FXYD5 promotes the growth of glioblastoma by targeting the PI3K/AKT/ACSL4 signaling axis

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Glioblastoma (GBM) is the most malignant primary brain tumor, with few therapeutic therapy options. Abnormalities of FXYD5 have been reported in multiple malignancies, which proposes FXYD5 as a potential target for precision treatment. Here, we identified that FXYD5 was observably upregulated in GBM and inversely correlated with the prognosis of patients. Functional studies showed that the knockdown of FXYD5 suppressed GBM cell growth and progression in vitro , demonstrating that FXYD5 could be the target of GBM treatment. Through bioinformatic analysis, we found FXYD5 was associated with lipid metabolism and the PI3K/AKT signaling pathway. Mechanistically, knockdown of FXYD5 inhibited the activation of the PI3K/AKT signaling pathway, leading to suppression of the expression of lipid metabolism-related gene ACSL4 and level of lipid metabolism. Our study has shown that FXYD5 facilitates GBM progression and metastasis via the PI3K/AKT/ACSL4 signaling axis. Notably, inhibition of PI3K/AKT signal pathway could antagonize FXYD5 overexpression-induced subcutaneous tumorigenesis enlargement in the GBM mouse model. These findings revealed that FXYD5 was a potential therapeutic target in GBM.
Full text 93,550 characters · extracted from preprint-html · click to expand
FXYD5 promotes the growth of glioblastoma by targeting the PI3K/AKT/ACSL4 signaling axis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article FXYD5 promotes the growth of glioblastoma by targeting the PI3K/AKT/ACSL4 signaling axis Xuebin Hu, Bang Wang, Yong Qin, Hang Cheng, Yibin Zeng, Lianglei Jiang This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6967066/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Glioblastoma (GBM) is the most malignant primary brain tumor, with few therapeutic therapy options. Abnormalities of FXYD5 have been reported in multiple malignancies, which proposes FXYD5 as a potential target for precision treatment. Here, we identified that FXYD5 was observably upregulated in GBM and inversely correlated with the prognosis of patients. Functional studies showed that the knockdown of FXYD5 suppressed GBM cell growth and progression in vitro , demonstrating that FXYD5 could be the target of GBM treatment. Through bioinformatic analysis, we found FXYD5 was associated with lipid metabolism and the PI3K/AKT signaling pathway. Mechanistically, knockdown of FXYD5 inhibited the activation of the PI3K/AKT signaling pathway, leading to suppression of the expression of lipid metabolism-related gene ACSL4 and level of lipid metabolism. Our study has shown that FXYD5 facilitates GBM progression and metastasis via the PI3K/AKT/ACSL4 signaling axis. Notably, inhibition of PI3K/AKT signal pathway could antagonize FXYD5 overexpression-induced subcutaneous tumorigenesis enlargement in the GBM mouse model. These findings revealed that FXYD5 was a potential therapeutic target in GBM. Biological sciences/Cancer/Cancer therapy/Targeted therapies Biological sciences/Cancer/Oncogenes FXYD5 PI3K/AKT lipid metabolism GBM Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Glioblastoma (GBM), an intrinsic brain tumor thought to originate from glial stem or progenitor cells, increases with age and is higher in men[1, 2]. Gliomas account for 30% of primary brain tumors and 80% of all malignant ones[3]. GBM is the most prevalent and aggressive primary brain tumor in adults, which histopathologic traits are necrosis and endothelial proliferation, that lead to the attribution of the highest grade in the World Health Organization's (WHO) categorization system for brain tumors, grade IV[4]. The median overall survival rate for GBM ranges from 14.6 to 20.5 months, with less than 5% of patients living five years after diagnosis[5, 6]. Standard treatment procedures and classical immunotherapy are ineffective since they do not appreciably improve the long-term survival of glioblastoma patients. Therefore, a better understanding of abnormalities and therapeutic target is essential for GBM precision therapy. The FXYD domain-containing ion transport regulator 5 (FXYD5) gene is a cancer promoter, whose expression promotes metastasis in multiple tumors, like endometrial cancer, ovarian cancer, pancreatic and lung cancer, et al[7–9]. In comparison to normal tissues, FXYD5 expression was elevated in various cancerous tissues. Furthermore, FXYD5 overexpression was typically anticipative of poor patient survival[8]. Study found that the metastatic tumors had higher expression of FXYD5 than the original tumors, and blocking FXYD5 expression stopped cancer cells from invading, spreading, and proliferating[10–12]. Thus, our hypothesis is that FXYD5 has a significant impact on both development and metastasis in GBM. These suggested that the high expression of FXYD5 contributes to the formation of GBM and FXYD5-targeted therapy is a promising strategy for the treatment of GBM. Long-chain acyl-coenzyme A (CoA) synthase 4 (ACSL4), an enzyme that esterifies CoA into certain polyunsaturated fatty acids, such as arachidonic acid and adrenic acid, could contribute to the execution of ferroptosis by triggering phospholipid peroxidation[13]. Furthermore, fatty acid metabolism is crucially regulated by ACSL4, which also controls steroidogenesis, balances eicosanoid production, and may alter the phospholipid makeup of cell membranes[13]. Study has confirmed that inhibiting ACSL4 is associated with a reduction in phospholipids within mitochondrial membranes, enhancing cancer cell apoptosis[14]. Lipidomic study further revealed that activated ACSL4 catalyzes polyunsaturated fatty acid-containing lipid formation[15]. Moreover, ACSL4 could trigger metastatic extravasation by enhancing membrane fluidity and cellular invasiveness, promoting tumor development[16]. In our study, we found that the FXYD5 was upregulated and was essential for the survival and proliferation of GBM. Mechanically, we identified that FXYD5 boosted the expression of ACSL4 and increased the level of survival-promoting lipid metabolism and, which contributed to GBM cells development and migration. We also revealed FXYD5 could increase the expression of ACSL4 by activating the PI3K/AKT pathway leading to higher lipid metabolism levels in GBM cells. Briefly, we provided a potential new strategy to improve GBM treatment effectiveness via FXYD5/PI3K/AKT/ACSL4 signal pathway. Materials and Methods Cell culture LN229 and U251 were purchased from the Chinese Academy of Sciences Cell Bank (CASCB, China) and cultured in DMEM (Gibco, C11995500BT, USA) with 10% FBS (Gibco, 10099-141, USA). These cells were both confirmed by STR profiling analysis and were cultured in a 37°C cell incubator with 5% CO₂. Gene knockdown For gene knockdown, the short hairpin RNA (shRNA) was based on lentiviral vectors: shFXYD5 #1 (CGTTGAAAGATACCACGTCCA), shFXYD5 #2 (GAGACACACAAGAGCACCAAA), or shACSL4 (CGCTGCGTGAACGAGGGCTAT). Lentiviruses were produced in 293 T cells using cloned vectors, and LN229 or U251 cells were infected with shRNA lentiviruses. RNA extraction, reverse transcription and quantitative PCR (qRT-PCR) Total RNA was extracted using TRIzol (Thermo, 15596026CN, USA). Reverse transcription of total RNA was performed using reverse transcription kits (Vazyme, R233-01, China). qPCR was conducted using Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Q712-02, China). The relative expression of mRNA was quantified using the 2– ΔΔCt method. Western blot Western blot Cell lysates were prepared at 4°C using a RIPA lysis buffer supplemented with 1× phosphatase inhibitors and 1×protease inhibitors (Thermo, 89901, USA) and was quantified by BCA Protein Assay Kit (Meilunbio, MA0082, China). Western blotting was performed following a standardized protocol. Primary antibodies included anti-FXYD5 antibody (Biodragon, BD-PN2424, China), anti-ACSL4 antibody (Proteintech, 22401-1-AP, USA), anti-GPAT3 antibody (Proteintech, 20603-1-AP, USA), anti-SOAT antibody (abcam, ab307597, UK), anti-PI3K antibody (CST, Cat# 4249, USA), anti-phospho-PI3K antibody (CST, Cat# 13857, USA), anti-Akt antibody (CST, Cat# 4691, USA), anti-phospho-Akt antibody (CST, Cat# 4060, USA), anti-GAPDH antibody (Proteintech, Cat# 60004, USA). Anti-rabbit secondary antibody (abcam, ab6721, UK) and Anti-Mouse secondary antibody (abcam, ab205719, UK) were used at a dilution of 1:3000. Migration and invasion assay Migration assays were conducted using trans-well inserts (Corning, 3422, USA), with 5 × 10 4 LN229 cells or U251 cells placed in serum-free DMEM medium (Corning, 10-013-CV, USA) in the upper chamber and DMEM medium with 30% FBS in the lower chamber. After 24 h, migrated cells were fixed by 4% Tissue Fix Soution (meilunbio, MA0192, China), stained by 0.1% Crystal Violet Ammonium Oxalate Solution (Solarbio, G1063, China), and quantified. Lipid assay Lipid abundance and evaluation were examined by Lipid Droplets Red Fluorescence Assay Kit with Nile Red (Beyotime, C2051S, China). Moreover, Free fatty acids were detected by Amplex Red Free Fatty Acid Assay Kit (Beyotime, S0215S, China). The contents of total cholesterol (TC) and triglyceride (TG) in LN229 cells or U251 cells were analyzed using the corresponding commercial kit according to the manufacture's protocols (MEIBIAO, MB-3634A and MB-3858A, China). Bioinformatic analysis The clinical data were sourced from the TCGA-GBM database. Detection of differentially expressed genes (DEGs): the DESeq2 R package is employed to identify differentially expressed genes (DEGs) between two groups, with a threshold of |log2FoldChange| > 1 and an adjusted P-value < 0.05. Enrichment analysis: Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were conducted using “clusterProfiler” package. The adj.P-value < 0.05 and adj.q-value < 0.05 were considered statistically significant. We utilized the ssGSEA algorithm from the "GSVA" package to quantify enrichment scores of lipid metabolism-associated pathways and the PI3K/AKT pathway based on the MSigDB database, renowned for its curated gene sets. This approach facilitated the evaluation of the frequency and strength of lipid metabolism responses and the activation of the PI3K/AKT pathway in GBM samples. Animal models Male BALB/c nude mice, aged 4–6 weeks, were procured from Gem Pharmatech LLC., for the study. A volume of 3× 10 6 cells in PBS was subcutaneous injected using a 100 µl needle into the right lobe of the mouse (n = 5 per group). The PI3K/AKT inhibitor, (E)-Akt inhibitor-IV (100 µmol/kg), was injected subcutaneously on the 21st, 25th and 29th days after the GBM cells were inoculated. The mice were euthanized about 33 days later, and the size of the tumor was then determined. The tumors were then extracted and fixed for immunohistochemistry. Results FXYD5 is upregulated and is a potential therapeutic target in GBM with dismal prognosis in patients. To identify potential targets for the treatment of GBM, we analyzed gene expression profiles between normal tissue and GBM tumor tissue. FXYD5 has been reported showing significantly increased expression in tumors[17]. The TCGA dataset indicated a significant increase in FXYD5 mRNA levels in GBM tissue compared to normal tissue (Fig. 1 A). Importantly, GBM patients with higher FXYD5 expression were more prone to adverse events and had shorter survival time than patients with lower FXYD5 expression (Fig. 1 B). Taken together, FXYD5 was substantially elevated in GBM and negatively related to the prognosis of the GBM patients. Subsequently, we examined the functional roles of FXYD5 in GBM. After knock-downing the FXYD5 in GBM cell lines through RNA interference, the knockdown efficiency was obvious and the proliferation of GBM cells, both LN229 cell line and U251 cell line were impaired observably, with increasing level of apoptosis (Fig. 1 C-H). Trans-well assay also indicated that FXYD5 knockdown could inhibit metastasis of GBM cells (Fig. 1 I-J). Therefore, the expression of FXYD5 is closely related to growth and metastasis in GBM and could be the potential therapeutic target of GBM. FXYD5 enhances the expression of ACSL4 to promote lipid metabolism in GBM cells. To investigate the role of FXYD5 in the progression of GBM, we analyzed the mRNAs from high-FXYDH expression and low-FXYDH expression clusters. We observed that the lipid metabolism signaling pathway was significantly represented within the GO database, like phospholipid metabolic process, glycerolipid metabolic process, sphingolipid metabolic process, and lipid tranport process (Fig. 2 A). The ssGSEA Score assay also showed significant differences in lipid metabolism levels between the FXYD5-high and FXYD5-low expression groups (Fig. 2 B). Then we compared the distribution of Lipid metabolism-related genes expression between FXYD5-low or -high clusters (Fig. 2 C), finding ACSL4, GPAT3 and SOAT1 were significantly positively correlated with FXYD5 expression (Fig. 2 D). Glycerol-3-phosphate acyltransferase 3 (GPAT3) was a crucial liposynthase in the glycerol phosphate pathway, and its downstream metabolites, triacylglycerol and lysophosphatidic acid, were crucial components for the formation of lipid droplets[18]. Sterol O-acyltransferases (SOAT1) could synthesize cholesterol esters in the endoplasmic reticulum from cholesterol, which was the first step in the process of lipid droplet formation[19]. ACSL4 was an enzyme that esterifies CoA into specific polyunsaturated fatty acids, which was an essential regulator of fatty acid metabolism[13]. The significance of the lipid metabolism regulation in tumor growth and metastasis has been established in previous studies. Study has confirmed that lipid metabolism had emerged as necessary for GBM progression[20–23]. Therefore, our investigation focused on examining FXYD5 promotes GBM development by regulating lipid metabolism in GBM cells. Through lipid assay Nile and red indicator assay, we demonstrated that the level of fatty acid concentration (Fig. 2 E, Supplementary Fig. 1A), intracellular lipid titer (Fig. 2 F, Supplementary Fig. 1B), total cholesterol content and triglyceride content (Fig. 2 G, Supplementary Fig. 1C) were all significantly decrease after FXYD5 knockdown in GBM cells. Moreover, the mRNA (Fig. 2 H, Supplementary Fig. 1D) and protein (Fig. 2 I, Supplementary Fig. 1E) expression of lipid metabolism key genes ACSL4, GPAT3 and SOAT1 in GBM cells all decreased after FXYD5 knockdown. These results indicated that FXYD5 plays an important role in GBM development by regulating lipid metabolism. Furthermore, FXYD5 could promote the transcription and translation levels of lipid metabolism-related factors, ACSL4, GPAT3 and SOAT1. FXYD5 promotes lipid metabolism in GBM cells by regulating ACSL4 expression. Previous research has stablished the significance of ACSL4 control of fatty lipid metabolism in tumor development and metastasis[13, 24]. To explore the regulatory relationship between FXYD5 and ACSL4, we performed FXYD5 overexpression in ACSL4 knockdown GBM cells. The results demonstrated that, overexpression of FXYD5 in GBM cells could restore the mRNA and protein expression level of ACSL4 that were reduced by ACSL4 knockdown, without influencing FXYD5 expression (Fig. 3 A-D). The above results indicated that FXYD5 is the upstream factor of ACSL4 and could regulate the transcription and translation of ACSL4. Moreover, overexpression of FXYD5 in GBM cells could also restore the level of fatty acid concentration (Fig. 3 E, Supplementary Fig. 1F), intracellular lipid titer (Fig. 3 F, Supplementary Fig. 1G), total cholesterol content and triglyceride content (Fig. 3 G, Supplementary Fig. 1H) in GBM cells that were reduced by ACSL4 knockdown. These findings further confirmed the notion that FXYD5 advanced the intracellular lipid metabolism is hinged on its regulation of ACSL4 expression. FXYD5 regulated ACSL4 via activating the PI3K/AKT signaling pathway, promoting GBM development and metastasis. After analyzing the KEGG database, we found that the PI3K/AKT signaling pathway was also significantly enriched (Fig. 4 A). The ssGSEA Score assay showed significant differences in PI3K/AKT signal pathway between the FXYD5-high and FXYD5-low expression groups (Fig. 4 B-C). Study has proved the typical molecular changes in GBM include mutations in genes regulating PI3K signaling[4]. PI3K/Akt signaling pathway has been confirmed could be the targeted therapy for glioblastoma[25–27]. However, there have been no reports examining a regulatory relationship between FXYD5 and the PI3K/AKT pathway. Western blot analysis confirmed decreased expression of phosphorylated PI3K and AKT following FXYD5 knockdown in GBM cells, demonstrating that FXYD5 could activate PI3K/AKT pathway (Fig. 4 D-E). Furthermore, overexpression of FXYD5 in GBM cells could both restore the growth and metastasis of GBM cells that were treated by PI3K/AKT inhibitor (Fig. 4 F-G, Supplementary Fig. 2A-B), revealing that FXYD5 could potentially enhance the progression of GBM by activating the PI3K/AKT pathway. FXYD5 was the upstream factor of the PI3K/AKT pathway. Finally, Western blot analysis indicated that overexpressing FXYD5 could restore the protein expression of ACSL4 in GBM cells that were treated by PI3K/AKT inhibitor (Fig. 4 H-I). In conclusion, the findings suggested that targeting FXYD5 leads to decreased progression of GBM by suppressing the PI3K/AKT signaling pathway-mediated expression of ACSL4, then decreasing the lipid metabolism level in GBM cells. PI3K/AKT inhibitor treated GBM induced by FXYD5 overexpression in vivo. Some studies have reported that certain targets could activate the PI3K/AKT pathway, improving glioma or glioblastoma growth in vivo[28, 29]. However, no study has yet demonstrated that FXYD5 could promote the development of GBM through the PI3K/AKT pathway in vivo. To evaluate the therapeutic impact of FXYD5 on GBM in vivo, FXYD5 overexpressed-LN229 cells were subcutaneously injected in a murine model. Tumor size was measured starting 13 days after subcutaneous injection, and the PI3K/AKT inhibitor treatment group was able to inhibit tumor growth promoted by FXYD5 overexpression (Fig. 5 A). The final tumor size and weight of mice in the PI3K/AKT inhibitor treatment group was significantly smaller than that of mice in the FXYD5 overexpression group alone (Fig. 5 B-C). As expected, the study showed that PI3K/AKT inhibitor prevented tumor progression induced by FXYD5, which was further supported by IHC staining and analysis (Fig. 5 D). In final analysis, the findings suggested that targeting FXYD5 leads to decreased progression of GBM in vivo via the PI3K/AKT/ACSL4 pathway. Discussion GBM was a highly malignant malignancy of the central nervous system with short survival period, which was distinguished by rapid growth, widespread infiltration, and resistance to therapies[30]. GBM was usually treated with chemotherapy and radiotherapy[31, 32]. However, issues, such as chemoresistance and radio-resistance, still need to be addressed. The complexity and heterogeneity of GBM has long hampered therapeutic progress, but modern technologies, like single-cell and spatially resolved transcriptomics, are offering a new way to investigate these complicated malignancies[33]. The Cancer Genome Atlas (TCGA) presented a study examining the main mutation in GBM, according to which three major genetic events occur in GBM: RTK gene amplification and mutational activation, PI3K pathway activation, and p53 and retinoblastoma tumor suppressor pathway inactivation[34]. Numerous studies have demonstrated that targeting certain signaling pathways, like NF-κB signaling pathway, Wnt pathway, PI3K/AKT/mTOR signaling pathway could prevent the development of GBM[35]. Therefore, new more targeting therapies for GBM based on genes still need to be advocated. Several studies have documented the involvement of FXYD5 in the progression of various cancers[36, 37], without GBM. In this study, our analysis of public databases suggested a positive correlation between the expression of FXYD5 in GBM tissue samples from clinical cases. Besides, we found that knockdown of FXYD5 could increase the level of GBM cells apoptosis, suppressing the growth and migration of GBM cells. Nevertheless, further research was needed to elucidate the exact role of FXYD5 in promoting growth and metastasis in GBM. Results of bioinformatics analysis showed that lipid metabolism-related pathways were enriched in FXYD5 clusters and FXYD5 was significantly positively correlated with lipid metabolism-related factors ACSL4, GPAT3 and SOAT1. Subsequently, we confirmed that knocking down FXYD5 indeed could reduce the level of fatty acid concentration, intracellular lipid titer, total cholesterol content and triglyceride content in GBM cells. ACSL4, an essential regulator of fatty acid metabolism, might be a potential therapeutic target for tumor[13]. Knockdown of FXYD5 could inhibit the transcription and translation of ACSL4. Furthermore, overexpression of FXYD5 could similarly restore the decreased lipid metabolism level caused by ACSL4-knockdown, demonstrating that FXYD5, as the upstream factor of ACSL4, could influence the lipid metabolism level of GBM cells by regulating the gene expression of ACSL4. Targeting PI3K/AKT signaling pathway was a successful therapeutic strategy in GBM[27]. Study has reported that activation of PI3K/AKT signaling lead to the stemness of GBM cells increases[38]. Anti-tumor agents have found inducing both apoptosis and autophagy in GBM via affecting PI3K/Akt/mTOR axis. Sinomenine ester derivative, a suppressor of GBM progression, inhibited PI3K/Akt/mTOR pathway to induce apoptosis and autophagy via mitochondrial pathway in reducing GBM progression[39]. Punicic acid, another anti-cancer agent, was utilized in inducing apoptosis and decreasing metastasis of GBM cells by suppressing PI3K/AKT/mTOR axis[40–42]. Our bioinformatics investigation also revealed the connection between FXYD5 and the PI3K/AKT pathway. We found knockdown of FXYD5 could inhibit the activation of PI3K/AKT pathway. Moreover, PI3K/AKT inhibitor similarly restored the growth and migration of GBM cells and increased expression of ACSL4 caused by overexpression of FXYD5, which demonstrated that FXYD5 could affect the transcription and translation of ACSL4 via PI3K/AKT pathway, then influencing the progression of GBM. This study elucidated the role of the FXYD5/PI3K/AKT/ACSL4 signaling pathway in facilitating development and metastasis in GBM. In summary, our study identified that FXYD5 was a potential therapeutic target in GBM. Our research findings indicate that the FXYD5 could trigger the activation of the PI3K/AKT signaling pathway. The expression of FXYD5 lead to the activation of the PI3K/AKT signaling pathway, subsequently enhancing the expression of lipid metabolism-related factor ACSL4, advancing lipid metabolism, thereby facilitating GBM tumor development and metastasis. Targeting FXYD5 could inhibit the activation of PI3K/AKT pathway, which decreased the expression of lipid metabolism-related gene ACSL4, then preventing the lipid metabolism in GBM cells. The FXYD5/PI3K/AKT/ACSL4 signaling cascade is significantly involved in treating GBM. These results suggested that targeting this signaling cascade may hold promise as a therapeutic strategy for GBM. Declarations Data Availability Statement The datasets used and analyzed during the current study are available from the corresponding author upon reasonable request. Author C ontributions BW, YQ and HC performed the experiments, wrote the paper, and analyzed the data. YZ and LG helped analyze the data. XH designed and supervised the study. All authors read and approved the final manuscript. Funding No financial assistance was received in support of the study. Ethics declarations Competing interests The authors declare no competing interests. Ethics approval This study was conducted in accordance with relevant guidelines and regulations. For animal experiments, approval was obtained from the Hubei Provincial Center for Disease Control and Prevention (Approval No. 202510218). References Le Rhun E, Preusser M, Roth P, Reardon DA, van den Bent M, Wen P et al : Molecular targeted therapy of glioblastoma. Cancer Treat Rev 2019, 80:101896. Weller M, Wick W, Aldape K, Brada M, Berger M, Pfister SM et al : Glioma. Nat Rev Dis Primers 2015, 1:15017. Barnholtz-Sloan JS, Ostrom QT, Cote D: Epidemiology of Brain Tumors. Neurol Clin 2018, 36(3):395-419. Wirsching HG, Galanis E, Weller M: Glioblastoma. Handb Clin Neurol 2016, 134:381-397. Gilbert MR, Wang M, Aldape KD, Stupp R, Hegi ME, Jaeckle KA et al : Dose-dense temozolomide for newly diagnosed glioblastoma: a randomized phase III clinical trial. J Clin Oncol 2013, 31(32):4085-4091. Tan AC, Ashley DM, López GY, Malinzak M, Friedman HS, Khasraw M: Management of glioblastoma: State of the art and future directions. CA Cancer J Clin 2020, 70(4):299-312. Besso MJ, Rosso M, Lapyckyj L, Moiola CP, Matos ML, Mercogliano MF et al : FXYD5/Dysadherin, a Biomarker of Endometrial Cancer Myometrial Invasion and Aggressiveness: Its Relationship With TGF-β1 and NF-κB Pathways. Front Oncol 2019, 9:1306. Bai Y, Li LD, Li J, Chen RF, Yu HL, Sun HF et al : A FXYD5/TGF‑β/SMAD positive feedback loop drives epithelial‑to‑mesenchymal transition and promotes tumor growth and metastasis in ovarian cancer. Int J Oncol 2020, 56(1):301-314. Hotta T, Nariai Y, Kajitani N, Kadota K, Maruyama R, Tajima Y et al : Generation of the novel anti-FXYD5 monoclonal antibody and its application to the diagnosis of pancreatic and lung cancer. Biochimie 2023, 208:160-169. Mao Y, Hu Y, Meng H, Qin J, An Q, Zhang C et al : FXYD5 regulates gastric cancer cell metastasis and drug resistance by EMT modulation. Cancer Gene Ther 2025, 32(3):318-326. Lubarski-Gotliv I, Dey K, Kuznetsov Y, Kalchenco V, Asher C, Garty H: FXYD5 (dysadherin) may mediate metastatic progression through regulation of the β-Na(+)-K(+)-ATPase subunit in the 4T1 mouse breast cancer model. Am J Physiol Cell Physiol 2017, 313(1):C108-c117. Juurikka K, Dufour A, Pehkonen K, Mainoli B, Campioni Rodrigues P, Solis N et al : MMP8 increases tongue carcinoma cell-cell adhesion and diminishes migration via cleavage of anti-adhesive FXYD5. Oncogenesis 2021, 10(5):44. Ding K, Liu C, Li L, Yang M, Jiang N, Luo S et al : Acyl-CoA synthase ACSL4: an essential target in ferroptosis and fatty acid metabolism. Chin Med J (Engl) 2023, 136(21):2521-2537. Li YJ, Fahrmann JF, Aftabizadeh M, Zhao Q, Tripathi SC, Zhang C et al : Fatty acid oxidation protects cancer cells from apoptosis by increasing mitochondrial membrane lipids. Cell Rep 2022, 39(9):110870. Zhang HL, Hu BX, Li ZL, Du T, Shan JL, Ye ZP et al : PKCβII phosphorylates ACSL4 to amplify lipid peroxidation to induce ferroptosis. Nat Cell Biol 2022, 24(1):88-98. Wang Y, Hu M, Cao J, Wang F, Han JR, Wu TW et al : ACSL4 and polyunsaturated lipids support metastatic extravasation and colonization. Cell 2025, 188(2):412-429.e427. Biasiotta A, D'Arcangelo D, Passarelli F, Nicodemi EM, Facchiano A: Ion channels expression and function are strongly modified in solid tumors and vascular malformations. J Transl Med 2016, 14(1):285. Wang Y, Xu C, Yang X, Liu X, Guo Z, Lin X et al : Glycerol-3-phosphate acyltransferase 3-mediated lipid droplets accumulation confers chemoresistance of colorectal cancer. MedComm (2020) 2024, 5(2):e486. Kou Y, Geng F, Guo D: Lipid Metabolism in Glioblastoma: From De Novo Synthesis to Storage. Biomedicines 2022, 10(8). Lee H, Kim D, Youn B: Targeting Oncogenic Rewiring of Lipid Metabolism for Glioblastoma Treatment. Int J Mol Sci 2022, 23(22). Minami JK, Morrow D, Bayley NA, Fernandez EG, Salinas JJ, Tse C et al : CDKN2A deletion remodels lipid metabolism to prime glioblastoma for ferroptosis. Cancer Cell 2023, 41(6):1048-1060.e1049. Shakya S, Gromovsky AD, Hale JS, Knudsen AM, Prager B, Wallace LC et al : Altered lipid metabolism marks glioblastoma stem and non-stem cells in separate tumor niches. Acta Neuropathol Commun 2021, 9(1):101. Broadfield LA, Pane AA, Talebi A, Swinnen JV, Fendt SM: Lipid metabolism in cancer: New perspectives and emerging mechanisms. Dev Cell 2021, 56(10):1363-1393. Lei Z, Luo Y, Lu J, Fu Q, Wang C, Chen Q et al : FBXO22 promotes HCC angiogenesis and metastasis via RPS5/AKT/HIF-1α/VEGF-A signaling axis. Cancer Gene Ther 2025, 32(2):198-213. Li X, Wu C, Chen N, Gu H, Yen A, Cao L et al : PI3K/Akt/mTOR signaling pathway and targeted therapy for glioblastoma. Oncotarget 2016, 7(22):33440-33450. Barzegar Behrooz A, Talaie Z, Jusheghani F, Łos MJ, Klonisch T, Ghavami S: Wnt and PI3K/Akt/mTOR Survival Pathways as Therapeutic Targets in Glioblastoma. Int J Mol Sci 2022, 23(3). Hashemi M, Etemad S, Rezaei S, Ziaolhagh S, Rajabi R, Rahmanian P et al : Progress in targeting PTEN/PI3K/Akt axis in glioblastoma therapy: Revisiting molecular interactions. Biomed Pharmacother 2023, 158:114204. Zhang D, Wang X, Wang X, Wang Z, Ma S, Zhang C et al : CPNE3 regulates the cell proliferation and apoptosis in human Glioblastoma via the activation of PI3K/AKT signaling pathway. J Cancer 2021, 12(24):7277-7286. Zhang A, Peng S, Sun S, Ye S, Zhao Y, Wu Q: NRBP1 promotes malignant phenotypes of glioblastoma by regulating PI3K/Akt activation. Cancer Med 2024, 13(16):e70100. Yabo YA, Heiland DH: Understanding glioblastoma at the single-cell level: Recent advances and future challenges. PLoS Biol 2024, 22(5):e3002640. Jemal A, Siegel R, Xu J, Ward E: Cancer statistics, 2010. CA: a cancer journal for clinicians 2010, 60(5):277-300. Broekman ML, Maas SL, Abels ER, Mempel TR, Krichevsky AM, Breakefield XO: Multidimensional communication in the microenvirons of glioblastoma. Nature Reviews Neurology 2018, 14(8):482-495. Aldape K, Brindle KM, Chesler L, Chopra R, Gajjar A, Gilbert MR et al : Challenges to curing primary brain tumours. Nat Rev Clin Oncol 2019, 16(8):509-520. Comprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature 2008, 455(7216):1061-1068. Khabibov M, Garifullin A, Boumber Y, Khaddour K, Fernandez M, Khamitov F et al : Signaling pathways and therapeutic approaches in glioblastoma multiforme (Review). Int J Oncol 2022, 60(6). Xie H, Li J, Lu M, Zhang R, Mao H: miR-1180 Targets FXYD5 to Regulate Pancreatic Cancer Cells Migration and Invasion. Mol Biotechnol 2024, 66(11):3182-3194. Zhao E, Gao K, Xiong J, Liu Z, Chen Y, Yi L: The roles of FXYD family members in ovarian cancer: an integrated analysis by mining TCGA and GEO databases and functional validations. J Cancer Res Clin Oncol 2023, 149(19):17269-17284. Yao Y, Xue Y, Ma J, Shang C, Wang P, Liu L et al : MiR-330-mediated regulation of SH3GL2 expression enhances malignant behaviors of glioblastoma stem cells by activating ERK and PI3K/AKT signaling pathways. PloS one 2014, 9(4):e95060. Zheng X, Li W, Xu H, Liu J, Ren L, Yang Y et al : Sinomenine ester derivative inhibits glioblastoma by inducing mitochondria-dependent apoptosis and autophagy by PI3K/AKT/mTOR and AMPK/mTOR pathway. Acta Pharmaceutica Sinica B 2021, 11(11):3465-3480. Gasmi J, Sanderson JT: Growth inhibitory, antiandrogenic, and pro-apoptotic effects of punicic acid in LNCaP human prostate cancer cells. Journal of agricultural and food chemistry 2010, 58(23):12149-12156. Wang L, Li W, Lin M, Garcia M, Mulholland D, Lilly M et al : Luteolin, ellagic acid and punicic acid are natural products that inhibit prostate cancer metastasis. Carcinogenesis 2014, 35(10):2321-2330. Mete M, Unsal UU, Aydemir I, Sönmez PK, Tuglu MI: Punicic acid inhibits glioblastoma migration and proliferation via the PI3K/AKT1/mTOR signaling pathway. Anti-Cancer Agents in Medicinal Chemistry (Formerly Current Medicinal Chemistry-Anti-Cancer Agents) 2019, 19(9):1120-1131. Additional Declarations There is NO conflict of interest to disclose. Supplementary Files WB1.tif western blot data1 WB2.tif western blot data2 WB3.tif western blot data3 WB4.tif western blot data4 WB5.tif western blot data5 WB6.tif western blot data6 WB7.tif western blot data7 qPCRdata.xlsx qPCR data WB8.tif western blot data8 FigS1.tif Fig. S1 A Level of free Fatty Acid concentration of U251 cells after FXYD5 knockdown. B Nile Red indicator assay evaluating the effect of FXYD5 knockdown on intracellular lipid titer in U251 cells. C Level of total cholesterol content and triglyceride content of U251 cells after FXYD5 knockdown. D mRNA expression of lipid metabolism, ACSL4, GPAT3 and SOAT1 in U251 cells after overexpression of FXYD5 and knockdown of ACSL4. E Western blot analysis of ACSL4, GPAT3 and SOAT1 protein expression in U251 cells after overexpression of FXYD5 and knockdown of ACSL4. F Level of free Fatty Acid concentration of U251 cells after overexpression of FXYD5 and knockdown of ACSL4.G Nile Red indicator assay evaluating the effect of overexpression of FXYD5 and knockdown of ACSL4 on intracellular lipid titer in U251 cells. H Level of total cholesterol content and triglyceride content of U251 cells after overexpression of FXYD5 and knockdown of ACSL4. Data are mean ± SD (Two-tailed unpaired Student’s t test, *** p < 0.001). FigS2.tif Fig. S2 A Relative cell growth of U251 cells after overexpression of FXYD5 and using PI3K/AKT inhibitor. B Trans-well assays demonstrated the inhibition of migratory and invasive capabilities in U251 cells after overexpression of FXYD5 and using PI3K/AKT inhibitor. Data are mean ± SD (Two-tailed unpaired Student’s t test, *** p < 0.001). Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6967066","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":485930193,"identity":"6bddf2df-eb07-414b-aa08-d84b4ae8d9ed","order_by":0,"name":"Xuebin Hu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA4UlEQVRIie3OoY7CQBCA4d2QtGYfYAk5eIXZVFxIeZip6ZoWjUAMBtXkbB+jjuA2NKGmh65AcOYwCHAYCCSoE5TFndg/GTHJfMkw5nL9w4AJ/3y6jvrw2DtWhHVzLw7uhJM16QlvFRXW5FOmBoQweiH1fscmYUT+t2klw2yDKOU2XeaJIlbriMQY2x+rMjAAv2nRJJz4vIxICmgnpVCEWGpo9A/xqw2psoAZUyI0qIiTDak3MZ9RrIr6oHJc62AukhekSdedC40GUOnd8TgNP778up38De/jvXHvcrlcrifdALpVSz5fQI03AAAAAElFTkSuQmCC","orcid":"","institution":"Department of Neurosurgery, Union Hospital, Tongji Medical College, Huazhong University of Science and Technology","correspondingAuthor":true,"prefix":"","firstName":"Xuebin","middleName":"","lastName":"Hu","suffix":""},{"id":485930194,"identity":"58326e89-2d8b-4bd5-a939-ab9991b3e19b","order_by":1,"name":"Bang Wang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Bang","middleName":"","lastName":"Wang","suffix":""},{"id":485930195,"identity":"0be175c8-0ad2-4fba-bf53-630a4e1b65e1","order_by":2,"name":"Yong Qin","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yong","middleName":"","lastName":"Qin","suffix":""},{"id":485930196,"identity":"c4b5cea0-c3e3-4ec4-a2f8-d827306c83a2","order_by":3,"name":"Hang Cheng","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Hang","middleName":"","lastName":"Cheng","suffix":""},{"id":485930197,"identity":"7822962a-a537-408e-b735-d9a8774db3fb","order_by":4,"name":"Yibin Zeng","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Yibin","middleName":"","lastName":"Zeng","suffix":""},{"id":485930198,"identity":"3a08ea7c-d424-4627-bf2a-eca726c7812f","order_by":5,"name":"Lianglei Jiang","email":"","orcid":"","institution":"","correspondingAuthor":false,"prefix":"","firstName":"Lianglei","middleName":"","lastName":"Jiang","suffix":""}],"badges":[],"createdAt":"2025-06-24 15:06:24","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6967066/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6967066/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":87359673,"identity":"4b632efc-406e-4c10-b2a6-bb62683ea135","added_by":"auto","created_at":"2025-07-23 05:40:31","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":5457479,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFXYD5 is upregulated in GBM with the prognosis of patients and promtes GBM cell growth in vitro.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eAnalysis of FXYD5 mRNA expression in tumor and normal tissues in glioblastoma using TCGA data. \u003cstrong\u003eB \u003c/strong\u003eKaplan-Meier survival curves for overall survival comparing the low-FXYD5 and high-FXYD5 groups within the TCGA training dataset. \u003cstrong\u003eC\u003c/strong\u003e Western blot analysis of FXYD5 protein expression following FXYD5 knockdown in LN229 cells. \u003cstrong\u003eD\u003c/strong\u003eRelative cell growth of LN229 cells after FXYD5 knockdown. \u003cstrong\u003eE\u003c/strong\u003e Apoptosis rate (%) of LN229 cells after FXYD5 knockdown.\u003cstrong\u003e F\u003c/strong\u003e Western blot analysis of FXYD5 protein expression following FXYD5 knockdown in U251 cells. \u003cstrong\u003eG\u003c/strong\u003e Relative cell growth of U251 cells after FXYD5 knockdown. \u003cstrong\u003eH \u003c/strong\u003eApoptosis rate (%) of U251 cells after FXYD5 knockdown.\u003cstrong\u003e I-J \u003c/strong\u003eTrans-well assays demonstrated the inhibition of migratory and invasive capabilities in LN229 (\u003cstrong\u003eI\u003c/strong\u003e) and U251 (\u003cstrong\u003eJ\u003c/strong\u003e) cells with FXYD5 knockdown. Statistical significance was determined using unpaired t-test. The p-values are denoted by asterisks as follows: *** p \u0026lt; 0.001, **** p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Fig1.png","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/ebb7382de420f9527ea221ac.png"},{"id":87359669,"identity":"e3e197c0-a82b-44a8-a1bd-211362e74f3e","added_by":"auto","created_at":"2025-07-23 05:40:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2936742,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFXYD5 promotes GBM tumor development by upregulating lipid metabolism.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eThe GO analysis of the differentially expressed genes (DEGs). \u003cstrong\u003eB\u003c/strong\u003e ssGSEA Score of Lipid metabolic pathway between FXYD5-low or -high clusters. \u003cstrong\u003eC\u003c/strong\u003e Comparison of the distribution of Lipid metabolism-related genes expression between FXYD5-low or -high clusters. \u003cstrong\u003eD\u003c/strong\u003e Correlation analysis of positively correlation between FXYD5 and the key genes of lipid metabolism, ACSL4, GPAT3 and SOAT1. \u003cstrong\u003eE\u003c/strong\u003eLevel of free Fatty Acid concentration of LN229 cells after FXYD5 knockdown. \u003cstrong\u003eF\u003c/strong\u003eNile Red indicator assay evaluating the effect of FXYD5 knockdown on intracellular lipid titer in LN229 cells.\u003cstrong\u003e G\u003c/strong\u003e Level of total cholesterol content and triglyceride content of LN229 cells after FXYD5 knockdown. \u003cstrong\u003eH\u003c/strong\u003e mRNA expression of lipid metabolism key genes, ACSL4, GPAT3 and SOAT1 in LN229 cells after FXYD5 knockdown. \u003cstrong\u003eI\u003c/strong\u003e Western blot analysis of ACSL4, GPAT3 and SOAT1 protein expression in LN229 cells after FXYD5 knockdown. The p-values are denoted by asterisks as follows: * p \u0026lt; 0.1, ** p \u0026lt; 0.01, *** p \u0026lt; 0.001, **** p \u0026lt; 0.0001.\u003c/p\u003e","description":"","filename":"Fig2.png","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/45d8651039979a312c34bc9b.png"},{"id":87360662,"identity":"977cea86-b1aa-44f3-b8eb-b66b2389588c","added_by":"auto","created_at":"2025-07-23 05:48:31","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3923865,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFXYD5 affects intracellular lipid metabolism in GBM cells via ACSL4 factor.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e mRNA expression of FXYD5 and ACSL4 in LN229 cells after overexpression of FXYD5 and knockdown of ACSL4. \u003cstrong\u003eB \u003c/strong\u003eWestern blot analysis of FXYD5 and ACSL4 protein expression in LN229 cells after overexpression of FXYD5 and knockdown of ACSL4. \u003cstrong\u003eC\u003c/strong\u003e mRNA expression of FXYD5 and ACSL4 in U251 cells after overexpression of FXYD5 and knockdown of ACSL4. \u003cstrong\u003eD \u003c/strong\u003eWestern blot analysis of FXYD5 and ACSL4 protein expression in U251 cells after overexpression of FXYD5 and knockdown of ACSL4. \u003cstrong\u003eE \u003c/strong\u003eLevel of free Fatty Acid concentration of LN229 cells after overexpression of FXYD5 and knockdown of ACSL4. \u003cstrong\u003eF \u003c/strong\u003eNile Red indicator assay evaluating the effect of overexpression of FXYD5 and knockdown of ACSL4 on intracellular lipid titer in LN229 cells.\u003cstrong\u003e G\u003c/strong\u003e Level of total cholesterol content and triglyceride content of LN229 cells after overexpression of FXYD5 and knockdown of ACSL4. Data are mean ± SD (Two-tailed unpaired Student’s t test, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"Fig3.png","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/84feb220d646b933257d6f34.png"},{"id":87359675,"identity":"f9b9b7fc-a183-4c7b-b60a-bbcd61bdd17e","added_by":"auto","created_at":"2025-07-23 05:40:31","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":4348052,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFXYD5 promotes GBM tumor development by upregulating lipid metabolism through the PI3K/AKT/ACSL4 signaling pathway.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eThe KEGG analysis of the differentially expressed genes (DEGs). \u003cstrong\u003eB-C\u003c/strong\u003e ssGSEA Score of PI3K/AKT pathway between FXYD5-low or -high clusters. \u003cstrong\u003eD-E\u003c/strong\u003e Western blot analysis of PI3K, AKT and phosphorylated PI3K, AKT protein expression in LN229 (\u003cstrong\u003eD\u003c/strong\u003e) and U251 (\u003cstrong\u003eE\u003c/strong\u003e) cells after FXYD5 knockdown. \u003cstrong\u003eF\u003c/strong\u003e Relative cell growth of LN229 cells after overexpression of FXYD5 and using PI3K/AKT inhibitor.\u003cstrong\u003e G\u003c/strong\u003eTrans-well assays demonstrated the inhibition of migratory and invasive capabilities in LN229 cells after overexpression of FXYD5 and using PI3K/AKT inhibitor. \u003cstrong\u003eH-I\u003c/strong\u003e Western blot analysis of FXYD5 and ACSL4 protein expression in LN229 (\u003cstrong\u003eH\u003c/strong\u003e) and U251 (\u003cstrong\u003eI\u003c/strong\u003e) cells after overexpression of FXYD5 and using PI3K/AKT inhibitor. Data are mean ± SD (Two-tailed unpaired Student’s t test, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"Fig4.png","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/251bfe301ee32b7be8593e89.png"},{"id":87359686,"identity":"887221a2-4417-4a4b-b390-de8482143415","added_by":"auto","created_at":"2025-07-23 05:40:31","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":7497907,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003ePI3K/AKT inhibitors have an inhibitory effect on GBM tumor development induced by overexpression of FXYD5 in vivo.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eTumor volume by subcutaneous injection of LN299 cells. \u003cstrong\u003eB \u003c/strong\u003eTumor weight by subcutaneous injection of LN299 cells. \u003cstrong\u003eC\u003c/strong\u003e Representative image of a subcutaneous tumor in a mouse model. \u003cstrong\u003eD\u003c/strong\u003e Tumor section by subcutaneous injection of LN299 cells. Data are mean ± SD (Two-tailed unpaired Student’s t test, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"Fig5.png","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/88692d3f8f720cc4309afa41.png"},{"id":102298544,"identity":"ad8cbaaa-fc3a-4ba8-9ca9-0ff2d6baec06","added_by":"auto","created_at":"2026-02-10 10:44:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3212277,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/94f6afed-0614-41e8-8d13-c2350107c0c4.pdf"},{"id":87359667,"identity":"cf634fef-84dc-42e9-8eb0-e5638643943b","added_by":"auto","created_at":"2025-07-23 05:40:31","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":878246,"visible":true,"origin":"","legend":"western blot data1","description":"","filename":"WB1.tif","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/63760df5f70c2bc8f9e9352b.tif"},{"id":87359666,"identity":"d600802a-28e2-421a-a1f2-ce15243e3a40","added_by":"auto","created_at":"2025-07-23 05:40:31","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":878246,"visible":true,"origin":"","legend":"western blot data2","description":"","filename":"WB2.tif","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/bf6c44fe730ab096bd567d72.tif"},{"id":87359671,"identity":"8baa6f5f-9b42-4438-bc03-6c0354ad0013","added_by":"auto","created_at":"2025-07-23 05:40:31","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":878246,"visible":true,"origin":"","legend":"\u003cp\u003ewestern blot data3\u003c/p\u003e","description":"","filename":"WB3.tif","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/6bb13f6c9317ebd7b54027ea.tif"},{"id":87360667,"identity":"10c8313b-ef5d-443d-b675-63bde654f8b2","added_by":"auto","created_at":"2025-07-23 05:48:32","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":878246,"visible":true,"origin":"","legend":"western blot data4","description":"","filename":"WB4.tif","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/8b4cd75de8a73c94f2d083d6.tif"},{"id":87359694,"identity":"2150b768-42ca-48fe-9a5e-00a3655d81cc","added_by":"auto","created_at":"2025-07-23 05:40:32","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":878246,"visible":true,"origin":"","legend":"western blot data5","description":"","filename":"WB5.tif","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/f1877751020d5478b7fa22f0.tif"},{"id":87362652,"identity":"12af88ab-61db-40fe-b0bb-514783167f1f","added_by":"auto","created_at":"2025-07-23 05:56:31","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":878246,"visible":true,"origin":"","legend":"western blot data6","description":"","filename":"WB6.tif","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/bb2a7c1e74fed16dedceb9ae.tif"},{"id":87359678,"identity":"24f326cc-71f2-4fe9-befa-876bc5a51133","added_by":"auto","created_at":"2025-07-23 05:40:31","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":878246,"visible":true,"origin":"","legend":"western blot data7","description":"","filename":"WB7.tif","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/65a7a8894c64a261dad23e74.tif"},{"id":87359684,"identity":"6a704207-3166-4c1b-8c40-ab87e8432003","added_by":"auto","created_at":"2025-07-23 05:40:31","extension":"xlsx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":15721,"visible":true,"origin":"","legend":"\u003cp\u003eqPCR data\u003c/p\u003e","description":"","filename":"qPCRdata.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/0f32bacea0dc0ad5307ca8c6.xlsx"},{"id":87359699,"identity":"04dafdff-0f15-44b3-aed1-06873e8f8502","added_by":"auto","created_at":"2025-07-23 05:40:32","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":878246,"visible":true,"origin":"","legend":"\u003cp\u003ewestern blot data8\u003c/p\u003e","description":"","filename":"WB8.tif","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/a815a9ef3a5e84f812b8ac04.tif"},{"id":87359693,"identity":"bdda68ee-10d0-4ada-81c6-10a5cafe50fa","added_by":"auto","created_at":"2025-07-23 05:40:32","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":11648900,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. S1\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eLevel of free Fatty Acid concentration of U251 cells after FXYD5 knockdown. \u003cstrong\u003eB\u003c/strong\u003e Nile Red indicator assay evaluating the effect of FXYD5 knockdown on intracellular lipid titer in U251 cells. \u003cstrong\u003eC\u003c/strong\u003e Level of total cholesterol content and triglyceride content of U251 cells after FXYD5 knockdown. \u003cstrong\u003eD\u003c/strong\u003e mRNA expression of lipid metabolism, ACSL4, GPAT3 and SOAT1 in U251 cells after overexpression of FXYD5 and knockdown of ACSL4. \u003cstrong\u003eE\u003c/strong\u003e Western blot analysis of ACSL4, GPAT3 and SOAT1 protein expression in U251 cells after overexpression of FXYD5 and knockdown of ACSL4. \u003cstrong\u003eF\u003c/strong\u003e Level of free Fatty Acid concentration of U251 cells after overexpression of FXYD5 and knockdown of ACSL4.\u003cstrong\u003eG\u003c/strong\u003e Nile Red indicator assay evaluating the effect of overexpression of FXYD5 and knockdown of ACSL4 on intracellular lipid titer in U251 cells. \u003cstrong\u003eH\u003c/strong\u003e Level of total cholesterol content and triglyceride content of U251 cells after overexpression of FXYD5 and knockdown of ACSL4. Data are mean ± SD (Two-tailed unpaired Student’s t test, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"FigS1.tif","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/a1dff7b1bd482924379c10b7.tif"},{"id":87359703,"identity":"cd782f13-5605-41aa-a74f-33cb157c1215","added_by":"auto","created_at":"2025-07-23 05:40:32","extension":"tif","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":6277708,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFig. S2\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA \u003c/strong\u003eRelative cell growth of U251 cells after overexpression of FXYD5 and using PI3K/AKT inhibitor. \u003cstrong\u003eB\u003c/strong\u003e Trans-well assays demonstrated the inhibition of migratory and invasive capabilities in U251 cells after overexpression of FXYD5 and using PI3K/AKT inhibitor. Data are mean ± SD (Two-tailed unpaired Student’s t test, *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001).\u003c/p\u003e","description":"","filename":"FigS2.tif","url":"https://assets-eu.researchsquare.com/files/rs-6967066/v1/7b4e4fa3a8e98893635bddf0.tif"}],"financialInterests":"There is \u003cb\u003eNO\u003c/b\u003e conflict of interest to disclose.","formattedTitle":"FXYD5 promotes the growth of glioblastoma by targeting the PI3K/AKT/ACSL4 signaling axis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGlioblastoma (GBM), an intrinsic brain tumor thought to originate from glial stem or progenitor cells, increases with age and is higher in men[1, 2]. Gliomas account for 30% of primary brain tumors and 80% of all malignant ones[3]. GBM is the most prevalent and aggressive primary brain tumor in adults, which histopathologic traits are necrosis and endothelial proliferation, that lead to the attribution of the highest grade in the World Health Organization's (WHO) categorization system for brain tumors, grade IV[4]. The median overall survival rate for GBM ranges from 14.6 to 20.5 months, with less than 5% of patients living five years after diagnosis[5, 6]. Standard treatment procedures and classical immunotherapy are ineffective since they do not appreciably improve the long-term survival of glioblastoma patients. Therefore, a better understanding of abnormalities and therapeutic target is essential for GBM precision therapy.\u003c/p\u003e \u003cp\u003eThe FXYD domain-containing ion transport regulator 5 (FXYD5) gene is a cancer promoter, whose expression promotes metastasis in multiple tumors, like endometrial cancer, ovarian cancer, pancreatic and lung cancer, et al[7\u0026ndash;9]. In comparison to normal tissues, FXYD5 expression was elevated in various cancerous tissues. Furthermore, FXYD5 overexpression was typically anticipative of poor patient survival[8]. Study found that the metastatic tumors had higher expression of FXYD5 than the original tumors, and blocking FXYD5 expression stopped cancer cells from invading, spreading, and proliferating[10\u0026ndash;12]. Thus, our hypothesis is that FXYD5 has a significant impact on both development and metastasis in GBM. These suggested that the high expression of FXYD5 contributes to the formation of GBM and FXYD5-targeted therapy is a promising strategy for the treatment of GBM.\u003c/p\u003e \u003cp\u003eLong-chain acyl-coenzyme A (CoA) synthase 4 (ACSL4), an enzyme that esterifies CoA into certain polyunsaturated fatty acids, such as arachidonic acid and adrenic acid, could contribute to the execution of ferroptosis by triggering phospholipid peroxidation[13]. Furthermore, fatty acid metabolism is crucially regulated by ACSL4, which also controls steroidogenesis, balances eicosanoid production, and may alter the phospholipid makeup of cell membranes[13]. Study has confirmed that inhibiting ACSL4 is associated with a reduction in phospholipids within mitochondrial membranes, enhancing cancer cell apoptosis[14]. Lipidomic study further revealed that activated ACSL4 catalyzes polyunsaturated fatty acid-containing lipid formation[15]. Moreover, ACSL4 could trigger metastatic extravasation by enhancing membrane fluidity and cellular invasiveness, promoting tumor development[16].\u003c/p\u003e \u003cp\u003eIn our study, we found that the FXYD5 was upregulated and was essential for the survival and proliferation of GBM. Mechanically, we identified that FXYD5 boosted the expression of ACSL4 and increased the level of survival-promoting lipid metabolism and, which contributed to GBM cells development and migration. We also revealed FXYD5 could increase the expression of ACSL4 by activating the PI3K/AKT pathway leading to higher lipid metabolism levels in GBM cells. Briefly, we provided a potential new strategy to improve GBM treatment effectiveness via FXYD5/PI3K/AKT/ACSL4 signal pathway.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eCell culture\u003c/h2\u003e \u003cp\u003eLN229 and U251 were purchased from the Chinese Academy of Sciences Cell Bank (CASCB, China) and cultured in DMEM (Gibco, C11995500BT, USA) with 10% FBS (Gibco, 10099-141, USA). These cells were both confirmed by STR profiling analysis and were cultured in a 37\u0026deg;C cell incubator with 5% CO₂.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eGene knockdown\u003c/h3\u003e\n\u003cp\u003eFor gene knockdown, the short hairpin RNA (shRNA) was based on lentiviral vectors: shFXYD5 #1 (CGTTGAAAGATACCACGTCCA), shFXYD5 #2 (GAGACACACAAGAGCACCAAA), or shACSL4 (CGCTGCGTGAACGAGGGCTAT). Lentiviruses were produced in 293 T cells using cloned vectors, and LN229 or U251 cells were infected with shRNA lentiviruses.\u003c/p\u003e\n\u003ch3\u003eRNA extraction, reverse transcription and quantitative PCR (qRT-PCR)\u003c/h3\u003e\n\u003cp\u003eTotal RNA was extracted using TRIzol (Thermo, 15596026CN, USA). Reverse transcription of total RNA was performed using reverse transcription kits (Vazyme, R233-01, China). qPCR was conducted using Taq Pro Universal SYBR qPCR Master Mix (Vazyme, Q712-02, China). The relative expression of mRNA was quantified using the 2\u0026ndash;\u003csup\u003eΔΔCt\u003c/sup\u003e method.\u003c/p\u003e\n\u003ch3\u003eWestern blot\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eWestern blot\u003c/div\u003e \u003cp\u003eCell lysates were prepared at 4\u0026deg;C using a RIPA lysis buffer supplemented with 1\u0026times; phosphatase inhibitors and 1\u0026times;protease inhibitors (Thermo, 89901, USA) and was quantified by BCA Protein Assay Kit (Meilunbio, MA0082, China).\u003c/p\u003e \u003cp\u003eWestern blotting was performed following a standardized protocol. Primary antibodies included anti-FXYD5 antibody (Biodragon, BD-PN2424, China), anti-ACSL4 antibody (Proteintech, 22401-1-AP, USA), anti-GPAT3 antibody (Proteintech, 20603-1-AP, USA), anti-SOAT antibody (abcam, ab307597, UK), anti-PI3K antibody (CST, Cat# 4249, USA), anti-phospho-PI3K antibody (CST, Cat# 13857, USA), anti-Akt antibody (CST, Cat# 4691, USA), anti-phospho-Akt antibody (CST, Cat# 4060, USA), anti-GAPDH antibody (Proteintech, Cat# 60004, USA). Anti-rabbit secondary antibody (abcam, ab6721, UK) and Anti-Mouse secondary antibody (abcam, ab205719, UK) were used at a dilution of 1:3000.\u003c/p\u003e\n\u003ch3\u003eMigration and invasion assay\u003c/h3\u003e\n\u003cp\u003eMigration assays were conducted using trans-well inserts (Corning, 3422, USA), with 5 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e LN229 cells or U251 cells placed in serum-free DMEM medium (Corning, 10-013-CV, USA) in the upper chamber and DMEM medium with 30% FBS in the lower chamber. After 24 h, migrated cells were fixed by 4% Tissue Fix Soution (meilunbio, MA0192, China), stained by 0.1% Crystal Violet Ammonium Oxalate Solution (Solarbio, G1063, China), and quantified.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eLipid assay\u003c/h2\u003e \u003cp\u003eLipid abundance and evaluation were examined by Lipid Droplets Red Fluorescence Assay Kit with Nile Red (Beyotime, C2051S, China). Moreover, Free fatty acids were detected by Amplex Red Free Fatty Acid Assay Kit (Beyotime, S0215S, China). The contents of total cholesterol (TC) and triglyceride (TG) in LN229 cells or U251 cells were analyzed using the corresponding commercial kit according to the manufacture's protocols (MEIBIAO, MB-3634A and MB-3858A, China).\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eBioinformatic analysis\u003c/h3\u003e\n\u003cp\u003eThe clinical data were sourced from the TCGA-GBM database. Detection of differentially expressed genes (DEGs): the DESeq2 R package is employed to identify differentially expressed genes (DEGs) between two groups, with a threshold of |log2FoldChange| \u0026gt; 1 and an adjusted P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05. Enrichment analysis: Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were conducted using \u0026ldquo;clusterProfiler\u0026rdquo; package. The adj.P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and adj.q-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered statistically significant. We utilized the ssGSEA algorithm from the \"GSVA\" package to quantify enrichment scores of lipid metabolism-associated pathways and the PI3K/AKT pathway based on the MSigDB database, renowned for its curated gene sets. This approach facilitated the evaluation of the frequency and strength of lipid metabolism responses and the activation of the PI3K/AKT pathway in GBM samples.\u003c/p\u003e\n\u003ch3\u003eAnimal models\u003c/h3\u003e\n\u003cp\u003eMale BALB/c nude mice, aged 4\u0026ndash;6 weeks, were procured from Gem Pharmatech LLC., for the study. A volume of 3\u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells in PBS was subcutaneous injected using a 100 \u0026micro;l needle into the right lobe of the mouse (n\u0026thinsp;=\u0026thinsp;5 per group). The PI3K/AKT inhibitor, (E)-Akt inhibitor-IV (100 \u0026micro;mol/kg), was injected subcutaneously on the 21st, 25th and 29th days after the GBM cells were inoculated. The mice were euthanized about 33 days later, and the size of the tumor was then determined. The tumors were then extracted and fixed for immunohistochemistry.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eFXYD5 is upregulated and is a potential therapeutic target in GBM with dismal prognosis in patients.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo identify potential targets for the treatment of GBM, we analyzed gene expression profiles between normal tissue and GBM tumor tissue. FXYD5 has been reported showing significantly increased expression in tumors[17]. The TCGA dataset indicated a significant increase in FXYD5 mRNA levels in GBM tissue compared to normal tissue (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Importantly, GBM patients with higher FXYD5 expression were more prone to adverse events and had shorter survival time than patients with lower FXYD5 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Taken together, FXYD5 was substantially elevated in GBM and negatively related to the prognosis of the GBM patients.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSubsequently, we examined the functional roles of FXYD5 in GBM. After knock-downing the FXYD5 in GBM cell lines through RNA interference, the knockdown efficiency was obvious and the proliferation of GBM cells, both LN229 cell line and U251 cell line were impaired observably, with increasing level of apoptosis (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC-H). Trans-well assay also indicated that FXYD5 knockdown could inhibit metastasis of GBM cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eI-J). Therefore, the expression of FXYD5 is closely related to growth and metastasis in GBM and could be the potential therapeutic target of GBM.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFXYD5 enhances the expression of ACSL4 to promote lipid metabolism in GBM cells.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eTo investigate the role of FXYD5 in the progression of GBM, we analyzed the mRNAs from high-FXYDH expression and low-FXYDH expression clusters. We observed that the lipid metabolism signaling pathway was significantly represented within the GO database, like phospholipid metabolic process, glycerolipid metabolic process, sphingolipid metabolic process, and lipid tranport process (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). The ssGSEA Score assay also showed significant differences in lipid metabolism levels between the FXYD5-high and FXYD5-low expression groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Then we compared the distribution of Lipid metabolism-related genes expression between FXYD5-low or -high clusters (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC), finding ACSL4, GPAT3 and SOAT1 were significantly positively correlated with FXYD5 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Glycerol-3-phosphate acyltransferase 3 (GPAT3) was a crucial liposynthase in the glycerol phosphate pathway, and its downstream metabolites, triacylglycerol and lysophosphatidic acid, were crucial components for the formation of lipid droplets[18]. Sterol O-acyltransferases (SOAT1) could synthesize cholesterol esters in the endoplasmic reticulum from cholesterol, which was the first step in the process of lipid droplet formation[19]. ACSL4 was an enzyme that esterifies CoA into specific polyunsaturated fatty acids, which was an essential regulator of fatty acid metabolism[13].\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe significance of the lipid metabolism regulation in tumor growth and metastasis has been established in previous studies. Study has confirmed that lipid metabolism had emerged as necessary for GBM progression[20\u0026ndash;23]. Therefore, our investigation focused on examining FXYD5 promotes GBM development by regulating lipid metabolism in GBM cells. Through lipid assay Nile and red indicator assay, we demonstrated that the level of fatty acid concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE, Supplementary Fig.\u0026nbsp;1A), intracellular lipid titer (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF, Supplementary Fig.\u0026nbsp;1B), total cholesterol content and triglyceride content (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG, Supplementary Fig.\u0026nbsp;1C) were all significantly decrease after FXYD5 knockdown in GBM cells. Moreover, the mRNA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH, Supplementary Fig.\u0026nbsp;1D) and protein (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI, Supplementary Fig.\u0026nbsp;1E) expression of lipid metabolism key genes ACSL4, GPAT3 and SOAT1 in GBM cells all decreased after FXYD5 knockdown. These results indicated that FXYD5 plays an important role in GBM development by regulating lipid metabolism. Furthermore, FXYD5 could promote the transcription and translation levels of lipid metabolism-related factors, ACSL4, GPAT3 and SOAT1.\u003c/p\u003e \u003cp\u003e \u003cb\u003eFXYD5 promotes lipid metabolism in GBM cells by regulating ACSL4 expression.\u003c/b\u003e \u003c/p\u003e \u003cp\u003ePrevious research has stablished the significance of ACSL4 control of fatty lipid metabolism in tumor development and metastasis[13, 24]. To explore the regulatory relationship between FXYD5 and ACSL4, we performed FXYD5 overexpression in ACSL4 knockdown GBM cells. The results demonstrated that, overexpression of FXYD5 in GBM cells could restore the mRNA and protein expression level of ACSL4 that were reduced by ACSL4 knockdown, without influencing FXYD5 expression (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-D). The above results indicated that FXYD5 is the upstream factor of ACSL4 and could regulate the transcription and translation of ACSL4. Moreover, overexpression of FXYD5 in GBM cells could also restore the level of fatty acid concentration (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, Supplementary Fig.\u0026nbsp;1F), intracellular lipid titer (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF, Supplementary Fig.\u0026nbsp;1G), total cholesterol content and triglyceride content (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG, Supplementary Fig.\u0026nbsp;1H) in GBM cells that were reduced by ACSL4 knockdown. These findings further confirmed the notion that FXYD5 advanced the intracellular lipid metabolism is hinged on its regulation of ACSL4 expression.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eFXYD5 regulated ACSL4 via activating the PI3K/AKT signaling pathway, promoting GBM development and metastasis.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAfter analyzing the KEGG database, we found that the PI3K/AKT signaling pathway was also significantly enriched (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). The ssGSEA Score assay showed significant differences in PI3K/AKT signal pathway between the FXYD5-high and FXYD5-low expression groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-C). Study has proved the typical molecular changes in GBM include mutations in genes regulating PI3K signaling[4]. PI3K/Akt signaling pathway has been confirmed could be the targeted therapy for glioblastoma[25\u0026ndash;27]. However, there have been no reports examining a regulatory relationship between FXYD5 and the PI3K/AKT pathway. Western blot analysis confirmed decreased expression of phosphorylated PI3K and AKT following FXYD5 knockdown in GBM cells, demonstrating that FXYD5 could activate PI3K/AKT pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD-E). Furthermore, overexpression of FXYD5 in GBM cells could both restore the growth and metastasis of GBM cells that were treated by PI3K/AKT inhibitor (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF-G, Supplementary Fig.\u0026nbsp;2A-B), revealing that FXYD5 could potentially enhance the progression of GBM by activating the PI3K/AKT pathway. FXYD5 was the upstream factor of the PI3K/AKT pathway. Finally, Western blot analysis indicated that overexpressing FXYD5 could restore the protein expression of ACSL4 in GBM cells that were treated by PI3K/AKT inhibitor (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH-I). In conclusion, the findings suggested that targeting FXYD5 leads to decreased progression of GBM by suppressing the PI3K/AKT signaling pathway-mediated expression of ACSL4, then decreasing the lipid metabolism level in GBM cells.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003ePI3K/AKT inhibitor treated GBM induced by FXYD5 overexpression in vivo.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSome studies have reported that certain targets could activate the PI3K/AKT pathway, improving glioma or glioblastoma growth in vivo[28, 29]. However, no study has yet demonstrated that FXYD5 could promote the development of GBM through the PI3K/AKT pathway in vivo.\u003c/p\u003e \u003cp\u003eTo evaluate the therapeutic impact of FXYD5 on GBM in vivo, FXYD5 overexpressed-LN229 cells were subcutaneously injected in a murine model. Tumor size was measured starting 13 days after subcutaneous injection, and the PI3K/AKT inhibitor treatment group was able to inhibit tumor growth promoted by FXYD5 overexpression (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). The final tumor size and weight of mice in the PI3K/AKT inhibitor treatment group was significantly smaller than that of mice in the FXYD5 overexpression group alone (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB-C). As expected, the study showed that PI3K/AKT inhibitor prevented tumor progression induced by FXYD5, which was further supported by IHC staining and analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). In final analysis, the findings suggested that targeting FXYD5 leads to decreased progression of GBM in vivo via the PI3K/AKT/ACSL4 pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eGBM was a highly malignant malignancy of the central nervous system with short survival period, which was distinguished by rapid growth, widespread infiltration, and resistance to therapies[30]. GBM was usually treated with chemotherapy and radiotherapy[31, 32]. However, issues, such as chemoresistance and radio-resistance, still need to be addressed. The complexity and heterogeneity of GBM has long hampered therapeutic progress, but modern technologies, like single-cell and spatially resolved transcriptomics, are offering a new way to investigate these complicated malignancies[33]. The Cancer Genome Atlas (TCGA) presented a study examining the main mutation in GBM, according to which three major genetic events occur in GBM: RTK gene amplification and mutational activation, PI3K pathway activation, and p53 and retinoblastoma tumor suppressor pathway inactivation[34]. Numerous studies have demonstrated that targeting certain signaling pathways, like NF-κB signaling pathway, Wnt pathway, PI3K/AKT/mTOR signaling pathway could prevent the development of GBM[35]. Therefore, new more targeting therapies for GBM based on genes still need to be advocated.\u003c/p\u003e \u003cp\u003eSeveral studies have documented the involvement of FXYD5 in the progression of various cancers[36, 37], without GBM. In this study, our analysis of public databases suggested a positive correlation between the expression of FXYD5 in GBM tissue samples from clinical cases. Besides, we found that knockdown of FXYD5 could increase the level of GBM cells apoptosis, suppressing the growth and migration of GBM cells. Nevertheless, further research was needed to elucidate the exact role of FXYD5 in promoting growth and metastasis in GBM.\u003c/p\u003e \u003cp\u003eResults of bioinformatics analysis showed that lipid metabolism-related pathways were enriched in FXYD5 clusters and FXYD5 was significantly positively correlated with lipid metabolism-related factors ACSL4, GPAT3 and SOAT1. Subsequently, we confirmed that knocking down FXYD5 indeed could reduce the level of fatty acid concentration, intracellular lipid titer, total cholesterol content and triglyceride content in GBM cells. ACSL4, an essential regulator of fatty acid metabolism, might be a potential therapeutic target for tumor[13]. Knockdown of FXYD5 could inhibit the transcription and translation of ACSL4. Furthermore, overexpression of FXYD5 could similarly restore the decreased lipid metabolism level caused by ACSL4-knockdown, demonstrating that FXYD5, as the upstream factor of ACSL4, could influence the lipid metabolism level of GBM cells by regulating the gene expression of ACSL4.\u003c/p\u003e \u003cp\u003eTargeting PI3K/AKT signaling pathway was a successful therapeutic strategy in GBM[27]. Study has reported that activation of PI3K/AKT signaling lead to the stemness of GBM cells increases[38]. Anti-tumor agents have found inducing both apoptosis and autophagy in GBM via affecting PI3K/Akt/mTOR axis. Sinomenine ester derivative, a suppressor of GBM progression, inhibited PI3K/Akt/mTOR pathway to induce apoptosis and autophagy via mitochondrial pathway in reducing GBM progression[39]. Punicic acid, another anti-cancer agent, was utilized in inducing apoptosis and decreasing metastasis of GBM cells by suppressing PI3K/AKT/mTOR axis[40\u0026ndash;42]. Our bioinformatics investigation also revealed the connection between FXYD5 and the PI3K/AKT pathway. We found knockdown of FXYD5 could inhibit the activation of PI3K/AKT pathway. Moreover, PI3K/AKT inhibitor similarly restored the growth and migration of GBM cells and increased expression of ACSL4 caused by overexpression of FXYD5, which demonstrated that FXYD5 could affect the transcription and translation of ACSL4 via PI3K/AKT pathway, then influencing the progression of GBM. This study elucidated the role of the FXYD5/PI3K/AKT/ACSL4 signaling pathway in facilitating development and metastasis in GBM.\u003c/p\u003e \u003cp\u003eIn summary, our study identified that FXYD5 was a potential therapeutic target in GBM. Our research findings indicate that the FXYD5 could trigger the activation of the PI3K/AKT signaling pathway. The expression of FXYD5 lead to the activation of the PI3K/AKT signaling pathway, subsequently enhancing the expression of lipid metabolism-related factor ACSL4, advancing lipid metabolism, thereby facilitating GBM tumor development and metastasis. Targeting FXYD5 could inhibit the activation of PI3K/AKT pathway, which decreased the expression of lipid metabolism-related gene ACSL4, then preventing the lipid metabolism in GBM cells. The FXYD5/PI3K/AKT/ACSL4 signaling cascade is significantly involved in treating GBM. These results suggested that targeting this signaling cascade may hold promise as a therapeutic strategy for GBM.\u003c/p\u003e "},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData Availability Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor C\u003c/strong\u003e\u003cstrong\u003eontributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBW, YQ and HC performed the experiments, wrote the paper, and analyzed the data. YZ and LG helped analyze the data. XH designed and supervised the study. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNo financial assistance was received in support of the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics declarations\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was conducted in accordance with relevant guidelines and regulations. For animal experiments, approval was obtained from the Hubei Provincial Center for Disease Control and Prevention (Approval No. 202510218).\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLe Rhun E, Preusser M, Roth P, Reardon DA, van den Bent M, Wen P\u003cem\u003e et al\u003c/em\u003e: Molecular targeted therapy of glioblastoma. Cancer Treat Rev\u003cem\u003e \u003c/em\u003e2019, 80:101896.\u003c/li\u003e\n\u003cli\u003eWeller M, Wick W, Aldape K, Brada M, Berger M, Pfister SM\u003cem\u003e et al\u003c/em\u003e: Glioma. Nat Rev Dis Primers\u003cem\u003e \u003c/em\u003e2015, 1:15017.\u003c/li\u003e\n\u003cli\u003eBarnholtz-Sloan JS, Ostrom QT, Cote D: Epidemiology of Brain Tumors. Neurol Clin\u003cem\u003e \u003c/em\u003e2018, 36(3):395-419.\u003c/li\u003e\n\u003cli\u003eWirsching HG, Galanis E, Weller M: Glioblastoma. Handb Clin Neurol\u003cem\u003e \u003c/em\u003e2016, 134:381-397.\u003c/li\u003e\n\u003cli\u003eGilbert MR, Wang M, Aldape KD, Stupp R, Hegi ME, Jaeckle KA\u003cem\u003e et al\u003c/em\u003e: Dose-dense temozolomide for newly diagnosed glioblastoma: a randomized phase III clinical trial. J Clin Oncol\u003cem\u003e \u003c/em\u003e2013, 31(32):4085-4091.\u003c/li\u003e\n\u003cli\u003eTan AC, Ashley DM, L\u0026oacute;pez GY, Malinzak M, Friedman HS, Khasraw M: Management of glioblastoma: State of the art and future directions. CA Cancer J Clin\u003cem\u003e \u003c/em\u003e2020, 70(4):299-312.\u003c/li\u003e\n\u003cli\u003eBesso MJ, Rosso M, Lapyckyj L, Moiola CP, Matos ML, Mercogliano MF\u003cem\u003e et al\u003c/em\u003e: FXYD5/Dysadherin, a Biomarker of Endometrial Cancer Myometrial Invasion and Aggressiveness: Its Relationship With TGF-\u0026beta;1 and NF-\u0026kappa;B Pathways. Front Oncol\u003cem\u003e \u003c/em\u003e2019, 9:1306.\u003c/li\u003e\n\u003cli\u003eBai Y, Li LD, Li J, Chen RF, Yu HL, Sun HF\u003cem\u003e et al\u003c/em\u003e: A FXYD5/TGF‑\u0026beta;/SMAD positive feedback loop drives epithelial‑to‑mesenchymal transition and promotes tumor growth and metastasis in ovarian cancer. Int J Oncol\u003cem\u003e \u003c/em\u003e2020, 56(1):301-314.\u003c/li\u003e\n\u003cli\u003eHotta T, Nariai Y, Kajitani N, Kadota K, Maruyama R, Tajima Y\u003cem\u003e et al\u003c/em\u003e: Generation of the novel anti-FXYD5 monoclonal antibody and its application to the diagnosis of pancreatic and lung cancer. Biochimie\u003cem\u003e \u003c/em\u003e2023, 208:160-169.\u003c/li\u003e\n\u003cli\u003eMao Y, Hu Y, Meng H, Qin J, An Q, Zhang C\u003cem\u003e et al\u003c/em\u003e: FXYD5 regulates gastric cancer cell metastasis and drug resistance by EMT modulation. Cancer Gene Ther\u003cem\u003e \u003c/em\u003e2025, 32(3):318-326.\u003c/li\u003e\n\u003cli\u003eLubarski-Gotliv I, Dey K, Kuznetsov Y, Kalchenco V, Asher C, Garty H: FXYD5 (dysadherin) may mediate metastatic progression through regulation of the \u0026beta;-Na(+)-K(+)-ATPase subunit in the 4T1 mouse breast cancer model. Am J Physiol Cell Physiol\u003cem\u003e \u003c/em\u003e2017, 313(1):C108-c117.\u003c/li\u003e\n\u003cli\u003eJuurikka K, Dufour A, Pehkonen K, Mainoli B, Campioni Rodrigues P, Solis N\u003cem\u003e et al\u003c/em\u003e: MMP8 increases tongue carcinoma cell-cell adhesion and diminishes migration via cleavage of anti-adhesive FXYD5. Oncogenesis\u003cem\u003e \u003c/em\u003e2021, 10(5):44.\u003c/li\u003e\n\u003cli\u003eDing K, Liu C, Li L, Yang M, Jiang N, Luo S\u003cem\u003e et al\u003c/em\u003e: Acyl-CoA synthase ACSL4: an essential target in ferroptosis and fatty acid metabolism. Chin Med J (Engl)\u003cem\u003e \u003c/em\u003e2023, 136(21):2521-2537.\u003c/li\u003e\n\u003cli\u003eLi YJ, Fahrmann JF, Aftabizadeh M, Zhao Q, Tripathi SC, Zhang C\u003cem\u003e et al\u003c/em\u003e: Fatty acid oxidation protects cancer cells from apoptosis by increasing mitochondrial membrane lipids. Cell Rep\u003cem\u003e \u003c/em\u003e2022, 39(9):110870.\u003c/li\u003e\n\u003cli\u003eZhang HL, Hu BX, Li ZL, Du T, Shan JL, Ye ZP\u003cem\u003e et al\u003c/em\u003e: PKC\u0026beta;II phosphorylates ACSL4 to amplify lipid peroxidation to induce ferroptosis. Nat Cell Biol\u003cem\u003e \u003c/em\u003e2022, 24(1):88-98.\u003c/li\u003e\n\u003cli\u003eWang Y, Hu M, Cao J, Wang F, Han JR, Wu TW\u003cem\u003e et al\u003c/em\u003e: ACSL4 and polyunsaturated lipids support metastatic extravasation and colonization. Cell\u003cem\u003e \u003c/em\u003e2025, 188(2):412-429.e427.\u003c/li\u003e\n\u003cli\u003eBiasiotta A, D\u0026apos;Arcangelo D, Passarelli F, Nicodemi EM, Facchiano A: Ion channels expression and function are strongly modified in solid tumors and vascular malformations. J Transl Med\u003cem\u003e \u003c/em\u003e2016, 14(1):285.\u003c/li\u003e\n\u003cli\u003eWang Y, Xu C, Yang X, Liu X, Guo Z, Lin X\u003cem\u003e et al\u003c/em\u003e: Glycerol-3-phosphate acyltransferase 3-mediated lipid droplets accumulation confers chemoresistance of colorectal cancer. MedComm (2020)\u003cem\u003e \u003c/em\u003e2024, 5(2):e486.\u003c/li\u003e\n\u003cli\u003eKou Y, Geng F, Guo D: Lipid Metabolism in Glioblastoma: From De Novo Synthesis to Storage. Biomedicines\u003cem\u003e \u003c/em\u003e2022, 10(8).\u003c/li\u003e\n\u003cli\u003eLee H, Kim D, Youn B: Targeting Oncogenic Rewiring of Lipid Metabolism for Glioblastoma Treatment. Int J Mol Sci\u003cem\u003e \u003c/em\u003e2022, 23(22).\u003c/li\u003e\n\u003cli\u003eMinami JK, Morrow D, Bayley NA, Fernandez EG, Salinas JJ, Tse C\u003cem\u003e et al\u003c/em\u003e: CDKN2A deletion remodels lipid metabolism to prime glioblastoma for ferroptosis. Cancer Cell\u003cem\u003e \u003c/em\u003e2023, 41(6):1048-1060.e1049.\u003c/li\u003e\n\u003cli\u003eShakya S, Gromovsky AD, Hale JS, Knudsen AM, Prager B, Wallace LC\u003cem\u003e et al\u003c/em\u003e: Altered lipid metabolism marks glioblastoma stem and non-stem cells in separate tumor niches. Acta Neuropathol Commun\u003cem\u003e \u003c/em\u003e2021, 9(1):101.\u003c/li\u003e\n\u003cli\u003eBroadfield LA, Pane AA, Talebi A, Swinnen JV, Fendt SM: Lipid metabolism in cancer: New perspectives and emerging mechanisms. Dev Cell\u003cem\u003e \u003c/em\u003e2021, 56(10):1363-1393.\u003c/li\u003e\n\u003cli\u003eLei Z, Luo Y, Lu J, Fu Q, Wang C, Chen Q\u003cem\u003e et al\u003c/em\u003e: FBXO22 promotes HCC angiogenesis and metastasis via RPS5/AKT/HIF-1\u0026alpha;/VEGF-A signaling axis. Cancer Gene Ther\u003cem\u003e \u003c/em\u003e2025, 32(2):198-213.\u003c/li\u003e\n\u003cli\u003eLi X, Wu C, Chen N, Gu H, Yen A, Cao L\u003cem\u003e et al\u003c/em\u003e: PI3K/Akt/mTOR signaling pathway and targeted therapy for glioblastoma. Oncotarget\u003cem\u003e \u003c/em\u003e2016, 7(22):33440-33450.\u003c/li\u003e\n\u003cli\u003eBarzegar Behrooz A, Talaie Z, Jusheghani F, Łos MJ, Klonisch T, Ghavami S: Wnt and PI3K/Akt/mTOR Survival Pathways as Therapeutic Targets in Glioblastoma. Int J Mol Sci\u003cem\u003e \u003c/em\u003e2022, 23(3).\u003c/li\u003e\n\u003cli\u003eHashemi M, Etemad S, Rezaei S, Ziaolhagh S, Rajabi R, Rahmanian P\u003cem\u003e et al\u003c/em\u003e: Progress in targeting PTEN/PI3K/Akt axis in glioblastoma therapy: Revisiting molecular interactions. Biomed Pharmacother\u003cem\u003e \u003c/em\u003e2023, 158:114204.\u003c/li\u003e\n\u003cli\u003eZhang D, Wang X, Wang X, Wang Z, Ma S, Zhang C\u003cem\u003e et al\u003c/em\u003e: CPNE3 regulates the cell proliferation and apoptosis in human Glioblastoma via the activation of PI3K/AKT signaling pathway. J Cancer\u003cem\u003e \u003c/em\u003e2021, 12(24):7277-7286.\u003c/li\u003e\n\u003cli\u003eZhang A, Peng S, Sun S, Ye S, Zhao Y, Wu Q: NRBP1 promotes malignant phenotypes of glioblastoma by regulating PI3K/Akt activation. Cancer Med\u003cem\u003e \u003c/em\u003e2024, 13(16):e70100.\u003c/li\u003e\n\u003cli\u003eYabo YA, Heiland DH: Understanding glioblastoma at the single-cell level: Recent advances and future challenges. PLoS Biol\u003cem\u003e \u003c/em\u003e2024, 22(5):e3002640.\u003c/li\u003e\n\u003cli\u003eJemal A, Siegel R, Xu J, Ward E: Cancer statistics, 2010. CA: a cancer journal for clinicians\u003cem\u003e \u003c/em\u003e2010, 60(5):277-300.\u003c/li\u003e\n\u003cli\u003eBroekman ML, Maas SL, Abels ER, Mempel TR, Krichevsky AM, Breakefield XO: Multidimensional communication in the microenvirons of glioblastoma. Nature Reviews Neurology\u003cem\u003e \u003c/em\u003e2018, 14(8):482-495.\u003c/li\u003e\n\u003cli\u003eAldape K, Brindle KM, Chesler L, Chopra R, Gajjar A, Gilbert MR\u003cem\u003e et al\u003c/em\u003e: Challenges to curing primary brain tumours. Nat Rev Clin Oncol\u003cem\u003e \u003c/em\u003e2019, 16(8):509-520.\u003c/li\u003e\n\u003cli\u003eComprehensive genomic characterization defines human glioblastoma genes and core pathways. Nature\u003cem\u003e \u003c/em\u003e2008, 455(7216):1061-1068.\u003c/li\u003e\n\u003cli\u003eKhabibov M, Garifullin A, Boumber Y, Khaddour K, Fernandez M, Khamitov F\u003cem\u003e et al\u003c/em\u003e: Signaling pathways and therapeutic approaches in glioblastoma multiforme (Review). Int J Oncol\u003cem\u003e \u003c/em\u003e2022, 60(6).\u003c/li\u003e\n\u003cli\u003eXie H, Li J, Lu M, Zhang R, Mao H: miR-1180 Targets FXYD5 to Regulate Pancreatic Cancer Cells Migration and Invasion. Mol Biotechnol\u003cem\u003e \u003c/em\u003e2024, 66(11):3182-3194.\u003c/li\u003e\n\u003cli\u003eZhao E, Gao K, Xiong J, Liu Z, Chen Y, Yi L: The roles of FXYD family members in ovarian cancer: an integrated analysis by mining TCGA and GEO databases and functional validations. J Cancer Res Clin Oncol\u003cem\u003e \u003c/em\u003e2023, 149(19):17269-17284.\u003c/li\u003e\n\u003cli\u003eYao Y, Xue Y, Ma J, Shang C, Wang P, Liu L\u003cem\u003e et al\u003c/em\u003e: MiR-330-mediated regulation of SH3GL2 expression enhances malignant behaviors of glioblastoma stem cells by activating ERK and PI3K/AKT signaling pathways. PloS one\u003cem\u003e \u003c/em\u003e2014, 9(4):e95060.\u003c/li\u003e\n\u003cli\u003eZheng X, Li W, Xu H, Liu J, Ren L, Yang Y\u003cem\u003e et al\u003c/em\u003e: Sinomenine ester derivative inhibits glioblastoma by inducing mitochondria-dependent apoptosis and autophagy by PI3K/AKT/mTOR and AMPK/mTOR pathway. Acta Pharmaceutica Sinica B\u003cem\u003e \u003c/em\u003e2021, 11(11):3465-3480.\u003c/li\u003e\n\u003cli\u003eGasmi J, Sanderson JT: Growth inhibitory, antiandrogenic, and pro-apoptotic effects of punicic acid in LNCaP human prostate cancer cells. Journal of agricultural and food chemistry\u003cem\u003e \u003c/em\u003e2010, 58(23):12149-12156.\u003c/li\u003e\n\u003cli\u003eWang L, Li W, Lin M, Garcia M, Mulholland D, Lilly M\u003cem\u003e et al\u003c/em\u003e: Luteolin, ellagic acid and punicic acid are natural products that inhibit prostate cancer metastasis. Carcinogenesis\u003cem\u003e \u003c/em\u003e2014, 35(10):2321-2330.\u003c/li\u003e\n\u003cli\u003eMete M, Unsal UU, Aydemir I, S\u0026ouml;nmez PK, Tuglu MI: Punicic acid inhibits glioblastoma migration and proliferation via the PI3K/AKT1/mTOR signaling pathway. Anti-Cancer Agents in Medicinal Chemistry (Formerly Current Medicinal Chemistry-Anti-Cancer Agents)\u003cem\u003e \u003c/em\u003e2019, 19(9):1120-1131.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"FXYD5, PI3K/AKT, lipid metabolism, GBM","lastPublishedDoi":"10.21203/rs.3.rs-6967066/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6967066/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eGlioblastoma (GBM) is the most malignant primary brain tumor, with few therapeutic therapy options. Abnormalities of FXYD5 have been reported in multiple malignancies, which proposes FXYD5 as a potential target for precision treatment. Here, we identified that FXYD5 was observably upregulated in GBM and inversely correlated with the prognosis of patients. Functional studies showed that the knockdown of FXYD5 suppressed GBM cell growth and progression \u003cem\u003ein vitro\u003c/em\u003e, demonstrating that FXYD5 could be the target of GBM treatment. Through bioinformatic analysis, we found FXYD5 was associated with lipid metabolism and the PI3K/AKT signaling pathway. Mechanistically, knockdown of FXYD5 inhibited the activation of the PI3K/AKT signaling pathway, leading to suppression of the expression of lipid metabolism-related gene ACSL4 and level of lipid metabolism. Our study has shown that FXYD5 facilitates GBM progression and metastasis via the PI3K/AKT/ACSL4 signaling axis. Notably, inhibition of PI3K/AKT signal pathway could antagonize FXYD5 overexpression-induced subcutaneous tumorigenesis enlargement in the GBM mouse model. These findings revealed that FXYD5 was a potential therapeutic target in GBM.\u003c/p\u003e","manuscriptTitle":"FXYD5 promotes the growth of glioblastoma by targeting the PI3K/AKT/ACSL4 signaling axis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-07-23 05:40:26","doi":"10.21203/rs.3.rs-6967066/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"93fff636-6a8b-4ded-8397-9b3377da8fde","owner":[],"postedDate":"July 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":51587443,"name":"Biological sciences/Cancer/Cancer therapy/Targeted therapies"},{"id":51587444,"name":"Biological sciences/Cancer/Oncogenes"}],"tags":[],"updatedAt":"2026-02-05T11:51:44+00:00","versionOfRecord":[],"versionCreatedAt":"2025-07-23 05:40:26","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6967066","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6967066","identity":"rs-6967066","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00