (1 nM) was added to the cells and incubated at 37°C for 20 min in the dark. The cells were washed twice with 1 mL PBS, and DCF Fluorescence was detected using flow cytometry (BD). Measurements of intracellular NADP + and NADPH levels Intracellular NADP + and NADPH levels were determined using the NADP + /NADPH Assay Kit (Beyotime Biotechnology) according to the manufacturer’s instructions. Briefly, stable cell lines in each group were transferred to a centrifuge tube, centrifuged at 1,000 rpm for 5 min, and washed with PBS three times. The cells were then lysed with 200 mL pre-cooled NADP + /NADPH extraction buffer. The supernatant was collected, and NADP + and NADPH levels were detected by centrifugation at 10, 000 rpm for 10 min. Immunohistochemistry Xenografted tumors were fixed using 4% paraformaldehyde overnight before being embedded in paraffin, sectioned at 4 mm thickness using a cryostat, and subjected to immunohistochemistry (Servicebio, Wuhan, China). The antibodies used are listed in Table 2. Statistical analysis All data were analyzed using GraphPad Prism 8 and SPSS 20.0. All quantification results are presented as the mean ± SD (n = 3, unless otherwise indicated). Unifactorial analysis and t-tests were used for different groups, and P < 0.05. Results G6PD knockdown suppresses the growth of leukemia cells To explore the effect of G6PD on leukemia cells, we first constructed four G6PD -knockdown stable cell lines by lentiviral infection with three targets. As shown in Figure S1A-1D, these three targets significantly decreased the mRNA expression of G6PD, and siG6PD-1 was the most effective. Thus, we chose siG6PD-1 for the follow-up studies. We then detected mRNA and protein expression levels when G6PD was silenced in AML cells. As shown in Figure 1E–1H, silencing G6PD significantly suppressed G6PD mRNA and protein expression levels. After confirming the interference efficiency, we assessed the cell viability. As shown in Figure 1E, G6PD knockdown significantly decreased the viability of CCRF-CEM cells at 24 h and 48 h. Similar results were found in HL-60, THP-1, and HEL cells (Figure 1I-1L). These findings suggest that the knockdown of G6PD could suppress leukemia cell viability. G6PD knockdown leads to cell cycle arrest PPP is the only pathway that utilizes glucose to produce ribose-5-phosphate, which provides raw materials for the synthesis of nucleotides in vivo. It maintains the cell cycle progression, which is critical for cell proliferation (19, 20). We then assessed DNA content using flow cytometry to examine the effect of G6PD knockdown on the cell cycle. As shown in Figure 2A–2 B, we detected an increased proportion of cells in the G1 phase, and the proportion of cells in the S and G2 phases decreased when G6PD was knocked down. This suggested that the cell cycle was arrested in the G1 phase in G6PD -knockdown CCRF-CEM cells. Similarly, we detected the same results in G6PD -knockdown HL-60, THP-1, and HEL cells (Figure 2C-2H). Together, these results indicate that G6PD is essential for leukemia cell proliferation, and that knockdown of G6PD could lead to significant G1 phase cell cycle arrest. G6PD maintains the REDOX balance in leukemia cells G6PD is the rate-limiting enzyme in PPP, which plays a critical role in providing the cellular reductant NADPH, which is crucial for the antioxidant defense of tumor cells by ameliorating cellular ROS levels (14). We next examined the effect of G6PD on the REDOX balance in leukemia cells. We found that G6PD knockdown clearly reduced cellular NADPH levels, but its oxidized form, NADP + , increased significantly (Figure 3A-3D). We also assayed ROS generation by flow cytometry. As shown in Figure 3E-3F, ROS generation was elevated in the four leukemia cell lines when G6PD was knocked down. These results clearly showed that knocking down G6PD broke the REDOX balance in leukemia cells and led to cellular ROS accumulation. G6PD knockdown induces leukemia cell apoptosis Excessive intracellular ROS levels may cause damage to cells, including DNA damage, cell membrane damage, and mitochondrial dysfunction, eventually leading to apoptotic cell death (21). To further investigate the role of G6PD in apoptosis, we examined apoptosis using flow cytometry. Compared with the NC group, the apoptotic cell rates were increased in G6PD -knockdown leukemia cells (Figure 4A-4D). To verify this finding further, we examined the expression of apoptosis-related genes. As shown in Figure S2A-2D, when G6PD was knocked down, the mRNA expressions of p53 were elevated. In line with this result, the mRNA expression of the apoptosis inhibitory factor Bcl-2 decreased. Meanwhile, we detected the protein expression of these factors using western blotting as well and got the same conclusion (Figure 4E-4H). Together, these findings indicate that G6PD knockdown induces leukemia cell apoptosis. G6PD knockdown alters mitochondrial membrane permeability of leukemia cells Mitochondria are crucial organelles involved in the process of apoptosis. It plays a decisive role in regulating energy metabolism under physiological or pathological conditions and in controlling cell death and survival (22). We previously demonstrated that the downregulation of G6PD could trigger leukemia cell apoptosis, and we then investigated the function of mitochondria. We first assessed mitochondrial membrane potential. There was an increasing proportion of JC-1 monomers in G6PD -knockdown CCRF-CEM cells (Figure 5A-5D). This suggests that G6PD knockdown reduced the mitochondrial membrane potential. Next, we examined the release of cyt-c from the mitochondria. As shown in Figure 5E-5H, the level of cyt-c content in the cytoplasm was elevated in G6PD -knockdown leukemia cells. Taken together, these results clearly demonstrate that G6PD knockdown alters the mitochondrial membrane permeability of leukemia cells. G6PD knockdown suppresses the tumorigenic potential of leukemia cells To determine the role of G6PD in tumorigenesis, we examined the pathological function of G6PD in tumorigenesis in vivo by transplanting CCRF-CEM/si-G6PD and THP-1/si-G6PD stable cell lines subcutaneously into BALB/c nu/nu mice. As shown in Figure 6A-6D, G6PD knockdown robustly suppressed tumor growth. Concomitantly, G6PD knockdown reduced the size and weight of the generated tumors. The proliferating cell nuclear antigen (PCNA) protein levels were decreased in G6PD -knockdown CCRF-CEM and THP-1 cells (Figure 6E-6F). Meanwhile, we detected Ki67 expression levels in xenografted tumors by immunohistochemistry staining. The results showed that knockdown of G6PD slowed the growth of leukemia cells in vivo (Figure 6G-6H). Furthermore, we performed a survival analysis using TCGA database. As shown in Figure 6I, in line with our results, high expression of G6PD was related to poor overall survival compared to low expression of G6PD. These findings clearly support that G6PD is involved in the development of leukemia cell proliferation in vivo. Together, our study revealed that the downregulation of G6PD caused cell cycle inhibition, reduced NADPH production, altered mitochondrial membrane permeability, and induced apoptosis in leukemia cells (Figure 6J). Discussion Metabolic reprogramming is a hallmark of malignant tumors, and is critical for the generation of energy for the rapid proliferation of tumor cells. The rate of glycolysis in tumor cells increases and subsequently exhibits a preference for lactic acid fermentation rather than oxidative phosphorylation, even in the presence of sufficient oxygen. This is known as the Warburg effect, as well as glucose metabolism reprogramming (23, 24). Recent studies have suggested that leukemia cells rely more heavily on aerobic glycolysis (25). Studies using mouse models have suggested that leukemia occurs more quickly when there is an increase in glucose uptake in vivo (26). Moreover, blocking glycolysis could lead to the cessation of proliferation or death of leukemia cells and enhance their sensitivity to chemotherapy medications (18, 27). Notably, the PPP pathway is frequently altered in leukemia cells (28). Leukemia cells prefer the PPP pathway to the glycolysis pathway for glucose conversion, suggesting that the PPP pathway plays an important role in metabolic reprogramming in leukemia (29). Here, we demonstrated that G6PD knockdown in leukemia cells decreased the level of NADPH and led to the accumulation of ROS. In addition, downregulation of G6PD suppressed PPP, which produced ribose 5‑phosphate for nucleic acid synthesis and inhibits the cell cycle. Taken together, these data indicate that G6PD is necessary for leukemia cell proliferation. Mitochondria play a crucial role in several cellular processes such as energy generation, ROS accumulation, and induction of apoptosis (30). It is a vital organelle that regulates numerous cellular pathways in almost all the cell types (31). Apoptosis signaling pathways are inhibited in various tumor cells. Therefore, mitochondria are the target of apoptotic signal transduction in anticancer treatment (32). Apoptosis caused by the mitochondrial pathway is mainly due to signaling molecules acting on the mitochondrial membrane, leading to changes in mitochondrial membrane permeability or the formation of protein complex pores (33, 34). The release of apoptotic proteins such as cyt-c activates downstream caspase family proteins or directly acts on the corresponding substrates to induce apoptosis (35). In this study, we detected an increase in ROS generation in G6PD -knockdown leukemia cells; excess ROS could damage mitochondria and cause mitochondrial dysfunction (36). Indeed, we found that the JC-1 monomer content was elevated when G6PD was knocked down in leukemia cells, suggesting that the mitochondrial membrane potential decreased. We also detected increased cyt-c levels in the cytoplasm. These findings demonstrate that the permeability of the mitochondrial membrane was destroyed, and the function was impaired, eventually leading to apoptosis. However, the specific molecular mechanism by which G6PD regulates apoptosis in leukemia cells has not been fully elucidated and could serve as a direction for further research. Nevertheless, our study clearly shows that G6PD is involved in leukemia cell apoptosis. Declarations Disclosure statement No potential conflict of interest was reported by author(s). Funding This work was supported by Scientific Research Fund of Education Department of Yunnan Province: [Grant Number 2023J0894]. Author’s contributions Qiurong Zhang designed the study and conception. Material preparation and data collection were performed by Lijuan He and Hui Cha. Analysis was conducted by Qiurong Zhang Lijuan He, and Hui Cha. The first draft was written by Qiurong Zhang and all authors critically revised subsequent versions. Qiurong Zhang supervised the project and acquired funding. All authors read and approved the final manuscript. Data Availability Statement The datasets generated and analysed during the current study are available from the corresponding author on reasonable request. References Mao J, Li S, Zhao H, Zhu Y, Hong M, Zhu H, et al. Effects of chidamide and its combination with decitabine on proliferation and apoptosis of leukemia cell lines. Am J Transl Res. 2018;10(8):2567-78. PubMed PMID: 30210693; PubMed Central PMCID: PMC6129529. Harris MH, Czuchlewski DR, Arber DA, Czader M. Genetic Testing in the Diagnosis and Biology of Acute Leukemia. Am J Clin Pathol. 2019;152(3):322-46. doi: 10.1093/ajcp/aqz093. PubMed PMID: 31367767. Wong JYC, Filippi AR, Scorsetti M, Hui S, Muren LP, Mancosu P. Total marrow and total lymphoid irradiation in bone marrow transplantation for acute leukaemia. Lancet Oncol. 2020;21(10):e477-e87. doi: 10.1016/S1470-2045(20)30342-9. PubMed PMID: 33002443. Klco JM, Mullighan CG. Advances in germline predisposition to acute leukaemias and myeloid neoplasms. Nat Rev Cancer. 2021;21(2):122-37. doi: 10.1038/s41568-020-00315-z. PubMed PMID: 33328584; PubMed Central PMCID: PMC8404376. Wouters BJ, Delwel R. Epigenetics and approaches to targeted epigenetic therapy in acute myeloid leukemia. Blood. 2016;127(1):42-52. doi: 10.1182/blood-2015-07-604512. PubMed PMID: 26660432. Patra KC, Hay N. The pentose phosphate pathway and cancer. Trends Biochem Sci. 2014;39(8):347-54. doi: 10.1016/j.tibs.2014.06.005. PubMed PMID: 25037503; PubMed Central PMCID: PMC4329227. Stincone A, Prigione A, Cramer T, Wamelink MM, Campbell K, Cheung E, et al. The return of metabolism: biochemistry and physiology of the pentose phosphate pathway. Biol Rev Camb Philos Soc. 2015;90(3):927-63. doi: 10.1111/brv.12140. PubMed PMID: 25243985; PubMed Central PMCID: PMC4470864. Li Q, Qin T, Bi Z, Hong H, Ding L, Chen J, et al. Rac1 activates non-oxidative pentose phosphate pathway to induce chemoresistance of breast cancer. Nat Commun. 2020;11(1):1456. doi: 10.1038/s41467-020-15308-7. PubMed PMID: 32193458; PubMed Central PMCID: PMC7081201. Zhang Y, Xu Y, Lu W, Li J, Yu S, Brown EJ, et al. G6PD-mediated increase in de novo NADP(+) biosynthesis promotes antioxidant defense and tumor metastasis. Sci Adv. 2022;8(29):eabo0404. doi: 10.1126/sciadv.abo0404. PubMed PMID: 35857842; PubMed Central PMCID: PMC9299539. Jiang P, Du W, Yang X. A critical role of glucose-6-phosphate dehydrogenase in TAp73-mediated cell proliferation. Cell Cycle. 2013;12(24):3720-6. doi: 10.4161/cc.27267. PubMed PMID: 24270845; PubMed Central PMCID: PMC3905063. Mele L, Paino F, Papaccio F, Regad T, Boocock D, Stiuso P, et al. A new inhibitor of glucose-6-phosphate dehydrogenase blocks pentose phosphate pathway and suppresses malignant proliferation and metastasis in vivo. Cell Death Dis. 2018;9(5):572. doi: 10.1038/s41419-018-0635-5. PubMed PMID: 29760380; PubMed Central PMCID: PMC5951921. Deng P, Li K, Gu F, Zhang T, Zhao W, Sun M, et al. LINC00242/miR-1-3p/G6PD axis regulates Warburg effect and affects gastric cancer proliferation and apoptosis. Mol Med. 2021;27(1):9. doi: 10.1186/s10020-020-00259-y. PubMed PMID: 33514309; PubMed Central PMCID: PMC7845121. Zhang HS, Zhang ZG, Du GY, Sun HL, Liu HY, Zhou Z, et al. Nrf2 promotes breast cancer cell migration via up-regulation of G6PD/HIF-1alpha/Notch1 axis. J Cell Mol Med. 2019;23(5):3451-63. doi: 10.1111/jcmm.14241. PubMed PMID: 30809937; PubMed Central PMCID: PMC6484400. Li Z, He Y, Li Y, Li J, Zhao H, Song G, et al. NeuroD1 promotes tumor cell proliferation and tumorigenesis by directly activating the pentose phosphate pathway in colorectal carcinoma. Oncogene. 2021;40(50):6736-47. doi: 10.1038/s41388-021-02063-2. PubMed PMID: 34657129. Tang Y, Li W, Qiu L, Zhang X, Zhang L, Miyagishi M, et al. The p52-ZER6/G6PD axis alters aerobic glycolysis and promotes tumor progression by activating the pentose phosphate pathway. Oncogenesis. 2023;12(1):17. doi: 10.1038/s41389-023-00464-4. PubMed PMID: 36977688; PubMed Central PMCID: PMC10050210. Wu S, Wang H, Li Y, Xie Y, Huang C, Zhao H, et al. Transcription Factor YY1 Promotes Cell Proliferation by Directly Activating the Pentose Phosphate Pathway. Cancer Res. 2018;78(16):4549-62. doi: 10.1158/0008-5472.CAN-17-4047. PubMed PMID: 29921695. Qing Y, Dong L, Gao L, Li C, Li Y, Han L, et al. R-2-hydroxyglutarate attenuates aerobic glycolysis in leukemia by targeting the FTO/m(6)A/PFKP/LDHB axis. Mol Cell. 2021;81(5):922-39 e9. doi: 10.1016/j.molcel.2020.12.026. PubMed PMID: 33434505; PubMed Central PMCID: PMC7935770. Meynet O, Beneteau M, Jacquin MA, Pradelli LA, Cornille A, Carles M, et al. Glycolysis inhibition targets Mcl-1 to restore sensitivity of lymphoma cells to ABT-737-induced apoptosis. Leukemia. 2012;26(5):1145-7. doi: 10.1038/leu.2011.327. PubMed PMID: 22076465. Matthews HK, Bertoli C, de Bruin RAM. Cell cycle control in cancer. Nat Rev Mol Cell Biol. 2021. doi: 10.1038/s41580-021-00404-3. PubMed PMID: 34508254. Li R, Wang W, Yang Y, Gu C. Exploring the role of glucose‑6‑phosphate dehydrogenase in cancer (Review). Oncol Rep. 2020;44(6):2325-36. doi: 10.3892/or.2020.7803. PubMed PMID: 33125150. Cheung EC, Vousden KH. The role of ROS in tumour development and progression. Nat Rev Cancer. 2022;22(5):280-97. doi: 10.1038/s41568-021-00435-0. PubMed PMID: 35102280. Abate M, Festa A, Falco M, Lombardi A, Luce A, Grimaldi A, et al. Mitochondria as playmakers of apoptosis, autophagy and senescence. Semin Cell Dev Biol. 2020;98:139-53. doi: 10.1016/j.semcdb.2019.05.022. PubMed PMID: 31154010. El Hassouni B, Granchi C, Valles-Marti A, Supadmanaba IGP, Bononi G, Tuccinardi T, et al. The dichotomous role of the glycolytic metabolism pathway in cancer metastasis: Interplay with the complex tumor microenvironment and novel therapeutic strategies. Semin Cancer Biol. 2020;60:238-48. doi: 10.1016/j.semcancer.2019.08.025. PubMed PMID: 31445217. Yuan Y, Li H, Pu W, Chen L, Guo D, Jiang H, et al. Cancer metabolism and tumor microenvironment: fostering each other? Sci China Life Sci. 2022;65(2):236-79. doi: 10.1007/s11427-021-1999-2. PubMed PMID: 34846643. Akers LJ, Fang W, Levy AG, Franklin AR, Huang P, Zweidler-McKay PA. Targeting glycolysis in leukemia: a novel inhibitor 3-BrOP in combination with rapamycin. Leuk Res. 2011;35(6):814-20. doi: 10.1016/j.leukres.2010.12.028. PubMed PMID: 21316758; PubMed Central PMCID: PMC4805370. Saito Y, Chapple RH, Lin A, Kitano A, Nakada D. AMPK Protects Leukemia-Initiating Cells in Myeloid Leukemias from Metabolic Stress in the Bone Marrow. Cell Stem Cell. 2015;17(5):585-96. doi: 10.1016/j.stem.2015.08.019. PubMed PMID: 26440282; PubMed Central PMCID: PMC4597792. Hulleman E, Kazemier KM, Holleman A, VanderWeele DJ, Rudin CM, Broekhuis MJ, et al. Inhibition of glycolysis modulates prednisolone resistance in acute lymphoblastic leukemia cells. Blood. 2009;113(9):2014-21. doi: 10.1182/blood-2008-05-157842. PubMed PMID: 18978206; PubMed Central PMCID: PMC4081395. Xu SN, Wang TS, Li X, Wang YP. SIRT2 activates G6PD to enhance NADPH production and promote leukaemia cell proliferation. Sci Rep. 2016;6:32734. doi: 10.1038/srep32734. PubMed PMID: 27586085; PubMed Central PMCID: PMC5009355. Chen Y, Xu Q, Ji D, Wei Y, Chen H, Li T, et al. Inhibition of pentose phosphate pathway suppresses acute myelogenous leukemia. Tumour Biol. 2016;37(5):6027-34. doi: 10.1007/s13277-015-4428-5. PubMed PMID: 26596840. Zou Z, Chang H, Li H, Wang S. Induction of reactive oxygen species: an emerging approach for cancer therapy. Apoptosis. 2017;22(11):1321-35. doi: 10.1007/s10495-017-1424-9. PubMed PMID: 28936716. Bock FJ, Tait SWG. Mitochondria as multifaceted regulators of cell death. Nat Rev Mol Cell Biol. 2020;21(2):85-100. doi: 10.1038/s41580-019-0173-8. PubMed PMID: 31636403. Carneiro BA, El-Deiry WS. Targeting apoptosis in cancer therapy. Nat Rev Clin Oncol. 2020;17(7):395-417. doi: 10.1038/s41571-020-0341-y. PubMed PMID: 32203277; PubMed Central PMCID: PMC8211386. Ader NR, Hoffmann PC, Ganeva I, Borgeaud AC, Wang C, Youle RJ, et al. Molecular and topological reorganizations in mitochondrial architecture interplay during Bax-mediated steps of apoptosis. Elife. 2019;8. doi: 10.7554/eLife.40712. PubMed PMID: 30714902; PubMed Central PMCID: PMC6361589. Zorova LD, Popkov VA, Plotnikov EY, Silachev DN, Pevzner IB, Jankauskas SS, et al. Mitochondrial membrane potential. Anal Biochem. 2018;552:50-9. doi: 10.1016/j.ab.2017.07.009. PubMed PMID: 28711444; PubMed Central PMCID: PMC5792320. Jiang X, Jiang H, Shen Z, Wang X. Activation of mitochondrial protease OMA1 by Bax and Bak promotes cytochrome c release during apoptosis. Proc Natl Acad Sci U S A. 2014;111(41):14782-7. doi: 10.1073/pnas.1417253111. PubMed PMID: 25275009; PubMed Central PMCID: PMC4205663. Annesley SJ, Fisher PR. Mitochondria in Health and Disease. Cells-Basel. 2019;8(7). doi: 10.3390/cells8070680. PubMed PMID: 31284394; PubMed Central PMCID: PMC6678092. Tables Table 1. Primer pairs used for quantitative real time PCR. Genes Refseq No. Primer sequences (5'-3') Forward Reverse b-actin NM_001101.5 GGAAATCGTGCGTGACATT CAGGCAGCTCGTAGCTCTT G6PD NM_000402.4 TCCAACCACATCTCCTCCCT GCGACCCTCAGTGCCAAA P53 NM_000546.6 CCACCATCCACTACAACTACAT AAACACGCACCTCAAAGC Bcl-2 NM_000633.3 CTGGGAGAACAGGGTACGATAA GGCTGGGAGGAGAAGATGC Table 2. Antibodies used for western blotting. Antibody Maker Product No. Experiment Dilution Anti-b-actin Abcam Ab8227 Western blotting 1/5,000 Anti-G6PD Proteintech 66373-1-Ig Western blotting 1/1,000 Anti-PCNA Abcam Ab280088 Western blotting 1/,000 Anti-Ki67 Proteintech 28074-1-AP Immunohistochemistry 1/200 Anti-Bcl-2 Proteintech 68103-1-Ig Western blotting 1/1,000 Cytochrome c Abcam Ab133504 Western blotting 1/5,000 Anti-p53 Proteintech 60283-2-Ig Western blotting 1/1,000 Goat Anti-Rabbit IgG ZSGB-BIO ZB2301 Western blotting 1/10,000 Goat Anti-Mouse IgG ZSGB-BIO ZB2305 Western blotting 1/10,000 Additional Declarations No competing interests reported. Supplementary Files FigureS1.tif.jpg Figure S1. Transfection efficiency of G6PD lentivirus vectors. A-D. G6PD mRNA expression levels in G6PD -knockdown CCRF-CEM (A), HL-60 (B), THP-1 (C) and HEL (D) cells, as assessed by qRT-PCR. b-actin was used for qRT-PCR normalization. Quantification data are expressed as mean ± SD (n = 3). siG6PD: lentivirus interferes vector targeting G6PD; NC: negative control; * P < 0.05, ** P < 0.01, *** P < 0.001, **** P < 0.0001. FigureS2.tif.jpg Figure S2. The efficiency of G6PD on expression of apoptosis-related genes. A-D. mRNA expression levels of p53 and Bcl-2 in G6PD -knockdown CCRF-CEM cells (A), HL-60 cells (B), THP-1 cells (C) and HEL cells (D), as assessed by qRT-PCR. b-actin was used for qRT-PCR normalization. Quantification data are expressed as mean ± SD (n = 3). siG6PD: lentivirus interferes vector targeting G6PD; NC: negative control; ** P < 0.01, *** P < 0.001, **** P < 0.0001. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7512827","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":531787487,"identity":"71271162-652d-4cdb-a18a-d5188e8cc88e","order_by":0,"name":"Qiurong Zhang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyUlEQVRIiWNgGAWjYHACxgcfKmzk2NgbGx9+IFILs+GMM2nG/DyHm40liNTCJszbdjhx5oz0NgEeYtTLt+c+Y5xx5nDihpsP2xgkGOzkdBsIaGHseW4G9Eu68YbbiW0PChiSjc0OENDCLJHGDvSLtSxQS7uBBMOBxG2EtLBJpLFJ87YxM264ebBNgocYLTwQLc6KM2cwEqlFgucZLJATgYFsQIRf5NvTYFF5/OHDDxV2cgS1MDAkIHMMCCrH0DIKRsEoGAWjAAsAAGFNRKvYfIOqAAAAAElFTkSuQmCC","orcid":"","institution":"The First Affiliated Hospital of Dali University","correspondingAuthor":true,"prefix":"","firstName":"Qiurong","middleName":"","lastName":"Zhang","suffix":""},{"id":531787488,"identity":"78c9dc5e-ca9a-4c3c-a0d4-b669fa081ebd","order_by":1,"name":"Lijuan He","email":"","orcid":"","institution":"The First Affiliated Hospital of Dali University","correspondingAuthor":false,"prefix":"","firstName":"Lijuan","middleName":"","lastName":"He","suffix":""},{"id":531787490,"identity":"c1205fd9-4a86-46fb-ba31-dc4c1bbf08e4","order_by":2,"name":"Hui Cha","email":"","orcid":"","institution":"The First Affiliated Hospital of Dali University","correspondingAuthor":false,"prefix":"","firstName":"Hui","middleName":"","lastName":"Cha","suffix":""}],"badges":[],"createdAt":"2025-09-02 03:23:20","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7512827/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7512827/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":94096284,"identity":"21bd7d92-81f2-483d-ba9a-5dfd3d5e7730","added_by":"auto","created_at":"2025-10-22 09:59:32","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1410050,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnocking down \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eG6PD\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003esuppresses leukemia cell proliferation. A-D.\u003c/strong\u003e G6PD mRNA expression levels in \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM cells (A), HL-60 cells (B), THP-1 cells (C) and HEL cells (D) were assessed by qRT-PCR. \u003cstrong\u003eE-H. \u003c/strong\u003eThe G6PD protein levels in G6PD-knockdown CCRF-CEM cells (E), HL-60 cells (F), THP-1 cells (G) and HEL cells (H), as determined by western blotting. \u003cstrong\u003eI-L. \u003c/strong\u003eRelative cell viabilities of \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM cells (I), HL-60 cells (J), THP-1 cells (K) and HEL cells (L) at 24 h and 48 h. b-actin was used for qRT-PCR normalization and western blotting loading control. Quantification data are expressed as mean ± SD (n = 3). siG6PD: lentivirus interferes vector targeting G6PD; NC: negative control; *\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure1.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7512827/v1/6565fe137e9a33b2b4d2eb1c.jpg"},{"id":94096639,"identity":"89dd57d0-6656-4cd6-aa63-e41e0f522e70","added_by":"auto","created_at":"2025-10-22 10:07:32","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1838904,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eG6PD\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eknockdown results in cell cycle arrest. A-B. \u003c/strong\u003eCell cycle analysis of \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM cells, as examined using PI staining and flow cytometry. \u003cstrong\u003eC-D. \u003c/strong\u003eCell cycle analysis of \u003cem\u003eG6PD\u003c/em\u003e-knockdown HL-60 cells, as examined using PI staining and flow cytometry. \u003cstrong\u003eE-F. \u003c/strong\u003eCell cycle analysis of \u003cem\u003eG6PD\u003c/em\u003e-knockdown THP-1 cells, as examined using PI staining and flow cytometry.\u003cstrong\u003e G-H. \u003c/strong\u003eCell cycle analysis of \u003cem\u003eG6PD\u003c/em\u003e-knockdown HEL cells, as examined using PI staining and flow cytometry. Representative images (left) and quantification results (right) are shown. Quantification data are expressed as mean ± SD (n = 3). siG6PD: lentivirus interferes vector targeting G6PD; NC: negative control; *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure2.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7512827/v1/2d47925aeb74364645a12e63.jpg"},{"id":94096641,"identity":"e1dc4536-202c-48ea-b0e7-5d3a1ed15573","added_by":"auto","created_at":"2025-10-22 10:07:32","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1668116,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eG6PD is crucial for the redox balance of leukemia cells. A-D. \u003c/strong\u003eIntracellular NADPH, NADP\u003csup\u003e+\u003c/sup\u003e and NADP\u003csup\u003e+\u003c/sup\u003e/ NADPH ratio in \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM cells (A), HL-60 cells (B), THP-1 cells (C) and HEL cells (D); NADPH (left), NADP\u003csup\u003e+\u003c/sup\u003e (middle), NADP\u003csup\u003e+\u003c/sup\u003e/NADPH (right).\u003cstrong\u003e E-H.\u003c/strong\u003e Intracellular ROS levels in \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM cells (E), HL-60 cells (F), THP-1 cells (G) and HEL cells (H) as examined using DCFA-DA staining and flow cytometry; Representative images (left) and quantification results (right) are shown\u003cstrong\u003e. \u003c/strong\u003eQuantification data are expressed as mean ± SD (n = 3). siG6PD: lentivirus interferes vector targeting G6PD; NC: negative control; *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure3.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7512827/v1/075247085ebff839a43700c3.jpg"},{"id":94096286,"identity":"20f6e4ea-b000-4f6d-8e81-4dd2a20d7fd2","added_by":"auto","created_at":"2025-10-22 09:59:32","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1737668,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKnocking down \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eG6PD\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e triggers apoptosis in leukemia cells. A-D. \u003c/strong\u003eApoptotic cell rate in \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM cells (A), HL-60 cells (B), THP-1 cells (C) and HEL cells (D), as examined using Annexin V/PI staining and flow-cytometry; Representative images (left) and quantification results (right) are shown\u003cstrong\u003e. E-H. \u003c/strong\u003eProtein expression levels of p53 and Bcl-2 proteins in \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM cells (E), HL-60 cells (F), THP-1 cells (G) and HEL cells (H), as determined by western blotting.\u003cstrong\u003e \u003c/strong\u003eb-actin was used as western blotting loading control. Quantification data are expressed as mean ± SD (n = 3). siG6PD: lentivirus interferes vector targeting G6PD; NC: negative control; ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure4.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7512827/v1/c13ee23fea19704698dfd44f.jpg"},{"id":94096292,"identity":"51077326-5c0e-42cb-99fa-1e1b37e92777","added_by":"auto","created_at":"2025-10-22 09:59:32","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1580854,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eG6PD affects mitochondrial membrane permeability in leukemia cells. A-D. \u003c/strong\u003eLevel of mitochondrial membrane potential in\u003cem\u003e G6PD\u003c/em\u003e-knockdown CCRF-CEM cells (A), HL-60 cells (B), THP-1 cells (C) and HEL cells (D), as examined using JC-1 staining and flow-cytometry; Representative images (left) and quantification results (right) are shown.\u003cstrong\u003e E-H. \u003c/strong\u003eThe cyt-c protein levels in the cytoplasm of \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM cells (E), HL-60 cells (F), THP-1 cells (G) and HEL cells (H), as determined by western blotting. b-actin was used as western blotting loading control. Quantification data are expressed as mean ± SD (n = 3). siG6PD: lentivirus interferes vector targeting G6PD; NC: negative control; **\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001.\u003c/p\u003e","description":"","filename":"Figure5.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7512827/v1/44957df118680c98394a946c.jpg"},{"id":94096640,"identity":"c866fc2f-8f59-47a2-ad31-31d0eaef0888","added_by":"auto","created_at":"2025-10-22 10:07:32","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2344601,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003e\u003cstrong\u003eG6PD\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eknockdown leukemia tumorigenesis potential. A-B. \u003c/strong\u003eTumor morphological images of \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM (A) and THP-1 (B) cells were examined in vivo by subcutaneous injection into Balb/c mice (n = 6).\u003cstrong\u003eC-D. \u003c/strong\u003eTumor weight at day 6 after transplanting, CCRF-CEM (C) and THP-1 (D) cells (n = 6). \u003cstrong\u003eE-F. \u003c/strong\u003eThe protein expression level of PCNA in xenografted tumors injected with \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM (E) and THP-1 cells (F). \u003cstrong\u003eG-H. \u003c/strong\u003eImmunohistochemistry staining showing the expression levels of Ki67 in tissue sections of xenografted tumors in Balb/c mice injected with \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM (G) and THP-1 cells (H). Scale bars: 20 μm. \u003cstrong\u003eI.\u003c/strong\u003e Overall survival of G6PD in AML patients. \u003cstrong\u003eJ.\u003c/strong\u003eSchematic diagram showing the role of G6PD on leukemia cells apoptosis and tumorigenesis. b-actin was used as western blotting loading control. siG6PD: lentivirus interferes vector targeting G6PD; NC: negative control; ****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Figure6.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7512827/v1/0865917bde66825ed6d6f121.jpg"},{"id":104399792,"identity":"0a41e07d-1c1d-4ed9-9e72-cb4727628df5","added_by":"auto","created_at":"2026-03-11 12:07:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":11515446,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7512827/v1/95642470-fe62-405e-81ef-39fd0ef4c382.pdf"},{"id":94096287,"identity":"1dc9040f-c6c6-4810-b4b7-4560ac62d3d2","added_by":"auto","created_at":"2025-10-22 09:59:32","extension":"jpg","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":802373,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure S1. Transfection efficiency of G6PD lentivirus vectors. A-D. \u003c/strong\u003eG6PD mRNA expression levels in \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM (A), HL-60 (B), THP-1 (C) and HEL (D) cells, as assessed by qRT-PCR. b-actin was used for qRT-PCR normalization. Quantification data are expressed as mean ± SD (n = 3). siG6PD: lentivirus interferes vector targeting G6PD; NC: negative control; *\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"FigureS1.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7512827/v1/60669b97ae6c3767f9a80193.jpg"},{"id":94096289,"identity":"2ae2c32c-21df-4cac-934d-b74b080bb675","added_by":"auto","created_at":"2025-10-22 09:59:32","extension":"jpg","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":564571,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure S2. The efficiency of G6PD on expression of apoptosis-related genes. A-D. \u003c/strong\u003emRNA expression levels of p53 and Bcl-2 in \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM cells (A), HL-60 cells (B), THP-1 cells (C) and HEL cells (D), as assessed by qRT-PCR. b-actin was used for qRT-PCR normalization. Quantification data are expressed as mean ± SD (n = 3). siG6PD: lentivirus interferes vector targeting G6PD; NC: negative control; **\u003cem\u003eP\u003c/em\u003e\u0026lt; 0.01, ***\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001, ****\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"FigureS2.tif.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7512827/v1/3543b91a32a085eb68c067de.jpg"}],"financialInterests":"No competing interests reported.","formattedTitle":"G6PD promotes leukemia cell proliferation through mitochondrial inhibition of apoptosis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eLeukemia is a type of blood cancer that begins in hematopoietic tissue and is caused by abnormal proliferation of blood cells, usually white blood cells, in the bone marrow (1). Acute leukemia (AL) is a malignant clonal hematopoietic stem cells (2). At the onset of the disease, abnormal primitive and immature cells in the bone marrow proliferate in large quantities, accumulate in the bone marrow, and inhibit normal hematopoiesis, widely infiltrating extramedullary organs such as the liver, spleen, and lymph nodes (3, 4). AL can be categorized into two types, namely acute myelogenous leukemia (AML) and acute lymphoblastic leukemia (ALL). Acute myeloid leukemia (AML) is the most prevalent malignant myeloid disease in adults (5).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThe pentose phosphate pathway (PPP) provides the nucleotide precursors needed for proliferation and NADPH for intracellular reactive oxygen species (ROS) detoxification and catabolism and has recently been proven to play a vital role in cancer cell proliferation (6-8). Glucose-6-phosphate dehydrogenase (G6PD) is the first rate-limiting enzyme in PPP, which exists in the cytoplasm of red blood cells, protecting them from oxidative damage (9). The biological function of G6PD is crucial for cell survival (10). G6PD is highly expressed in many cancers and is correlated with tumorigenesis and poor prognosis (11). For example, a recent study showed that high G6PD expression enhances aerobic glycolysis and promotes gastric cancer cell proliferation (12). Furthermore, upregulation of the G6PD/HIF1-a/Notch1 axis\u0026nbsp;promotes migration of breast cancer cells\u0026nbsp;(13). Previous studies have also shown that G6PD promotes tumor cell proliferation and tumorigenesis by enhancing the PPP in colorectal carcinoma\u0026nbsp;(14-16). Previous evidence has indicated that leukemia cells rely more heavily on aerobic glycolysis\u0026nbsp;(17). Moreover, glycolysis inhibition results in growth arrest or cell death in AML cells\u0026nbsp;(18). However, the biological functions of G6PD in leukemia progression have not yet been fully explored.\u003c/p\u003e\n\u003cp\u003eIn this study, we aimed to explore the role of G6PD in leukemia cells. Through in vitro experiments, we determined that the downregulation of G6PD could suppress the proliferation and cell cycle of four types of leukemia cells. \u003cem\u003eG6PD\u0026nbsp;\u003c/em\u003ealso decreased NADPH levels and increased intracellular ROS levels. This further leads to the loss of mitochondrial membrane potential and increased permeability of the mitochondrial outer membrane. Subsequently, cytochrome c (cyt c) is released into the cytoplasm, causing apoptosis. Moreover, we used xenograft tumor models to verify the effect of G6PD on leukemia cells in vivo. Taken together, our findings suggest that G6PD is essential for leukemia cell proliferation.\u003c/p\u003e"},{"header":"Material and methods","content":"\u003cp\u003e\u003cstrong\u003eCell line and cell culture\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCCRF-CEM, THP-1, HEL, and HL-60 leukemia cells were purchased from the Procell Cell Bank (Wuhan, China) and cultured in Dulbecco\u0026apos;s modified Eagle\u0026apos;s medium (Gibco, Life Technologies, Grand Island, NY) with 10% fet bovine serum (FBS, Gibco) and 1% penicillin-streptomycin. The cell lines were verified using the short-tandem repeat profiling method.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eThree targets were used for the G6PD interference experiments. Lentivirus transfection was performed according to the manufacturer\u0026apos;s instructions. Briefly, CCRF-CEM, THP-1, HEL, and HL-60 cells were transfected with siG6PD lentivirus, the transfected cells were selected with puromycin, and the transfected cells were continuously expanded and cultured. The transfection efficiency of the cells was greater than 90% under a fluorescence microscope. The transfection efficiency of the repeatedly frozen culture cells was more than 90%, and the cells in each group were collected for follow-up experiments.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAnimal experiment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eFor the animal experiment, BALB/c-nu/nu mice (male; body weight, 18-22 g; 6 weeks old) were purchased from Charles River (Beijing, China). BALB/c-nu/nu mice were randomly divided into two groups to establish an experimental subcutaneous tumor model. Each group was injected with 3 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e stable cell lines. Tumor size (V) was measured every day using a caliper according to the following equation: V = a \u0026times; b\u003csup\u003e2\u003c/sup\u003e /2, where a and b are the major and minor axes of the tumor, respectively. The mice were anesthetized with pentobarbital sodium and died of cervical dislocation. The investigator remained unaware of group allocation during the assessment. The First Affiliated Hospital of Dali University conducted the animal studies approved by the Laboratory Animal Welfare and Ethics Committee. All animal experiments followed the guidelines of the Animal Care and Use Committee of the First Affiliated Hospital of Dali University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eRNA extraction and quantitative real-time PCR\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from four stable cell lines, and each cell was divided into NC and siG6PD groups. TRIzol reagent (Solarbio, Beijing, China) was used according to the kit instructions. Total RNA was reverse transcribed into cDNA (Vazyme) using a cDNA reverse transcription kit (Takara, Dalian, China). Real-time quantitative PCR (qRT-PCR) was performed using SYBR Mix (Vazyme Biotech, Nanjing, China) and a real-time fluorescent quantitative PCR instrument (Applied Biosystems 7500, United States). The relative expression was evaluated using the 2-∆∆CT method. The primers used are listed in Table 1.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell viability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAfter screening with puromycin, the stable cell lines were reseeded in 96-well plates, and the relative cell viability was assessed by counting the number of live cells using the Cell Counting Kit-8 (CCK-8, Beyotime Biotechnology, Shanghai, China). CCK-8 was added at 24 and 48 h to determine cell viability.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eCells were centrifuged and 250\u0026nbsp;mL protein lysate RIPA buffer (Solarbio) supplemented with 1% PMSF (100 mM) was added. The total protein concentration was determined using a BCA protein assay kit (Solarbio). The samples were denatured at 100\u0026deg;C for 5 min. Total proteins were isolated by SDS-PAGE and transferred to a PVDF membrane (Millipore, Billerica, MA, USA). The transformed PVDF film was placed in 5% skim milk, blocked for 2 h at room temperature, and incubated with the primary antibody (1:1,000) at 4\u0026deg;C overnight. The next day, the film was washed with TBST three times for 10 min each. The membrane was then incubated with a secondary antibody coupled with horseradish peroxidase (HRP) at room temperature for 2 h. Images were analyzed using the Gel Imaging Analysis System (Tanon MINI Space, Shanghai, China). The antibodies used are listed in Table 2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell cycle analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStable cell lines in each group were transferred to a centrifuge tube, centrifuged at 1,000 rpm for 5 min, and washed with PBS three times. Next, 1 mL of 70% ethanol was added and fixed overnight. The next day, the samples were centrifuged at 1,000 rpm for 5 min and washed three times with PBS. Subsequently, 500\u0026nbsp;mL of 1\u0026times; buffer, 10\u0026nbsp;mL of RNase A, and 25\u0026nbsp;mL of PI were added to each tube and the cells were incubated at 37\u0026deg;C for 30 min. The cells were then transferred to flow cytometry tubes. The cell cycle was measured using flow cytometry (BD FACS Calibur, United States), and the percentage of G1, S, and G2 cells was analyzed using FlowJo_V10.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell apoptosis assay\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStable cell lines in each group were transferred to a centrifuge tube, centrifuged at 1,000 rpm for 5 min, and washed with PBS three times.\u0026nbsp;Add 500 mL\u0026nbsp;buffer binding solution, 5\u0026nbsp;mL Annexin V-FITC (BD), and 10\u0026nbsp;mL PI dyeing solution and mix well. The mixture was incubated at room temperature for 15 min in the dark. The cells were then transferred into flow cytometry tubes, and apoptosis was detected using flow cytometry (BD).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMitochondrial membrane potential\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStable cell lines in each group were transferred to a centrifuge tube, centrifuged at 1,000 rpm for 5 min, and washed with PBS three times. JC-1 was assessed using a Mitochondrial Membrane Potential Kit (Beyotime Biotechnology). Add 500\u0026nbsp;mL JC-1 was solution to the cells and incubated at 37\u0026deg;C for 20 min in the dark. Cells were washed twice with 1 mL of 1\u0026times; buffer, and then detect JC-1 using flow cytometry (BD).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eROS generation\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStable cell lines in each group were transferred to a centrifuge tube, centrifuged at 1,000 rpm for 5 min, and washed with PBS three times. ROS generation was assessed using a Reactive Oxygen Species Assay Kit (Beyotime Biotechnology). DCFH-DA (1 nM) was added to the cells and incubated at 37\u0026deg;C for 20 min in the dark. The cells were washed twice with 1 mL PBS, and DCF Fluorescence was detected using flow cytometry (BD).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMeasurements of intracellular NADP\u003csup\u003e+\u003c/sup\u003e and NADPH levels\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eIntracellular NADP\u003csup\u003e+\u003c/sup\u003e and NADPH levels were determined using the NADP\u003csup\u003e+\u003c/sup\u003e/NADPH Assay Kit (Beyotime Biotechnology) according to the manufacturer\u0026rsquo;s instructions. Briefly, stable cell lines in each group were transferred to a centrifuge tube, centrifuged at 1,000 rpm for 5 min, and washed with PBS three times. The cells were then lysed with 200\u0026nbsp;mL pre-cooled NADP\u003csup\u003e+\u003c/sup\u003e/NADPH extraction buffer. The supernatant was collected, and NADP\u003csup\u003e+\u003c/sup\u003e and NADPH levels were detected by centrifugation at 10, 000 rpm for 10 min.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eImmunohistochemistry\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eXenografted tumors were fixed using 4% paraformaldehyde overnight before being embedded in paraffin, sectioned at 4\u0026nbsp;mm thickness using a cryostat, and subjected to immunohistochemistry (Servicebio, Wuhan, China). The antibodies used are listed in Table 2.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data were analyzed using GraphPad Prism 8 and SPSS 20.0. All quantification results are presented as the mean \u0026plusmn; SD (n = 3, unless otherwise indicated). Unifactorial analysis and t-tests were used for different groups, and \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eG6PD\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;knockdown suppresses the growth of leukemia cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo explore the effect of G6PD on leukemia cells, we first constructed four \u003cem\u003eG6PD\u003c/em\u003e-knockdown stable cell lines by lentiviral infection with three targets. As shown in Figure S1A-1D, these three targets significantly decreased the mRNA expression of G6PD, and siG6PD-1 was the most effective. Thus, we chose siG6PD-1 for the follow-up studies.\u003c/p\u003e\n\u003cp\u003eWe then detected mRNA and protein expression levels when G6PD was silenced in AML cells. As shown in Figure 1E\u0026ndash;1H, silencing G6PD significantly suppressed G6PD mRNA and protein expression levels. After confirming the interference efficiency, we assessed the cell viability. As shown in Figure 1E, \u003cem\u003eG6PD\u003c/em\u003e knockdown significantly decreased the viability of CCRF-CEM cells at 24 h and 48 h. Similar results were found in HL-60, THP-1, and HEL cells (Figure 1I-1L). These findings suggest that the knockdown of \u003cem\u003eG6PD\u003c/em\u003e could suppress leukemia cell viability.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eG6PD\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;knockdown leads to cell cycle arrest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePPP is the only pathway that utilizes glucose to produce ribose-5-phosphate, which provides raw materials for the synthesis of nucleotides in vivo. It maintains the cell cycle progression, which is critical for cell proliferation (19, 20). We then assessed DNA content using flow cytometry to examine the effect of \u003cem\u003eG6PD\u003c/em\u003e knockdown on the cell cycle. As shown in Figure 2A\u0026ndash;2 B, we detected an increased proportion of cells in the G1 phase, and the proportion of cells in the S and G2 phases decreased when \u003cem\u003eG6PD\u003c/em\u003e was knocked down. This suggested that the cell cycle was arrested in the G1 phase in \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM cells. Similarly, we detected the same results in \u003cem\u003eG6PD\u003c/em\u003e-knockdown HL-60, THP-1, and HEL cells (Figure 2C-2H). Together, these results indicate that G6PD is essential for leukemia cell proliferation, and that knockdown of \u003cem\u003eG6PD\u003c/em\u003e could lead to significant G1 phase cell cycle arrest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eG6PD maintains the REDOX balance in leukemia cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eG6PD is the rate-limiting enzyme in PPP, which plays a critical role in providing the cellular reductant NADPH, which is crucial for the antioxidant defense of tumor cells by ameliorating cellular ROS levels (14). We next examined the effect of G6PD on the REDOX balance in leukemia cells. We found that \u003cem\u003eG6PD\u003c/em\u003e knockdown clearly reduced cellular NADPH levels, but its oxidized form, NADP\u003csup\u003e+\u003c/sup\u003e, increased significantly (Figure 3A-3D). We also assayed ROS generation by flow cytometry. As shown in Figure 3E-3F, ROS generation was elevated in the four leukemia cell lines when \u003cem\u003eG6PD\u0026nbsp;\u003c/em\u003ewas knocked down. These results clearly showed that knocking down \u003cem\u003eG6PD\u0026nbsp;\u003c/em\u003ebroke the REDOX balance in leukemia cells and led to cellular ROS accumulation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eG6PD\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;knockdown induces leukemia cell apoptosis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eExcessive intracellular ROS levels may cause damage to cells, including DNA damage, cell membrane damage, and mitochondrial dysfunction, eventually leading to apoptotic cell death (21). To further investigate the role of G6PD in apoptosis, we examined apoptosis using flow cytometry. Compared with the NC group, the apoptotic cell rates were increased in \u003cem\u003eG6PD\u003c/em\u003e-knockdown leukemia cells (Figure 4A-4D).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eTo verify this finding further, we examined the expression of apoptosis-related genes. As shown in Figure S2A-2D, when \u003cem\u003eG6PD\u0026nbsp;\u003c/em\u003ewas knocked down, the mRNA expressions of p53 were elevated. In line with this result, the mRNA expression of the apoptosis inhibitory factor Bcl-2 decreased. Meanwhile, we detected the protein expression of these factors using western blotting as well and got the same conclusion (Figure 4E-4H). Together, these findings indicate that \u003cem\u003eG6PD\u003c/em\u003e knockdown induces leukemia cell apoptosis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eG6PD\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;knockdown alters mitochondrial membrane permeability of leukemia cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMitochondria are crucial organelles involved in the process of apoptosis. It plays a decisive role in regulating energy metabolism under physiological or pathological conditions and in controlling cell death and survival (22). We previously demonstrated that the downregulation of G6PD could trigger leukemia cell apoptosis, and we then investigated the function of mitochondria. We first assessed mitochondrial membrane potential. There was an increasing proportion of JC-1 monomers in \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM cells (Figure 5A-5D). This suggests that \u003cem\u003eG6PD\u003c/em\u003e knockdown reduced the mitochondrial membrane potential. Next, we examined the release of cyt-c from the mitochondria. As shown in Figure 5E-5H, the level of cyt-c content in the cytoplasm was elevated in \u003cem\u003eG6PD\u003c/em\u003e-knockdown leukemia cells. Taken together, these results clearly demonstrate that \u003cem\u003eG6PD\u003c/em\u003e knockdown alters the mitochondrial membrane permeability of leukemia cells.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eG6PD\u003c/em\u003e\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;knockdown suppresses the tumorigenic potential of leukemia cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTo determine the role of G6PD in tumorigenesis, we examined the pathological function of G6PD in tumorigenesis in vivo by transplanting CCRF-CEM/si-G6PD and THP-1/si-G6PD stable cell lines subcutaneously into BALB/c nu/nu mice. As shown in Figure 6A-6D, \u003cem\u003eG6PD\u0026nbsp;\u003c/em\u003eknockdown robustly suppressed tumor growth. Concomitantly, \u003cem\u003eG6PD\u003c/em\u003e knockdown reduced the size and weight of the generated tumors. The proliferating cell nuclear antigen (PCNA) protein levels were decreased in \u003cem\u003eG6PD\u003c/em\u003e-knockdown CCRF-CEM and THP-1 cells (Figure 6E-6F). Meanwhile, we detected Ki67 expression levels in xenografted tumors by immunohistochemistry staining. The results showed that knockdown of G6PD slowed the growth of leukemia cells in vivo (Figure 6G-6H). Furthermore, we performed a survival analysis using TCGA database. As shown in Figure 6I, in line with our results, high expression of G6PD was related to poor overall survival compared to low expression of G6PD. These findings clearly support that G6PD is involved in the development of leukemia cell proliferation in vivo.\u003c/p\u003e\n\u003cp\u003eTogether, our study revealed that the downregulation of G6PD caused cell cycle inhibition, reduced NADPH production, altered mitochondrial membrane permeability, and induced apoptosis in leukemia cells (Figure 6J).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eMetabolic reprogramming is a hallmark of malignant tumors, and is critical for the generation of energy for the rapid proliferation of tumor cells.\u0026nbsp;The rate of glycolysis in tumor cells increases and subsequently exhibits a preference for lactic acid fermentation rather than oxidative phosphorylation, even in the presence of sufficient oxygen. This is known as the Warburg effect, as well as glucose metabolism reprogramming (23, 24). Recent studies have suggested that leukemia cells rely more heavily on aerobic glycolysis (25). Studies using mouse models have suggested that leukemia occurs more quickly when there is an increase in glucose uptake in vivo (26). Moreover, blocking glycolysis could lead to the cessation of proliferation or death of leukemia cells and enhance their sensitivity to chemotherapy medications (18, 27). Notably, the PPP pathway is frequently altered in leukemia cells (28). Leukemia cells prefer the PPP pathway to the glycolysis pathway for glucose conversion, suggesting that the PPP pathway plays an important role in metabolic reprogramming in leukemia (29). Here, we demonstrated that \u003cem\u003eG6PD\u003c/em\u003e knockdown in leukemia cells decreased the level of NADPH and led to the accumulation of ROS. In addition, downregulation of G6PD suppressed PPP, which produced ribose 5‑phosphate for nucleic acid synthesis and inhibits the cell cycle. Taken together, these data indicate that G6PD is necessary for leukemia cell proliferation.\u003c/p\u003e\n\u003cp\u003eMitochondria play a crucial role in several cellular processes such as energy generation, ROS accumulation, and induction of apoptosis (30). It is a vital organelle that regulates numerous cellular pathways in almost all the cell types (31). Apoptosis signaling pathways are inhibited in various tumor cells. Therefore, mitochondria are the target of apoptotic signal transduction in anticancer treatment (32). Apoptosis caused by the mitochondrial pathway is mainly due to signaling molecules acting on the mitochondrial membrane, leading to changes in mitochondrial membrane permeability or the formation of protein complex pores (33, 34). The release of apoptotic proteins such as cyt-c activates downstream caspase family proteins or directly acts on the corresponding substrates to induce apoptosis (35). In this study, we detected an increase in ROS generation in \u003cem\u003eG6PD\u003c/em\u003e-knockdown leukemia cells; excess ROS could damage mitochondria and cause mitochondrial dysfunction (36). Indeed, we found that the JC-1 monomer content was elevated when \u003cem\u003eG6PD\u003c/em\u003e was knocked down in leukemia cells, suggesting that the mitochondrial membrane potential decreased. We also detected increased cyt-c levels in the cytoplasm. These findings demonstrate that the permeability of the mitochondrial membrane was destroyed, and the function was impaired, eventually leading to apoptosis. However, the specific molecular mechanism by which G6PD regulates apoptosis in leukemia cells has not been fully elucidated and could serve as a direction for further research. Nevertheless, our study clearly shows that G6PD is involved in leukemia cell apoptosis.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eDisclosure statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo potential conflict of interest was reported by author(s).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by Scientific Research Fund of Education Department of Yunnan Province: [Grant Number 2023J0894].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor’s contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eQiurong Zhang designed the study and conception. Material preparation and data collection were performed by Lijuan He and Hui Cha. Analysis was conducted by Qiurong Zhang Lijuan He, and Hui Cha. The first draft was written by Qiurong Zhang and all authors critically revised subsequent versions. Qiurong Zhang supervised the project and acquired funding. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMao J, Li S, Zhao H, Zhu Y, Hong M, Zhu H, et al. Effects of chidamide and its combination with decitabine on proliferation and apoptosis of leukemia cell lines. Am J Transl Res. 2018;10(8):2567-78. PubMed PMID: 30210693; PubMed Central PMCID: PMC6129529.\u003c/li\u003e\n\u003cli\u003eHarris MH, Czuchlewski DR, Arber DA, Czader M. Genetic Testing in the Diagnosis and Biology of Acute Leukemia. Am J Clin Pathol. 2019;152(3):322-46. doi: 10.1093/ajcp/aqz093. PubMed PMID: 31367767.\u003c/li\u003e\n\u003cli\u003eWong JYC, Filippi AR, Scorsetti M, Hui S, Muren LP, Mancosu P. Total marrow and total lymphoid irradiation in bone marrow transplantation for acute leukaemia. Lancet Oncol. 2020;21(10):e477-e87. doi: 10.1016/S1470-2045(20)30342-9. PubMed PMID: 33002443.\u003c/li\u003e\n\u003cli\u003eKlco JM, Mullighan CG. Advances in germline predisposition to acute leukaemias and myeloid neoplasms. Nat Rev Cancer. 2021;21(2):122-37. doi: 10.1038/s41568-020-00315-z. PubMed PMID: 33328584; PubMed Central PMCID: PMC8404376.\u003c/li\u003e\n\u003cli\u003eWouters BJ, Delwel R. Epigenetics and approaches to targeted epigenetic therapy in acute myeloid leukemia. Blood. 2016;127(1):42-52. doi: 10.1182/blood-2015-07-604512. PubMed PMID: 26660432.\u003c/li\u003e\n\u003cli\u003ePatra KC, Hay N. The pentose phosphate pathway and cancer. Trends Biochem Sci. 2014;39(8):347-54. doi: 10.1016/j.tibs.2014.06.005. PubMed PMID: 25037503; PubMed Central PMCID: PMC4329227.\u003c/li\u003e\n\u003cli\u003eStincone A, Prigione A, Cramer T, Wamelink MM, Campbell K, Cheung E, et al. The return of metabolism: biochemistry and physiology of the pentose phosphate pathway. Biol Rev Camb Philos Soc. 2015;90(3):927-63. doi: 10.1111/brv.12140. PubMed PMID: 25243985; PubMed Central PMCID: PMC4470864.\u003c/li\u003e\n\u003cli\u003eLi Q, Qin T, Bi Z, Hong H, Ding L, Chen J, et al. Rac1 activates non-oxidative pentose phosphate pathway to induce chemoresistance of breast cancer. Nat Commun. 2020;11(1):1456. doi: 10.1038/s41467-020-15308-7. PubMed PMID: 32193458; PubMed Central PMCID: PMC7081201.\u003c/li\u003e\n\u003cli\u003eZhang Y, Xu Y, Lu W, Li J, Yu S, Brown EJ, et al. G6PD-mediated increase in de novo NADP(+) biosynthesis promotes antioxidant defense and tumor metastasis. Sci Adv. 2022;8(29):eabo0404. doi: 10.1126/sciadv.abo0404. PubMed PMID: 35857842; PubMed Central PMCID: PMC9299539.\u003c/li\u003e\n\u003cli\u003eJiang P, Du W, Yang X. A critical role of glucose-6-phosphate dehydrogenase in TAp73-mediated cell proliferation. Cell Cycle. 2013;12(24):3720-6. doi: 10.4161/cc.27267. PubMed PMID: 24270845; PubMed Central PMCID: PMC3905063.\u003c/li\u003e\n\u003cli\u003eMele L, Paino F, Papaccio F, Regad T, Boocock D, Stiuso P, et al. A new inhibitor of glucose-6-phosphate dehydrogenase blocks pentose phosphate pathway and suppresses malignant proliferation and metastasis in vivo. Cell Death Dis. 2018;9(5):572. doi: 10.1038/s41419-018-0635-5. PubMed PMID: 29760380; PubMed Central PMCID: PMC5951921.\u003c/li\u003e\n\u003cli\u003eDeng P, Li K, Gu F, Zhang T, Zhao W, Sun M, et al. LINC00242/miR-1-3p/G6PD axis regulates Warburg effect and affects gastric cancer proliferation and apoptosis. Mol Med. 2021;27(1):9. doi: 10.1186/s10020-020-00259-y. PubMed PMID: 33514309; PubMed Central PMCID: PMC7845121.\u003c/li\u003e\n\u003cli\u003eZhang HS, Zhang ZG, Du GY, Sun HL, Liu HY, Zhou Z, et al. Nrf2 promotes breast cancer cell migration via up-regulation of G6PD/HIF-1alpha/Notch1 axis. J Cell Mol Med. 2019;23(5):3451-63. doi: 10.1111/jcmm.14241. PubMed PMID: 30809937; PubMed Central PMCID: PMC6484400.\u003c/li\u003e\n\u003cli\u003eLi Z, He Y, Li Y, Li J, Zhao H, Song G, et al. NeuroD1 promotes tumor cell proliferation and tumorigenesis by directly activating the pentose phosphate pathway in colorectal carcinoma. Oncogene. 2021;40(50):6736-47. doi: 10.1038/s41388-021-02063-2. PubMed PMID: 34657129.\u003c/li\u003e\n\u003cli\u003eTang Y, Li W, Qiu L, Zhang X, Zhang L, Miyagishi M, et al. The p52-ZER6/G6PD axis alters aerobic glycolysis and promotes tumor progression by activating the pentose phosphate pathway. Oncogenesis. 2023;12(1):17. doi: 10.1038/s41389-023-00464-4. PubMed PMID: 36977688; PubMed Central PMCID: PMC10050210.\u003c/li\u003e\n\u003cli\u003eWu S, Wang H, Li Y, Xie Y, Huang C, Zhao H, et al. Transcription Factor YY1 Promotes Cell Proliferation by Directly Activating the Pentose Phosphate Pathway. Cancer Res. 2018;78(16):4549-62. doi: 10.1158/0008-5472.CAN-17-4047. PubMed PMID: 29921695.\u003c/li\u003e\n\u003cli\u003eQing Y, Dong L, Gao L, Li C, Li Y, Han L, et al. R-2-hydroxyglutarate attenuates aerobic glycolysis in leukemia by targeting the FTO/m(6)A/PFKP/LDHB axis. Mol Cell. 2021;81(5):922-39 e9. doi: 10.1016/j.molcel.2020.12.026. PubMed PMID: 33434505; PubMed Central PMCID: PMC7935770.\u003c/li\u003e\n\u003cli\u003eMeynet O, Beneteau M, Jacquin MA, Pradelli LA, Cornille A, Carles M, et al. Glycolysis inhibition targets Mcl-1 to restore sensitivity of lymphoma cells to ABT-737-induced apoptosis. Leukemia. 2012;26(5):1145-7. doi: 10.1038/leu.2011.327. PubMed PMID: 22076465.\u003c/li\u003e\n\u003cli\u003eMatthews HK, Bertoli C, de Bruin RAM. Cell cycle control in cancer. Nat Rev Mol Cell Biol. 2021. doi: 10.1038/s41580-021-00404-3. PubMed PMID: 34508254.\u003c/li\u003e\n\u003cli\u003eLi R, Wang W, Yang Y, Gu C. Exploring the role of glucose‑6‑phosphate dehydrogenase in cancer (Review). Oncol Rep. 2020;44(6):2325-36. doi: 10.3892/or.2020.7803. PubMed PMID: 33125150.\u003c/li\u003e\n\u003cli\u003eCheung EC, Vousden KH. The role of ROS in tumour development and progression. Nat Rev Cancer. 2022;22(5):280-97. doi: 10.1038/s41568-021-00435-0. PubMed PMID: 35102280.\u003c/li\u003e\n\u003cli\u003eAbate M, Festa A, Falco M, Lombardi A, Luce A, Grimaldi A, et al. Mitochondria as playmakers of apoptosis, autophagy and senescence. Semin Cell Dev Biol. 2020;98:139-53. doi: 10.1016/j.semcdb.2019.05.022. PubMed PMID: 31154010.\u003c/li\u003e\n\u003cli\u003eEl Hassouni B, Granchi C, Valles-Marti A, Supadmanaba IGP, Bononi G, Tuccinardi T, et al. The dichotomous role of the glycolytic metabolism pathway in cancer metastasis: Interplay with the complex tumor microenvironment and novel therapeutic strategies. Semin Cancer Biol. 2020;60:238-48. doi: 10.1016/j.semcancer.2019.08.025. PubMed PMID: 31445217.\u003c/li\u003e\n\u003cli\u003eYuan Y, Li H, Pu W, Chen L, Guo D, Jiang H, et al. Cancer metabolism and tumor microenvironment: fostering each other? Sci China Life Sci. 2022;65(2):236-79. doi: 10.1007/s11427-021-1999-2. PubMed PMID: 34846643.\u003c/li\u003e\n\u003cli\u003eAkers LJ, Fang W, Levy AG, Franklin AR, Huang P, Zweidler-McKay PA. Targeting glycolysis in leukemia: a novel inhibitor 3-BrOP in combination with rapamycin. Leuk Res. 2011;35(6):814-20. doi: 10.1016/j.leukres.2010.12.028. PubMed PMID: 21316758; PubMed Central PMCID: PMC4805370.\u003c/li\u003e\n\u003cli\u003eSaito Y, Chapple RH, Lin A, Kitano A, Nakada D. AMPK Protects Leukemia-Initiating Cells in Myeloid Leukemias from Metabolic Stress in the Bone Marrow. Cell Stem Cell. 2015;17(5):585-96. doi: 10.1016/j.stem.2015.08.019. PubMed PMID: 26440282; PubMed Central PMCID: PMC4597792.\u003c/li\u003e\n\u003cli\u003eHulleman E, Kazemier KM, Holleman A, VanderWeele DJ, Rudin CM, Broekhuis MJ, et al. Inhibition of glycolysis modulates prednisolone resistance in acute lymphoblastic leukemia cells. Blood. 2009;113(9):2014-21. doi: 10.1182/blood-2008-05-157842. PubMed PMID: 18978206; PubMed Central PMCID: PMC4081395.\u003c/li\u003e\n\u003cli\u003eXu SN, Wang TS, Li X, Wang YP. SIRT2 activates G6PD to enhance NADPH production and promote leukaemia cell proliferation. Sci Rep. 2016;6:32734. doi: 10.1038/srep32734. PubMed PMID: 27586085; PubMed Central PMCID: PMC5009355.\u003c/li\u003e\n\u003cli\u003eChen Y, Xu Q, Ji D, Wei Y, Chen H, Li T, et al. Inhibition of pentose phosphate pathway suppresses acute myelogenous leukemia. Tumour Biol. 2016;37(5):6027-34. doi: 10.1007/s13277-015-4428-5. PubMed PMID: 26596840.\u003c/li\u003e\n\u003cli\u003eZou Z, Chang H, Li H, Wang S. Induction of reactive oxygen species: an emerging approach for cancer therapy. Apoptosis. 2017;22(11):1321-35. doi: 10.1007/s10495-017-1424-9. PubMed PMID: 28936716.\u003c/li\u003e\n\u003cli\u003eBock FJ, Tait SWG. Mitochondria as multifaceted regulators of cell death. Nat Rev Mol Cell Biol. 2020;21(2):85-100. doi: 10.1038/s41580-019-0173-8. PubMed PMID: 31636403.\u003c/li\u003e\n\u003cli\u003eCarneiro BA, El-Deiry WS. Targeting apoptosis in cancer therapy. Nat Rev Clin Oncol. 2020;17(7):395-417. doi: 10.1038/s41571-020-0341-y. PubMed PMID: 32203277; PubMed Central PMCID: PMC8211386.\u003c/li\u003e\n\u003cli\u003eAder NR, Hoffmann PC, Ganeva I, Borgeaud AC, Wang C, Youle RJ, et al. Molecular and topological reorganizations in mitochondrial architecture interplay during Bax-mediated steps of apoptosis. Elife. 2019;8. doi: 10.7554/eLife.40712. PubMed PMID: 30714902; PubMed Central PMCID: PMC6361589.\u003c/li\u003e\n\u003cli\u003eZorova LD, Popkov VA, Plotnikov EY, Silachev DN, Pevzner IB, Jankauskas SS, et al. Mitochondrial membrane potential. Anal Biochem. 2018;552:50-9. doi: 10.1016/j.ab.2017.07.009. PubMed PMID: 28711444; PubMed Central PMCID: PMC5792320.\u003c/li\u003e\n\u003cli\u003eJiang X, Jiang H, Shen Z, Wang X. Activation of mitochondrial protease OMA1 by Bax and Bak promotes cytochrome c release during apoptosis. Proc Natl Acad Sci U S A. 2014;111(41):14782-7. doi: 10.1073/pnas.1417253111. PubMed PMID: 25275009; PubMed Central PMCID: PMC4205663.\u003c/li\u003e\n\u003cli\u003eAnnesley SJ, Fisher PR. Mitochondria in Health and Disease. Cells-Basel. 2019;8(7). doi: 10.3390/cells8070680. PubMed PMID: 31284394; PubMed Central PMCID: PMC6678092.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003e\u003cstrong\u003eTable 1. Primer pairs used for quantitative real time PCR.\u003c/strong\u003e\u003c/p\u003e\n\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"605\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 66px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenes\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 105px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRefseq No.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd colspan=\"2\" valign=\"bottom\" style=\"width: 434px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ePrimer sequences (5\u0026apos;-3\u0026apos;)\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 66px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 105px;\"\u003e\n \u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 222px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eForward\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 212px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eReverse\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003eb-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 105px;\"\u003e\n \u003cp\u003eNM_001101.5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 222px;\"\u003e\n \u003cp\u003eGGAAATCGTGCGTGACATT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 212px;\"\u003e\n \u003cp\u003eCAGGCAGCTCGTAGCTCTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003eG6PD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003eNM_000402.4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 222px;\"\u003e\n \u003cp\u003eTCCAACCACATCTCCTCCCT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 212px;\"\u003e\n \u003cp\u003eGCGACCCTCAGTGCCAAA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003eP53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003eNM_000546.6\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 222px;\"\u003e\n \u003cp\u003eCCACCATCCACTACAACTACAT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 212px;\"\u003e\n \u003cp\u003eAAACACGCACCTCAAAGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 66px;\"\u003e\n \u003cp\u003eBcl-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd style=\"width: 105px;\"\u003e\n \u003cp\u003eNM_000633.3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 222px;\"\u003e\n \u003cp\u003eCTGGGAGAACAGGGTACGATAA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 212px;\"\u003e\n \u003cp\u003eGGCTGGGAGGAGAAGATGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2. Antibodies used for western blotting.\u003c/strong\u003e\u003c/p\u003e\n \u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"605\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 161px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eAntibody\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eMaker\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eProduct No.\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eExperiment\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eDilution\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 161px;\"\u003e\n \u003cp\u003eAnti-b-actin\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 95px;\"\u003e\n \u003cp\u003eAb8227\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 142px;\"\u003e\n \u003cp\u003eWestern blotting\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003e1/5,000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 161px;\"\u003e\n \u003cp\u003eAnti-G6PD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 95px;\"\u003e\n \u003cp\u003e66373-1-Ig\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 142px;\"\u003e\n \u003cp\u003eWestern blotting\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003e1/1,000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 161px;\"\u003e\n \u003cp\u003eAnti-PCNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 95px;\"\u003e\n \u003cp\u003eAb280088\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 142px;\"\u003e\n \u003cp\u003eWestern blotting\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003e1/,000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 161px;\"\u003e\n \u003cp\u003eAnti-Ki67\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 95px;\"\u003e\n \u003cp\u003e28074-1-AP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 142px;\"\u003e\n \u003cp\u003eImmunohistochemistry\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003e1/200\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 161px;\"\u003e\n \u003cp\u003eAnti-Bcl-2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 95px;\"\u003e\n \u003cp\u003e68103-1-Ig\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 142px;\"\u003e\n \u003cp\u003eWestern blotting\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003e1/1,000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 161px;\"\u003e\n \u003cp\u003eCytochrome c\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eAbcam\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 95px;\"\u003e\n \u003cp\u003eAb133504\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 142px;\"\u003e\n \u003cp\u003eWestern blotting\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003e1/5,000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 161px;\"\u003e\n \u003cp\u003eAnti-p53\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 76px;\"\u003e\n \u003cp\u003eProteintech\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 95px;\"\u003e\n \u003cp\u003e60283-2-Ig\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 142px;\"\u003e\n \u003cp\u003eWestern blotting\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"bottom\" style=\"width: 132px;\"\u003e\n \u003cp\u003e1/1,000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 161px;\"\u003e\n \u003cp\u003eGoat Anti-Rabbit IgG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003eZSGB-BIO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003eZB2301\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eWestern blotting\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e1/10,000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"bottom\" style=\"width: 161px;\"\u003e\n \u003cp\u003eGoat Anti-Mouse IgG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 76px;\"\u003e\n \u003cp\u003eZSGB-BIO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 95px;\"\u003e\n \u003cp\u003eZB2305\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 142px;\"\u003e\n \u003cp\u003eWestern blotting\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 132px;\"\u003e\n \u003cp\u003e1/10,000\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Glucose-6-phosphate dehydrogenase (G6PD), leukemia, apoptosis, REDOX balance","lastPublishedDoi":"10.21203/rs.3.rs-7512827/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7512827/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Cancer cells, including leukemia cells, maintain rapid growth and reproduction by promoting biosynthetic processes and metabolic reprogramming. The pentose phosphate pathway (PPP) plays a crucial role in meeting the synthetic metabolic needs of cancer cells, and glucose 6-phosphate dehydrogenase (G6PD) is the first rate-limiting enzyme in the oxidative branch of PPP. However, the molecular mechanism by which G6PD causes leukemia remains unclear. In this study, we found that the proliferation of leukemia cells depends on the presence of G6PD. Knocking down G6PD can cause cell cycle arrest in leukemia cells, thereby inhibiting cell proliferation. G6PD knockdown reduced the NADPH level in leukemia cells and increased the production of intracellular reactive oxygen species (ROS). Moreover, G6PD knockdown can also promote the expression of apoptotic factors and alter the permeability of cell mitochondrial membranes, leading to apoptosis in leukemia cells. Importantly, we also validated in vivo that the knockdown of G6PD could inhibit the growth of leukemia cells. In summary, our study suggests that G6PD is crucial for the growth of leukemia cells and may be a potential biological target for leukemia treatment.","manuscriptTitle":"G6PD promotes leukemia cell proliferation through mitochondrial inhibition of apoptosis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-22 09:59:27","doi":"10.21203/rs.3.rs-7512827/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"71d485cc-9c2e-4f3a-a5a4-a62b315fcd61","owner":[],"postedDate":"October 22nd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2026-02-28T14:40:10+00:00","versionOfRecord":[],"versionCreatedAt":"2025-10-22 09:59:27","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7512827","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7512827","identity":"rs-7512827","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.