Red-flowered white clover (T. repens L.): insights from morphobiological and genetic analysis

Red-flowered white clover (T. repens L.): insights from morphobiological and genetic analysis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Red-flowered white clover (T. repens L.): insights from morphobiological and genetic analysis Anastasia Olegovna Shamustakimova, Alina Aleksandrovna Ivanova, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8987527/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract A five year breeding program (2021-2025) successfully established white clover ( Trifolium repens L.) lines with stable, bright pink inflorescences, achieving a frequency up to 94.4% in the F4 generation. Molecular genetic analysis identified a polymorphism in the promoter region of the F3’5’H gene in red flowered (RF) plants. Bioinformatic analysis of these contrasting promoter regions revealed significant differences in the composition of cis-regulatory elements (CREs) including light-sensitive motifs (AE-box, TCT-motif), which apparently explains the light-dependent expression of anthocyanins. In silico analysis ruled out that the studied plants belong to T. occidentale Combe and confirmed their hybrid nature. This conclusion was based on the presence of sequences from flavonoid biosynthesis genes characteristic of the modern form of T. occidentale along with the T. pallescens Schreb subgenome. The specific SCAR marker 865_ F3’5’H can reliably identify RF plants and detect recent hybridization events between Trifolium repens and T. occidentale . T. repens T. occidentale T. pallescens hybrid subgenome flower pigmentation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction White clover ( Trifolium repens L.) is an important component of pastures in the majority of temperate regions of the world, and its inclusion in grasslands leads to increased dry matter yield, improved feed value, and prolonged pasture use (Privalova 2004). Recent genomic studies have established that white clover is an allopolyploid species derived from hybridization between T. pallescens Schreb and T. occidentale Combe (Griffiths et al. 2019; Fechete et al. 2024). At the same time, most varieties of T. repens have white inflorescences, while T. pallescens and some T. occidentale plants have pink petals. There are several forms of white clover with pigmented inflorescences that are known in the literature. For example, such varieties as Dragon's Blood and Dark Dancer (Tashiro, 2009) have pink petals, while the plants described by Brubaker (Brewbaker 1962) and those found in Iowa in 1983 (Pederson and McLaughlin 1995) had highly pigmented flowers. Plant pigmentation serves as a marker trait for botanical identification and classification by family, genus or species. Breeders analyze the color of flowers, leaves, stems and other plant parts to breed visually distinct varieties. Consequently, early botanical and agricultural studies in the 19th century naturally focused on plant pigments such as carotenoids and chlorophylls (Młodzińska et al. 2009). Later, it was established that betalains and flavonoids were also responsible for pigmentation (Tanaka et al. 2010). Anthocyanins, a subclass of flavonoids, are widely studied in plant breeding programs targeting both ornamental and food crops due to their beneficial properties as secondary metabolites. Plants with high anthocyanin content have been shown to be less susceptible to ultraviolet radiation and more resistant to biotic and abiotic environmental factors (Guo et al. 2008; Winkel-Shirley 2001). Consuming foods rich in anthocyanins has a beneficial effect on heart diseases, hyperglycemia, and vision problems (Molina et al. 2023). A number of studies have also investigated their anticancer (Faria et al. 2010; Hui et al. 2010; Jing et al. 2008), antioxidant (Molina et al. 2019; Gonçalves et al. 2018), and antimicrobial (Bendokas et al. 2018; Chen et al. 2018) effect. Previous studies have established that anthocyanin biosynthesis involves a cascade of structural and regulatory genes (Sunil and Shetty 2022). Previously, a team from China (Zhang et al. 2018) analyzed the transcriptome of the white clover forms that produce brightly colored flowers upon light exposure and compared them to the same genotype grown in shaded conditions. They found these forms differ significantly in the expression of eight genes: CHS, F3'H, DFR, ANS, LAR, UFGT, FLS, F3’5’H . Although the authors identified the key genes responsible for light-induced color change, their regulatory regions have remained unexplored. Literature reports indicate that deletions/insertions in the promoter regions of anthocyanin biosynthesis genes often alter their regulation, thereby affecting trait expression (Nishihara et al. 2014; Moreau et al. 2012; Sato et al. 2011). In this study, through a multi-year selection program, we developed white clover lines with stable, brightly colored inflorescences and conducted a comprehensive analysis of their key morphobiological traits and the underlying genetic mechanisms. Materials and methods Plant material and growth conditions Plants were bred between 2021 and 2025 under greenhouse and field conditions. Seedlings were grown in 0.2 L containers. Elite plants were placed in 3 L containers. In field conditions, seedlings were transplanted in a grid pattern (checkrowed), with one plant per hole spaced at 0.5 m x 0.5 m. The plot’s soil was sod-podzolic; its humus content was 1.6%; hydrolyzable nitrogen 7.5%; potassium 15 mg/100 g of soil; phosphorus 25 mg/100 g of soil, and its soil pHKCl was 4.5. For initial PCR-analysis, we used five adult plants each of white-flowered (WF) and red-flowered (RF) clover, all grown in a greenhouse. To validate the marker, we analyzed an expanded panel including: 1) seed progeny from 16 RF lines, and ( 2 ) 10 commercial varieties and 6 wild forms of WF clover (Table 1 ). Table 1 List of white clover accessions used for marker validation and the corresponding red-flowered selection lines No. Type Accession/Cultivar Origin No. Red-flowered lines 1 Cultivar Lugovik FWRC FPA 21 № 6/6 2 Wild № 762 Udmurtia 22 № 8/8 3 Wild № 801 Buryatia 23 № 29/1 4 Cultivar VIK70 FWRC FPA 24 № 1 5 Wild № 232 Altai, Ulagan pass, h = 2000 m 25 № 2 6 Cultivar Wilka Netherlands 26 № 217 7 Cultivar Ritm FWRC FPA 27 № 3 8 Cultivar Ladino Netherlands 28 № 17/8 9 Wild № 598 Archangelsk region, Nothern Dvina River 29 № 6 10 Cultivar Nanuk Denmark 30 № 15/3 11 Wild Altai wild Altai 31 № 6/7 12 Wild № 517 Karelia, lake Sandal 32 № 1/2 13 Cultivar Merlin Denmark 33 № 16 14 Cultivar Ovcak Czechoslovak Republic 34 № 7 15 Cultivar Blanca France 35 № 12 16 Cultivar Zapican Uruguay 36 № 5/5 DNA extraction The experiments were carried out on 30 mg of leaf tissue from the adult plants grown in the greenhouse. To genotype the expanded sample set (varieties and wild forms), we used DNA from seedlings grown on Petri dishes, with 30 seedlings pooled per sample. Total genomic DNA was extracted using a modified SDS method (Klimenko et al. 2021). Primer design To amplify the promoter regions of eight genes, specific primers were developed using contigs from a previous transcriptome study (Zhang et al. 2018). The position of the ATG codon was determined by aligning the contigs against the T. pratense genome (version ARS_RC_1.1). Subsequently, the promoter sequence, together with a portion of the first exon’s coding region, was aligned to the white clover genome (versions UTM_Trep_v1.0 and AgR_To_v5). The obtained data were loaded into the PrimerQuest tool (Integrated DNA Technologies, http://www.idtdna.com ) to select primers according to the specified parameters. PCR-amplification The 20 µL PCR reaction mixture contained: 3 µL of 10× Taq Turbo buffer, 0.5 µL of 50× dNTP mix, 0.4 µL of Taq DNA polymerase (5 U/µL), 1 µL of DNA template (30 ng), and 1 µL each of forward and reverse primers. All reagent volumes are given per reaction. The samples were amplified on a Bio-Rad T 1000 Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA) under the following conditions: initial denaturation for 3 minutes at 94°C; 35 cycles of 30 seconds at 94°C, 30 seconds at 56/59/62°C (depending on the primer pair), 1 minute at 72°C; final elongation at 72°C for 5 minutes. Table 2 shows the characteristics of the developed primers and the lengths of expected PCR products. Table 2 Primers designed to amplify the promoter region of flavonoid biosynthesis genes in white clover. Gene Primer Sequence (5’→3’) Tm (°C) Amplicon length (bp) ANS F TGTTTCTATTGCCTTAGTTCCCT 62 747 R CCACTCAAAGATAAGCTTTCAACTC LAR F GCTCAGATAATAAAGAGTGTCTAAC 59 681 R TGTAACCAGTTCCACCAAATAC 61 F3’H F ACATTGATTGCACGCACTTTAG 62 781 R GTTGAGAATGCAATGAGCAATAGA UFGT F CTCACCGCTACTTACCATTCC 62 800 R AACAGGGTGGCTTCCAAA DFR F CTCTACCAATTGAGCTATGTTTATGG 62 803 R GACCAACCATGAACCAATGAAG CHS F TGATTGCTTAGTTGATTAACCG 59 761 R GTGTGTTGCTATATTTGTCCTT FLS F GAAAGGAGATGTCACTCTTA 56 645 R TGTTGTGGCATATGTAGTTAG 58 F3’5’H F CTCGCATCATGTACTTCATAGGT 62 776 R TGAGAAGCACAAGAGTACAACTTA PCR results were detected by electrophoresis in 1.6% agarose gel at 50 V for 90 minutes. A 100 bp DNA ladder molecular marker (Thermo fisher scientific, USA) was used to assess the size of amplification product fragments. The fragments were visualized using a Gel Doc™ XR+ imaging system (Bio-Rad, USA). DNA sequencing The PCR products obtained were purified using ‘Clean-up Standard’ columns (Evrogen, Russia), cloned into the pAL2-T vector following the manufacturer’s protocol, and Sanger-sequenced from both ends to determine the primary nucleotide sequence. Bioinformatic analysis The obtained sequences were analyzed using the UGENE program (Okonechnikov et al. 2012). The PlantCare online application (Lescot et al. 2002) was utilized to study the cis-regulatory landscape. Sequence alignment and pairwise percent identity calculations were performed using the ClustalOmega software ( https://www.ebi.ac.uk/jdispatcher/msa/clustalo ). To determine the expected PCR product lengths, BLAST analysis was performed against the subgenomes of white clover (version UTM_Trep_v1.0) and the genome of T.occidentale (version drTriOcci1.hap1.1) when analyzing flavonoid bisynthesis gene regions. Results The breeding program commenced in 2021 with two plants selected from an experimental plot in a breeding nursery at Federal Williams Research Center of Forage Production and Agroecology. These plants were F3 hybrids of the cross “Atolai (Latvia) x Pechorsky (a wild form from Russia)” and were notable for their pale pink inflorescence color. Multi-year selection for inflorescence color In 2022, the first generation was evaluated in a soil greenhouse. Seedlings were transplanted into the ground at a spacing of 0.5 x 0.5 m. Among the 100 plants evaluated, 95 (95%) had white flowers, 3 (3%) pink, and 2 (2%) bright pink flowers. The colored genotypes were transplanted into 3-L containers for further hybridization. In 2023, 613 F 2 generation plants were potted in 0.2 L containers. Among them, 200 plants (32.63%) had white flowers, 364 (59.38%) were pink and 49 (7.99%) were bright pink. Of these, 312 colored plants were transplanted to grow in the field; the distance between plants was 1 x 1 m. Based on the morphological characteristics, 25 elite plants were selected, potted in a greenhouse, and manually pollinated. In 2024, the inflorescence colors of 536 F 3 plants grown in 0.2 L containers were evaluated. Twenty-one plants (3.92%) bloomed white, 471 plants (87.87%) pink, and 44 plants (8.21%) bright pink. Of these, 100 plants with colored inflorescences were planted in the field at a distance of 1 x 1 m. Based on the morphobiological characteristics, 17 elite plants were selected, their stolon parts were cut off for vegetative reproduction in a soil greenhouse. In 2025, 960 F 4 genotypes were planted in the field on a highly acidic soil (pH = 4.5). The seedlings were planted at a distance of 0.5 m x 0.5 m. Among them, 4 plants (0.4%) were white, 906 (94.4%) were pink, and 50 (5.2%) had bright pink inflorescences. Seeds were obtained after negative selection. Stolons from elite plants of rich pink color were planted in a soil greenhouse. Comparative analysis of morphological and productive traits Comparative analysis of the morphological characteristics showed that the RF clover sample was less productive than the VIK 70 standard (see Table 3 ). Table 3 Agronomically important traits of the F 3 white clover breeding line (year 2024). Trait VIK 70 standart F 3 colored-flowered line % of standart Plant diameter, cm 77,00 47,69 61,94 Stolon diameter, cm 0,26 0,24 92,31 Leaf petiole height, cm 14,58 11,08 76,00 Leaf petiole diameter, cm 0,16 0,15 93,75 Leaf blade length, cm 2,99 2,15 71,91 Leaf blade width, cm 2,30 1,94 84,35 Peduncle height, cm 24,17 18,64 77,12 Peduncle diameter, cm 0,22 0,19 86,36 Inflorescence length, cm 2,28 1,83 80,26 Inflorescence diameter, cm 2,48 2,33 93,95 Flower length, cm 0,98 0,95 96,94 Flower diameter, cm 0,50 0,47 94,00 Number of flower heads per plant 98,00 59,00 60,20 Green mass yield, g/plant 180,00 95,40 53,00 Dry matter yield, g/plant 32,50 15,30 47,08 Crude protein content, % 20,00 18,00 90,00 Number of florets per head 88,40 80,00 90,50 Seed yield per plant, g 3,45 1,90 55,07 1000-seed weight, g 0,55 0,60 109,09 Winter hardiness, % 90,00 95,00 - The plant belongs to the hollandiсum variety. It has a semi-erect growth habit. The leaves have a distinct white mark and exhibit a color gradient from blue-green to burgundy. The flower heads are deep pink, and flowering continues until late autumn (Fig. 1 ). Light and cold-induced color changes Under low-temperature stress, the vegetative biomass of the plant accumulated anthocyanins, turning burgundy in color (Fig. 2 ) Plants that did not change the color of their vegetative mass (green) subsequently bloomed with white inflorescences. Thus, these plants were discarded early in development. We also found that the intensity of coloration of both green mass and inflorescences was regulated by exposure to light, resulting in higher brightness of pink coloration under field conditions. However, when the selected RF plants were placed in a shaded greenhouse, the inflorescence color changed to white (Fig. 3 ). PCR screening for polymorphisms in candidate gene promoters Prompted by our observations and prior reports of light-induced anthocyanin accumulation, we developed primers for amplification and further study of the promoter regions of eight candidate genes with differential expression. PCR analysis using eight primer pairs detected significant differences in amplicon length for the F3’5’H gene between the RF and WF samples (Fig. 4 ). PCR analysis revealed a clear polymorphism (Fig. 4 ). DNA from five WF varieties yielded the expected ~ 750 bp product, whereas DNA from five RF plants produced a distinct ~ 850 bp amplicon. Structural and phylogenetic analysis of the F3’5’H promoter Sequence analysis of the polymorphic F3’5’H amplicon revealed that the length of the PCR product of the RF varieties was 865 bp, while that of WF was 775 bp. Pairwise alignment of the sequences identified several insertions at distinct positions within the F3’5’H promoter region in RF varieties (Fig. 5 ) The observed high level of polymorphism in the F3’5’H promoter region between RF and WF plants is atypical for allelic variants within a species. Therefore, we identified and aligned the promoter region sequences of F3’5’H gene from: the white clover subgenomes ( T. occidentale and T. pallescens ), the genome of T. occidentale species, and our sequenced RF and WF samples. Figure 6 shows the identity percentages obtained after pairwise alignment of the sequences. As shown in Fig. 6 , pairwise identity analysis revealed the highest similarity (99.74%) between the WF and occi.sub sequences. In contrast, the RF sequence showed 99.08% identity to the F3’5’H gene from the whole genome of T. occidentale (occi.gen). Notably, the identity between this RF sequence and the T. occidentale subgenome within white clover was substantially lower (81.24%). Cis-element landscape. Light and cold-responsive motifs The resulting sequences were then analyzed for the presence of CREs using the PlantCARE program (Fig. 7 ). Bioinformatic analysis of the F3’5’H promoter region revealed distinct cis-regulatory element (CRE) profiles between RF and WF plants (Fig. 7 ). In total, we identified 20 different groups of CREs across both sequences. The RF promoter contained 18 of these groups, while the WF promoter contained 15. Thirteen groups (65%) were common to both promoters. Each promoter also possessed unique CRE groups. The WF promoter harbored two specific elements: AuxRR-core (involved in auxin responsiveness) and STRE (function not yet defined in plants). In contrast, the RF promoter possessed six unique CRE groups: AE-box, ERE, TATA, TC-rich repeats and TCT-motif. Of these, the functions of ERE and TATA remain uncharacterized in this context. TC-rich repeats are known cis-acting elements involved in defense and stress responsiveness. Critically, the remaining two motifs – AE-box and TCT-motif – are associated with light responsiveness. Their positions and characteristics within the RF promoter are detailed in Table 4 . Table 4 Location of cold- and light-inducible CREs in the promoter region of the F3’5’H gene RF WF Name of cis-element Position and strand Name of cis-element Position and strand Light-responsive cis-elements AE-box 404+ Box 4 404- Box 4 286+,774-,479- TCT-motif 102- Cold-responsive cis-elements LTR 523- LTR 448- As summarized in Table 4 , the RF F3’5’H promoter harbored three types of light-responsive CREs (AE-box, Box 4 and TCT-motif), whereas the WF promoter contained only a single Box 4 element. This striking disparity in the repertoire of photoresponsive elements (three distinct motifs in RF versus one in WF) provides a plausible cis-regulatory explanation for the light-induced anthocyanin accumulation specific to RF plants and its absence in WF plants. As for changes in anthocyanin accumulation in response to cold exposure, we cannot draw any conclusions here, since both regions contain the low-temperature-responsive (LTR) element. This suggests that the expression of these genes is controlled by transcription factors of the cold-inducible regulon. Discussion Validation of SCAR-marker 865_F3’5’H To validate the specificity and uniqueness of our newly developed DNA marker (provisionally called 865_ F3’5’H ), we expanded the analysis to include an extended panel comprising wild accessions and commercial varieties of white clover (Fig. 8 ). As can be seen from the gel image, the 865-bp band was not detected in the DNA analysis of any of the three Russian and seven foreign varieties, as well as six wild forms of white clover. At the same time, DNA analysis of all 16 RF progeny pools showed the presence of this band. Notably, the 775-bp PCR product was present in all samples of varieties and wild forms of the white clover we analyzed, regardless of their country of origin. This band was also present in DNA samples from some progeny of the brightly colored forms, indicating segregation at this locus and providing evidence for their hybrid origin. T.repens or T. occidentale? In order to exclude the belonging of the brightly colored plants to the T. occidentale species, we also performed in silico analysis and aligned the sequences of all eight promoter regions of flavonoid synthesis genes to the T. occidentale genome and white clover subgenomes. The analysis showed that four genes can be used to hypothesize the species affiliation of brightly colored plants (Table 5 ). Table 5 In silico and experimental PCR amplicon lengths for CHS , ANS , UFGT , and F3'5'H Genes Genome T.repens Genome T. occidentale RF WF Subgenome T. pallescens Subgenome T. occidentale Predicted amplicon length (bp) Experimental amplicon length (bp) CHS 749 No product No product 749 749 ANS 792 747 772 747, 772 747 UFGT 800 1278 559 800 800 F3’5’H No product 776 866 865 775 In the case of CHS , only the reverse primer showed complete homology to the promoter region of the T. occidentale genome and subgenome; the forward primer exhibited mismatches. At the same time, both RF and WF samples produced a ~ 750 bp amplicon corresponding to a CHS gene copy originating from the T. pallescens subgenome. The predicted amplicon lengths for ANS and UFGT varied by 45–241 bp depending on the template ( T.occidentale genome vs. subgenome), making these polymorphism easily detectable by gel electrophoresis. The most pronounced length polymorphism was observed for the UFGT gene: 800 bp for the T. pallescens subgenome, 1278 bp for the T. occidentale subgenome, and 559 bp for its counterpart from the T. occidentale species. While the 800 bp UFGT amplicon present in RF and WF plants was identified as the T. pallescens subgenome copy (Table 5 ), the ANS promoter region exhibited unexpected polymorphism within the RF group. Hence, RF plants 1 and 4 possessed the T. occidentale genome copy of ANS , while plants 2 and 3 carried the subgenome variant. In contrast, amplification of the F3’5’H promoter from the T. pallescens subgenome was precluded by multiple primer-template mismatches. The brightly colored plants are therefore not T. occidentale themselves, but contain introgressed ANS and F3’5’H alleles of T. occidentale origin. Consistent with this, crosses between RF and WF plants produced fertile F1 hybrids (Fig. 9 ), providing independent evidence for their close genomic relationship. Direct crosses between diploid T. occidentale (2n = 16) and tetraploid T. repens (2n = 32) are typically unsuccessful due to chromosome number mismatch, resulting in seed failure. Pederson and McLaughlin (1995) likewise reported successful hybridization and backcrossing between RF and WF biotypes of the cultivar ‘Tilman’. Several studies have since reported successful interspecific hybridization between T. occidentale and T. repens aimed at introgressing economically valuable traits into modern white clover cultivars (Gibson and Beinhart 1969; Hussain et al. 2016; Hussain & Williams 2016; Chen and Gibson 1970; Chen and Gibson 1972). The usual approach involved colchicines treatment to double the chromosome number of T. occidentale (from 2n = 2x = 16 to 2n = 4x = 32), rendering it compatible with tetraploid T. repens for subsequent hybridization. According to Hussain and Williams (2016), such hybrids were fertile. The presence of the genomes – one from colchicines treated T. occidentale and the two native subgenomes of T. repens ( T. occidentale and T. pallescens ) – allowed for multiple chromosome pairing configurations during meiosis. Thus, the brightly colored plants described here represent hybrids between T. repens and T. occidentale . The observed polymorphism in the ANS promoter amplification, together with the presence of the T. occidentale specific F3’5’H allele, points to a recent recombination event between homeologous chromosomes of the ancestral T. occidentale donor and its modern counterpart within the T. repens genome. Conclusion This study of white clover ( Trifolium repens ) led to the development of breeding lines with stable, atypical bright pink inflorescences and provided a genetic characterization of this trait. The identified molecular markers, particularly the SCAR marker 865 F3’5’H , are direct outcomes of this work. The work further demonstrates that comparative analysis of promoter sequences of flavonoid biosynthesis genes helps identify hybrid forms and detect haplotype-specific mutations. Consequently, this research directly contributed to the breeding of the first Russian white clover cultivar with pink petals, ‘Rubin’. Statements & Declarations Acknowledgments We thank V.L. Korovina and the Department of Genetic Resources for supplying seeds of white clover varieties with standard inflorescence color. Funding The research was performed within the framework of the Project No. FGGW-2025-0001 funded by the Ministry of Science and Higher Education of the Russian Federation. Competing Interests The authors declare no conflict of interest. Author Contributions Study conception, SAO, IAA. Breeding and morphobiological analysis, IAA. DNA extraction, PCR and electrophoresis, DVA, SAO. Bioinfornatic analysis, primer design and visualization, SA. Original article preparation, SAO, IAA. Review and editing, SAO, IAA, DVA. Data Availability All data generated or analysed during this study are included in this published article. References Bendokas V, Šarkinas A, Jasinauskienë D, Anisimovienë-Haimi S, Stanys V, Šikšnianas T (2018) Antimicrobial activity of berries extracts of four Ribes species, their phenolic content and anthocyanin composition. Folia Hortic 30:249–257. https://doi.org/10.2478/fhort-2018-0021 Brewbaker JL (1962) Cyanidin-red white clover - duplicate recessive mutant in Trifolium repens L. J Hered 53:163-167. Chen CC, Gibson PB (1970) Meiosis in Two Species of Trifolium and Their Hybrids. Crop Sci 10:188-189. Chen CC, Gibson PB (1972) Barriers to hybridization of Trifolium repens with related species. Can J Genet Cytol 14:381-389. Chen H, Yu W, Chen G, Meng S, Xiang Z, He N (2018) Antinociceptive and antibacterial properties of anthocyanins and flavonols from fruits of black and non-black mulberries. Molecules 23:4. https://doi.org/10.3390/molecules23010004 Faria A, Pestana D, Teixeira D, De Freitas V, Mateus N, Calhau C (2010) Blueberry anthocyanins and pyruvic acid adducts: Anticancer properties in breast cancer cell lines. Phytother Res 24:1862–1869. https://doi.org/10.1002/ptr.3213 Fechete LI, Larking AC, Heslop A, Hannaford R, Anderson CB, Hong W, Griffiths AG (2024) Harnessing cold adaptation for postglacial colonisation: Galactinol synthase expression and raffinose accumulation in a polyploid and its progenitors. Plant Cell Environ. https://doi.org/10.1111/pce.15009 Gibson PB, Beinhart G (1969) Hybridization of Trifolium occidentale with two other species of clover. J Hered 60:93–96. Gonçalves AC, Rodrigues M, Santos AO, Alves G, Silva LR (2018) Antioxidant status, antidiabetic properties and effects on Caco-2 cells of colored and non-colored enriched extracts of sweet cherry fruits. Nutrients 10:1688. https://doi.org/10.3390/nu10111688 Griffiths AG, Moraga R, Tausen M, Gupta V, Bilton TP, Campbell MA, Andersen SU (2019) Breaking free: the genomics of allopolyploidy-facilitated niche expansion in white clover. Plant Cell 31:1466-1487. https://doi.org/10.1105/tpc.18.00606 Guo J, Han W, Wang M (2008) Ultraviolet and environmental stresses involved in the induction and regulation of anthocyanin biosynthesis: a review. Afr J Biotechnol 7:4966-4972. https://doi.org/10.4314/ajb.v7i25.59709 Hui C, Bin Y, Xiaoping Y, Long Y, Chunye C, Mantian M, Wenhua L (2010) Anticancer activities of an anthocyanin-rich extract from black rice against breast cancer cells in vitro and in vivo. Nutr Cancer 62:1128–1136. https://doi.org/10.1080/01635581.2010.494821 Hussain SW, Williams WM (2016) Chromosome pairing and fertility of interspecific hybrids between Trifolium repens L. and T. occidentale Coombe. Plant Breed 135:239-245. https://doi.org/10.1111/pbr.12344 Hussain SW, Verry IM, Williams WM (2016) Development of breeding populations from interspecific hybrids between Trifolium repens L. and T. occidentale Coombe. Plant Breed 135:118–123. https://doi.org/10.1111/pbr.12326 Jing P, Bomser JA, Schwartz SJ, He J, Magnuson BA, Giusti MM (2008) Structure-function relationships of anthocyanins from various anthocyanin-rich extracts on the inhibition of colon cancer cell growth. J Agric Food Chem 56:9391–9398. https://doi.org/10.1021/jf8005917 Klimenko I, Antonov A, Dushkin V, Shamustakimova A, Mavlyutov Yu (2021). Efficient method of DNA isolation from bulking samples of seedlings. Adapt Fodder Prod. 3: 29–48. (in Russia) https://doi.org/10.33814/AFP-2222-5366-2021-3-29-48 Lescot M, Déhais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rombauts S (2002) PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res 30:325–327. https://doi.org/10.1093/nar/30.1.325 Młodzińska E (2009) Survey of plant pigments: molecular and environmental determinants of plant colors. Acta Biol Cracov Bot 51:7-16. Molina AK, Corrêa RC, Prieto MA, Pereira C, Barros L (2023) Bioactive natural pigments’ extraction, isolation, and stability in food applications. Molecules 28:1200. https://doi.org/10.3390/molecules28031200. Molina AK, Vega EN, Pereira C, Dias MI, Heleno SA, Rodrigues P, Soković M (2019) Promising antioxidant and antimicrobial food colourants from Lonicera caerulea L. var. Kamtschatica. Antioxidants 8:394. https://doi.org/10.3390/antiox8090394. Moreau C, Ambrose MJ, Turner L, Hill L, Ellis TN, Hofer JM (2012) The b gene of pea encodes a defective flavonoid 3′, 5′-hydroxylase, and confers pink flower color. Plant Physiol 159:759-768. https://doi.org/10.1104/pp.112.197517. Nishihara M, Yamada E, Saito M, Fujita K, Takahashi H, Nakatsuka T (2014) Molecular characterization of mutations in white-flowered torenia plants. BMC Plant Biol 14:86. https://doi.org/10.1186/1471-2229-14-86. Okonechnikov K, Golosova O, Fursov M, Ugene Team (2012) Unipro UGENE: a unified bioinformatics toolkit. Bioinformatics 28:1166-1167. https://doi.org/10.1093/bioinformatics/bts091 Pederson GA, McLaughlin MR (1995) Registration of MSRed F1 red-flowered white clover germplasm. Crop Sci 35:596. Privalova KN (2004) Produktivnost' dolgoletnikh travostoev s kleverom polzuchim [Productivity of long-term grass stands with white clover]. Kormoproizvodstvo 2:5-7. Sato M, Kawabe T, Hosokawa M, Tatsuzawa F, Doi M (2011) Tissue culture-induced flower-color changes in Saintpaulia caused by excision of the transposon inserted in the flavonoid 3′, 5′ hydroxylase (F3′ 5′ H) promoter. Plant Cell Rep 30:929-939. https://doi.org/10.1007/s00299-011-1016-z Sunil L, Shetty NP (2022) Biosynthesis and regulation of anthocyanin pathway genes. Appl Microbiol Biotechnol 106:1783-1798. https://doi.org/10.1007/s00253-022-11835-z Tanaka Y, Sasaki N, Ohmiya A (2008) Biosynthesis of plant pigments: anthocyanins, betalains and carotenoids. Plant J 54:733–749. https://doi.org/10.1111/j.1365-313X.2008.03447.x Tashiro RM (2009) From the field to the flowerbed to the lab: ornamental white clover breeding and leaf trait mapping. PhD Dissertation, University of Georgia. Winkel-Shirley B (2001) Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol 126:485–493. https://doi.org/10.1104/pp.126.2.485 Zhang H, Tian H, Chen M, Xiong J, Cai H, Liu Y (2018) Transcriptome analysis reveals potential genes involved in flower pigmentation in a red-flowered mutant of white clover ( Trifolium repens L.). Genomics 110:191-200. https://doi.org/10.1016/j.ygeno.2017.09.011 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Reviews received at journal 21 May, 2026 Reviews received at journal 18 May, 2026 Reviewers agreed at journal 08 May, 2026 Reviewers agreed at journal 07 May, 2026 Reviewers invited by journal 07 May, 2026 Editor assigned by journal 05 Mar, 2026 Submission checks completed at journal 05 Mar, 2026 First submitted to journal 27 Feb, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8987527","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":641544537,"identity":"a3339b99-ad86-4c4c-ab92-2ab2e086c027","order_by":0,"name":"Anastasia Olegovna Shamustakimova","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABGklEQVRIie3QPUvEMBjA8RbhulS6thx6n0BIKUTESr5KykG6tLrJubUI7RK51Y8hCJlzBq5LdM54LnUSFBcdBNOCLj1fbnPIH0KW50deLMtk+p+NvnbebZ5eHPM/EPeTBMUmpA/00z8Qr67b1VsmEHKWyY2aiUmk8gVfyfhkr6Zg66waEF/K/fCCiYS6hItMipCpY8yxIgdMSmDfDomlspG/zQR2rbQQeUXsbpLjJwGgItguh2Si0jZ4ZwK53kNP0DX9hQCF4VifYlNfXyyv4uTKoZqojkz5OhJKCcc7LE2oarF+Szy9bDoiCYBS8EVxNyC7Td0Gj+wQOXMSvWQz/2h+7kbPr8sYwKYs74vT7397fXxTYDKZTKa+D5K+fPRX3fkcAAAAAElFTkSuQmCC","orcid":"","institution":"Federal Scientific Center for Feed Production and Agroecology named after V.R. Williams","correspondingAuthor":true,"prefix":"","firstName":"Anastasia","middleName":"Olegovna","lastName":"Shamustakimova","suffix":""},{"id":641544539,"identity":"d41b6cd7-dff2-4c72-b91d-e754db996b7b","order_by":1,"name":"Alina Aleksandrovna Ivanova","email":"","orcid":"","institution":"Federal Scientific Center for Feed Production and Agroecology named after V.R. Williams","correspondingAuthor":false,"prefix":"","firstName":"Alina","middleName":"Aleksandrovna","lastName":"Ivanova","suffix":""},{"id":641544540,"identity":"79c575db-3f8a-4c3f-9634-e5b0b00d34ab","order_by":2,"name":"Vladimir Aleksandrovich Dushkin","email":"","orcid":"","institution":"Federal Scientific Center for Feed Production and Agroecology named after V.R. Williams","correspondingAuthor":false,"prefix":"","firstName":"Vladimir","middleName":"Aleksandrovich","lastName":"Dushkin","suffix":""}],"badges":[],"createdAt":"2026-02-27 11:38:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8987527/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8987527/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":109436334,"identity":"d062fcef-e0ef-49f7-bcfa-85a5f60e13cb","added_by":"auto","created_at":"2026-05-18 06:14:50","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":575305,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eRepresentative phenotype of the selected F5 white clover breeding line\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8987527/v1/3c9bdee7caf36337e994b577.png"},{"id":109800223,"identity":"c9f2af72-d9e1-42b3-8047-2588ea4527c2","added_by":"auto","created_at":"2026-05-22 15:36:55","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":459654,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of low temperature on pigmentation in white clover seedlings.\u003c/strong\u003eLeft: normal green coloration. Right: stress-induced burgundy coloration.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8987527/v1/834b6fae8abc0995686139bb.png"},{"id":109759221,"identity":"009f22e9-9d94-4880-81bc-07eccbb6ea03","added_by":"auto","created_at":"2026-05-22 07:26:11","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":956214,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eLoss of floral pigmentation under low-light conditions. \u003c/strong\u003eInflorescences of selected red-flowered (RF) plants revert to white when transferred to a shaded greenhouse, demonstrating the light-dependence of anthocyanin accumulation\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8987527/v1/6508b8409687ea1cb7c25c72.png"},{"id":109759490,"identity":"ea94f151-6b38-4b41-95fe-750d6c077abe","added_by":"auto","created_at":"2026-05-22 07:27:12","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":204833,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePCR amplification of promoter regions from anthocyanin/flavonoid biosynthesis genes in white clover. \u003c/strong\u003eThe electrophoregram shows amplicons from red-flowered and white-flowered varieties. A clear size polymorphism is evident for the \u003cem\u003eF3’5’H\u003c/em\u003e gene (marked)\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8987527/v1/d127b865ad52f7a1462377ea.png"},{"id":109799283,"identity":"331254a2-319e-4be5-8511-3f15f1ef5365","added_by":"auto","created_at":"2026-05-22 15:27:08","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":958392,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eStructural polymorphism in the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eF3’5’H\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e promoter.\u003c/strong\u003eAlignment reveals length differences between RF and WF sequences caused by insertions specific to the RF plants.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8987527/v1/6ca83eee15641991ad3cc300.png"},{"id":109759181,"identity":"0159b68c-43aa-4228-b26b-f8d5fff5ce9d","added_by":"auto","created_at":"2026-05-22 07:26:00","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":78562,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePairwise percent identity matrix for the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eF3’5’H\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e promoter region.\u003c/strong\u003eComparisons are shown between sequences from white-flowered (WF) and red-flowered (RF) plants, the \u003cem\u003eT.occidentale\u003c/em\u003e subgenome (occi.sub), the whole \u003cem\u003eT.occidentale\u003c/em\u003e genome (occi.gen), and the \u003cem\u003eT. pallescens\u003c/em\u003e subgenome (pall.sub) of white clover.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-8987527/v1/afa95560da33f042fc6fcb7d.png"},{"id":109760162,"identity":"c9a08f69-8873-41f4-aecb-7b7e273573b4","added_by":"auto","created_at":"2026-05-22 07:28:14","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":231958,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eComparative cis-regulatory element (CRE) profiles of the \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eF3’5’H\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e promoter in red-flowered (left) and white-flowered (right) plants.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-8987527/v1/6d2b6ae759d20a7a5e586d34.png"},{"id":109436339,"identity":"b5065b4e-df17-4ead-b579-4eafd72d62f9","added_by":"auto","created_at":"2026-05-18 06:14:50","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":192364,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eValidation of the diagnostic SCAR marker 865_\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eF3’5’H\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eon an extended white clover panel: WF plants (1–16); RF plants (17–32); M—molecular weight marker (Step 100 Long, Biolabmix). The 865-bp amplicon (pink arrow) is present exclusively in all RF lines (17-32) and is absent from all WF plants and varieties tested.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-8987527/v1/338846337fefea1412c6b4e4.png"},{"id":109759489,"identity":"bd6c5ef7-6069-4f8b-8679-be5adf3e0718","added_by":"auto","created_at":"2026-05-22 07:27:12","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":737561,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFertile F1 hybrids obtained from reciprocal crosses between RF and WF \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eT. repens\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e plants.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-8987527/v1/8093b9cd6efb931ff7ef075a.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"Red-flowered white clover (T. repens L.): insights from morphobiological and genetic analysis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eWhite clover (\u003cem\u003eTrifolium repens\u003c/em\u003e L.) is an important component of pastures in the majority of temperate regions of the world, and its inclusion in grasslands leads to increased dry matter yield, improved feed value, and prolonged pasture use (Privalova 2004).\u003c/p\u003e \u003cp\u003eRecent genomic studies have established that white clover is an allopolyploid species derived from hybridization between \u003cem\u003eT. pallescens\u003c/em\u003e Schreb and \u003cem\u003eT. occidentale\u003c/em\u003e Combe (Griffiths et al. 2019; Fechete et al. 2024). At the same time, most varieties of \u003cem\u003eT. repens\u003c/em\u003e have white inflorescences, while \u003cem\u003eT. pallescens\u003c/em\u003e and some \u003cem\u003eT. occidentale\u003c/em\u003e plants have pink petals. There are several forms of white clover with pigmented inflorescences that are known in the literature. For example, such varieties as Dragon's Blood and Dark Dancer (Tashiro, 2009) have pink petals, while the plants described by Brubaker (Brewbaker 1962) and those found in Iowa in 1983 (Pederson and McLaughlin 1995) had highly pigmented flowers.\u003c/p\u003e \u003cp\u003ePlant pigmentation serves as a marker trait for botanical identification and classification by family, genus or species. Breeders analyze the color of flowers, leaves, stems and other plant parts to breed visually distinct varieties. Consequently, early botanical and agricultural studies in the 19th century naturally focused on plant pigments such as carotenoids and chlorophylls (Młodzińska et al. 2009).\u003c/p\u003e \u003cp\u003eLater, it was established that betalains and flavonoids were also responsible for pigmentation (Tanaka et al. 2010). Anthocyanins, a subclass of flavonoids, are widely studied in plant breeding programs targeting both ornamental and food crops due to their beneficial properties as secondary metabolites. Plants with high anthocyanin content have been shown to be less susceptible to ultraviolet radiation and more resistant to biotic and abiotic environmental factors (Guo et al. 2008; Winkel-Shirley 2001). Consuming foods rich in anthocyanins has a beneficial effect on heart diseases, hyperglycemia, and vision problems (Molina et al. 2023). A number of studies have also investigated their anticancer (Faria et al. 2010; Hui et al. 2010; Jing et al. 2008), antioxidant (Molina et al. 2019; Gon\u0026ccedil;alves et al. 2018), and antimicrobial (Bendokas et al. 2018; Chen et al. 2018) effect.\u003c/p\u003e \u003cp\u003ePrevious studies have established that anthocyanin biosynthesis involves a cascade of structural and regulatory genes (Sunil and Shetty 2022). Previously, a team from China (Zhang et al. 2018) analyzed the transcriptome of the white clover forms that produce brightly colored flowers upon light exposure and compared them to the same genotype grown in shaded conditions. They found these forms differ significantly in the expression of eight genes: \u003cem\u003eCHS, F3'H, DFR, ANS, LAR, UFGT, FLS, F3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e. Although the authors identified the key genes responsible for light-induced color change, their regulatory regions have remained unexplored. Literature reports indicate that deletions/insertions in the promoter regions of anthocyanin biosynthesis genes often alter their regulation, thereby affecting trait expression (Nishihara et al. 2014; Moreau et al. 2012; Sato et al. 2011).\u003c/p\u003e \u003cp\u003eIn this study, through a multi-year selection program, we developed white clover lines with stable, brightly colored inflorescences and conducted a comprehensive analysis of their key morphobiological traits and the underlying genetic mechanisms.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant material and growth conditions\u003c/h2\u003e \u003cp\u003ePlants were bred between 2021 and 2025 under greenhouse and field conditions. Seedlings were grown in 0.2 L containers. Elite plants were placed in 3 L containers. In field conditions, seedlings were transplanted in a grid pattern (checkrowed), with one plant per hole spaced at 0.5 m x 0.5 m.\u003c/p\u003e \u003cp\u003eThe plot\u0026rsquo;s soil was sod-podzolic; its humus content was 1.6%; hydrolyzable nitrogen 7.5%; potassium 15 mg/100 g of soil; phosphorus 25 mg/100 g of soil, and its soil pHKCl was 4.5.\u003c/p\u003e \u003cp\u003eFor initial PCR-analysis, we used five adult plants each of white-flowered (WF) and red-flowered (RF) clover, all grown in a greenhouse.\u003c/p\u003e \u003cp\u003eTo validate the marker, we analyzed an expanded panel including: 1) seed progeny from 16 RF lines, and (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e) 10 commercial varieties and 6 wild forms of WF clover (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eList of white clover accessions used for marker validation and the corresponding red-flowered selection lines\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNo.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eType\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAccession/Cultivar\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eOrigin\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eNo.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eRed-flowered lines\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCultivar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLugovik\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFWRC FPA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e21\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 6/6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWild\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e№ 762\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eUdmurtia\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 8/8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWild\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e№ 801\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBuryatia\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 29/1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCultivar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eVIK70\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFWRC FPA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWild\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e№ 232\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAltai, Ulagan pass, h\u0026thinsp;=\u0026thinsp;2000 m\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCultivar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eWilka\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNetherlands\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 217\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCultivar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eRitm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFWRC FPA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e27\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e8\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCultivar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLadino\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eNetherlands\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 17/8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e9\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWild\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e№ 598\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eArchangelsk region, Nothern Dvina River\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e29\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCultivar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eNanuk\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDenmark\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 15/3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWild\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAltai wild\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAltai\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 6/7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWild\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e№ 517\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eKarelia, lake Sandal\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e32\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 1/2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCultivar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMerlin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDenmark\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 16\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCultivar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOvcak\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCzechoslovak Republic\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e34\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCultivar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eBlanca\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eFrance\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCultivar\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eZapican\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eUruguay\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e36\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e№ 5/5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDNA extraction\u003c/h3\u003e\n\u003cp\u003eThe experiments were carried out on 30 mg of leaf tissue from the adult plants grown in the greenhouse. To genotype the expanded sample set (varieties and wild forms), we used DNA from seedlings grown on Petri dishes, with 30 seedlings pooled per sample. Total genomic DNA was extracted using a modified SDS method (Klimenko et al. 2021).\u003c/p\u003e\n\u003ch3\u003ePrimer design\u003c/h3\u003e\n\u003cp\u003eTo amplify the promoter regions of eight genes, specific primers were developed using contigs from a previous transcriptome study (Zhang et al. 2018). The position of the ATG codon was determined by aligning the contigs against the \u003cem\u003eT. pratense\u003c/em\u003e genome (version ARS_RC_1.1). Subsequently, the promoter sequence, together with a portion of the first exon\u0026rsquo;s coding region, was aligned to the white clover genome (versions UTM_Trep_v1.0 and AgR_To_v5). The obtained data were loaded into the PrimerQuest tool (Integrated DNA Technologies, \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.idtdna.com\u003c/span\u003e\u003cspan address=\"http://www.idtdna.com\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) to select primers according to the specified parameters.\u003c/p\u003e\n\u003ch3\u003ePCR-amplification\u003c/h3\u003e\n\u003cp\u003eThe 20 \u0026micro;L PCR reaction mixture contained: 3 \u0026micro;L of 10\u0026times; Taq Turbo buffer, 0.5 \u0026micro;L of 50\u0026times; dNTP mix, 0.4 \u0026micro;L of Taq DNA polymerase (5 U/\u0026micro;L), 1 \u0026micro;L of DNA template (30 ng), and 1 \u0026micro;L each of forward and reverse primers. All reagent volumes are given per reaction. The samples were amplified on a Bio-Rad T 1000 Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, USA) under the following conditions: initial denaturation for 3 minutes at 94\u0026deg;C; 35 cycles of 30 seconds at 94\u0026deg;C, 30 seconds at 56/59/62\u0026deg;C (depending on the primer pair), 1 minute at 72\u0026deg;C; final elongation at 72\u0026deg;C for 5 minutes. Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e shows the characteristics of the developed primers and the lengths of expected PCR products.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers designed to amplify the promoter region of flavonoid biosynthesis genes in white clover.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTm (\u0026deg;C)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAmplicon length (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eANS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTTTCTATTGCCTTAGTTCCCT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e747\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCACTCAAAGATAAGCTTTCAACTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eLAR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCAGATAATAAAGAGTGTCTAAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e681\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTAACCAGTTCCACCAAATAC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e61\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eF3\u0026rsquo;H\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACATTGATTGCACGCACTTTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e781\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTGAGAATGCAATGAGCAATAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eUFGT\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCACCGCTACTTACCATTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e800\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAACAGGGTGGCTTCCAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eDFR\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCTACCAATTGAGCTATGTTTATGG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e803\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACCAACCATGAACCAATGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eCHS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGATTGCTTAGTTGATTAACCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e59\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e761\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGTGTTGCTATATTTGTCCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eFLS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAAAGGAGATGTCACTCTTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e56\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e645\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGTTGTGGCATATGTAGTTAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e58\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e\u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTCGCATCATGTACTTCATAGGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e62\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e \u003cp\u003e776\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGAGAAGCACAAGAGTACAACTTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003ePCR results were detected by electrophoresis in 1.6% agarose gel at 50 V for 90 minutes. A 100 bp DNA ladder molecular marker (Thermo fisher scientific, USA) was used to assess the size of amplification product fragments. The fragments were visualized using a Gel Doc\u0026trade; XR+ imaging system (Bio-Rad, USA).\u003c/p\u003e\n\u003ch3\u003eDNA sequencing\u003c/h3\u003e\n\u003cp\u003eThe PCR products obtained were purified using \u0026lsquo;Clean-up Standard\u0026rsquo; columns (Evrogen, Russia), cloned into the pAL2-T vector following the manufacturer\u0026rsquo;s protocol, and Sanger-sequenced from both ends to determine the primary nucleotide sequence.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatic analysis\u003c/h2\u003e \u003cp\u003eThe obtained sequences were analyzed using the UGENE program (Okonechnikov et al. 2012). The PlantCare online application (Lescot et al. 2002) was utilized to study the cis-regulatory landscape. Sequence alignment and pairwise percent identity calculations were performed using the ClustalOmega software (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ebi.ac.uk/jdispatcher/msa/clustalo\u003c/span\u003e\u003cspan address=\"https://www.ebi.ac.uk/jdispatcher/msa/clustalo\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). To determine the expected PCR product lengths, BLAST analysis was performed against the subgenomes of white clover (version UTM_Trep_v1.0) and the genome of \u003cem\u003eT.occidentale\u003c/em\u003e (version drTriOcci1.hap1.1) when analyzing flavonoid bisynthesis gene regions.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eThe breeding program commenced in 2021 with two plants selected from an experimental plot in a breeding nursery at Federal Williams Research Center of Forage Production and Agroecology. These plants were F3 hybrids of the cross \u0026ldquo;Atolai (Latvia) x Pechorsky (a wild form from Russia)\u0026rdquo; and were notable for their pale pink inflorescence color.\u003c/p\u003e\n\u003ch3\u003eMulti-year selection for inflorescence color\u003c/h3\u003e\n\u003cp\u003eIn 2022, the first generation was evaluated in a soil greenhouse. Seedlings were transplanted into the ground at a spacing of 0.5 x 0.5 m. Among the 100 plants evaluated, 95 (95%) had white flowers, 3 (3%) pink, and 2 (2%) bright pink flowers. The colored genotypes were transplanted into 3-L containers for further hybridization.\u003c/p\u003e \u003cp\u003eIn 2023, 613 F\u003csub\u003e2\u003c/sub\u003e generation plants were potted in 0.2 L containers. Among them, 200 plants (32.63%) had white flowers, 364 (59.38%) were pink and 49 (7.99%) were bright pink. Of these, 312 colored plants were transplanted to grow in the field; the distance between plants was 1 x 1 m. Based on the morphological characteristics, 25 elite plants were selected, potted in a greenhouse, and manually pollinated.\u003c/p\u003e \u003cp\u003eIn 2024, the inflorescence colors of 536 F\u003csub\u003e3\u003c/sub\u003e plants grown in 0.2 L containers were evaluated. Twenty-one plants (3.92%) bloomed white, 471 plants (87.87%) pink, and 44 plants (8.21%) bright pink. Of these, 100 plants with colored inflorescences were planted in the field at a distance of 1 x 1 m. Based on the morphobiological characteristics, 17 elite plants were selected, their stolon parts were cut off for vegetative reproduction in a soil greenhouse.\u003c/p\u003e \u003cp\u003eIn 2025, 960 F\u003csub\u003e4\u003c/sub\u003e genotypes were planted in the field on a highly acidic soil (pH\u0026thinsp;=\u0026thinsp;4.5). The seedlings were planted at a distance of 0.5 m x 0.5 m. Among them, 4 plants (0.4%) were white, 906 (94.4%) were pink, and 50 (5.2%) had bright pink inflorescences. Seeds were obtained after negative selection. Stolons from elite plants of rich pink color were planted in a soil greenhouse.\u003c/p\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eComparative analysis of morphological and productive traits\u003c/h2\u003e \u003cp\u003eComparative analysis of the morphological characteristics showed that the RF clover sample was less productive than the VIK 70 standard (see Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAgronomically important traits of the F\u003csub\u003e3\u003c/sub\u003e white clover breeding line (year 2024).\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTrait\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVIK 70 standart\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF\u003csub\u003e3\u003c/sub\u003e colored-flowered line\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003e% of standart\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePlant diameter, cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e77,00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e47,69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e61,94\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStolon diameter, cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0,26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0,24\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e92,31\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLeaf petiole height, cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e14,58\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e11,08\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e76,00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLeaf petiole diameter, cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0,16\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0,15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e93,75\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLeaf blade length, cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2,99\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2,15\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e71,91\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLeaf blade width, cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2,30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1,94\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e84,35\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePeduncle height, cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e24,17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e18,64\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e77,12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePeduncle diameter, cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0,22\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0,19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e86,36\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInflorescence length, cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2,28\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1,83\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e80,26\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eInflorescence diameter, cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2,48\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2,33\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e93,95\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFlower length, cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0,98\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0,95\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e96,94\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFlower diameter, cm\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0,50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0,47\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e94,00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber of flower heads per plant\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e98,00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e59,00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e60,20\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGreen mass yield, g/plant\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e180,00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e95,40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e53,00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eDry matter yield, g/plant\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e32,50\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e15,30\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e47,08\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCrude protein content, %\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e20,00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e18,00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e90,00\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNumber of florets per head\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e88,40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e80,00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e90,50\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSeed yield per plant, g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3,45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1,90\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e55,07\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1000-seed weight, g\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e0,55\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0,60\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e109,09\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWinter hardiness, %\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e90,00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e95,00\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eThe plant belongs to the \u003cem\u003ehollandiсum\u003c/em\u003e variety. It has a semi-erect growth habit. The leaves have a distinct white mark and exhibit a color gradient from blue-green to burgundy. The flower heads are deep pink, and flowering continues until late autumn (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eLight and cold-induced color changes\u003c/h2\u003e \u003cp\u003eUnder low-temperature stress, the vegetative biomass of the plant accumulated anthocyanins, turning burgundy in color (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e)\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003ePlants that did not change the color of their vegetative mass (green) subsequently bloomed with white inflorescences. Thus, these plants were discarded early in development.\u003c/p\u003e \u003cp\u003eWe also found that the intensity of coloration of both green mass and inflorescences was regulated by exposure to light, resulting in higher brightness of pink coloration under field conditions. However, when the selected RF plants were placed in a shaded greenhouse, the inflorescence color changed to white (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePCR screening for polymorphisms in candidate gene promoters\u003c/h2\u003e \u003cp\u003ePrompted by our observations and prior reports of light-induced anthocyanin accumulation, we developed primers for amplification and further study of the promoter regions of eight candidate genes with differential expression. PCR analysis using eight primer pairs detected significant differences in amplicon length for the \u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e gene between the RF and WF samples (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003ePCR analysis revealed a clear polymorphism (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). DNA from five WF varieties yielded the expected\u0026thinsp;~\u0026thinsp;750 bp product, whereas DNA from five RF plants produced a distinct\u0026thinsp;~\u0026thinsp;850 bp amplicon.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eStructural and phylogenetic analysis of the F3\u0026rsquo;5\u0026rsquo;H promoter\u003c/h2\u003e \u003cp\u003eSequence analysis of the polymorphic \u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e amplicon revealed that the length of the PCR product of the RF varieties was 865 bp, while that of WF was 775 bp. Pairwise alignment of the sequences identified several insertions at distinct positions within the \u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e promoter region in RF varieties (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e)\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe observed high level of polymorphism in the \u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e promoter region between RF and WF plants is atypical for allelic variants within a species. Therefore, we identified and aligned the promoter region sequences of \u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e gene from: the white clover subgenomes (\u003cem\u003eT. occidentale\u003c/em\u003e and \u003cem\u003eT. pallescens\u003c/em\u003e), the genome of \u003cem\u003eT. occidentale\u003c/em\u003e species, and our sequenced RF and WF samples. Figure\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e shows the identity percentages obtained after pairwise alignment of the sequences.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e, pairwise identity analysis revealed the highest similarity (99.74%) between the WF and occi.sub sequences. In contrast, the RF sequence showed 99.08% identity to the \u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e gene from the whole genome of \u003cem\u003eT. occidentale\u003c/em\u003e (occi.gen). Notably, the identity between this RF sequence and the \u003cem\u003eT. occidentale\u003c/em\u003e subgenome within white clover was substantially lower (81.24%).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eCis-element landscape. Light and cold-responsive motifs\u003c/h2\u003e \u003cp\u003eThe resulting sequences were then analyzed for the presence of CREs using the PlantCARE program (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eBioinformatic analysis of the \u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e promoter region revealed distinct cis-regulatory element (CRE) profiles between RF and WF plants (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). In total, we identified 20 different groups of CREs across both sequences. The RF promoter contained 18 of these groups, while the WF promoter contained 15. Thirteen groups (65%) were common to both promoters. Each promoter also possessed unique CRE groups. The WF promoter harbored two specific elements: AuxRR-core (involved in auxin responsiveness) and STRE (function not yet defined in plants).\u003c/p\u003e \u003cp\u003eIn contrast, the RF promoter possessed six unique CRE groups: AE-box, ERE, TATA, TC-rich repeats and TCT-motif. Of these, the functions of ERE and TATA remain uncharacterized in this context. TC-rich repeats are known cis-acting elements involved in defense and stress responsiveness. Critically, the remaining two motifs \u0026ndash; AE-box and TCT-motif \u0026ndash; are associated with light responsiveness. Their positions and characteristics within the RF promoter are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eLocation of cold- and light-inducible CREs in the promoter region of the \u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e gene\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colspan=\"2\" nameend=\"c2\" namest=\"c1\"\u003e \u003cp\u003eRF\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colspan=\"3\" nameend=\"c5\" namest=\"c3\"\u003e \u003cp\u003eWF\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName of cis-element\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePosition and strand\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e \u003cp\u003eName of cis-element\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ePosition and strand\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e \u003cp\u003eLight-responsive cis-elements\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAE-box\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e404+\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" morerows=\"2\" nameend=\"c4\" namest=\"c3\" rowspan=\"3\"\u003e \u003cp\u003eBox 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\" morerows=\"2\" rowspan=\"3\"\u003e \u003cp\u003e404-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBox 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e286+,774-,479-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTCT-motif\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e102-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colspan=\"5\" nameend=\"c5\" namest=\"c1\"\u003e \u003cp\u003eCold-responsive cis-elements\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLTR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e523-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLTR\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colspan=\"2\" nameend=\"c5\" namest=\"c4\"\u003e \u003cp\u003e448-\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAs summarized in Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e, the RF \u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e promoter harbored three types of light-responsive CREs (AE-box, Box 4 and TCT-motif), whereas the WF promoter contained only a single Box 4 element. This striking disparity in the repertoire of photoresponsive elements (three distinct motifs in RF versus one in WF) provides a plausible cis-regulatory explanation for the light-induced anthocyanin accumulation specific to RF plants and its absence in WF plants.\u003c/p\u003e \u003cp\u003eAs for changes in anthocyanin accumulation in response to cold exposure, we cannot draw any conclusions here, since both regions contain the low-temperature-responsive (LTR) element. This suggests that the expression of these genes is controlled by transcription factors of the cold-inducible regulon.\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n \u003ch2\u003eValidation of SCAR-marker 865_F3\u0026rsquo;5\u0026rsquo;H\u003c/h2\u003e\n \u003cp\u003eTo validate the specificity and uniqueness of our newly developed DNA marker (provisionally called 865_\u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e), we expanded the analysis to include an extended panel comprising wild accessions and commercial varieties of white clover (Fig. \u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e\n \u003cp\u003eAs can be seen from the gel image, the 865-bp band was not detected in the DNA analysis of any of the three Russian and seven foreign varieties, as well as six wild forms of white clover. At the same time, DNA analysis of all 16 RF progeny pools showed the presence of this band. Notably, the 775-bp PCR product was present in all samples of varieties and wild forms of the white clover we analyzed, regardless of their country of origin. This band was also present in DNA samples from some progeny of the brightly colored forms, indicating segregation at this locus and providing evidence for their hybrid origin.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n \u003ch2\u003eT.repens or T. occidentale?\u003c/h2\u003e\n \u003cp\u003eIn order to exclude the belonging of the brightly colored plants to the \u003cem\u003eT. occidentale\u003c/em\u003e species, we also performed \u003cem\u003ein silico\u003c/em\u003e analysis and aligned the sequences of all eight promoter regions of flavonoid synthesis genes to the \u003cem\u003eT. occidentale\u003c/em\u003e genome and white clover subgenomes. The analysis showed that four genes can be used to hypothesize the species affiliation of brightly colored plants (Table \u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e\n \u003ccaption language=\"En\"\u003e\n \u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\n \u003cdiv class=\"CaptionContent\"\u003e\n \u003cp\u003e\u003cem\u003eIn silico\u003c/em\u003e and experimental PCR amplicon lengths for \u003cem\u003eCHS\u003c/em\u003e, \u003cem\u003eANS\u003c/em\u003e, \u003cem\u003eUFGT\u003c/em\u003e, and \u003cem\u003eF3\u0026apos;5\u0026apos;H\u003c/em\u003e\u003c/p\u003e\n \u003c/div\u003e\n \u003c/caption\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colname=\"c1\" morerows=\"1\" rowspan=\"2\"\u003e\n \u003cp\u003eGenes\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\n \u003cp\u003eGenome\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eT.repens\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c4\" morerows=\"1\" rowspan=\"2\"\u003e\n \u003cp\u003eGenome\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eT. occidentale\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c5\" morerows=\"1\" rowspan=\"2\"\u003e\n \u003cp\u003eRF\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c6\" morerows=\"1\" rowspan=\"2\"\u003e\n \u003cp\u003eWF\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003eSubgenome\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eT. pallescens\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003eSubgenome\u003c/p\u003e\n \u003cp\u003e\u003cem\u003eT. occidentale\u003c/em\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colspan=\"3\" nameend=\"c4\" namest=\"c2\"\u003e\n \u003cp\u003ePredicted amplicon length (bp)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\n \u003cp\u003eExperimental amplicon length (bp)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\n \u003cp\u003e\u003cbr\u003e\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cem\u003eCHS\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e749\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003eNo product\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003eNo product\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003e749\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c6\"\u003e\n \u003cp\u003e749\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cem\u003eANS\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e792\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e747\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003e772\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003e747, 772\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c6\"\u003e\n \u003cp\u003e747\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cem\u003eUFGT\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003e800\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e1278\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003e559\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003e800\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c6\"\u003e\n \u003cp\u003e800\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\" colname=\"c1\"\u003e\n \u003cp\u003e\u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c2\"\u003e\n \u003cp\u003eNo product\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c3\"\u003e\n \u003cp\u003e776\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c4\"\u003e\n \u003cp\u003e866\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c5\"\u003e\n \u003cp\u003e865\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colname=\"c6\"\u003e\n \u003cp\u003e775\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003eIn the case of \u003cem\u003eCHS\u003c/em\u003e, only the reverse primer showed complete homology to the promoter region of the \u003cem\u003eT. occidentale\u003c/em\u003e genome and subgenome; the forward primer exhibited mismatches. At the same time, both RF and WF samples produced a\u0026thinsp;~\u0026thinsp;750 bp amplicon corresponding to a \u003cem\u003eCHS\u003c/em\u003e gene copy originating from the \u003cem\u003eT. pallescens\u003c/em\u003e subgenome. The predicted amplicon lengths for \u003cem\u003eANS\u003c/em\u003e and \u003cem\u003eUFGT\u003c/em\u003e varied by 45\u0026ndash;241 bp depending on the template (\u003cem\u003eT.occidentale\u003c/em\u003e genome vs. subgenome), making these polymorphism easily detectable by gel electrophoresis. The most pronounced length polymorphism was observed for the \u003cem\u003eUFGT\u003c/em\u003e gene: 800 bp for the \u003cem\u003eT. pallescens\u003c/em\u003e subgenome, 1278 bp for the \u003cem\u003eT. occidentale\u003c/em\u003e subgenome, and 559 bp for its counterpart from the \u003cem\u003eT. occidentale\u003c/em\u003e species. While the 800 bp \u003cem\u003eUFGT\u003c/em\u003e amplicon present in RF and WF plants was identified as the \u003cem\u003eT. pallescens\u003c/em\u003e subgenome copy (Table \u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e), the \u003cem\u003eANS\u003c/em\u003e promoter region exhibited unexpected polymorphism within the RF group. Hence, RF plants 1 and 4 possessed the \u003cem\u003eT. occidentale\u003c/em\u003e genome copy of \u003cem\u003eANS\u003c/em\u003e, while plants 2 and 3 carried the subgenome variant. In contrast, amplification of the \u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e promoter from the \u003cem\u003eT. pallescens\u003c/em\u003e subgenome was precluded by multiple primer-template mismatches.\u003c/p\u003e\n \u003cp\u003eThe brightly colored plants are therefore not \u003cem\u003eT. occidentale\u003c/em\u003e themselves, but contain introgressed \u003cem\u003eANS and F3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e alleles of \u003cem\u003eT. occidentale origin.\u003c/em\u003e Consistent with this, crosses between RF and WF plants produced fertile F1 hybrids (Fig. \u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e), providing independent evidence for their close genomic relationship.\u003c/p\u003e\n \u003cp\u003eDirect crosses between diploid \u003cem\u003eT. occidentale\u003c/em\u003e (2n\u0026thinsp;=\u0026thinsp;16) and tetraploid \u003cem\u003eT. repens\u003c/em\u003e (2n\u0026thinsp;=\u0026thinsp;32) are typically unsuccessful due to chromosome number mismatch, resulting in seed failure. Pederson and McLaughlin (1995) likewise reported successful hybridization and backcrossing between RF and WF biotypes of the cultivar \u0026lsquo;Tilman\u0026rsquo;. Several studies have since reported successful interspecific hybridization between \u003cem\u003eT. occidentale\u003c/em\u003e and \u003cem\u003eT. repens\u003c/em\u003e aimed at introgressing economically valuable traits into modern white clover cultivars (Gibson and Beinhart 1969; Hussain et al. 2016; Hussain \u0026amp; Williams 2016; Chen and Gibson 1970; Chen and Gibson 1972). The usual approach involved colchicines treatment to double the chromosome number of \u003cem\u003eT. occidentale\u003c/em\u003e (from 2n\u0026thinsp;=\u0026thinsp;2x\u0026thinsp;=\u0026thinsp;16 to 2n\u0026thinsp;=\u0026thinsp;4x\u0026thinsp;=\u0026thinsp;32), rendering it compatible with tetraploid \u003cem\u003eT. repens\u003c/em\u003e for subsequent hybridization. According to Hussain and Williams (2016), such hybrids were fertile. The presence of the genomes \u0026ndash; one from colchicines treated \u003cem\u003eT. occidentale\u003c/em\u003e and the two native subgenomes of \u003cem\u003eT. repens\u003c/em\u003e (\u003cem\u003eT. occidentale\u003c/em\u003e and \u003cem\u003eT. pallescens\u003c/em\u003e) \u0026ndash; allowed for multiple chromosome pairing configurations during meiosis. Thus, the brightly colored plants described here represent hybrids between \u003cem\u003eT. repens\u003c/em\u003e and \u003cem\u003eT. occidentale\u003c/em\u003e. The observed polymorphism in the \u003cem\u003eANS\u003c/em\u003e promoter amplification, together with the presence of the \u003cem\u003eT. occidentale\u003c/em\u003e specific \u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e allele, points to a recent recombination event between homeologous chromosomes of the ancestral \u003cem\u003eT. occidentale\u003c/em\u003e donor and its modern counterpart within the \u003cem\u003eT. repens\u003c/em\u003e genome.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study of white clover (\u003cem\u003eTrifolium repens\u003c/em\u003e) led to the development of breeding lines with stable, atypical bright pink inflorescences and provided a genetic characterization of this trait. The identified molecular markers, particularly the SCAR marker 865 \u003cem\u003eF3\u0026rsquo;5\u0026rsquo;H\u003c/em\u003e, are direct outcomes of this work. The work further demonstrates that comparative analysis of promoter sequences of flavonoid biosynthesis genes helps identify hybrid forms and detect haplotype-specific mutations.\u003c/p\u003e \u003cp\u003eConsequently, this research directly contributed to the breeding of the first Russian white clover cultivar with pink petals, \u0026lsquo;Rubin\u0026rsquo;.\u003c/p\u003e"},{"header":"Statements \u0026 Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank V.L. Korovina and the Department of Genetic Resources for supplying seeds of white clover varieties with standard inflorescence color.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe research was performed within the framework of the Project No. FGGW-2025-0001 funded by the Ministry of Science and Higher Education of the Russian Federation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eStudy conception, SAO, IAA. Breeding and morphobiological analysis, IAA. DNA extraction, PCR and electrophoresis, DVA, SAO. Bioinfornatic analysis, primer design and visualization, SA. Original article preparation, SAO, IAA. Review and editing, SAO, IAA, DVA.\u0026nbsp;\u003c/p\u003e\n\u003ch4\u003eData Availability\u003c/h4\u003e\n\u003cp\u003eAll data generated or analysed during this study are included in this published article.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eBendokas V, \u0026Scaron;arkinas A, Jasinauskien\u0026euml; D, Anisimovien\u0026euml;-Haimi S, Stanys V, \u0026Scaron;ik\u0026scaron;nianas T (2018) Antimicrobial activity of berries extracts of four Ribes species, their phenolic content and anthocyanin composition. Folia Hortic 30:249\u0026ndash;257. https://doi.org/10.2478/fhort-2018-0021 \u0026nbsp;\u003c/li\u003e\n \u003cli\u003eBrewbaker JL (1962) Cyanidin-red white clover - duplicate recessive mutant in \u003cem\u003eTrifolium repens\u003c/em\u003e L. J Hered 53:163-167.\u003c/li\u003e\n \u003cli\u003eChen CC, Gibson PB (1970) Meiosis in Two Species of Trifolium and Their Hybrids. Crop Sci 10:188-189.\u003c/li\u003e\n \u003cli\u003eChen CC, Gibson PB (1972) Barriers to hybridization of \u003cem\u003eTrifolium repens\u003c/em\u003e with related species. Can J Genet Cytol 14:381-389.\u003c/li\u003e\n \u003cli\u003eChen H, Yu W, Chen G, Meng S, Xiang Z, He N (2018) Antinociceptive and antibacterial properties of anthocyanins and flavonols from fruits of black and non-black mulberries. Molecules 23:4. https://doi.org/10.3390/molecules23010004\u003c/li\u003e\n \u003cli\u003eFaria A, Pestana D, Teixeira D, De Freitas V, Mateus N, Calhau C (2010) Blueberry anthocyanins and pyruvic acid adducts: Anticancer properties in breast cancer cell lines. Phytother Res 24:1862\u0026ndash;1869. https://doi.org/10.1002/ptr.3213\u003c/li\u003e\n \u003cli\u003eFechete LI, Larking AC, Heslop A, Hannaford R, Anderson CB, Hong W, Griffiths AG (2024) Harnessing cold adaptation for postglacial colonisation: Galactinol synthase expression and raffinose accumulation in a polyploid and its progenitors. Plant Cell Environ. https://doi.org/10.1111/pce.15009\u003c/li\u003e\n \u003cli\u003eGibson PB, Beinhart G (1969) Hybridization of \u003cem\u003eTrifolium occidentale\u003c/em\u003e with two other species of clover. J Hered 60:93\u0026ndash;96.\u003c/li\u003e\n \u003cli\u003eGon\u0026ccedil;alves AC, Rodrigues M, Santos AO, Alves G, Silva LR (2018) Antioxidant status, antidiabetic properties and effects on Caco-2 cells of colored and non-colored enriched extracts of sweet cherry fruits. Nutrients 10:1688. https://doi.org/10.3390/nu10111688\u003c/li\u003e\n \u003cli\u003eGriffiths AG, Moraga R, Tausen M, Gupta V, Bilton TP, Campbell MA, Andersen SU (2019) Breaking free: the genomics of allopolyploidy-facilitated niche expansion in white clover. Plant Cell 31:1466-1487. https://doi.org/10.1105/tpc.18.00606\u003c/li\u003e\n \u003cli\u003eGuo J, Han W, Wang M (2008) Ultraviolet and environmental stresses involved in the induction and regulation of anthocyanin biosynthesis: a review. Afr J Biotechnol 7:4966-4972. https://doi.org/10.4314/ajb.v7i25.59709\u003c/li\u003e\n \u003cli\u003eHui C, Bin Y, Xiaoping Y, Long Y, Chunye C, Mantian M, Wenhua L (2010) Anticancer activities of an anthocyanin-rich extract from black rice against breast cancer cells in vitro and in vivo. Nutr Cancer 62:1128\u0026ndash;1136. https://doi.org/10.1080/01635581.2010.494821\u003c/li\u003e\n \u003cli\u003eHussain SW, Williams WM (2016) Chromosome pairing and fertility of interspecific hybrids between \u003cem\u003eTrifolium repens\u003c/em\u003e L. and \u003cem\u003eT. occidentale\u003c/em\u003e Coombe. Plant Breed 135:239-245.\u0026nbsp;https://doi.org/10.1111/pbr.12344\u003c/li\u003e\n \u003cli\u003eHussain SW, Verry IM, Williams WM (2016) Development of breeding populations from interspecific hybrids between \u003cem\u003eTrifolium repens\u003c/em\u003e L. and \u003cem\u003eT. occidentale\u003c/em\u003e Coombe. Plant Breed 135:118\u0026ndash;123. https://doi.org/10.1111/pbr.12326\u003c/li\u003e\n \u003cli\u003eJing P, Bomser JA, Schwartz SJ, He J, Magnuson BA, Giusti MM (2008) Structure-function relationships of anthocyanins from various anthocyanin-rich extracts on the inhibition of colon cancer cell growth. J Agric Food Chem 56:9391\u0026ndash;9398. https://doi.org/10.1021/jf8005917\u003c/li\u003e\n \u003cli\u003eKlimenko I, Antonov A, Dushkin V, Shamustakimova A, Mavlyutov Yu (2021). Efficient method of DNA isolation from bulking samples of seedlings. Adapt Fodder Prod. 3: 29\u0026ndash;48.\u0026nbsp;(in Russia) https://doi.org/10.33814/AFP-2222-5366-2021-3-29-48\u003c/li\u003e\n \u003cli\u003eLescot M, D\u0026eacute;hais P, Thijs G, Marchal K, Moreau Y, Van de Peer Y, Rombauts S (2002) PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res 30:325\u0026ndash;327. https://doi.org/10.1093/nar/30.1.325\u003c/li\u003e\n \u003cli\u003eMłodzińska E (2009) Survey of plant pigments: molecular and environmental determinants of plant colors. Acta Biol Cracov Bot 51:7-16.\u003c/li\u003e\n \u003cli\u003eMolina AK, Corr\u0026ecirc;a RC, Prieto MA, Pereira C, Barros L (2023) Bioactive natural pigments\u0026rsquo; extraction, isolation, and stability in food applications. Molecules 28:1200.\u0026nbsp;https://doi.org/10.3390/molecules28031200.\u003c/li\u003e\n \u003cli\u003eMolina AK, Vega EN, Pereira C, Dias MI, Heleno SA, Rodrigues P, Soković M (2019) Promising antioxidant and antimicrobial food colourants from Lonicera caerulea L. var. Kamtschatica. Antioxidants 8:394.\u0026nbsp;https://doi.org/10.3390/antiox8090394.\u003c/li\u003e\n \u003cli\u003eMoreau C, Ambrose MJ, Turner L, Hill L, Ellis TN, Hofer JM (2012) The b gene of pea encodes a defective flavonoid 3\u0026prime;, 5\u0026prime;-hydroxylase, and confers pink flower color. Plant Physiol 159:759-768.\u0026nbsp;https://doi.org/10.1104/pp.112.197517.\u003c/li\u003e\n \u003cli\u003eNishihara M, Yamada E, Saito M, Fujita K, Takahashi H, Nakatsuka T (2014) Molecular characterization of mutations in white-flowered torenia plants. BMC Plant Biol 14:86.\u0026nbsp;https://doi.org/10.1186/1471-2229-14-86.\u003c/li\u003e\n \u003cli\u003eOkonechnikov K, Golosova O, Fursov M, Ugene Team (2012) Unipro UGENE: a unified bioinformatics toolkit. Bioinformatics 28:1166-1167.\u0026nbsp;https://doi.org/10.1093/bioinformatics/bts091\u003c/li\u003e\n \u003cli\u003ePederson GA, McLaughlin MR (1995) Registration of MSRed F1 red-flowered white clover germplasm. Crop Sci 35:596.\u003c/li\u003e\n \u003cli\u003ePrivalova KN (2004) Produktivnost\u0026apos; dolgoletnikh travostoev s kleverom polzuchim [Productivity of long-term grass stands with white clover]. Kormoproizvodstvo 2:5-7.\u003c/li\u003e\n \u003cli\u003eSato M, Kawabe T, Hosokawa M, Tatsuzawa F, Doi M (2011) Tissue culture-induced flower-color changes in Saintpaulia caused by excision of the transposon inserted in the flavonoid 3\u0026prime;, 5\u0026prime; hydroxylase (F3\u0026prime; 5\u0026prime; H) promoter. Plant Cell Rep 30:929-939. https://doi.org/10.1007/s00299-011-1016-z\u003c/li\u003e\n \u003cli\u003eSunil L, Shetty NP (2022) Biosynthesis and regulation of anthocyanin pathway genes. Appl Microbiol Biotechnol 106:1783-1798.\u0026nbsp;https://doi.org/10.1007/s00253-022-11835-z\u003c/li\u003e\n \u003cli\u003eTanaka Y, Sasaki N, Ohmiya A (2008) Biosynthesis of plant pigments: anthocyanins, betalains and carotenoids. Plant J 54:733\u0026ndash;749.\u0026nbsp;https://doi.org/10.1111/j.1365-313X.2008.03447.x\u003c/li\u003e\n \u003cli\u003eTashiro RM (2009) From the field to the flowerbed to the lab: ornamental white clover breeding and leaf trait mapping. PhD Dissertation, University of Georgia.\u003c/li\u003e\n \u003cli\u003eWinkel-Shirley B (2001) Flavonoid biosynthesis. A colorful model for genetics, biochemistry, cell biology, and biotechnology. Plant Physiol 126:485\u0026ndash;493.\u0026nbsp;https://doi.org/10.1104/pp.126.2.485\u003c/li\u003e\n \u003cli\u003eZhang H, Tian H, Chen M, Xiong J, Cai H, Liu Y (2018) Transcriptome analysis reveals potential genes involved in flower pigmentation in a red-flowered mutant of white clover (\u003cem\u003eTrifolium repens\u003c/em\u003e L.). Genomics 110:191-200. https://doi.org/10.1016/j.ygeno.2017.09.011\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":false,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"plant-molecular-biology-reporter","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pmbr","sideBox":"Learn more about [Plant Molecular Biology Reporter](http://link.springer.com/journal/11105)","snPcode":"11105","submissionUrl":"https://submission.nature.com/new-submission/11105/3","title":"Plant Molecular Biology Reporter","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"T. repens, T. occidentale, T. pallescens, hybrid, subgenome, flower pigmentation","lastPublishedDoi":"10.21203/rs.3.rs-8987527/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8987527/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eA five year breeding program (2021-2025) successfully established white clover (\u003cem\u003eTrifolium repens \u003c/em\u003eL.)\u003cem\u003e \u003c/em\u003elines with stable, bright pink inflorescences, achieving a frequency up to 94.4% in the F4 generation.\u003c/p\u003e\n\u003cp\u003eMolecular genetic analysis identified a polymorphism in the promoter region of the \u003cem\u003eF3’5’H\u003c/em\u003e gene in red flowered (RF) plants. Bioinformatic analysis of these contrasting promoter regions revealed significant differences in the composition of cis-regulatory elements (CREs) including light-sensitive motifs (AE-box, TCT-motif), which apparently explains the light-dependent expression of anthocyanins.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIn silico\u003c/em\u003e analysis ruled out that the studied plants belong to \u003cem\u003eT. occidentale \u003c/em\u003eCombe and confirmed their hybrid nature. This conclusion was based on the presence of sequences from flavonoid biosynthesis genes characteristic of the modern form of \u003cem\u003eT. occidentale\u003c/em\u003e along with the \u003cem\u003eT. pallescens \u003c/em\u003eSchreb subgenome. The specific SCAR marker 865_\u003cem\u003eF3’5’H\u003c/em\u003e can reliably identify RF plants and detect recent hybridization events between \u003cem\u003eTrifolium repens\u003c/em\u003e and \u003cem\u003eT. occidentale\u003c/em\u003e.\u003c/p\u003e","manuscriptTitle":"Red-flowered white clover (T. repens L.): insights from morphobiological and genetic analysis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-05-18 06:14:45","doi":"10.21203/rs.3.rs-8987527/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2026-05-21T08:59:45+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-18T10:01:18+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"319345787974612563201459326066553234394","date":"2026-05-09T00:31:31+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"254954890556666133566280106406586870216","date":"2026-05-08T00:29:17+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-05-07T14:05:09+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-03-06T02:13:55+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-03-06T02:12:37+00:00","index":"","fulltext":""},{"type":"submitted","content":"Plant Molecular Biology Reporter","date":"2026-02-27T11:23:47+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"plant-molecular-biology-reporter","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pmbr","sideBox":"Learn more about [Plant Molecular Biology Reporter](http://link.springer.com/journal/11105)","snPcode":"11105","submissionUrl":"https://submission.nature.com/new-submission/11105/3","title":"Plant Molecular Biology Reporter","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"6bfb2e42-1ddc-4798-8f66-02c2915af3a3","owner":[],"postedDate":"May 18th, 2026","published":true,"recentEditorialEvents":[{"type":"editorInvitedReview","content":"","date":"2026-05-21T08:59:45+00:00","index":15,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-05-18T10:01:18+00:00","index":14,"fulltext":""},{"type":"reviewerAgreed","content":"319345787974612563201459326066553234394","date":"2026-05-09T00:31:31+00:00","index":13,"fulltext":""},{"type":"reviewerAgreed","content":"254954890556666133566280106406586870216","date":"2026-05-08T00:29:17+00:00","index":11,"fulltext":""},{"type":"reviewersInvited","content":"5","date":"2026-05-07T14:05:09+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-18T06:14:45+00:00","versionOfRecord":[],"versionCreatedAt":"2026-05-18 06:14:45","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8987527","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8987527","identity":"rs-8987527","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}