Detection of Toxoplasma Gondii in the Brain of Pet Birds by Seizures with Loop-Mediated Isothermal Amplification (LAMP)

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract BACKGROUND This study seeks to close this divide by assessing the occurrence of Toxoplasma gondii (T. gondii) in the brain tissues of pet birds displaying neurological symptoms, utilizing Nested Polymerase Chain Reaction (PCR) and Loop-mediated Isothermal Amplification (LAMP) methods. Furthermore, it aims to evaluate and contrast the sensitivity and specificity of different diagnostic procedures. Seventy bird samples, consisting of 50 sick and 20 asymptomatic samples, were assessed using various methods. Brain tissue DNA was isolated and then analyzed using nested PCR and LAMP assays targeting the T. gondii B1 gene and RE gene. Sensitivity and specificity assessments were conducted, and statistical evaluations were made using SPSS software. RESULTS No T. gondii cysts were detected in the smear preparations. T. gondii DNA was discovered in 6% of the sick birds using nested PCR, while LAMP identified T. gondii DNA in 8% of these individuals. Both techniques exhibited a high level of specificity; however, LAMP demonstrated higher sensitivity and faster processing times than nested PCR. CONCLUSION The study indicates that LAMP is an efficient diagnostic method for quickly and accurately detecting T. gondii in pet birds while also being cost-effective. The results emphasize the significance of molecular diagnostics in promptly identifying and treating toxoplasmosis in birds, which enhances our comprehension and regulation of the disease. To improve the surveillance and preventative strategies against T. gondii infections, it is advisable to do additional studies using more extensive and diversified bird populations.
Full text 93,127 characters · extracted from preprint-html · click to expand
Detection of Toxoplasma Gondii in the Brain of Pet Birds by Seizures with Loop-Mediated Isothermal Amplification (LAMP) | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Detection of Toxoplasma Gondii in the Brain of Pet Birds by Seizures with Loop-Mediated Isothermal Amplification (LAMP) Mohammad Neshatpour Esfahani, Majid Gholami-Ahangaran, William J Sullivan Jr This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5008387/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 24 Jan, 2025 Read the published version in Acta Parasitologica → Version 1 posted 7 You are reading this latest preprint version Abstract BACKGROUND This study seeks to close this divide by assessing the occurrence of Toxoplasma gondii ( T. gondii ) in the brain tissues of pet birds displaying neurological symptoms, utilizing Nested Polymerase Chain Reaction (PCR) and Loop-mediated Isothermal Amplification (LAMP) methods. Furthermore, it aims to evaluate and contrast the sensitivity and specificity of different diagnostic procedures. Seventy bird samples, consisting of 50 sick and 20 asymptomatic samples, were assessed using various methods. Brain tissue DNA was isolated and then analyzed using nested PCR and LAMP assays targeting the T. gondii B1 gene and RE gene. Sensitivity and specificity assessments were conducted, and statistical evaluations were made using SPSS software. RESULTS No T. gondii cysts were detected in the smear preparations. T. gondii DNA was discovered in 6% of the sick birds using nested PCR, while LAMP identified T. gondii DNA in 8% of these individuals. Both techniques exhibited a high level of specificity; however, LAMP demonstrated higher sensitivity and faster processing times than nested PCR. CONCLUSION The study indicates that LAMP is an efficient diagnostic method for quickly and accurately detecting T. gondii in pet birds while also being cost-effective. The results emphasize the significance of molecular diagnostics in promptly identifying and treating toxoplasmosis in birds, which enhances our comprehension and regulation of the disease. To improve the surveillance and preventative strategies against T. gondii infections, it is advisable to do additional studies using more extensive and diversified bird populations. Toxoplasma gondii LAMP PCR brain seizure Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 INTRODUCTION Toxoplasmosis, caused by the significant parasite Toxoplasma gondii (T. gondii) , is a global disease affecting various species, infants, fetuses, and adults' eyes and nervous systems [ 1 ]. T. gondii is a significant European disease, affecting over one million people annually. Mainly transmitted through bradyzoite-infected meat, it affects 30% of the global population. Those with weakened immune systems are very vulnerable to severe diseases caused by the rapidly multiplying tachyzoite form, such as toxoplasmic encephalitis [ 2 ]. Parasites that survive continue to exist as bradyzoite tissue cysts, which expand slowly. These cysts are most commonly seen in tissues with inadequate immune surveillance, such as the brain, eye, heart, and skeletal muscle. [ 3 ]Patients with toxoplasmosis have been found to experience a range of neurological and mental disorders, including schizophrenia, Alzheimer's disease (AD), bipolar disorders, generalized anxiety disorder (GAD), obsessive-compulsive disorder, suicidality, Parkinson's disease, epilepsy, and depression [ 4 ]. T. gondii infection has been associated with alterations in glutamate excitotoxicity and spontaneous seizures in mouse models. Additionally, first clinical observations indicate that it may serve as a risk factor for epilepsy [ 5 ]. Despite being discovered in 1908, a viable vaccination for toxoplasmosis in humans has not yet been developed, and the treatment for this disease remains challenging [ 6 ]. There is a growing acknowledgment that the use of modern molecular diagnostic methods, such as ​Polymerase Chain Reaction (PCR), Loop-mediated isothermal amplification ( LAMP), and enzyme-linked immunosorbent assay (ELISA), has improved our comprehension of avian diseases. One of the widely recognized techniques for isothermal amplification is LAMP. It has been proven effective in diagnosing pathogens in various systems thanks to its robust, fast, specific, and sensitive advantages [ 7 , 8 ]. The lamp technique is fast and efficient, with a high specificity and sensitivity for detecting T. gondii in complex materials. The DNA is amplified under isothermal conditions. The LAMP technique is more efficient than other molecular methods because it lacks the requirement for an expensive heat cycler. Additionally, it can amplify DNA in less than one hour, does not necessitate probe labeling, and facilitates multiplexing [ 9 ]. LAMP is an intriguing alternative because it offers several detection methods. LAMP can be conducted by fluorometric detection, facilitated by portable equipment, or by colorimetric detection, visible to the unaided eye. [ 10 ]Although Toxoplasmosis illnesses in birds are significant, our understanding of it remains limited, mainly because of the constraints imposed by existing diagnostic tools. Numerous studies have investigated the prevalence and impact of T. gondii in various animal hosts, but research explicitly focusing on avian species, particularly pet birds, is limited. Chen, Qin, et al. was written a comprehensive assessment of scientific literature, and a statistical analysis was conducted to determine the worldwide incidence of T. gondii in wild birds and identify the parameters linked to infection. The findings indicate a need for enhanced monitoring to comprehend better the ecological dynamics of genotypes and the transmission of diseases [ 11 ]. Almuzaini et al. explored the transmission of T. gondii through food, examining risk factors, detection methods, and strategies for controlling and minimizing its prevalence [ 9 ]. Machado, Fornazari, et al. examined the occurrence of antibodies against T. gondii in blood samples of bats that were submitted for rabies diagnosis [ 1 ]. Zeedan et al. conducted a study on the prompt detection of Toxoplasma gondii in camels and small ruminants. They showed that the loop-mediated isothermal amplification (LAMP) assay is equally sensitive and specific as the polymerase chain reaction (PCR) in identifying T. gondii DNA in blood and milk samples. This assay provides a fast and dependable diagnostic technique that is suitable for use in both field and laboratory settings[ 12 ]. Li et al. discovered that Toxoplasma gondii may attach to, but not penetrate, nucleated chicken erythrocytes. This connection leads to apoptosis, indicating a complicated method of interaction. The findings also show that chicken erythrocytes have a crucial role in the immune response against T. gondii infection ​[ 13 ]. Gouda et al. conducted a cross-sectional investigation indicating a large prevalence of latent toxoplasmosis among moderate COVID-19 breakthrough infection patients, while no major link was established between Toxoplasma gondii infection and COVID-19 severity[ 14 ] . In Iran, The researchers conducted a study to examine anti- T. gondii antibodies and detect parasite DNA in maternal blood, placenta, and umbilical cord samples [ 15 ]. This research addresses the lack of knowledge on the frequency and consequences of T. gondii neurological symptoms in pet birds, focusing on using molecular diagnostic tools. The objective is to assess the prevalence of T. gondii in the brain tissues of pet birds that are showing neurological symptoms, utilizing both nested PCR and LAMP techniques. The objective is to assess the sensitivity and specificity of nested PCR and LAMP techniques for detecting T. gondii in symptomatic and asymptomatic pet birds. The objective of this study is to determine the occurrence of T. gondii in various kinds of pet birds and identify any possible factors that may contribute to the risk of infection. This study aims to fill existing literature gaps, improve T. gondii identification in pet birds, and ultimately enhance treatment and management options for avian neurological illnesses. MATERIALS AND METHODS Sampling Fifty whole heads from different species of finches and parrots exhibiting neurological symptoms such as paralysis, head tilt, loss of balance, wing drooping, nervous tics, and head retraction were collected from May to September 2023. Twenty dead birds that showed no neurological symptoms were also collected (Table 1). T. gondii cysts were evaluated in brain tissue samples using smear pressure. Subsequently, a DNA extraction kit was employed to isolate DNA from the parasite genome, and the LAMP method was utilized to detect the presence of T. gondii in brain tissues. TABLE 1 Number of pet birds sampled with and without neurological signs With neurological symptoms Without neurological symptoms Bird type Number Bird type Number African gray parrot 7 African gray parrot 3 Budgerigar 10 Budgerigar 2 Lovebird 8 Lovebird 2 Amazon parrot 3 Amazon parrot 1 Cockatiel Cockatiel 2 Canary 16 Canary 8 Finch 4 Finch 2 Total 50 Total 20 MOLECULAR EXAMINATION The DNA extraction process was done with the commercially available DNA Extraction Kit (MBST, Iran), following the manufacturer's instructions. NESTED-PCR A portion of the B1 gene was amplified by nested PCR utilizing two primer pairs that were designed by Shapchalard et al. (2005) (20) (Table 1). DNA collected from RH strain tachyzoites (Pasteur Institute, Iran) was used as a positive control. TABLE 2 - The characteristics of primers for amplifying the B1 Gene of Toxoplasma gondii Primer name Sequence 5' to 3' Length of amplicon (bp) B1F1 TCAAGCAGCGTATTGTCGAG 287 B1R1 CCGCAGCGACTTCTATCTCT B1F2 GGAACTGCATCCGTTCATGAG 194 B1R2 TCTTTAAAGCGTTCGTGGTC Accupower PCR premix kits (Bioneer, South Korea) were used in this study. The kit components were mixed with one microliter of 250–500 ng DNA sample and ten pmol of each primer (Dana Bioscience, Iran). Sterile distilled water was used to 20 microliter capacity. A Bio-Rad thermocycler (USA) was then used for PCR. The temperature was programmed to reach 94°C and maintained for 3 minutes. This was followed by 40 cycles of denaturation at 94°C for one minute, annealing at 72°C for one minute, and extension at 72°C for seven minutes. For visualization, the PCR product used to amplify the 287 bp fragment was electrophoresed on a 1.5% agarose gel. Regardless of whether the 287 bp amplicon was present or not, all initial PCR products were ready for the second PCR (Nested PCR). A 1:10 dilution of the original PCR product was made using sterile distilled water. Except for the annealing temperature, which was set at 52°C, and the number of cycles set at 30, every step of the second PCR was conducted similarly to the first. The 194 bp fragment was then visible after the PCR product was electrophoresed on a 1.5% agarose gel. LAMP The reaction was first carried out on a positive control sample of DNA from the RH strain of T. gondii to control the reaction phases. A negative control sample (a sample free of DNA) was included at every step of the procedure to detect T. gondii , and the RE gene (Accession No.: AF146527) was amplified. The sequences of primers for LAMP analysis published by Lin and Zhang (2012) were presented in Table 2. The following elements were utilized in LAMP in the ratios presented in Table 3. TABLE 3 - Sequence of LAMP Primers (20) Primer names Sequence (5′-3′) FIP TCCTCACCCTCGCCTTCATCTAGGACTACAGACGCGATGC BIP TGGTTGGGAAGCGACGAGAGTTCCAGGAAAAGCAGCCAAG F3 CCACAGAAGGGACAGAAGTC B3 TCCGGTGTCTCTTTTTCCAC LF TCCAAGACGGCTGGAGGAG LB CGGAGAGGGAGAAGATGTTTCC TABLE 4 - Biological Materials in the LAMP Component Volume (µl) Final concentration Buffer 10X \(\:2.5\) \(\:1mM\) Magnesium sulfate \(\:1.5\) \(\:0.8\:mM\) dNTP Mix (each) \(\:3.5\) \(\:1.4mM\) Internal primers FIP/BIP \(\:1\) \(\:1.6\mu\:M\) External primers F3/B3 \(\:1\) \(\:0.2\mu\:M\:\) Loop primers LF/LB \(\:1\) \(\:0.4\mu\:M\:\) Bst DNA Polymerase (Primary concentration: 320 U/ml, New England BioLabs, USA)) \(\:1.5\) \(\:4.8U\) Template DNA \(\:1\) copies or more10> Betaine (initial concentration: 5 mM) \(\:4\) \(\:1.6mM\) Sterile double-distilled water up to a final volume of \(\:25\:\mu\:l\) The reaction ingredients were heated in a heating block for 90 minutes at 66°C and then for 5 minutes at 80°C. Each reaction product was electrophoresed on a 1.5% agarose gel with HNB dye to see the amplified fragments. Primers, dNTPs, Betaine, MgSO4, and DNA, were all utilized in varying concentrations on positive and negative control samples to optimize the reaction's component. Using a gradient thermal cycler, nine temperatures (60 to 68°C) and three distinct periods (60, 90, and 120 minutes) were used to optimize the reaction temperature and time. Following the reaction, every sample was electrophoresed on an agarose gel, and band intensity was used to determine the ideal temperature and time. DNA from Leishmania major , Trichomonas vaginalis , and Neospora caninum was utilized in the experiment to assess the LAMP specificity. A serial dilution of DNA (the RH strain of T. gondii) was used to measure sensitivity. The concentration of templated DNA was measured by NanoDrop (BioRad, USA). A serial dilution from template DNA was prepared from 1 ng to 0.01 fg to optimize the LAMP reaction. STATISTICAL ANALYSIS The information gathered was subjected to statistical analysis using SPSS version 23 software, employing One Way ANOVA and Tukey's post hoc test. A significance level of p < 0.05 was used. RESULTS The initial evaluation of the samples in this study revealed that no cysts or other stages of T. gondii were observed in the impression smears prepared from 20 brains of asymptomatic birds and 50 brains of birds showing neurological signs. NESTED- PCR None of the 20 brain tissues from healthy birds showed any amplification of the 287 bp fragment of the B1 gene of T. gondii in the first step of the PCR reaction, and there was also no amplification of the 194 bp fragment in the second phase. The amplification of the 287 bp fragment of the B1 gene of T. gondii was detected in the initial stage (Fig. 1 ). In comparison, the amplification of the 194 bp fragment of the B1 gene of T. gondii was seen in the subsequent phase (Fig. 2 ). This was observed in 3 out of 50 brain samples obtained from birds displaying neurological symptoms (6% prevalence). These samples were obtained from 6.6% of the total of thirty colonies of pet birds. LAMP Evaluation of the specificity of external primers The primer sequences were aligned in the GenBank database to evaluate the specificity of the primers employed for T. gondii detection in LAMP. This showed that the primers can amplify a 202 bp fragment of T. gondii . PCR also validated this result using the same primers on the positive control (Fig. 3 ). TABLE 5 Optimal values and changes in the number of substances, temperature, and time in LAMP LAMP components examined amounts Optimal concentration Primer Internal primer (1, 1.6, 2.2, 2.8, and 3.4 µM) External primer (0.1, 0.2, and 0.3 µM) Loop (0.2, 0.4, 0.6, and 0.8 µM) Internal primers (FIP and BIP): 6.1 µM External primers (B3 and F3) 2.0 µM Loop primers (LF and BF) 4 µM Bst DNA polymerase 4, 4.8, and 5.6 units 4.8 units dNTP 1, 1.2, 1.4, and 1.6 mM 1.4 mM Betaine 0.8, 1, and 1.2 mM 0.8 mM Magnesium ions 8, 10, 12, and14 mM Eight mM Template DNA 0.25, 0.5, 1, 1.5, 2 µL 0.5 µL of 1:25 dilution Temperature 60, 61, 62, 63, 64, 65, 66, 67, and 68°C 66°C Time 60, 90, and 120 minutes 90 minutes SENSITIVITY AND SPECIFICITY OF LAMP The negative control, Neospora caninum , and Trichomonas vaginalis extracted DNAs were not amplified in LAMP. To conduct sensitivity testing, an aserial dilution of the DNA from the T. gondii strain that serves as the positive control was made. Based on the repetitive 529 bp gene (RE gene) from the Rh strain of T. gondii 's genome, this DNA was found in LAMP at a concentration of 10 fg. Lower amounts were not detected in LAMP and did not cause a color change (Fig. 4 ). Evaluation of T. gondii infection in bird brain samples using LAMP Visual examination and electrophoresis of LAMP products in brain samples of birds exhibiting neurological indications revealed that in 4 out of 50 analyzed samples (8%), this gene was amplified in isothermal conditions. In the ocular approach, color shift was noted, and in the electrophoresis method, streaks were evident (Fig. 5 ). DISCUSSION Previous research on T. gondii infection in avian species has established a baseline understanding of the parasite's prevalence and molecular characteristics. For instance, studies have estimated the global prevalence of T. gondii infection in wild birds at 16.6%. Among the variables examined, publication year post-2020 and climate type were significantly associated with T. gondii infection (P < 0.01) [ 11 ]. Previous investigations have identified certain methodological limitations. These include reliance on conventional diagnostic procedures like PCR, which, despite having acceptable sensitivity and specificity, as indicated by Opsteegh et al., nonetheless have disadvantages such as relatively high costs[ 16 ]. This work utilized nested PCR and LAMP techniques to identify the presence of T. gondii DNA in bird brain tissues. By performing this operation, we can validate our experiment with the bulb. Marín-García et al. utilized Additional methods, including Immunomagnetic Separation Assay (IMS), LAMP test, and RT-PCR methodology, which are employed to identify T. gondii oocysts in samples [ 17 ]. The study found an elevated rate of T. gondii infection in birds with neurological symptoms. T. gondii DNA was found in 6% of samples using nested PCR and in 8% of samples using LAMP. The light technology demonstrates superior performance and additional benefits, such as its cost-effectiveness. This study contributes to the current body of research by offering new perspectives on the molecular diagnosis of T. gondii infection in avian species. By utilizing modern molecular techniques such as LAMP, this research enhances the range of diagnostic tools for identifying T. gondii in birds with neurological symptoms. Norouzi et al. found that the LAMP assay, which focuses on the RE and B1 genes, exhibited higher sensitivity and specificity than the standard PCR technique, which also targets the same genomic regions for detecting T. gondii DNA [ 18 ]. One significant accomplishment of this study is the effective utilization of LAMP to identify T. gondii DNA in bird tissues. The LAMP technique provides a quick, highly responsive, and economical approach to diagnosing T. gondii infection, improving diagnostic capacities. We achieved superior outcomes compared to the previous research investigations. Durand et al. have demonstrated that this method is fast and accurate for detecting T. gondii in complex samples. The DNA is amplified in a constant-temperature environment. The LAMP technique is more efficient than other molecular methods due to its lack of reliance on an expensive heat cycler. Additionally, it can amplify DNA in less than one hour, does not require probe labeling, and facilitates multiplexing [ 19 ]. The successful identification of T. gondii in birds exhibiting neurological symptoms has significant implications for both veterinary and public health. Early detection and treatment of T. gondii infections in birds can help prevent the spread of the parasite to humans and other animals, thereby reducing public health risks. Bahia et al. have demonstrated that importing foreign materials makes parasite transmission in developed countries possible. The increased population of cats, which can infect birds, raises the likelihood of environmental contamination with T. gondii . This ultimately leads to higher risks of transmission through food and water, posing a threat to human health [ 9 ]. An essential aspect of this study is its originality in using optimized LAMP to diagnose T. gondii infection in birds. This innovative methodology tackles the constraints of traditional PCR technologies and presents a possible substitute for swift and precise diagnosis. Other studies suggest that the convolutional approach needs improvement. Laboratories should employ Real-Time PCR (qPCR) to diagnose toxoplasmosis precisely. This technology quantifies T. gondii in biological samples, allowing the detection of the protozoan in clinical settings. However, the complexity of the procedure needs improvement [ 1 ]. The results of this study have consequences for surveillance and control programs designed to manage the transmission of T. gondii in bird populations. Using LAMP for prompt and precise detection can expedite timely intervention and preventive actions, thereby lessening the impact of T. gondii infection in avian species. The comparative investigations provide a clear understanding of the enhanced specificity, sensitivity, and speed of the LAMP approach in comparison to other methods [ 20 ]. Although this study has achieved significant progress, it is essential to consider several limitations that should be considered for future research. Specifically, the study analyzed a limited number of bird species, and the sample size needed to be more significant. Subsequent investigations should enlarge the sample population by incorporating a more diverse array of avian hosts. In addition, the study predominantly concentrated on birds that displayed neurological symptoms, which may have resulted in the omission of asymptomatic carriers of T. gondii. Upcoming research should prioritize examining asymptomatic birds to have a more comprehensive understanding of the prevalence of T. gondii in avian communities. An issue that could be explored further is the transmission of T. gondii from birds to humans and its potential connection to the development of epilepsy. T. gondii possesses the capability to induce localized regions of atypical electrical activity in the brain, which can result in the development of epilepsy. Methods such as EEG and fMRI can pinpoint these specific areas, assisting in the identification and management, including surgical procedures [ 21 ]. Zavareh, Hadiipour, et al. provided evidence that administering T. gondii to animals with tumors reduced the size of colon cancer. This discovery is consistent with other scientific findings suggesting that T. gondii has considerable capacity to inhibit the growth of tumors. Further research should explore the possible association between T. gondii infection in avian species and colon-related illnesses like cancer[ 22 ]. Neshatpour Esfahani demonstrated that investigating the impact of electrical stimulation on the colon might reveal significant connections between colon neurons and cancer progression [ 23 ]. By considering these discoveries, we can develop research projects to reveal the impact of T. gondii on the advancement of colon cancer by examining the electrical function of the colon. Declarations ETHICAL STATEMENT The study received approval from the Ethical Committee of the Veterinary Department of Islamic Azad University, by institutional and national requirements for animal care. The bird samples, even those displaying neurological and subclinical signs, were handled compassionately, with tissue samples collected after death to prevent unnecessary harm. The research was carried out with a dedication to scientific integrity, ensuring that all data were reported truthfully to enhance our knowledge of T. gondii in pet birds. CONFLICT OF INTEREST The authors affirm that the study was conducted without business relationships or financial associations, which could be seen as a possible conflict of interest. Author Contribution M.N. (Mohammad Neshatpour Esfahani) was responsible for writing the main manuscript text and conducting the experimental work presented in the study. M.G. (Dr. Majid Gholami-Ahangaran) assisted with the experimental work in the laboratory and provided essential recommendations throughout the research process. W.J.S. (Dr. William J. Sullivan Jr.) contributed by offering guidance, reviewing the data, and critically evaluating the manuscript to ensure its accuracy and scientific integrity. All authors have reviewed and approved the final version of the manuscript. References Machado DMR et al (2023) Serological and molecular investigations on Toxoplasma gondii and Leptospira spp. in bats captured in urban areas from Brazil. Emerg Anim Species 9:100033 Koutsogiannis Z, Mina JG, Suman R, Denny PW (2023) Assessment of Toxoplasma gondii lytic cycle and the impact of a gene deletion using 3D label-free optical diffraction holotomography. Front Cell Infect Microbiol, 13 Zaki L et al (2024) Global prevalence of Toxoplasma gondii in birds: A systematic review and meta-analysis. Parasite Epidemiol Control, p. e00350 Bisetegn H et al (2023) Global seroprevalence of Toxoplasma gondii infection among patients with mental and neurological disorders: A systematic review and meta-analysis. Health Sci Rep 6(6):e1319 Baker TL et al (2023) Pre-existing Toxoplasma gondii infection increases susceptibility to pentylenetetrazol-induced seizures independent of traumatic brain injury in mice. Front Mol Neurosci 15:1079097 Wesołowski R, Pawłowska M, Smoguła M, Szewczyk-Golec K (2023) Advances and challenges in diagnostics of toxoplasmosis in HIV-infected patients, Pathogens , vol. 12, no. 1, p. 110 Mao R, Wu X, Miao Q, Cai T (2022) Asymmetric stem-loop–mediated isothermal amplification of nucleic acids for DNA diagnostic assays by simple modification of canonical PCR primers. Front Bioeng Biotechnol 10:931770 Xiao F et al (2024) Rapid and reliable diagnosis of Moraxella catarrhalis infection using loop-mediated isothermal amplification-based testing. Front Bioeng Biotechnol 11:1330047 Almuzaini AM (2023) Flow of Zoonotic Toxoplasmosis in Food Chain. Pakistan Veterinary J, 43, 1 Bohórquez JA et al (2024) Development of a new loop-mediated isothermal amplification test for the sensitive, rapid, and economic detection of different genotypes of Classical swine fever virus. Front Cell Infect Microbiol 14:1372166 Chen C et al (2024) Global prevalence and risk factors associated with Toxoplasma gondii infection in wild birds: A systematic review and meta-analysis. Prev Vet Med, p. 106187 Zeedan GS, Abdalhamed AM, Shaapan RM, El-Namaky AH (2022) Rapid diagnosis of Toxoplasma gondii using loop-mediated isothermal amplification assay in camels and small ruminants, Beni-Suef University Journal of Basic and Applied Sciences , vol. 11, no. 1, p. 1 Li C et al (2023) Toxoplasma gondii adhesion and apoptosis of chicken erythrocytes. Anim Dis 3(1):28 Gouda MA et al (2023) Association between breakthrough infection with COVID-19 and Toxoplasma gondii: a cross-sectional study. Sci Rep 13(1):17636 Saki J, Zamanpour M, Najafian M, Mohammadpour N, Foroutan M (2021) Detection of acute and chronic Toxoplasma gondii infection among women with history of abortion in the Southwest of Iran, Journal of Parasitology Research , vol. 2021 Opsteegh M et al (2020) Methods to assess the effect of meat processing on viability of Toxoplasma gondii: towards replacement of mouse bioassay by in vitro testing. Int J Parasitol 50(5):357–369 Marín-García P-J, Planas N, Llobat L (2022) Toxoplasma gondii in foods: prevalence, control, and safety, Foods , vol. 11, no. 16, p. 2542 Norouzi R, Dalimi A, Moghadam MF, Ghaffarifar F (2016) Comparison of a Nucleic Acid Sequence-based Amplification (NASBA) and real-time reverse transcriptase PCR methods for detection of Toxoplasma gondii in rat blood samples. J Zoonotic Dis 1(1):15–23 Durand L, La Carbona S, Geffard A, Possenti A, Dubey JP, Lalle M (2020) Comparative evaluation of loop-mediated isothermal amplification (LAMP) vs qPCR for detection of Toxoplasma gondii oocysts DNA in mussels. Exp Parasitol 208:107809 Sotiriadou I, Karanis P (2008) Evaluation of loop-mediated isothermal amplification for detection of Toxoplasma gondii in water samples and comparative findings by polymerase chain reaction and immunofluorescence test (IFT). Diagn Microbiol Infect Dis 62(4):357–365 Sadjadi SM, Ebrahimzadeh E, Shams M, Seraji M, Soltanian-Zadeh H (2021) Localization of epileptic foci based on simultaneous EEG–fMRI data. Front Neurol 12:645594 Zavareh FSE, Hadiipour M, Kalantari R, Mousavi S, Tavakolifard N, Darani HY (2021) Effect of Toxoplasma gondii on colon cancer growth in mouse model. Am J Biomed 9(2):168–176 Neshatpour Esfahani M (2017) Factors affecting the development of colon cancer and electrical stimulation of the colon. Int J Med Reviews 4(3):70–75 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 24 Jan, 2025 Read the published version in Acta Parasitologica → Version 1 posted Editorial decision: Revision requested 13 Sep, 2024 Reviews received at journal 13 Sep, 2024 Reviewers agreed at journal 09 Sep, 2024 Reviewers invited by journal 04 Sep, 2024 Editor assigned by journal 02 Sep, 2024 Submission checks completed at journal 02 Sep, 2024 First submitted to journal 31 Aug, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5008387","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":353697023,"identity":"6548932a-7611-418d-9063-62e4d36c67e5","order_by":0,"name":"Mohammad Neshatpour Esfahani","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABK0lEQVRIiWNgGAWjYFACHjDJ2AAkmBGiFSAucwMxWgygomdAXEZStDC2wQUxgG5778FPN3PsZBukmw9/Lqj5k8cvkfuA4eO82mj+dqCWHxXb0LWYnTmXLJ27Ldm4QeZYmvSMYwbFkjPSDRhnbjueO+MwYwNjz5nbGFpu5BgAtTAnNkjkmDHzsBkkbriRxsDMu+1YbgNQCzNjGzYtxr9zt9UDteR//szzD6rl75xjufNxazED2nIYZAuDNG8bVAtjQ03uBlxazpwxs87ddty4TSLNTJq3z7hYsucZw8GeYwdyNwK1HMTml+M9xrdzt1XL9kskP/7M800uj589jfHBj5q63HnnDx988KMCQwscsEHpBBBxgIHhMAOUQRgkQOk6YhSPglEwCkbByAAAWTd3RvShi2UAAAAASUVORK5CYII=","orcid":"","institution":"","correspondingAuthor":true,"prefix":"","firstName":"Mohammad","middleName":"Neshatpour","lastName":"Esfahani","suffix":""},{"id":353697025,"identity":"ad13c127-a610-4c2a-892d-440b91ac203a","order_by":1,"name":"Majid Gholami-Ahangaran","email":"","orcid":"","institution":"Islamic Azad University","correspondingAuthor":false,"prefix":"","firstName":"Majid","middleName":"","lastName":"Gholami-Ahangaran","suffix":""},{"id":353697030,"identity":"2605305a-47f4-4eeb-8960-af27fcf0c288","order_by":2,"name":"William J Sullivan Jr","email":"","orcid":"","institution":"Indiana University School of Medicine","correspondingAuthor":false,"prefix":"","firstName":"William","middleName":"J","lastName":"Sullivan","suffix":"Jr"}],"badges":[],"createdAt":"2024-08-31 10:08:19","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5008387/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5008387/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s11686-024-00983-z","type":"published","date":"2025-01-24T15:57:26+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":66943051,"identity":"e085e4fa-d471-4376-92da-fda6d06e0ae8","added_by":"auto","created_at":"2024-10-18 09:19:23","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":177430,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Picture1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5008387/v1/cd0aceaa05a8ff1eff4c39d7.jpg"},{"id":66942830,"identity":"3946b48f-1636-4226-b005-23242598b95c","added_by":"auto","created_at":"2024-10-18 09:11:23","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":103830,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Picture2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5008387/v1/a82753b688593a3f20aaa5f4.jpg"},{"id":66942831,"identity":"31fc87ed-0423-4572-bdf4-e8a257c080a2","added_by":"auto","created_at":"2024-10-18 09:11:23","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":139280,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Picture3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5008387/v1/1e13a50f276435c1ba7693aa.jpg"},{"id":66942832,"identity":"db872e10-e107-4963-8418-a6005925df03","added_by":"auto","created_at":"2024-10-18 09:11:23","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":180615,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Picture4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5008387/v1/6db4d173372e3ddfd220f27f.jpg"},{"id":66942833,"identity":"5c2c4a09-ff8f-4078-bab8-89db3a926ab5","added_by":"auto","created_at":"2024-10-18 09:11:23","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":156483,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend.\u003c/p\u003e","description":"","filename":"Picture5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-5008387/v1/44873c766cb9813d38b61c4a.jpg"},{"id":74858360,"identity":"947352d1-e1ab-4dee-a272-df52cfeea475","added_by":"auto","created_at":"2025-01-27 16:08:32","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1383733,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5008387/v1/912b6ecd-d773-4b7f-b9fb-9ffcad85b404.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Detection of Toxoplasma Gondii in the Brain of Pet Birds by Seizures with Loop-Mediated Isothermal Amplification (LAMP)","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003eToxoplasmosis, caused by the significant parasite \u003cem\u003eToxoplasma gondii (T. gondii)\u003c/em\u003e, is a global disease affecting various species, infants, fetuses, and adults' eyes and nervous systems [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. \u003cem\u003eT. gondii\u003c/em\u003e is a significant European disease, affecting over one million people annually. Mainly transmitted through bradyzoite-infected meat, it affects 30% of the global population. Those with weakened immune systems are very vulnerable to severe diseases caused by the rapidly multiplying tachyzoite form, such as \u003cem\u003etoxoplasmic\u003c/em\u003e encephalitis [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Parasites that survive continue to exist as bradyzoite tissue cysts, which expand slowly. These cysts are most commonly seen in tissues with inadequate immune surveillance, such as the brain, eye, heart, and skeletal muscle. [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]Patients with toxoplasmosis have been found to experience a range of neurological and mental disorders, including schizophrenia, Alzheimer's disease (AD), bipolar disorders, generalized anxiety disorder (GAD), obsessive-compulsive disorder, suicidality, Parkinson's disease, epilepsy, and depression [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. \u003cem\u003eT. gondii\u003c/em\u003e infection has been associated with alterations in glutamate excitotoxicity and spontaneous seizures in mouse models. Additionally, first clinical observations indicate that it may serve as a risk factor for epilepsy [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Despite being discovered in 1908, a viable vaccination for toxoplasmosis in humans has not yet been developed, and the treatment for this disease remains challenging [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. There is a growing acknowledgment that the use of modern molecular diagnostic methods, such as ​Polymerase Chain Reaction (PCR), Loop-mediated isothermal amplification \u003cb\u003e(\u003c/b\u003eLAMP), and enzyme-linked immunosorbent assay (ELISA), has improved our comprehension of avian diseases. One of the widely recognized techniques for isothermal amplification is LAMP. It has been proven effective in diagnosing pathogens in various systems thanks to its robust, fast, specific, and sensitive advantages [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. The lamp technique is fast and efficient, with a high specificity and sensitivity for detecting \u003cem\u003eT. gondii\u003c/em\u003e in complex materials. The DNA is amplified under isothermal conditions. The LAMP technique is more efficient than other molecular methods because it lacks the requirement for an expensive heat cycler. Additionally, it can amplify DNA in less than one hour, does not necessitate probe labeling, and facilitates multiplexing [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eLAMP is an intriguing alternative because it offers several detection methods. LAMP can be conducted by fluorometric detection, facilitated by portable equipment, or by colorimetric detection, visible to the unaided eye. [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]Although Toxoplasmosis illnesses in birds are significant, our understanding of it remains limited, mainly because of the constraints imposed by existing diagnostic tools. Numerous studies have investigated the prevalence and impact of \u003cem\u003eT. gondii\u003c/em\u003e in various animal hosts, but research explicitly focusing on avian species, particularly pet birds, is limited.\u003c/p\u003e \u003cp\u003eChen, Qin, et al. was written a comprehensive assessment of scientific literature, and a statistical analysis was conducted to determine the worldwide incidence of \u003cem\u003eT. gondii\u003c/em\u003e in wild birds and identify the parameters linked to infection. The findings indicate a need for enhanced monitoring to comprehend better the ecological dynamics of genotypes and the transmission of diseases [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Almuzaini et al. explored the transmission of \u003cem\u003eT. gondii\u003c/em\u003e through food, examining risk factors, detection methods, and strategies for controlling and minimizing its prevalence [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Machado, Fornazari, et al. examined the occurrence of antibodies against \u003cem\u003eT. gondii\u003c/em\u003e in blood samples of bats that were submitted for rabies diagnosis [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Zeedan et al. conducted a study on the prompt detection of Toxoplasma gondii in camels and small ruminants. They showed that the loop-mediated isothermal amplification (LAMP) assay is equally sensitive and specific as the polymerase chain reaction (PCR) in identifying T. gondii DNA in blood and milk samples. This assay provides a fast and dependable diagnostic technique that is suitable for use in both field and laboratory settings[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Li et al. discovered that Toxoplasma gondii may attach to, but not penetrate, nucleated chicken erythrocytes. This connection leads to apoptosis, indicating a complicated method of interaction. The findings also show that chicken erythrocytes have a crucial role in the immune response against T. gondii infection ​[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Gouda et al. conducted a cross-sectional investigation indicating a large prevalence of latent toxoplasmosis among moderate COVID-19 breakthrough infection patients, while no major link was established between Toxoplasma gondii infection and COVID-19 severity[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] .\u003c/p\u003e \u003cp\u003eIn Iran, The researchers conducted a study to examine anti-\u003cem\u003eT. gondii\u003c/em\u003e antibodies and detect parasite DNA in maternal blood, placenta, and umbilical cord samples [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThis research addresses the lack of knowledge on the frequency and consequences of \u003cem\u003eT. gondii\u003c/em\u003e neurological symptoms in pet birds, focusing on using molecular diagnostic tools.\u003c/p\u003e \u003cp\u003e \u003cul\u003e \u003cli\u003e \u003cp\u003e The objective is to assess the prevalence of \u003cem\u003eT. gondii\u003c/em\u003e in the brain tissues of pet birds that are showing neurological symptoms, utilizing both nested PCR and LAMP techniques.\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003e The objective is to assess the sensitivity and specificity of nested PCR and LAMP techniques for detecting \u003cem\u003eT. gondii\u003c/em\u003e in symptomatic and asymptomatic pet birds.\u003c/p\u003e \u003c/li\u003e \u003cli\u003e \u003cp\u003e The objective of this study is to determine the occurrence of \u003cem\u003eT. gondii\u003c/em\u003e in various kinds of pet birds and identify any possible factors that may contribute to the risk of infection.\u003c/p\u003e \u003c/li\u003e \u003c/ul\u003e \u003c/p\u003e \u003cp\u003eThis study aims to fill existing literature gaps, improve \u003cem\u003eT. gondii\u003c/em\u003e identification in pet birds, and ultimately enhance treatment and management options for avian neurological illnesses.\u003c/p\u003e"},{"header":"MATERIALS AND METHODS","content":"\u003cp\u003eSampling\u003c/p\u003e\n\u003cp\u003eFifty whole heads from different species of finches and parrots exhibiting neurological symptoms such as paralysis, head tilt, loss of balance, wing drooping, nervous tics, and head retraction were collected from May to September 2023. Twenty dead birds that showed no neurological symptoms were also collected (Table 1). \u003cem\u003eT. gondii\u003c/em\u003e cysts were evaluated in brain tissue samples using smear pressure. Subsequently, a DNA extraction kit was employed to isolate DNA from the parasite genome, and the LAMP method was utilized to detect the presence of \u003cem\u003eT. gondii\u003c/em\u003e in brain tissues.\u003c/p\u003e\n\u003cp\u003eTABLE 1 Number of pet birds sampled with and without neurological signs\u003c/p\u003e\n\u003ctable id=\"Taba\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eWith neurological symptoms\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eWithout neurological symptoms\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eBird type\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eNumber\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eBird type\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eNumber\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAfrican gray parrot\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e7\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAfrican gray parrot\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBudgerigar\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e10\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBudgerigar\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLovebird\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLovebird\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAmazon parrot\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eAmazon parrot\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCockatiel\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCockatiel\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCanary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e16\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCanary\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e8\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFinch\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e4\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFinch\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e50\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cstrong\u003e20\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003e\u003c/p\u003e\n\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\n \u003ch2\u003eMOLECULAR EXAMINATION\u003c/h2\u003e\n \u003cp\u003eThe DNA extraction process was done with the commercially available DNA Extraction Kit (MBST, Iran), following the manufacturer\u0026apos;s instructions.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e\n \u003ch2\u003eNESTED-PCR\u003c/h2\u003e\n \u003cp\u003eA portion of the B1 gene was amplified by nested PCR utilizing two primer pairs that were designed by Shapchalard et al. (2005) (20) (Table\u0026nbsp;1). DNA collected from RH strain tachyzoites (Pasteur Institute, Iran) was used as a positive control.\u003c/p\u003e\n \u003cp\u003eTABLE 2 - The characteristics of primers for amplifying the B1 Gene of Toxoplasma gondii\u003c/p\u003e\n \u003ctable id=\"Tabb\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer name\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence 5\u0026apos; to 3\u0026apos;\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eLength of amplicon (bp)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eB1F1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCAAGCAGCGTATTGTCGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" rowspan=\"2\"\u003e\n \u003cp\u003e287\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eB1R1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCGCAGCGACTTCTATCTCT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eB1F2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eGGAACTGCATCCGTTCATGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"char\" rowspan=\"2\"\u003e\n \u003cp\u003e194\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eB1R2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCTTTAAAGCGTTCGTGGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003cp\u003eAccupower PCR premix kits (Bioneer, South Korea) were used in this study. The kit components were mixed with one microliter of 250\u0026ndash;500 ng DNA sample and ten pmol of each primer (Dana Bioscience, Iran). Sterile distilled water was used to 20 microliter capacity. A Bio-Rad thermocycler (USA) was then used for PCR.\u003c/p\u003e\n \u003cp\u003eThe temperature was programmed to reach 94\u0026deg;C and maintained for 3 minutes. This was followed by 40 cycles of denaturation at 94\u0026deg;C for one minute, annealing at 72\u0026deg;C for one minute, and extension at 72\u0026deg;C for seven minutes.\u003c/p\u003e\n \u003cp\u003eFor visualization, the PCR product used to amplify the 287 bp fragment was electrophoresed on a 1.5% agarose gel. Regardless of whether the 287 bp amplicon was present or not, all initial PCR products were ready for the second PCR (Nested PCR). A 1:10 dilution of the original PCR product was made using sterile distilled water. Except for the annealing temperature, which was set at 52\u0026deg;C, and the number of cycles set at 30, every step of the second PCR was conducted similarly to the first. The 194 bp fragment was then visible after the PCR product was electrophoresed on a 1.5% agarose gel.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec5\" class=\"Section2\"\u003e\n \u003ch2\u003eLAMP\u003c/h2\u003e\n \u003cp\u003eThe reaction was first carried out on a positive control sample of DNA from the RH strain of \u003cem\u003eT. gondii\u003c/em\u003e to control the reaction phases. A negative control sample (a sample free of DNA) was included at every step of the procedure to detect \u003cem\u003eT. gondii\u003c/em\u003e, and the RE gene (Accession No.: AF146527) was amplified. The sequences of primers for LAMP analysis published by Lin and Zhang (2012) were presented in Table\u0026nbsp;2. The following elements were utilized in LAMP in the ratios presented in Table\u0026nbsp;3.\u003c/p\u003e\n \u003cp\u003eTABLE 3 - Sequence of LAMP Primers (20)\u0026nbsp;\u003c/p\u003e\n \u003ctable id=\"Tabc\" border=\"1\"\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003ePrimer names\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eSequence (5\u0026prime;-3\u0026prime;)\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eFIP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCCTCACCCTCGCCTTCATCTAGGACTACAGACGCGATGC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBIP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTGGTTGGGAAGCGACGAGAGTTCCAGGAAAAGCAGCCAAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eF3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCCACAGAAGGGACAGAAGTC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eB3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCCGGTGTCTCTTTTTCCAC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTCCAAGACGGCTGGAGGAG\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eCGGAGAGGGAGAAGATGTTTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003cp\u003e\u003c/p\u003e\n \u003cp\u003eTABLE 4 - Biological Materials in the LAMP\u003c/p\u003e\n \u003cdiv class=\"gridtable\"\u003e\u0026nbsp;\u003ctable id=\"Tabd\" border=\"1\"\u003e\n \u003ccolgroup cols=\"3\"\u003e\u003c/colgroup\u003e\n \u003cthead\u003e\n \u003ctr\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eComponent\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eVolume (\u0026micro;l)\u003c/p\u003e\n \u003c/th\u003e\n \u003cth align=\"left\"\u003e\n \u003cp\u003eFinal concentration\u003c/p\u003e\n \u003c/th\u003e\n \u003c/tr\u003e\n \u003c/thead\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBuffer 10X\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:2.5\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:1mM\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eMagnesium sulfate\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:1.5\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:0.8\\:mM\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003edNTP Mix (each)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:3.5\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:1.4mM\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eInternal primers FIP/BIP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:1\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:1.6\\mu\\:M\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eExternal primers F3/B3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:1\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:0.2\\mu\\:M\\:\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eLoop primers LF/LB\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:1\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:0.4\\mu\\:M\\:\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cem\u003eBst\u003c/em\u003e DNA Polymerase (Primary concentration: 320 U/ml, New England BioLabs, USA))\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:1.5\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:4.8U\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eTemplate DNA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:1\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003ecopies or more10\u0026gt;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eBetaine (initial concentration: 5 mM)\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:4\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003e\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:1.6mM\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd align=\"left\"\u003e\n \u003cp\u003eSterile double-distilled water\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd align=\"left\" colspan=\"2\"\u003e\n \u003cp\u003eup to a final volume of \u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:25\\:\\mu\\:l\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n \u003c/div\u003e\n \u003cp\u003eThe reaction ingredients were heated in a heating block for 90 minutes at 66\u0026deg;C and then for 5 minutes at 80\u0026deg;C. Each reaction product was electrophoresed on a 1.5% agarose gel with HNB dye to see the amplified fragments.\u003c/p\u003e\n \u003cp\u003ePrimers, dNTPs, Betaine, MgSO4, and DNA, were all utilized in varying concentrations on positive and negative control samples to optimize the reaction\u0026apos;s component. Using a gradient thermal cycler, nine temperatures (60 to 68\u0026deg;C) and three distinct periods (60, 90, and 120 minutes) were used to optimize the reaction temperature and time. Following the reaction, every sample was electrophoresed on an agarose gel, and band intensity was used to determine the ideal temperature and time.\u003c/p\u003e\n \u003cp\u003eDNA from \u003cem\u003eLeishmania major\u003c/em\u003e, \u003cem\u003eTrichomonas vaginalis\u003c/em\u003e, and \u003cem\u003eNeospora caninum\u003c/em\u003e was utilized in the experiment to assess the LAMP specificity. A serial dilution of DNA (the RH strain of \u003cem\u003eT. gondii)\u003c/em\u003e was used to measure sensitivity. The concentration of templated DNA was measured by NanoDrop (BioRad, USA). A serial dilution from template DNA was prepared from 1 ng to 0.01 fg to optimize the LAMP reaction.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec6\" class=\"Section2\"\u003e\n \u003ch2\u003eSTATISTICAL ANALYSIS\u003c/h2\u003e\n \u003cp\u003eThe information gathered was subjected to statistical analysis using SPSS version 23 software, employing One Way ANOVA and Tukey\u0026apos;s post hoc test. A significance level of p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was used.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"RESULTS","content":"\u003cp\u003eThe initial evaluation of the samples in this study revealed that no cysts or other stages of \u003cem\u003eT. gondii\u003c/em\u003e were observed in the impression smears prepared from 20 brains of asymptomatic birds and 50 brains of birds showing neurological signs.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eNESTED- PCR\u003c/h2\u003e \u003cp\u003eNone of the 20 brain tissues from healthy birds showed any amplification of the 287 bp fragment of the B1 gene of \u003cem\u003eT. gondii\u003c/em\u003e in the first step of the PCR reaction, and there was also no amplification of the 194 bp fragment in the second phase. The amplification of the 287 bp fragment of the B1 gene of \u003cem\u003eT. gondii\u003c/em\u003e was detected in the initial stage (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In comparison, the amplification of the 194 bp fragment of the B1 gene of \u003cem\u003eT. gondii\u003c/em\u003e was seen in the subsequent phase (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). This was observed in 3 out of 50 brain samples obtained from birds displaying neurological symptoms (6% prevalence). These samples were obtained from 6.6% of the total of thirty colonies of pet birds.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eLAMP\u003c/h2\u003e \u003cp\u003eEvaluation of the specificity of external primers\u003c/p\u003e \u003cp\u003eThe primer sequences were aligned in the GenBank database to evaluate the specificity of the primers employed for \u003cem\u003eT. gondii\u003c/em\u003e detection in LAMP. This showed that the primers can amplify a 202 bp fragment of \u003cem\u003eT. gondii\u003c/em\u003e. PCR also validated this result using the same primers on the positive control (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eTABLE 5 Optimal values and changes in the number of substances, temperature, and time in LAMP\u003c/p\u003e\u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Tabe\" border=\"1\"\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLAMP components\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eexamined amounts\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOptimal concentration\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimer\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eInternal primer (1, 1.6, 2.2, 2.8, and 3.4 \u0026micro;M) External primer (0.1, 0.2, and 0.3 \u0026micro;M) Loop (0.2, 0.4, 0.6, and 0.8 \u0026micro;M)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eInternal primers (FIP and BIP): 6.1 \u0026micro;M\u003c/p\u003e \u003cp\u003eExternal primers (B3 and F3) 2.0 \u0026micro;M\u003c/p\u003e \u003cp\u003eLoop primers (LF and BF) 4 \u0026micro;M\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBst\u003c/em\u003e DNA polymerase\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4, 4.8, and 5.6 units\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e4.8 units\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003edNTP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1, 1.2, 1.4, and 1.6 mM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.4 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBetaine\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.8, 1, and 1.2 mM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.8 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMagnesium ions\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e8, 10, 12, and14 mM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eEight mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTemplate DNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.25, 0.5, 1, 1.5, 2 \u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5 \u0026micro;L of 1:25 dilution\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTemperature\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e60, 61, 62, 63, 64, 65, 66, 67, and 68\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e66\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTime\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e60, 90, and 120 minutes\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e90 minutes\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eSENSITIVITY AND SPECIFICITY OF LAMP\u003c/h2\u003e \u003cp\u003eThe negative control, \u003cem\u003eNeospora caninum\u003c/em\u003e, and \u003cem\u003eTrichomonas vaginalis\u003c/em\u003e extracted DNAs were not amplified in LAMP. To conduct sensitivity testing, an aserial dilution of the DNA from the \u003cem\u003eT. gondii\u003c/em\u003e strain that serves as the positive control was made. Based on the repetitive 529 bp gene (RE gene) from the Rh strain of \u003cem\u003eT. gondii\u003c/em\u003e's genome, this DNA was found in LAMP at a concentration of 10 fg. Lower amounts were not detected in LAMP and did not cause a color change (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eEvaluation of \u003cem\u003eT. gondii\u003c/em\u003e infection in bird brain samples using LAMP\u003c/p\u003e \u003cp\u003eVisual examination and electrophoresis of LAMP products in brain samples of birds exhibiting neurological indications revealed that in 4 out of 50 analyzed samples (8%), this gene was amplified in isothermal conditions. In the ocular approach, color shift was noted, and in the electrophoresis method, streaks were evident (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003e \u003c/p\u003e \u003cp\u003ePrevious research on \u003cem\u003eT. gondii\u003c/em\u003e infection in avian species has established a baseline understanding of the parasite's prevalence and molecular characteristics. For instance, studies have estimated the global prevalence of \u003cem\u003eT. gondii\u003c/em\u003e infection in wild birds at 16.6%. Among the variables examined, publication year post-2020 and climate type were significantly associated with \u003cem\u003eT. gondii\u003c/em\u003e infection (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ePrevious investigations have identified certain methodological limitations. These include reliance on conventional diagnostic procedures like PCR, which, despite having acceptable sensitivity and specificity, as indicated by Opsteegh et al., nonetheless have disadvantages such as relatively high costs[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThis work utilized nested PCR and LAMP techniques to identify the presence of \u003cem\u003eT. gondii\u003c/em\u003e DNA in bird brain tissues. By performing this operation, we can validate our experiment with the bulb.\u003c/p\u003e \u003cp\u003eMar\u0026iacute;n-Garc\u0026iacute;a et al. utilized Additional methods, including Immunomagnetic Separation Assay (IMS), LAMP test, and RT-PCR methodology, which are employed to identify \u003cem\u003eT. gondii\u003c/em\u003e oocysts in samples [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe study found an elevated rate of \u003cem\u003eT. gondii\u003c/em\u003e infection in birds with neurological symptoms. \u003cem\u003eT. gondii\u003c/em\u003e DNA was found in 6% of samples using nested PCR and in 8% of samples using LAMP. The light technology demonstrates superior performance and additional benefits, such as its cost-effectiveness.\u003c/p\u003e \u003cp\u003eThis study contributes to the current body of research by offering new perspectives on the molecular diagnosis of \u003cem\u003eT. gondii\u003c/em\u003e infection in avian species. By utilizing modern molecular techniques such as LAMP, this research enhances the range of diagnostic tools for identifying \u003cem\u003eT. gondii\u003c/em\u003e in birds with neurological symptoms.\u003c/p\u003e \u003cp\u003eNorouzi et al. found that the LAMP assay, which focuses on the RE and B1 genes, exhibited higher sensitivity and specificity than the standard PCR technique, which also targets the same genomic regions for detecting \u003cem\u003eT. gondii\u003c/em\u003e DNA [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eOne significant accomplishment of this study is the effective utilization of LAMP to identify \u003cem\u003eT. gondii\u003c/em\u003e DNA in bird tissues. The LAMP technique provides a quick, highly responsive, and economical approach to diagnosing \u003cem\u003eT. gondii\u003c/em\u003e infection, improving diagnostic capacities. We achieved superior outcomes compared to the previous research investigations.\u003c/p\u003e \u003cp\u003eDurand et al. have demonstrated that this method is fast and accurate for detecting \u003cem\u003eT. gondii\u003c/em\u003e in complex samples. The DNA is amplified in a constant-temperature environment. The LAMP technique is more efficient than other molecular methods due to its lack of reliance on an expensive heat cycler. Additionally, it can amplify DNA in less than one hour, does not require probe labeling, and facilitates multiplexing [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe successful identification of \u003cem\u003eT. gondii\u003c/em\u003e in birds exhibiting neurological symptoms has significant implications for both veterinary and public health. Early detection and treatment of \u003cem\u003eT. gondii\u003c/em\u003e infections in birds can help prevent the spread of the parasite to humans and other animals, thereby reducing public health risks. Bahia et al. have demonstrated that importing foreign materials makes parasite transmission in developed countries possible. The increased population of cats, which can infect birds, raises the likelihood of environmental contamination with \u003cem\u003eT. gondii\u003c/em\u003e. This ultimately leads to higher risks of transmission through food and water, posing a threat to human health [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAn essential aspect of this study is its originality in using optimized LAMP to diagnose \u003cem\u003eT. gondii\u003c/em\u003e infection in birds. This innovative methodology tackles the constraints of traditional PCR technologies and presents a possible substitute for swift and precise diagnosis.\u003c/p\u003e \u003cp\u003eOther studies suggest that the convolutional approach needs improvement. Laboratories should employ Real-Time PCR (qPCR) to diagnose toxoplasmosis precisely. This technology quantifies \u003cem\u003eT. gondii\u003c/em\u003e in biological samples, allowing the detection of the protozoan in clinical settings. However, the complexity of the procedure needs improvement [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe results of this study have consequences for surveillance and control programs designed to manage the transmission of \u003cem\u003eT. gondii\u003c/em\u003e in bird populations. Using LAMP for prompt and precise detection can expedite timely intervention and preventive actions, thereby lessening the impact of \u003cem\u003eT. gondii\u003c/em\u003e infection in avian species.\u003c/p\u003e \u003cp\u003eThe comparative investigations provide a clear understanding of the enhanced specificity, sensitivity, and speed of the LAMP approach in comparison to other methods [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAlthough this study has achieved significant progress, it is essential to consider several limitations that should be considered for future research. Specifically, the study analyzed a limited number of bird species, and the sample size needed to be more significant. Subsequent investigations should enlarge the sample population by incorporating a more diverse array of avian hosts. In addition, the study predominantly concentrated on birds that displayed neurological symptoms, which may have resulted in the omission of asymptomatic carriers of \u003cem\u003eT. gondii.\u003c/em\u003e Upcoming research should prioritize examining asymptomatic birds to have a more comprehensive understanding of the prevalence of \u003cem\u003eT. gondii\u003c/em\u003e in avian communities.\u003c/p\u003e \u003cp\u003eAn issue that could be explored further is the transmission of \u003cem\u003eT. gondii\u003c/em\u003e from birds to humans and its potential connection to the development of epilepsy. \u003cem\u003eT. gondii\u003c/em\u003e possesses the capability to induce localized regions of atypical electrical activity in the brain, which can result in the development of epilepsy. Methods such as EEG and fMRI can pinpoint these specific areas, assisting in the identification and management, including surgical procedures [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eZavareh, Hadiipour, et al. provided evidence that administering \u003cem\u003eT. gondii\u003c/em\u003e to animals with tumors reduced the size of colon cancer. This discovery is consistent with other scientific findings suggesting that \u003cem\u003eT. gondii\u003c/em\u003e has considerable capacity to inhibit the growth of tumors. Further research should explore the possible association between \u003cem\u003eT. gondii\u003c/em\u003e infection in avian species and colon-related illnesses like cancer[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Neshatpour Esfahani demonstrated that investigating the impact of electrical stimulation on the colon might reveal significant connections between colon neurons and cancer progression [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. By considering these discoveries, we can develop research projects to reveal the impact of \u003cem\u003eT. gondii\u003c/em\u003e on the advancement of colon cancer by examining the electrical function of the colon.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eETHICAL STATEMENT\u003c/h2\u003e \u003cp\u003e The study received approval from the Ethical Committee of the Veterinary Department of Islamic Azad University, by institutional and national requirements for animal care. The bird samples, even those displaying neurological and subclinical signs, were handled compassionately, with tissue samples collected after death to prevent unnecessary harm. The research was carried out with a dedication to scientific integrity, ensuring that all data were reported truthfully to enhance our knowledge of \u003cem\u003eT. gondii\u003c/em\u003e in pet birds.\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eCONFLICT OF INTEREST\u003c/h2\u003e \u003cp\u003eThe authors affirm that the study was conducted without business relationships or financial associations, which could be seen as a possible conflict of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eM.N. (Mohammad Neshatpour Esfahani) was responsible for writing the main manuscript text and conducting the experimental work presented in the study. M.G. (Dr. Majid Gholami-Ahangaran) assisted with the experimental work in the laboratory and provided essential recommendations throughout the research process. W.J.S. (Dr. William J. Sullivan Jr.) contributed by offering guidance, reviewing the data, and critically evaluating the manuscript to ensure its accuracy and scientific integrity. All authors have reviewed and approved the final version of the manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eMachado DMR et al (2023) Serological and molecular investigations on Toxoplasma gondii and Leptospira spp. in bats captured in urban areas from Brazil. Emerg Anim Species 9:100033\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKoutsogiannis Z, Mina JG, Suman R, Denny PW (2023) Assessment of Toxoplasma gondii lytic cycle and the impact of a gene deletion using 3D label-free optical diffraction holotomography. Front Cell Infect Microbiol, 13\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZaki L et al (2024) Global prevalence of Toxoplasma gondii in birds: A systematic review and meta-analysis. Parasite Epidemiol Control, p. e00350\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBisetegn H et al (2023) Global seroprevalence of Toxoplasma gondii infection among patients with mental and neurological disorders: A systematic review and meta-analysis. Health Sci Rep 6(6):e1319\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaker TL et al (2023) Pre-existing Toxoplasma gondii infection increases susceptibility to pentylenetetrazol-induced seizures independent of traumatic brain injury in mice. Front Mol Neurosci 15:1079097\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWesołowski R, Pawłowska M, Smoguła M, Szewczyk-Golec K (2023) Advances and challenges in diagnostics of toxoplasmosis in HIV-infected patients, \u003cem\u003ePathogens\u003c/em\u003e, vol. 12, no. 1, p. 110\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMao R, Wu X, Miao Q, Cai T (2022) Asymmetric stem-loop\u0026ndash;mediated isothermal amplification of nucleic acids for DNA diagnostic assays by simple modification of canonical PCR primers. Front Bioeng Biotechnol 10:931770\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao F et al (2024) Rapid and reliable diagnosis of Moraxella catarrhalis infection using loop-mediated isothermal amplification-based testing. Front Bioeng Biotechnol 11:1330047\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlmuzaini AM (2023) Flow of Zoonotic Toxoplasmosis in Food Chain. Pakistan Veterinary J, 43, 1\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoh\u0026oacute;rquez JA et al (2024) Development of a new loop-mediated isothermal amplification test for the sensitive, rapid, and economic detection of different genotypes of Classical swine fever virus. Front Cell Infect Microbiol 14:1372166\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen C et al (2024) Global prevalence and risk factors associated with Toxoplasma gondii infection in wild birds: A systematic review and meta-analysis. Prev Vet Med, p. 106187\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeedan GS, Abdalhamed AM, Shaapan RM, El-Namaky AH (2022) Rapid diagnosis of Toxoplasma gondii using loop-mediated isothermal amplification assay in camels and small ruminants, \u003cem\u003eBeni-Suef University Journal of Basic and Applied Sciences\u003c/em\u003e, vol. 11, no. 1, p. 1\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi C et al (2023) Toxoplasma gondii adhesion and apoptosis of chicken erythrocytes. Anim Dis 3(1):28\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGouda MA et al (2023) Association between breakthrough infection with COVID-19 and Toxoplasma gondii: a cross-sectional study. Sci Rep 13(1):17636\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaki J, Zamanpour M, Najafian M, Mohammadpour N, Foroutan M (2021) Detection of acute and chronic Toxoplasma gondii infection among women with history of abortion in the Southwest of Iran, \u003cem\u003eJournal of Parasitology Research\u003c/em\u003e, vol. 2021\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOpsteegh M et al (2020) Methods to assess the effect of meat processing on viability of Toxoplasma gondii: towards replacement of mouse bioassay by in vitro testing. Int J Parasitol 50(5):357\u0026ndash;369\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMar\u0026iacute;n-Garc\u0026iacute;a P-J, Planas N, Llobat L (2022) Toxoplasma gondii in foods: prevalence, control, and safety, \u003cem\u003eFoods\u003c/em\u003e, vol. 11, no. 16, p. 2542\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNorouzi R, Dalimi A, Moghadam MF, Ghaffarifar F (2016) Comparison of a Nucleic Acid Sequence-based Amplification (NASBA) and real-time reverse transcriptase PCR methods for detection of Toxoplasma gondii in rat blood samples. J Zoonotic Dis 1(1):15\u0026ndash;23\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDurand L, La Carbona S, Geffard A, Possenti A, Dubey JP, Lalle M (2020) Comparative evaluation of loop-mediated isothermal amplification (LAMP) vs qPCR for detection of Toxoplasma gondii oocysts DNA in mussels. Exp Parasitol 208:107809\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSotiriadou I, Karanis P (2008) Evaluation of loop-mediated isothermal amplification for detection of Toxoplasma gondii in water samples and comparative findings by polymerase chain reaction and immunofluorescence test (IFT). Diagn Microbiol Infect Dis 62(4):357\u0026ndash;365\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSadjadi SM, Ebrahimzadeh E, Shams M, Seraji M, Soltanian-Zadeh H (2021) Localization of epileptic foci based on simultaneous EEG\u0026ndash;fMRI data. Front Neurol 12:645594\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZavareh FSE, Hadiipour M, Kalantari R, Mousavi S, Tavakolifard N, Darani HY (2021) Effect of Toxoplasma gondii on colon cancer growth in mouse model. Am J Biomed 9(2):168\u0026ndash;176\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNeshatpour Esfahani M (2017) Factors affecting the development of colon cancer and electrical stimulation of the colon. Int J Med Reviews 4(3):70\u0026ndash;75\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"acta-parasitologica","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"actp","sideBox":"Learn more about [Acta Parasitologica](http://link.springer.com/journal/11686)","snPcode":"11686","submissionUrl":"https://submission.springernature.com/new-submission/11686/3","title":"Acta Parasitologica","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Toxoplasma gondii, LAMP, PCR, brain, seizure","lastPublishedDoi":"10.21203/rs.3.rs-5008387/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5008387/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBACKGROUND\u003c/h2\u003e \u003cp\u003eThis study seeks to close this divide by assessing the occurrence of \u003cem\u003eToxoplasma gondii\u003c/em\u003e (\u003cem\u003eT. gondii\u003c/em\u003e) in the brain tissues of pet birds displaying neurological symptoms, utilizing Nested Polymerase Chain Reaction (PCR) and Loop-mediated Isothermal Amplification (LAMP) methods. Furthermore, it aims to evaluate and contrast the sensitivity and specificity of different diagnostic procedures. Seventy bird samples, consisting of 50 sick and 20 asymptomatic samples, were assessed using various methods. Brain tissue DNA was isolated and then analyzed using nested PCR and LAMP assays targeting the \u003cem\u003eT. gondii\u003c/em\u003e B1 gene and RE gene. Sensitivity and specificity assessments were conducted, and statistical evaluations were made using SPSS software.\u003c/p\u003e\u003ch2\u003eRESULTS\u003c/h2\u003e \u003cp\u003eNo \u003cem\u003eT. gondii\u003c/em\u003e cysts were detected in the smear preparations. \u003cem\u003eT. gondii\u003c/em\u003e DNA was discovered in 6% of the sick birds using nested PCR, while LAMP identified \u003cem\u003eT. gondii\u003c/em\u003e DNA in 8% of these individuals. Both techniques exhibited a high level of specificity; however, LAMP demonstrated higher sensitivity and faster processing times than nested PCR.\u003c/p\u003e\u003ch2\u003eCONCLUSION\u003c/h2\u003e \u003cp\u003eThe study indicates that LAMP is an efficient diagnostic method for quickly and accurately detecting \u003cem\u003eT. gondii\u003c/em\u003e in pet birds while also being cost-effective. The results emphasize the significance of molecular diagnostics in promptly identifying and treating toxoplasmosis in birds, which enhances our comprehension and regulation of the disease. To improve the surveillance and preventative strategies against \u003cem\u003eT. gondii\u003c/em\u003e infections, it is advisable to do additional studies using more extensive and diversified bird populations.\u003c/p\u003e","manuscriptTitle":"Detection of Toxoplasma Gondii in the Brain of Pet Birds by Seizures with Loop-Mediated Isothermal Amplification (LAMP)","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-10-18 09:11:19","doi":"10.21203/rs.3.rs-5008387/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-09-13T14:12:43+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-09-13T12:25:45+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"308531911170369236974548304529604409199","date":"2024-09-09T12:04:03+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-09-04T14:45:02+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-09-02T08:48:11+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-09-02T08:46:52+00:00","index":"","fulltext":""},{"type":"submitted","content":"Acta Parasitologica","date":"2024-08-31T10:04:05+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"acta-parasitologica","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"actp","sideBox":"Learn more about [Acta Parasitologica](http://link.springer.com/journal/11686)","snPcode":"11686","submissionUrl":"https://submission.springernature.com/new-submission/11686/3","title":"Acta Parasitologica","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"8bd468fe-dda3-4cc7-9b84-24c4ea208578","owner":[],"postedDate":"October 18th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-01-27T16:01:12+00:00","versionOfRecord":{"articleIdentity":"rs-5008387","link":"https://doi.org/10.1007/s11686-024-00983-z","journal":{"identity":"acta-parasitologica","isVorOnly":false,"title":"Acta Parasitologica"},"publishedOn":"2025-01-24 15:57:26","publishedOnDateReadable":"January 24th, 2025"},"versionCreatedAt":"2024-10-18 09:11:19","video":"","vorDoi":"10.1007/s11686-024-00983-z","vorDoiUrl":"https://doi.org/10.1007/s11686-024-00983-z","workflowStages":[]},"version":"v1","identity":"rs-5008387","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5008387","identity":"rs-5008387","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00