Mechanism insights into the regulation of the LuxS/AI-2 quorum sensing system on the formation of viable but nonculturable state in biofilm cells of beer-spoilage Lactiplantibacillus plantarum

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Lactiplantibacillus plantarum is a major beer spoilage bacterium that poses significant challenges to industrial brewing processes. This study investigated the function of the luxS gene in regulating the transformation of biofilm cells to a viable but non-culturable (VBNC) state induced by iso-α-acids from hops. Scanning electron microscopy revealed increased cell adhesion in biofilms versus planktonic cells, with VBNC cells exhibiting surface protrusions and reduced volume. Temporal analysis showed synchronized upregulation of luxS expression and AI-2 levels during VBNC induction, peaking at 4 hours before declining. Exogenous AI-2 facilitated biofilm-to-VBNC transition and revival, whereas luxS manipulation disrupted these processes, indicating luxS regulates VBNC dynamics via AI-2 biosynthesis in the quorum sensing (QS) system. A luxS-overexpressing strain was engineered to explore molecular mechanisms. Multi-omics analyses (transcriptomics, proteomics, ChIP-seq) demonstrated that luxS directly activates genes involved in carbohydrate metabolism and stress responses, promoting energy homeostasis and stress resilience in the VBNC state. Differential gene enrichment analysis identified luxS-regulated genes upregulated during VBNC entry, forming a regulatory network linked to QS and biofilm formation. This study integrates the multi-omics data, systematically elucidating the LuxS-AI-2 axis in VBNC-state establishment, providing a molecular framework for understanding beer spoilage and controlling biofilm-associated industrial contamination.
Full text 177,061 characters · extracted from preprint-html · click to expand
Mechanism insights into the regulation of the LuxS/AI-2 quorum sensing system on the formation of viable but nonculturable state in biofilm cells of beer-spoilage Lactiplantibacillus plantarum | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Mechanism insights into the regulation of the LuxS/AI-2 quorum sensing system on the formation of viable but nonculturable state in biofilm cells of beer-spoilage Lactiplantibacillus plantarum Xuchen Li, Chuanchao Huang, Hongliang Liu, Qianqian Xin, Zhijian Wang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6435335/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Lactiplantibacillus plantarum is a major beer spoilage bacterium that poses significant challenges to industrial brewing processes. This study investigated the function of the luxS gene in regulating the transformation of biofilm cells to a viable but non-culturable (VBNC) state induced by iso-α-acids from hops. Scanning electron microscopy revealed increased cell adhesion in biofilms versus planktonic cells, with VBNC cells exhibiting surface protrusions and reduced volume. Temporal analysis showed synchronized upregulation of luxS expression and AI-2 levels during VBNC induction, peaking at 4 hours before declining. Exogenous AI-2 facilitated biofilm-to-VBNC transition and revival, whereas luxS manipulation disrupted these processes, indicating luxS regulates VBNC dynamics via AI-2 biosynthesis in the quorum sensing (QS) system. A luxS -overexpressing strain was engineered to explore molecular mechanisms. Multi-omics analyses (transcriptomics, proteomics, ChIP-seq) demonstrated that luxS directly activates genes involved in carbohydrate metabolism and stress responses, promoting energy homeostasis and stress resilience in the VBNC state. Differential gene enrichment analysis identified luxS -regulated genes upregulated during VBNC entry, forming a regulatory network linked to QS and biofilm formation. This study integrates the multi-omics data, systematically elucidating the LuxS-AI-2 axis in VBNC-state establishment, providing a molecular framework for understanding beer spoilage and controlling biofilm-associated industrial contamination. Biological sciences/Biological techniques Biological sciences/Microbiology beer spoilage Lactobacillus biofilm viable but noncuturable (VBNC) state quorum sensing system transcriptomics and proteomics ChIP-seq Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Beer, recognized as one of the most ancient fermented alcoholic beverages, encounters multifaceted microbial safety dilemmas during industrial-scale production. The protracted brewing timelines and sophisticated equipment configurations frequently engender microbial colonization niches within sanitation-challenged zones, such as pipeline elbows and sealing interfaces, thereby precipitating recurrent off-odor generation and product turbidity phenomena 1 . Under extended operational regimes, microbial populations exhibit a propensity for biofilm-mediated surface colonization-a cooperative survival paradigm that confers augmented environmental resilience and cleansing resistance 2 , 3 . Notably, biofilm matrix development not only markedly amplifies microbial viability but also catalyzes their phenotypic transition into the viable but non-culturable (VBNC) state, thereby posing a twofold existential threat to the food safety continuum 4 , 5 . As an adaptive stress-response mechanism, the VBNC state enables microbial persistence under conventional culturing paradigms while preserving metabolic functionality, with latent proliferative capacity upon stressor alleviation 6 . Emerging evidence suggests that residual chlorine concentrations in municipal water treatment systems can elicit biofilm-entrenched bacteria to adopt the VBNC state, thereby undermining conventional detection protocols and introducing microbial safety vulnerabilities 7 . Previous investigations conducted by our research group have elucidated the transformational trajectories of beer-spoilage lactic acid bacteria (LAB) into the VBNC state, specifically identifying hop-derived phytochemicals (iso-α-acids), cryogenic anaerobic conditions, and interspecies microbial antagonism as potent inducers of VBNC-state transition in beer-spoilage Lactobacillus plantarum , L. acetotolerans , and Pediococcus damnosus 5 , 8 – 10 . Despite losing culturability under standard laboratory protocols, these VBNC-transformed LAB retain their pathogenic potential to induce turbidity and generate off-flavor metabolites, thereby compromising beer quality. Recent studies has further substantiated that biofilm communities colonizing brewing apparatus serve as microbial sanctuaries, where sessile spoilage bacteria readily adopt the VBNC phenotype under sustained environmental pressures 11 . These cryptic VBNC biofilms elude conventional detection methodologies, representing the most insidious microbial hazard within contemporary beer production paradigms. The quorum sensing (QS) system represents a fundamental bacterial mechanism employed for the detection of population density through the utilization of chemical signaling molecules, subsequently orchestrating the regulation of physiological behaviors. Upon attainment of a critical population threshold, bacteria secrete autoinducers, the accumulation of which initiates a sequential cascade of gene expression, thereby coordinating the modulation of biofilm formation, virulence factor secretion, and bacteriocin synthesis 12 . QS systems are classified into three primary categories: Gram-negative, Gram-positive, and interspecies communication types. Notably, the LuxS/AI-2 system functions as a ubiquitous interspecies QS mechanism, widely distributed among both Gram-positive and Gram-negative bacteria. The central signal molecule AI-2, encoded by the luxS gene, demonstrates a high degree of structural conservation across intra- and interspecies LAB strains 13 . Research findings corroborate that luxS overexpression in L. plantarum L-ZS9 markedly augments AI-2 production and biofilm formation 14 . Further explorations have unveiled that AI-2 activates the LuxR regulator to upregulate rpoS expression, consequently inducing the overexpression of the catalase gene katG , which enhances environmental resistance and sustains survival in the VBNC state of Vibrio vulnificus 15 . It is noteworthy that, while contemporary VBNC research predominantly concentrates on planktonic bacteria, biofilm-associated cells may exhibit unique VBNC formation mechanisms attributable to metabolic divergence, implying a specialized function for QS systems in the regulation of biofilm-associated VBNC states. This study utilizes L. plantarum , a widespread beer-spoilage bacterium renowned for its potent biofilm-forming capabilities and a well-conserved LuxS/AI-2 QS system 16 , as the exprimental model. Leveraging this model, we seek to unravel the molecular intricacies governing the regulation of VBNC transition in biofilm-encased cells by the luxS gene, thereby surmounting the constraints inherent in traditional planktonic bacteria-centric research. The insights garnered from this study will furnish a theoretical framework for the development of QS-directed interventions aimed at mitigating beer-spoilage microorganisms. Results Induction and recovery of VBNC state As illustrated in Fig. 1 , L. plantarum L-PB01 was effectively induced into the viable but non-culturable (VBNC) state through exposure to iso-α-acids. The concentration of iso-α-acids exerted a pronounced effect on bacterial culturability and survival. In the untreated control group, cells maintained full viability and culturability over the entire experimental duration (Fig. 1 a). For cultures subjected to 9–27 mg/L iso-α-acids, total cell counts remained consistent, yet viable cell numbers demonstrated a marginal decline. Notably, culturability was entirely eradicated at 18 mg/L following 24 hours of exposure and at 27 mg/L after 12 hours of exposure, while viable cell counts remained relatively high, thereby confirming successful VBNC induction (Figs. 1 b– 1 d). Partial culturability was restored following the alleviation of stress through 24 hours of incubation in MRS medium at 37°C, underscoring the reversible nature of VBNC entry under iso-α-acids-induced stress. These findings imply that biofilm-associated spoilage bacteria within brewing systems may leverage this mechanism to circumvent conventional detection methodologies. The present study advances the comprehension of the molecular mechanisms governing weak organic acid-mediated VBNC state induction. Chaveerach et al. previously demonstrated that formic acid can elicit VBNC entry in Campylobacter within 2-hour timeframe 17 , and the Bai group subsequently validated that Staphylococcus aureus induced into the VBNC state via citric acid treatment retains elevated ATP levels and exhibits recovery potential 18 . Significantly, as a representative weak organic acid, the mechanism through which hop-derived iso-α-acids induce L. brevis to enter the VBNC state has been elucidated 19 . This investigation represents the inaugural confirmation of the inductive effect of iso-α-acids on L. plantarum VBNC transition, which, in conjunction with the distinctive beer microenvironment (characterized by low pH, high ethanol/CO₂ concentrations, and hop antimicrobial constituents), establishes a complex microbial stress network 20 . However, the phenotypic crypticity of the VBNC state in spoilage bacteria obscures their true physiological condition, thereby substantially elevating microbial safety risks in beer. Future research endeavors are imperative to dissect the regulatory intricacies of pivotal genes, such as luxS , in VBNC state formation, thereby furnishing a theoretical foundation for precise prevention and control strategies. Morphological and structural differences of bacteria in different states To evaluate the morphological disparities exhibited by L. plantarum under varying physiological conditions, this study conducted a systematic analysis of cellular ultrastructure utilizing scanning electron microscopy. Biofilm-associated cells, in contrast to planktonic counterparts, displayed a notable augmentation in cell adhesion, leading to the formation of multicellular aggregates, alongside an accumulation of extracellular matrix constituents (Figs. 1 d-f). This observation may be intricately linked to the deposition of extracellular polysaccharides and other secretory products during biofilm development. Subsequent examination unveiled distinctive phenotypic traits in biofilm-associated cells that had fully transitioned into the VBNC state. Compared to planktonic and conventional biofilm cells, VBNC cells were enveloped by a dense polymeric layer on their surface (highlighted in green in Fig. 1 g), resulting in a marked roughening of the surface topography and the emergence of high-density cell clusters. This polymer likely comprises composite extracellular materials secreted by the cells. This discovery aligns closely with the phenotypic alterations observed by Vattakaven et al. in the VBNC state of Vibrio tasmaniensis , wherein pathogens induce surface roughening and compact cell aggregation via the secretion of polymer-like substances 21 . Quantitative assessments revealed that the average cell volume of L. plantarum diminished from 1.63 µm³ in the initial state to 1.13 µm³ in the VBNC state. This contractile effect corresponds with the volume change patterns observed in Salmonella Typhi and Escherichia coli during their respective VBNC states 22 . Relationship between AI-2 and biofilm and VBNC state formation By examining the impact of culture medium constituents on bacterial AI-2 QS activity, this study uncovered that no AI-2 activity was discernible in the cell-free supernatant (CFS) of L. plantarum L-PB01 cultivated in MRS medium (encompassing the pH 7.0-adjusted cohort), whereas pronounced activity was evident in CFS derived from skim milk medium (Figs. 2 a-c). This phenomenon could be ascribed to transcriptional suppression of the luxS gene cluster in the Vibrio harveyi BB170 reporter strain, induced by the elevated glucose concentration (20 g/L) and the initially low pH inherent in MRS medium. Building upon these observations, the influence of endogenous AI-2 present in CFS on biofilm formation was further scrutinized. As illustrated in Fig. 2 b, graded supplementation of CFS did not elicit substantial dose-dependent effects on biofilm biomass, with enhanced biofilm formation observed solely under 75% CFS treatment after a 36-hour incubation period ( P < 0.05). This observation may be rationalized by two plausible mechanisms: (1) the AI-2 concentration within CFS did not attain the QS threshold 23 , and (2) subinhibitory concentrations of AI-2 might exert regulatory effects on bacterial proliferation via metabolic modulation 24 . Prior research posits that biofilm-associated cells may orchestrate VBNC state transition via the LuxS/AI-2 QS system. In this present investigation, the temporal dynamics of luxS gene expression during VBNC induction were meticulously tracked through quantitative reverse transcription polymerase chain reaction (qRT-PCR). The findings revealed an initial upregulation followed by a decline in luxS expression, culminating in a peak at the 4-hour induction mark (Figs. 2 a-b). Given that LuxS is implicated in both AI-2 biosynthesis and the methionine cycle metabolism in L. plantarum , the interplay between luxS expression and AI-2 production warrants further validation. This study also assessed fluctuations in AI-2 activity throughout the VBNC process, revealing a striking concordance with the luxS expression pattern, thereby underscoring a robust correlation between luxS expression and AI-2 synthesis in this bacterial strain. This observation stands in contrast to a study on Streptococcus suis , wherein luxS overexpression failed to influence AI-2 production 25 . Considering the discordance between VBNC induction conditions (characterized by low temperature, oligotrophic environments, and bitter acid stress) and the nutritional profile of the AI-2-enriched skim milk matrix, synthetic AI-2 was employed for functional validation in this study. As depicted in Fig. 2 d, the supplementation of 80 µmol/L AI-2 prompted biofilm-associated cells to enter the VBNC state after 8 hours, whereas the 40 µmol/L group achieved conversion after 10 hours, both preceding the 12-hour conversion timeframe observed in the control group. Building upon our previously established VBNC induction model, which involves a 12-hour treatment of biofilm-associated cells with 27 mg/L iso-α-acids, this study assessed the resuscitation potential of VBNC cells through the removal of stressors (specifically, transferring the cells to 37°C MRS medium). As illustrated in Fig. 2 e, the addition of 50%-75% CFS markedly augmented the efficiency of VBNC resuscitation, with viable cell counts increasing by approximately 10 3 colony-forming units per milliliter (CFU/mL) in comparison to control groups following an 8-hour culture period. This observation is congruent with prior findings from studies investigating VBNC resuscitation in Vibrio vulnificus 15 . To clarify the functional specificity of AI-2 within CFS, synthetic AI-2 was utilized for validation purposes. Figure 2 f demonstrates that exogenous AI-2 supplementation accelerates resuscitation kinetics in a dose-dependent manner, with the 80 µmol/L treatment group exhibiting significantly superior resuscitation efficiency relative to the 40 µmol/L cohort. Notably, this finding contrasts with the report by Ayrapetyan et al., which indicated no AI-2-mediated enhancement of resuscitation in rpoS -deficient mutants. This discrepancy may arise from strain-specific responses and variations in signal molecule concentration gradients, suggesting that the intricate regulatory network governing VBNC recovery necessitates further exploration. Relationship between luxS and biofilm formation and VBNC state The luxS gene, a pivotal genetic element encoding an enzyme crucial for the metabolism of S-ribosylhomocysteine (SRH), plays an integral role in the biosynthesis of AI-2. To elucidate its functional significance, we engineered bacterial strains utilizing homologous overexpression technology and gene knockout methodologies grounded in homologous recombination principles. PCR-based validation was executed employing verification primers yzluxS-F/R and qcyz-F/R, as depicted in Figure S1 . To ascertain the efficacy of luxS overexpression, three PCR-positive strains were subjected to quantitative reverse transcription PCR (qRT-PCR) analysis. The findings revealed a substantial upregulation of luxS mRNA expression, approximately 10-fold higher in the recombinant strain LP-luxS-36e-3 compared to the wild-type L-PB01 (Fig. 2 g), thereby confirming the successful generation of both luxS overexpression and knockout strains. The strain exhibiting the highest expression level was selected for subsequent experimental investigations. The influence of genetic manipulation on bacterial proliferation was evaluated by monitoring the kinetic alterations in optical density at 600 nm (OD 600 ) over a 3-36-hour timeframe. The results indicated that the growth trajectories of the luxS overexpression and knockout strains mirrored the overall growth pattern of the wild-type L-PB01, suggesting that the genetic modifications did not significantly perturb the fundamental growth attributes of the bacteria. In the biofilm formation assay (Fig. S2b), no statistically discernible differences in biofilm production were observed between the luxS knockout strain and the wild-type strain, implying that the bacteria may possess multiple quorum sensing (QS) systems that synergistically regulate biofilm formation. The AI-2 synthesis deficiency induced by the single luxS gene deletion could be compensated by alternative QS systems 26 . Notably, the biofilm-forming capacity of the luxS overexpression strain was markedly elevated compared to the wild-type, corroborating the gene's involvement in modulating biofilm formation in L-PB01. This observation aligns with the canonical mechanism of LuxS/AI-2-mediated QS system regulation of biofilm formation 27 , 28 . Figures 2 h-i depicts the survival profiles of luxS -edited strains and wild-type biofilm-associated cells under conditions of iso-α-acid stress. The findings reveal that the culturable colony count of the luxS -deficient mutant exhibited a markedly accelerated decline relative to the wild-type strain (L-PB01), suggesting a diminished capacity for environmental stress resilience. Remarkably, the luxS -overexpressing strain demonstrated a complete loss of culturability after 10-hour induction. However, live/dead cell staining indicated that, following an initial decline from 10 6 CFU/mL, the viable cell count stabilized at 10 5 CFU/mL, suggesting an elevated susceptibility to entering the VBNC state. Resuscitation experiments further corroborated that the luxS -deficient mutant displayed a complete absence of resuscitative capability, whereas the overexpressing strain exhibited significantly enhanced resuscitation efficiency compared to the wild-type. This phenotypic congruence with outcomes from exogenous AI-2 supplementation experiments substantiates that luxS modulates bacterial stress responses via the regulation of AI-2 biosynthesis. Current literature underscores the involvement of QS systems in mediating bacterial transitions into the VBNC state, and our findings provide empirical support for this mechanism: elevated luxS expression may augment AI-2-dependent signaling pathways to facilitate VBNC entry while concurrently preserving resuscitative potential. It is imperative to acknowledge, however, that luxS is concomitantly implicated in methyl cycle metabolism, suggesting that the observed phenotypic variations may arise from synergistic interactions across multiple metabolic pathways. Given the intrinsic complexity of VBNC transition mechanisms, the precise functional pathways of luxS in this process necessitate comprehensive elucidation through integrated multi-omics strategies, encompassing proteomic and metabolomic analyses. Integrative transcriptomic-proteomic analyses To elucidate the molecular mechanisms underlying the regulation of the VBNC state within biofilms of L-PB01 by the luxS gene, this study employed transcriptome sequencing to comparatively analyze gene expression profiles between the luxS -overexpressing strain and its wild-type counterpart across various physiological stages. The experimental design encompassed six distinct treatment groups, which were categorized based on the strain type and physiological condition: the wild-type strain L-PB01 was subdivided into three groups representing the normal state (L-PB01), the biofilm-forming state (L-PB01-BF), and the biofilm-associated VBNC state (L-PB01-VBNC); correspondingly, the luxS -overexpressing strain LP-LUXS-36e was allocated to analogous physiological states (LP-LUXS-36e, LP-LUXS-36e-BF, and LP-LUXS-36e-VBNC). Differential expression analysis conducted across these groups identified 1,082 genes exhibiting significant expression variations (with 520 upregulated and 310 downregulated) between LP-LUXS-36e and L-PB01; 902 differentially expressed genes (363 upregulated and 539 downregulated) in the biofilm state (LP-LUXS-36e-BF versus L-PB01-BF); and 646 genes displaying altered expression (403 upregulated and 243 downregulated) in the VBNC state (LP-LUXS-36e-VBNC versus L-PB01-VBNC). Subsequent gene set intersection analysis (Figs. 4 a-c) revealed the presence of 136 commonly differentially expressed genes across all three physiological stages examined (56 of which were upregulated and 30 downregulated). Furthermore, 229 genes exhibited shared differential expression between the biofilm and VBNC stages (86 upregulated and 70 downregulated), whereas 280 genes displayed differential expression specific to the VBNC state (259 upregulated and 141 downregulated). The dynamic profiling of key gene expression (Figs. 3 d-f) demonstrated a notable upregulation of pgmB , rbsU , rbsD , rbsK , nrdD , pepc , and tetM during the biofilm-associated VBNC stage. Specifically, nrdD and pepc exhibited upregulation commencing at the biofilm stage, while pgmB , rbsU , rbsD , and rbsK displayed a sequential expression trend characterized by initial downregulation followed by subsequent upregulation. Functional enrichment analysis utilizing Gene Ontology (GO) terms (Fig. S3) consistently identified pathways associated with membrane structural components, developmental processes, and stress responses as being enriched across all three comparative groups. In parallel, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis (Figs. 3 g-i) highlighted significant enrichment of metabolic pathways, including ABC transporters, starch and sucrose metabolism, purine/pyrimidine metabolism, and the pentose phosphate pathway, among the upregulated gene sets. To comprehensively evaluate the regulatory dynamic of these metabolic pathways, Gene Set Enrichment Analysis (GSEA) analysis was performed (Fig. 4 ). Within the framework of KEGG pathway analysis (Figs. 5 a-c and Fig. S4), the starch and sucrose metabolism pathway exhibited consistent upregulation across all three experimental groups, suggesting its activation during the process of biofilm-associated VBNC cell formation. Conversely, ABC transporters demonstrated a contrasting regulatory pattern, being downregulated in the biofilm state but upregulated in both the normal and VBNC states. The pentose phosphate and pyrimidine metabolism pathways displayed downregulation under normal and biofilm conditions, yet upregulation during the VBNC state, indicative of their activation specifically in the biofilm VBNC stage. Moreover, the purine metabolism pathway was uniformly downregulated across all three groups, suggesting a general suppression of this pathway irrespective of the physiological state. To investigate the potential concordance between transcriptional alterations and corresponding changes at the protein level, we performed a comprehensive proteomic analysis and conducted differential expression profiling of proteins across samples with distinct genotypes at the same developmental stage. Subsequently, we carried out enrichment analysis on the differentially expressed proteins (DEPs) and integrated the KEGG pathway results derived from the proteomic data with those obtained from the transcriptomic differential expression analysis of genes (Figs. 4 d-f). Notably, both the transcriptomic and proteomic datasets exhibited significant enrichment in key metabolic pathways, including ABC transporters, starch and sucrose metabolism, purine metabolism, pyrimidine metabolism, and the pentose phosphate pathway. With the exception of the pentose phosphate pathway which did not demonstrate enrichment in the proteome during the biofilm-associated VBNC state, the enrichment of the other pathways was notably augmented, indicating a coordinated regulatory response across the transcriptomic and proteomic layers during this physiological transition. Transcriptional regulatory mechanism of LuxS on VBNC biofilm formation To elucidate the direct regulatory impact of LuxS on gene expression, this study employed chromatin immunoprecipitation followed by sequencing (ChIP-seq) analysis on three LuxS-overexpressing samples, namely LP-LUXS-36e, LP-LUXS-36e-BF, and LP-LUXS-36e-VBNC. DNA fragments that were co-precipitated with the LuxS protein were enriched using a LuxS-specific antibody, thereby facilitating the identification of genes that interact with LuxS under conditions of overexpression. Subsequent peak calling and gene annotation of the ChIP-seq data derived from these three samples yielded 507, 232, and 111 annotated genes for LP-LUXS-36e, LP-LUXS-36e-BF, and LP-LUXS-36e-VBNC, respectively. By utilizing all peak regions as target areas, we conducted an analysis of the average signal intensity within a ± 5 kb window surrounding the peak summits (Figs. 5 d-f). The distribution patterns of the peaks revealed specific binding events that were markedly distinct from background signals within the central ± 1 kb region across all three samples (Figs. 5 a-c). Furthermore, an analysis of peak heights indicated no statistically significant variation in LuxS-DNA binding intensity among the three distinct physiological states, suggesting a consistent regulatory role of LuxS across these conditions. Intersection analysis was performed to assess the overlap between genes enriched via ChIP-seq and those exhibiting differential expression in corresponding transcriptomic datasets (Fig. 5 d-f). This analysis identified 4 genes that were common to both ChIP-seq-enriched and differentially expressed gene sets under normal conditions, 51 genes during biofilm formation, and 13 genes during the transition from biofilm to the VBNC state. Among the 13 overlapping genes identified in the biofilm-to-VBNC transition phase, 11 genes displayed unique upregulation specifically at this stage, including pgmB , rbsU , rbsD , rbsK , and tetM . Conversely, nrdD and pepc demonstrated co-upregulation in both the biofilm and biofilm-to-VBNC phases (Table 1 ). The examination of the track view (Fig. 5 g) unveiled the presence of substantial binding enrichment peaks localized specifically at the pgmB genomic locus spanning 63,678 to 65,678 bp, as well as within the nrdD , tetM , and pepC gene-associated regions. These findings suggest a plausible mechanism whereby LuxS may exert directly regulatory influence over these target genes via direct DNA-binding interactions. Of particular significance is the observation that the identified binding peaks are predominantly concentrated within the mid-coding sequences of the respective genes, rather than at canonical promoter elements. This distinctive binding pattern prompted the formulation of a hypothesis postulating that LuxS might indirectly modulate gene expression profiles through the extracellular secretion of AI-2 signaling molecules, which could subsequently engage in regulatory interactions with trans-acting factors proximal to promoter regions. Complementary transcriptomic profiling analyses further corroborated these regulatory dynamics, revealing a temporal pattern of differential gene expression characterized by the progressive upregulation of nrdD , pepc , and tetM transcripts during the VBNC state transition, whereas pgmB , rbsU , rbsD , and rbsK exhibited downregulation during biofilm maturation followed by a compensatory upregulation during the biofilm-to-VBNC transitional phase (Fig. 5 h). Table 1 Genes commonly up-regulated in the biofilm VBNC phase transcriptome and ChIP-seq. Gene ID Gene name start end GO KEGG Stage GE000054 pgmB 63678 65678 Starch and sucrose metabolism (ko00500) VBNC GE002623 - 2817838 2819838 - - Biofilm, VBNC GE002942 pepc 3177027 3179027 Developmental process (GO:0032502, BP) - Biofilm, VBNC GE002926 rbsD 3154898 3156898 - ABC transporters (ko02010) VBNC GE002927 rbsK 3155821 3157821 - Pentose phosphate pathway (ko00030) VBNC GE000055 - 64565 66565 - - VBNC GE002625 cpdA 2819198 2821198 - - VBNC GE002925 rbsU 3154473 3156473 Membrane part (GO:0044425, CC) - VBNC GE002342 nrdD 2518057 2520057 - Purine metabolism (ko00230), Pyrimidine metabolism (ko00240) Biofilm, VBNC GE002874 - 3101595 3103595 - - VBNC GE000033 - 40144 42144 - - VBNC GE000062 tetM 71724 73724 Response to stimulus (GO:0050896, BP) - VBNC GE002758 - 2965332 2967332 - - VBNC As summarized in Table 1 , the KEGG pathway annotation analysis indicated functional affiliations of the studied genes: pgmB is implicated in starch and sucrose metabolism specifically within the pentose phosphate pathway, nrdD is engaged in purine and pyrimidine metabolism pathways, rbsD is categorized under the ABC transporter system, and rbsK contributes to the pentose phosphate pathway. It is noteworthy that rbsU , Pepc , and TetM did not exhibit significant enrichment in any KEGG pathways. Subsequent functional enrichment analysis employing GO annotation revealed that rbsU was significantly enriched for the “membrane part” category, Pepc participated in “developmental process”-related functions, and tetM was associated with “response to stimulus” categories. During the VBNC state formation, overexpression of the luxS gene resulted in a statistically significant upregulation of the transcriptional expression levels of pgmB , rbsU , rbsD , rbsK , tetM , nrd D, and pepc . The ChIP-seq analysis further confirmed direct binding of LuxS to the promoter or regulatory regions of these genes, thereby substantiating its role as a positive transcriptional regulator. Notably, temporal expression profiling revealed a progressive upregulation trend for tetM , nrdD , and pepc across three distinct physiological stages namely the normal state, biofilm formation, and the biofilm-to-VBNC transition (Fig. 5 h). Among these, nrdD encodes ribonucleotide reductase, an enzyme that catalyzes the conversion of ribonucleotides to deoxyribonucleotides and is intricately involved in purine and pyrimidine metabolism pathways. pepc encodes phosphoenolpyruvate during gluconeogenesis 29 . tetM , functioning as a 30S ribosomal subunit-binding protein, is recognized for its role in mediating tetracycline resistance by stabilizing the ribosome structure 30 , although its upregulation did not attain statistical significance prior to the onset of the VBNC state. In the terminal stage of the examined physiological progression (specifically, the biofilm-to-VBNC transition), pgmB , rbsU , rb s D , and rbsK exhibited significant upregulation. Specifically, pgmB encodes glycogen phosphorylase, an enzyme whose augmented expression facilitates the conversion of glycogen into D-glucose-6-phosphate and β-D-glucose-1-phosphate, thereby modulating central metabolism. Notably, these genes are components of the rbsUDK operon (spanning genomic coordinates 3,177,027 to 3,179,027 bp), which orchestrates ribose utilization pathways. Within this operon, rbsU encodes a ribose transport membrane protein, responsible for the translocation of ribose across cellular membranes. rbsD encodes D-ribopyranose isomerase, an enzyme that catalyzes the conversion of β-D-ribopyranose (imported via the ABC transporter system) to β-D-ribofuranose, a critical step in ribose metabolism 31 . rbsK encodes ribokinase, which phosphorylates β-D-ribopyranose and ribose to generate ribose-5-phosphate 32 . This metabolite serves a dual role: it participates in nucleotide biosynthesis as a precursor for purine and pyrimidine nucleotides and is further metabolized to D-glucose-6-phosphate via the non-oxidative phase of the pentose phosphate pathway, thereby linking ribose metabolism to central carbon metabolism 32 . Discussion In the context of industrial beer production, a distinctive microbial safety concern arises from the biofilm-mediated survival strategy employed by LAB 5 . Under environmental stressors, LAB associated with beer spoilage initially form biofilms, which serve as physical protective barriers, subsequently triggering a molecular transition mechanism that leads to the VBNC state 33 . While VBNC-state bacteria lose their proliferative capacity under standard culture conditions, their metabolic activity persists, and their environmental resistance is markedly augmented through stress-response pathways. Notably, these microorganisms not only withstand extreme conditions inherent to beer systems, such as high osmotic pressure and low pH, but also exhibit remarkable resistance to routine ultrasonic sterilization and chemical disinfectants, thereby posing dual challenges to existing microbial control systems in the brewing industry 5 , 34 . This study, for the first time, demonstrates that iso-α-acids, characteristic constituents of beer, specifically induce the VBNC state transition in L. plantarum within biofilms formed on production equipment. In this state, bacterial cells undergo substantial morphological alterations, enhancing their ability to penetrate filtration membranes and evade conventional detection methods. Our findings reveal a significant positive correlation between luxS gene expression levels and AI-2 synthesis during the biofilm-to-VBNC transition. Exogenous AI-2 supplementation was also shown to significantly promote VBNC formation. Remarkably, both overexpression and knockout of the luxS gene profoundly influenced the induction of the VBNC state, underscoring the critical role of LuxS/AI-2 quorum sensing in this process. Through a comprehensive, integrated analysis of transcriptomic, proteomic, and ChIP-seq datasets, this study elucidates the molecular mechanisms governing the heightened propensity of luxS -overexpressing strains to enter the VBNC state within biofilms and evade environmental stressors. During the pre-VBNC phase, upregulation of nrdD may suppress RNA synthesis, potentially as a stress-adaptive response, while activation of pepc may initiate gluconeogenesis and biofilm formation, thereby laying the groundwork for subsequent VBNC transition. The concerted expression of these two genes likely acts synergistically to accelerate the VBNC transition, highlighting their interdependent roles in this adaptive process. Upon establishment of the VBNC state, marked upregulation of TetM may serve to preserve ribosomal integrity against environmental insults, thereby maintaining essential translational activity despite the dormant state of the bacteria. Notably, the pepc , pmgB , and rbsUDK gene clusters collectively regulate D-glucose-6-phosphate metabolism, a critical metabolic hub that not only fuels glycolysis for energy production but also participates in the oxidative phase of the pentose phosphate pathway to generate substantial NADPH, a key antioxidant cofactor that counteracts oxidative damage 32 . The acidic microenvironment induced by hop bitter acid components has been shown to exacerbate bacterial oxidative stress 35 , and under such conditions, activation of the PPP serves as a crucial antioxidant defense mechanism supporting VBNC survival. Intriguingly, while LuxS interacts with pgmB , rbsU , rbsD , and rbsK throughout the three biofilm developmental stages- attachment, maturation, and dispersal—these genes exhibit stage-specific regulation: they are downregulated during biofilm formation but significantly upregulated in the terminal phase of biofilm development and VBNC state establishment. This temporal regulation pattern suggests a dynamic interplay between LuxS and these metabolic genes, which may be fine-tuned by additional regulatory networks to optimize bacterial survival under stressful conditions. Whether these additional regulatory networks govern the observed temporal expression pattern of pgmB , rbsU , rbsD , and rbsK warrants further investigation to fully elucidate the molecular mechanisms underlying VBNC state induction and maintenance. Accumulating empirical evidence indicates that although bacteria in the VBNC state exhibit dormancy-like traits characterized by reduced energy expenditure, their metabolic activities do not diminish in a proportionate manner 36 . Rather, specific metabolic pathways remain notably active during this physiological state, underscoring the adaptive potential of VBNC bacteria. In Rhodococcus biphenylivorans , the activation of starch and sucrose metabolism pathways during the VBNC transition has been posited to augment energy provisioning, thereby facilitating adaptation to environmental stressors. This metabolic reconfiguration likely represents a strategic response to ensure survival under nutrient-limited or otherwise adverse conditions 37 . Consistently, proteomic analyses of VBNC-state E. coli have revealed upregulation of ABC transporter systems. These transporters not only modulate pentose phosphate pathway activity—a critical metabolic route for generating reducing equivalents and ribose-5-phosphate—but also potentially sustain metabolic activities by enhancing nutrient acquisition under adverse environmental conditions 38 . Our current investigation has unveiled that luxS overexpression functions as a regulatory nexus orchestrating the temporal activation of metabolic pathways via targeted gene regulation. Specifically, sustained upregulation of pmgB , a pivotal gene within the starch and sucrose metabolism pathway, serves to maintain pathway activity throughout the VBNC transition, thereby ensuring a continuous supply of metabolic intermediates. Concurrently, the induction of the rbsUDK gene cluster, which is associated with ABC transporters, plays a critical role in coordinating the simultaneous upregulation of both ABC transporter systems and the pentose phosphate pathway in established VBNC cells. This study meticulously elucidates the fundamental role of the LuxS/AI-2 QS system in orchestrating the transition from Lactobacillus plantarum biofilms to the VBNC state. By unraveling the intricate regulatory networks governing this transition, our findings significantly advance theoretical comprehension of bacterial environmental adaptation mechanisms, particularly in response to nutrient-limited or stress-induced conditions. The elucidated molecular dialogues mediated by the LuxS/AI-2 QS system underscore the adaptive plasticity of L. plantarum , enabling it to persist in dormant yet metabolically active states under adverse circumstances. Moreover, these findings provide a pivotal theoretical foundation and robust scientific rationale for developing targeted prevention and control strategies against beer-spoilage bacteria within brewing industries. Understanding the molecular underpinnings of VBNC induction in L. plantarum offers valuable insights into the ecological resilience of these microbes, thereby facilitating the design of innovative interventions aimed at mitigating biofilm formation and preventing microbial contamination in brewing processes. Collectively, this study not only enriches our theoretical understanding of bacterial stress responses but also translates fundamental knowledge into actionable strategies for enhancing the quality and safety of brewed beverages. Methods Bacterial strain L. plantarum L-PB01 (originally isolated from commercial beer as described by Deng et al. 1 ) was cultured anaerobically in MRS broth or agar at 37°C. E. coli DH5α was maintained in LB agar medium at 37°C, with those carrying either pMG36e-luxs or pNG5319△ luxS plasmids being cultured in erythromycin-supplemented LB medium. The recombinant L. plantarum strains harboring pMG36e-luxs or pNG5319△ luxS plasmids were cultivated in MRS broth/agar containing 3 µg/ml erythromycin. Vibrio harveyi BB170 was propagated in either Marine Broth 2216 or AB medium. All bacterial strains and plasmids employed in this study is illustrated in Table 2 , whereas the primer sequences used for genetic manipulations are detailed in Table 3 . Table 2 Strains and plasmids used in this study. Strains and plasmids Genotype/description Source or ref. L-PB01 Isolated from finished beer LP-△LUXS-5319 L-PB01 with plasmid pNG5319△ luxS This study L-PB01 with plasmid pMG36e-luxs This study E. coli DH5α Lab collection Table 3 Primers used in this study. Primers Sequences (5’-3’) luxS-F ATTCGTAATTCGAGCTCGCCTTGCTCTAGGAAGGCTAAAG luxS-R CGTTTTCAGACTTTGCAAGCTCCGCTCGAGCTATTCAACGA pMG36e-F AGCTTGCAAAGTCTGAAAACG pMG36e-R GGCGAGCTCGAATTACGAATT yzluxS-F GGCAATCGTTTCAGCAGAAAAA yzluxS-R TTTACCAACTGTCTTGGCCGC xxh-L CCACTGGAGCACGTTTAAACAAT xxh-R GCGCGTTATCGGTCCTTTAATT luxS-L-f CCTTTGGGCGAATTTGTCGTGG luxS-L-r GAGTCCACATCCAGTGTGTTGTC luxS-R-f GCGTAGTTGATAGTGCTAATC luxS-R-r GCACGGGAATATTATGTTCTTTGGC xxh2-F ggctgtaccgttcgtatagcatac Xxh2-R gatctctaaagctgacggggtaaac qcyz-F ggcaatgtgctacacttgagtt qcyz-L agtggctctaacttatcccaat Preparation and identification of biofilm cells Following activation, L. plantarum cultures were inoculated at 2% (v/v) into fresh MRS broth and incubated statically at 37°C for 36 hours. Bacterial cells were harvested by centrifugation at 12,000 × g for 5 min, washed twice with sterile physiological saline, and resuspended to a final concentration of 1×10 7 CFU/mL to prepare biofilm-embedded cells. Biofilm formation capacity of both recombinant and wild-type strains was quantitatively assessed using crystal violet staining. Activated cultures were inoculated at 1% (v/v) into MRS medium and incubated statically at 37°C for 36 hours. Subsequently, planktonic cells were removed by gentle PBS washing, and adherent biofilms were air-dried at room temperature. The bound crystal violet was solubilized using 100 µL of 95% ethanol, and biofilm biomass was quantified by measuring optical density at 600 nm using a microplate reader. Induction and identification of VBNC state To induce the VBNC state, 1 mL of biofilm-forming cells was added to 9 mL of sterile water containing 27 mg/L iso-α-acids, resulting in an initial bacterial concentration of 1×10 6 CFU/mL. The mixture was incubated at 18°C for 12 hours under static conditions. The culturability of the bacterial strain was assessed using the MRS agar plate method. Specifically, 200 µL of the bacterial suspension was spread onto MRS agar plates and incubated anaerobically at 37°C for 24 hours, followed by colony counting. The total cell count was determined using the acridine orange direct counting (AODC) method. Cell viability was evaluated using the BacLight Live/Dead Bacterial Viability Kit, which employs SYTO 9 and propidium iodide (PI) staining solutions to assess membrane integrity. After staining, the cell suspension was analyzed using a Guava easyCyte 8HT flow cytometer with 488 nm blue excitation light. Preparation of cell-free supernatant and AI-2 activity detection L. plantarum was inoculated into MRS broth and skim milk medium, respectively, and incubated at 37°C for 12 hours under static conditions. The cultures were then centrifuged at 12,000 × g for 15 minutes, and the supernatants were collected. The supernatants were filtered through a 0.22 µm sterile membrane filter, adjusted to pH 7.0, and stored at -80°C as cell-free supernatants (CFS). For AI-2 activity detection, V. harveyi BB170 was diluted 1:5000 in AB medium. The CFS was added to the diluted BB170 culture at a ratio of 1:10 (v/v), and the mixture was incubated at 28°C for 5 hours. Subsequently, 100 µL of the sample was transferred to a white 96-well plate to measure AI-2 activity. The CFS from E. coli DH5α was used as a negative control. Luminescence was quantified using a microplate reader. Construction of Plasmids and Strains The genomic DNA of L. plantarum was extracted using a bacterial DNA extraction kit (Sangon Biotech Co., Shanghai, China). The luxS gene was amplified using primers luxS -F and luxS -R, which contained homologous arms. The amplified luxS gene was then seamlessly cloned into the linearized pMG36e vector, resulting in the construction of the recombinant plasmid luxS -pMG36e. This plasmid was subsequently transformed into E.coli DH5α, and the transformants were verified by PCR using primers yz luxS -F and yz luxS -R. Both the luxS -pMG36e plasmid and the empty pMG36e vector were electroporated into competent cells of L. plantarum . The recombinants were selected on erythromycin-containing plates and further confirmed by PCR and DNA sequencing. Quantitative Real-Time Reverse Transcription PCR (qRT-PCR) Total RNA was extracted using TRIpure reagent (Aidlab Biotech Co., Ltd., Beijing, China) following the manufacturer’s protocol. First-strand cDNA synthesis was performed with the TUREscript 1st Strand cDNA Synthesis Kit (Aidlab Biotech Co., Ltd.) according to the following protocol: 50 ng-5 µg of total RNA, 1 µL of random primer, 4 µL of 5×RT Reaction Mix, 1 µL of TUREscript H-RTase, and RNase-free H 2 O to a final volume of 20 µL. The reaction conditions included an initial incubation at 25°C for 10 minutes, followed by reverse transcription at 42°C for 30–50 minutes, and enzyme inactivation at 65°C for 15 minutes. The luxS gene sequence was subjected to comprehensive analysis leveraging whole-genome sequencing data, and specific primers were meticulously designed utilizing Primer3 software (version 0.4.0) with the 16S rRNA gene serving as the internal reference control (Table 4 ). qRT-PCR was executed empolying a SYBR Green-based detection system to ensure high sensitivity and specificity. The relative expression levels of the luxS were subsequently quantified using the 2 − ΔΔCT method, which facilitates the normalization of gene expression data against the internal reference gene and the calculation of fold changes relative to a calibrator sample. Table 4 Primers for Real-time PCR Primers Sequences (5’-3’) r-luxS-F TTTGGTTGCCGGACTGGTT r-luxS-R CAATCGTCGTTCCTTGAACATCT 16s RNA-F AGCCGACCTGAGAGGGTAAT 16s RNA-R CAATCGTCGTTCCTTGAACATCT Morphological Structure Observation Cells in planktonic, biofilm, and VBNC states were centrifuged at 4,000 rpm for 10 minutes. The supernatant was discarded, and the cell pellets were retained. The pellets were immediately fixed with glutaraldehyde at a final concentration of 2.5% and stored at 4°C overnight. Subsequently, the samples were dehydrated using a graded ethanol series up to 100% and mounted on a scanning electron microscopy (SEM) stage for morphological and structural observation. Growth Curve Determination The recombinant strains LP-LUXS-36e and LP-△LUXS-5319, as well as the wild-type strain L-PB01, were cultured in MRS broth. The cell density was measured at OD 600 using a UV-1800 spectrophotometer at 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, and 36 hours. Each measurement was performed in triplicate. Sample preparation for transcriptomics and proteomics Twelve samples (including normal strain and LP-LUXS-36e in both planktonic and biofilm states, with three biological replicates per group) were immediately flash-frozen in liquid nitrogen for 30 minutes. Yeast RNA was extracted following the instructions of the fungal RNA extraction kit, followed by flash-freezing in liquid nitrogen and storage at -80°C. RNA purity was assessed via 1% agarose gel electrophoresis, while RNA integrity was evaluated using an Agilent 2200 TapeStation. RNA concentration and quality were determined using a Nanodrop spectrophotometer. The transcriptomic library was constructed using the TruseqTM RNA Sample Prep Kit. Prior to PCR amplification, the cDNA second strand was digested with UNG enzyme to retain only the first-strand cDNA in the library. The library fragment size was quantified using Qubit 2.0 and Agilent 2100. The resulting libraries were sequenced on an Illumina NovaSeq 6000 in PE150 mode. For proteomic samples, an appropriate amount of frozen RNA powder was transferred to a 1.5 mL centrifuge tube and mixed with SDT lysis buffer (4% SDS, 100 mM Tris-HCl, 10 mM DTT, 1 mM PMSF, and 2 mM EDTA). After vortexing, the mixture was boiled at 95°C for 15 minutes, followed by ultrasonic lysis on ice for 10 min. The supernatant containing proteins was collected via centrifugation. Cold acetone (four times the volume) was added to the protein solution for overnight precipitation at -20°C. The precipitate was collected by centrifugation at 4°C and washed three times with cold acetone. Finally, the pellet was redissolved in 8M urea, and total protein concentration was measured using a BCA assay kit (Beyotime Biotechnology, Shanghai, China). Proteins exhibiting a fold change ≥ 2 and P-value < 0.05 between sample groups were identified as differentially expressed proteins. These proteins were subsequently subjected to the GO functional clustering analysis and the KEGG pathway enrichment analyses. Chromatin immunoprecipitation (ChIP) L. plantarum cells (6 × 10 10 ) were crosslinked with 1% formaldehyde at 37°C for 20 minutes, followed by quenching with 125 mM glycine (Macklin, #810676). Cells were pelleted by centrifugation, washed twice with Tris-buffer (150 mM NaCl, 20 mM Tris-HCl pH 7.5) containing protease inhibitor cocktail (Roche, #4693116001), and resuspended in 40 mL lysis buffer (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS, 1% Triton X-100, Roche protease inhibitor #11836170001) for 30 minutes. Chromatin was sheared using a Covaris M220 sonicator (14 minutes, 200–500 bp fragments). For immunoprecipitation, 2 µL of chromatin was saved as input DNA (− 20°C), while 100 µL was incubated overnight at 4°C with 5 µg anti-LuxS antibody (Invitrogen, #PA5-117653, 1:1000). Protein G magnetic beads (30 µL) were added and incubated for 3 hours at 4°C. Beads were sequentially washed with: Low-salt buffer (20 mM Tris-HCl pH 8.1, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS); LiCl buffer (10 mM Tris-HCl pH 8.1, 250 mM LiCl (ThermoFisher, #AM9480), 1 mM EDTA, 1% NP-40 (ThermoFisher, #85124), 1% deoxycholate (Solarbio, #D8460)) twice;TE buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA) twice. Bound DNA was eluted with 300 µL elution buffer (100 mM NaHCO 3 (Macklin, #S837271), 1% SDS) and treated sequentially with RNase A (8 µg/mL, ThermoFisher #EN0531, 65°C, 6 hours) and proteinase K (345 µg/mL, Macklin #39450-01-6, 45°C, overnight). ChIP and input DNA were end-repaired/dA-tailed (NEB #E7442), ligated to adapters (NEB #E7445), amplified for 15 cycles, and sequenced on Illumina NovaSeq 6000 (PE150). Statistical Analysis The values for each individual experiment are expressed as mean ± standard deviation (SD) of three independent biological replicates. Data were analyzed with one-way or two-way analysis of variance (ANOVA), followed by the Tukey’s comparison test (Xlstat software). The differences were considered to be statistically significant at a P- value < 0.05. ChIP-seq Data Analysis Raw sequencing data were processed with fastp (v0.20.0) to remove adapter sequences and low-quality reads shorter than 35 bp, generating high-quality clean reads. Data quality was further verified using FastQC. Clean reads were aligned to the mouse reference genome (GRCm38 assembly) using Bowtie2 (v2.2.6). The aligned files were converted to BAM, bigWig, and bedGraph formats using samtools (v1.10) and deepTools (v3.3.2), with the latter also employed for read count normalization and visualization. Peak calling was performed using MACS2 (v2.2.7.1) with a p -value threshold < 0.01. Annotated peaks were mapped to genomic features using the ChIPseeker R package. Differential peaks were identified by DESeq2 (for samples with replicates) or MAnorm2 (for non-replicated samples), with significance thresholds set as |log₂(fold change)| > 1 and adjusted p -value < 0.05. GO and KEGG pathway enrichment analyses of significant peaks were conducted using clusterProfiler. False discovery rate (FDR) correction was applied to calculate adjusted P -values for multiple testing. Only genes with adjusted P -values < 0.05 were retained for downstream analysis. De novo motif discovery within peaks was performed using HOMER (v4.11). Declarations Conflict of interest The authors declare that they have no conflict of interest. Author Contribution X.L. and C.H. was responsible for conceptualization, data curation, formal analysis, investigation, methodology, validation, visualization, and writing of the original draft. H.L., Q.X. and Z.W. curated the data, performed formal analysis, methodology, and visualization, and wrote the original draft. J.L. Reviewed and edited the manuscript. P.S. and T.D. performed the conceptualization, supervised the study, and reviewed and edited the manuscript. Y.D. conceptualized the study, acquired funds, performed the methodology and project administration, managed resources, supervised the study, and reviewed and edited the manuscript. Acknowledgements This study was financially supported by the National Natural Science Foundation of China (Nos. 32272279 and 32202191), the Key R&D project of Shandong Province (2023CXPT007 and 2024CXPT014), and the Key R&D Project of Qingdao Science and Technology Plan (24-2-3-4-zyyd-jch). References Deng, Y. et al. Reduction and restoration of culturability of beer-stressed and low-temperature-stressed Lactobacillus acetotolerans strain 2011-8. International Journal of Food Microbiology 206, 96–101 (2015). Zhu, Y., Li, C., Cui, H. & Lin, L. Feasibility of cold plasma for the control of biofilms in food industry. Trends in Food Science & Technology 99, 142–151 (2020). Wang, S. et al. Strategy to combat biofilms: a focus on biofilm dispersal enzymes. npj Biofilms and Microbiomes 9, 63 (2023). Maifreni, M. et al. Bacterial biofilm as a possible source of contamination in the microbrewery environment. Food Control 50, 809–814 (2015). Wang, Z. et al. Formation of viable, but putatively non-culturable (VPNC) cells of beer-spoilage lactobacilli growing in biofilms. LWT 133, 109964 (2020). Ayrapetyan, M. & Oliver, J.D. The viable but non-culturable state and its relevance in food safety. Current Opinion in Food Science 8, 127–133 (2016). Guo, L., Ye, C., Yu, X. & Horn, H. Induction of bacteria in biofilm into a VBNC state by chlorine and monitoring of biofilm structure changes by means of OCT. Science of The Total Environment 891 (2023). Xiao, Y. et al. Formation and resuscitation of viable but non-culturable (VBNC) yeast in the food industry: A review. International journal of food microbiology 426, 110901 (2025). Xiao, Y. et al. Characterization and formation mechanisms of viable, but putatively non-culturable brewer's yeast induced by isomerized hop extract. LWT 155, 112974 (2022). Wang, Z. et al. POX1 regulates the formation of viable but non-culturable brewer’s yeast induced by iso-alpha acid from hops. Food Science and Human Wellness (2024). Alvarez-Ordóñez, A., Coughlan, L.M., Briandet, R. & Cotter, P.D. Biofilms in Food Processing Environments: Challenges and Opportunities. Annual Review of Food Science and Technology 10, 173–195 (2019). Whiteley, M., Diggle, S.P. & Greenberg, E.P. Progress in and promise of bacterial quorum sensing research. Nature 551, 313–320 (2017). Gu, Y. et al. Dissecting signal molecule AI-2 mediated biofilm formation and environmental tolerance in Lactobacillus plantarum . Journal of Bioscience and Bioengineering 131, 153–160 (2021). Liu, L., Wu, R., Zhang, J. & Li, P. Overexpression of luxS Promotes Stress Resistance and Biofilm Formation of Lactobacillus paraplantarum L-ZS9 by Regulating the Expression of Multiple Genes. Frontiers in microbiology 9, 2628 (2018). Ayrapetyan, M., Williams, T.C., Oliver, J.D. & Griffiths, M.W. Interspecific Quorum Sensing Mediates the Resuscitation of Viable but Nonculturable Vibrios. Applied and Environmental Microbiology 80, 2478–2483 (2014). Liu, J. et al. Study on spoilage capability and VBNC state formation and recovery of Lactobacillus plantarum . Microbial pathogenesis 110, 257–261 (2017). Chaveerach, P., ter Huurne, A.A., Lipman, L.J. & van Knapen, F. Survival and resuscitation of ten strains of Campylobacter jejuni and Campylobacter coli under acid conditions. Applied and environmental microbiology 69, 711–714 (2003). Bai, H. et al. Citric acid can force Staphylococcus aureus into viable but nonculturable state and its characteristics. International Journal of Food Microbiology 305 (2019). Liu, J. et al. Induction and Recovery of the Viable but Nonculturable State of Hop-Resistance Lactobacillus brevis . Frontiers in microbiology 9, 2076 (2018). Sakamoto, K. & Konings, W.N. Beer spoilage bacteria and hop resistance. International Journal of Food Microbiology 89, 105–124 (2003). Vattakaven, T., Bond, P., Bradley, G. & Munn, C.B. Differential effects of temperature and starvation on induction of the viable-but-nonculturable state in the coral pathogens Vibrio shiloi and Vibrio tasmaniensis . Applied and environmental microbiology 72, 6508–6513 (2006). Zeng, B. et al. Formation and Resuscitation of Viable but NonculturableSalmonella typhi. BioMed Research International 2013, 1–7 (2013). Gu, Y. et al. Effects of Exogenous Synthetic Autoinducer-2 on Physiological Behaviors and Proteome of Lactic Acid Bacteria. ACS Omega 5, 1326–1335 (2020). Zhang, Y. et al. Exploring the relationship between the signal molecule AI-2 and the biofilm formation of Lactobacillus sanfranciscensis. Lwt 154 (2022). Bay, D.C. & Turner, R.J. Diversity and evolution of the small multidrug resistance protein family. BMC Evolutionary Biology 9 (2009). Wang, Q. et al. luxS Mutant Regulation: Quorum Sensing Impairment or Methylation Disorder? Sensors 12, 6176–6185 (2012). Tannock, G.W. et al. Ecological behavior of Lactobacillus reuteri 100 – 23 is affected by mutation of the luxS gene. Applied and environmental microbiology 71, 8419–8425 (2005). Buck, B.L., Azcarate-Peril, M.A. & Klaenhammer, T.R. Role of autoinducer-2 on the adhesion ability of Lactobacillus acidophilus . Journal of applied microbiology 107, 269–279 (2009). Li, R. et al. Identification and Analysis of PEPC Gene Family Reveals Functional Diversification in Orchidaceae and the Regulation of Bacterial-Type PEPC. International journal of molecular sciences 25 (2024). Dönhöfer, A. et al. Structural basis for TetM-mediated tetracycline resistance. Proceedings of the National Academy of Sciences of the United States of America 109, 16900–16905 (2012). McLeod, A., Snipen, L., Naterstad, K. & Axelsson, L. Global transcriptome response in Lactobacillus sakei during growth on ribose. BMC microbiology 11, 145 (2011). Lei, M.G. & Lee, C.Y. RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus . J Bacteriol 197, 3666–3675 (2015). Li, L., Mendis, N., Trigui, H., Oliver, J.D. & Faucher, S.P. The importance of the viable but non-culturable state in human bacterial pathogens. Frontiers in microbiology 5, 258 (2014). Piao, M. et al. Induction of viable but putatively non-culturable Lactobacillus acetotolerans by thermosonication and its characteristics. LWT 109, 313–318 (2019). Schurr, B.C., Hahne, H., Kuster, B., Behr, J. & Vogel, R.F. Molecular mechanisms behind the antimicrobial activity of hop iso-α-acids in Lactobacillus brevis . Food microbiology 46, 553–563 (2015). Wang, H. et al. Metabolomic Differences between Viable but Nonculturable and Recovered Lacticaseibacillus paracasei Zhang. Foods (Basel, Switzerland) 12 (2023). Su, X. et al. Identification, characterization and molecular analysis of the viable but nonculturable Rhodococcus biphenylivorans . Scientific reports 5, 18590 (2015). Se, J. et al. Proteomic changes of viable but nonculturable (VBNC) Escherichia coli O157:H7 induced by low moisture in an artificial soil. Biology and Fertility of Soils 57, 219–234 (2021). Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterials.docx GraphicAbstract.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6435335","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":442205335,"identity":"b7af77c3-2948-48a5-b855-895364168373","order_by":0,"name":"Xuchen Li","email":"","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Xuchen","middleName":"","lastName":"Li","suffix":""},{"id":442205336,"identity":"7cbc8fde-de1a-42e4-8e58-beeb10f968c9","order_by":1,"name":"Chuanchao Huang","email":"","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Chuanchao","middleName":"","lastName":"Huang","suffix":""},{"id":442205337,"identity":"5c2ce52e-75ec-4a71-9dda-03503e973d55","order_by":2,"name":"Hongliang Liu","email":"","orcid":"","institution":"Shandong Huifa Foodstuff Co., Ltd","correspondingAuthor":false,"prefix":"","firstName":"Hongliang","middleName":"","lastName":"Liu","suffix":""},{"id":442205338,"identity":"74f37cc7-be39-4006-aeb7-2714c977c9a9","order_by":3,"name":"Qianqian Xin","email":"","orcid":"","institution":"Shandong Huifa Foodstuff Co., Ltd","correspondingAuthor":false,"prefix":"","firstName":"Qianqian","middleName":"","lastName":"Xin","suffix":""},{"id":442205339,"identity":"30c3ced0-ebf7-452f-8ddf-8025ba498841","order_by":4,"name":"Zhijian Wang","email":"","orcid":"","institution":"Shandong Huifa Foodstuff Co., Ltd","correspondingAuthor":false,"prefix":"","firstName":"Zhijian","middleName":"","lastName":"Wang","suffix":""},{"id":442205340,"identity":"9b564cad-c321-4714-9d57-5d553633174d","order_by":5,"name":"Pengdong Sun","email":"","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Pengdong","middleName":"","lastName":"Sun","suffix":""},{"id":442205341,"identity":"723cdd96-a770-46bb-8195-2b7ea8e20bf1","order_by":6,"name":"Ting Ding","email":"","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Ting","middleName":"","lastName":"Ding","suffix":""},{"id":442205342,"identity":"3ce3a9c8-47c5-4848-86d5-f1cf0ba6ef31","order_by":7,"name":"Jingyuan Li","email":"","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":false,"prefix":"","firstName":"Jingyuan","middleName":"","lastName":"Li","suffix":""},{"id":442205343,"identity":"df4dcd34-01f5-4290-ae4e-5382ebb78ffb","order_by":8,"name":"Yang Deng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABBUlEQVRIiWNgGAWjYDCCA1Da/jDzwcdgFjNzA3FaGI6zJRszMBgAtTASq+U8j5k0WAsDAS18x3sPv+apuWPX2MxjVl1Q8Seavx2o5UfFNpxaJM+cS7PmOfYsuZmZrez2jDMGuTMOMzYw9py5jVOLwY0cM2MetsPJbMzM227zthnkNgC1MDO24dFy/w1Qy7/DyTzMDGbFIC3zCWq5wWP8mLftsJ0EM4sZM0jLBkJaJM/kmDHO7TucYMDMlizNc8Y4dyNQy0F8fuE7fsb4w5tvh+0N+A8f/MxTIZc77/zhgw9+VODWAgRsUjwMDIkNyEIH8KkHAuaPP4DphYCiUTAKRsEoGMkAAN6iW41o5eVWAAAAAElFTkSuQmCC","orcid":"","institution":"Qingdao Agricultural University","correspondingAuthor":true,"prefix":"","firstName":"Yang","middleName":"","lastName":"Deng","suffix":""}],"badges":[],"createdAt":"2025-04-12 15:08:17","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6435335/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6435335/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":80595592,"identity":"748b3024-df05-4759-bb8d-11ff48721998","added_by":"auto","created_at":"2025-04-15 03:50:17","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":175053,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eCellular dynamics and morphological characterization of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eL. plantarun\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e L-PB01 under isomerized hop extract treatment.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a-d) Total cell, viable cell, and culturable cell counts with different concentrations of isomerized hop extracts (a: 0 g/L; b: 9 mg/L; c: 18 mg/L; d: 27 mg/L). (e-g) SEM morphological characteristics: (e) planktonic cells, (f) biofilm-associated cells, (g) VBNC-state cells. Green circles highlight significant morphological and structural alterations between different physiological states.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6435335/v1/259ae1cd7c5ed0ce251d9d1d.png"},{"id":80596076,"identity":"eb1c44fb-a87e-48d1-ae53-71355a439612","added_by":"auto","created_at":"2025-04-15 03:58:17","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":140586,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIntegrated Crosstalk Between AI-2 Signaling and\u003c/strong\u003e\u003cem\u003e\u003cstrong\u003e luxS-\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eDependent Regulation in Biofilm Formation and VBNC State Dynamics.\u003c/strong\u003e \u003cstrong\u003e(a)\u003c/strong\u003e Luminescence intensity of different culture media. \u003cstrong\u003e(b)\u003c/strong\u003e Effect of cell-free supernatant (CFS) on biofilm production (*\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05;\u003cem\u003e \u003c/em\u003eerror bars: SD, \u003cem\u003en\u003c/em\u003e = 3). \u003cstrong\u003e(c)\u003c/strong\u003e Relationship between gene expression and AI-2 concentration during VBNC entry. \u003cstrong\u003e(d)\u003c/strong\u003e Impact of AI-2 supplementation on (0–100 μM) on culturable bacterial counts in membrane cells induced by 27 mg/L Iso-α-acids. \u003cstrong\u003e(e)\u003c/strong\u003e VBNC recovery in coated cells treated with varying CFS volume ratios. \u003cstrong\u003e(f)\u003c/strong\u003e Effect of AI-2 concentration on VBNC state recovery. \u003cstrong\u003e(g)\u003c/strong\u003e \u003cem\u003eluxS\u003c/em\u003e mRNA expression levels in LP-\u003cem\u003eluxS\u003c/em\u003e-36e vs. wild-type strains. \u003cstrong\u003e(h)\u003c/strong\u003e Culturable bacterial counts in membrane cells of different strains under 27 mg/L Iso-α-acids induction. \u003cstrong\u003e(i)\u003c/strong\u003e Recovery dynamics of culturable bacteria in coated cells of different strains during VBNC exit.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6435335/v1/2cb3a711122066fdd83680a3.png"},{"id":80595599,"identity":"3ccbaa5e-a21e-4993-accf-35a347ac2ddf","added_by":"auto","created_at":"2025-04-15 03:50:17","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":176140,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscription-proteomic association analysis of the mechanism of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eluxS\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e regulation of LP-B01 VBNC biofilm formation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e(a-c) Venn diagram of differentially expressed genes shared in three stages: (a) All differentially expressed genes, (b) Up-regulated genes, (c) Down-regulated genes. (d-f) Volcano plot of differentially expressed genes: (d) Normal state, (e) Biofilm state, (f) Biofilm VBNC state. (g-i) KEGG enrichment analysis results of up-regulated genes: (g) Normal state, (h) Biofilm state, (i) Biofilm VBNC state.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-6435335/v1/f95d6746e455f59dd77ce473.png"},{"id":80596077,"identity":"3cd54869-0c6f-4222-b50b-ab9dcb2893d3","added_by":"auto","created_at":"2025-04-15 03:58:17","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":161464,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIntegrated Pathway Enrichment and Multi-Omics Association in \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eluxS\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e-Regulated Biofilm VBNC Formation.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(a-c)\u003c/strong\u003e Gene Set Enrichment Analysis (GSEA) of KEGG pathways across distinct states: \u003cstrong\u003e(a)\u003c/strong\u003eNormal state, \u003cstrong\u003e(b)\u003c/strong\u003e Biofilm state, \u003cstrong\u003e(c)\u003c/strong\u003e Biofilm VBNC state. \u003cstrong\u003e(d-f)\u003c/strong\u003eEnrichment of ABC transporters, starch and sucrose metabolism, purine metabolism, pyrimidine metabolism, and pentose phosphate pathway in both proteome and transcriptome: \u003cstrong\u003e(d)\u003c/strong\u003e Normal state, \u003cstrong\u003e(e)\u003c/strong\u003e Biofilm state, \u003cstrong\u003e(f)\u003c/strong\u003eBiofilm VBNC state.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-6435335/v1/a5618812c4ac6395e244502a.png"},{"id":80596078,"identity":"32b077f3-22cb-42e3-a726-0eeb26c2af68","added_by":"auto","created_at":"2025-04-15 03:58:18","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":198535,"visible":true,"origin":"","legend":"\u003cp\u003eIntegrative Analysis of luxS-Dependent Transcriptional Regulation and Target Gene Dynamics in VBNC Biofilm Formation.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(a-c)\u003c/strong\u003eChIP-seq fragment center enrichment profiles across states: \u003cstrong\u003e(a)\u003c/strong\u003e Normal state, \u003cstrong\u003e(b)\u003c/strong\u003e Biofilm state, \u003cstrong\u003e(c)\u003c/strong\u003e Biofilm VBNC state. \u003cstrong\u003e(d-f)\u003c/strong\u003eVenn diagrams of genes co-upregulated in transcriptome and ChIP-seq datasets: \u003cstrong\u003e(d)\u003c/strong\u003eNormal state, \u003cstrong\u003e(e)\u003c/strong\u003e Biofilm state, \u003cstrong\u003e(f)\u003c/strong\u003e Biofilm VBNC state. \u003cstrong\u003e(g)\u003c/strong\u003eExpression tracks of \u003cem\u003etetM\u003c/em\u003e, \u003cem\u003enrdD\u003c/em\u003e, \u003cem\u003epepC\u003c/em\u003e, and \u003cem\u003epgmB\u003c/em\u003e in Ctrl, BF2, and VBNC conditions. \u003cstrong\u003e(h)\u003c/strong\u003e Relative expression changes of \u003cem\u003epgmB\u003c/em\u003e, \u003cem\u003erbsU\u003c/em\u003e, \u003cem\u003erbsD\u003c/em\u003e, \u003cem\u003erbsK\u003c/em\u003e, \u003cem\u003etetM\u003c/em\u003e, \u003cem\u003enrdD\u003c/em\u003e, and \u003cem\u003epepC\u003c/em\u003ein LuxS-overexpressing cells vs. wild type under distinct conditions.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-6435335/v1/2798335d56b8ced66556ed0b.png"},{"id":80635906,"identity":"3aefd7b1-4c11-44e8-8957-d6a6bd998874","added_by":"auto","created_at":"2025-04-15 12:23:44","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2164622,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6435335/v1/7e373020-bdd5-4abf-8bfa-f88d03018620.pdf"},{"id":80595596,"identity":"3e00e5eb-d4a6-4c6c-aca5-451888394c9b","added_by":"auto","created_at":"2025-04-15 03:50:17","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1000457,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-6435335/v1/ad80e78c8f9af0a9f154a69c.docx"},{"id":80595601,"identity":"0e25390b-f7e6-442f-824c-7821b4c12085","added_by":"auto","created_at":"2025-04-15 03:50:17","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":647520,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicAbstract.docx","url":"https://assets-eu.researchsquare.com/files/rs-6435335/v1/96659f9cd2a2ee21825963d1.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mechanism insights into the regulation of the LuxS/AI-2 quorum sensing system on the formation of viable but nonculturable state in biofilm cells of beer-spoilage Lactiplantibacillus plantarum","fulltext":[{"header":"Introduction","content":"\u003cp\u003eBeer, recognized as one of the most ancient fermented alcoholic beverages, encounters multifaceted microbial safety dilemmas during industrial-scale production. The protracted brewing timelines and sophisticated equipment configurations frequently engender microbial colonization niches within sanitation-challenged zones, such as pipeline elbows and sealing interfaces, thereby precipitating recurrent off-odor generation and product turbidity phenomena \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. Under extended operational regimes, microbial populations exhibit a propensity for biofilm-mediated surface colonization-a cooperative survival paradigm that confers augmented environmental resilience and cleansing resistance \u003csup\u003e\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e\u003c/sup\u003e. Notably, biofilm matrix development not only markedly amplifies microbial viability but also catalyzes their phenotypic transition into the viable but non-culturable (VBNC) state, thereby posing a twofold existential threat to the food safety continuum \u003csup\u003e\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. As an adaptive stress-response mechanism, the VBNC state enables microbial persistence under conventional culturing paradigms while preserving metabolic functionality, with latent proliferative capacity upon stressor alleviation \u003csup\u003e\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. Emerging evidence suggests that residual chlorine concentrations in municipal water treatment systems can elicit biofilm-entrenched bacteria to adopt the VBNC state, thereby undermining conventional detection protocols and introducing microbial safety vulnerabilities \u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003ePrevious investigations conducted by our research group have elucidated the transformational trajectories of beer-spoilage lactic acid bacteria (LAB) into the VBNC state, specifically identifying hop-derived phytochemicals (iso-α-acids), cryogenic anaerobic conditions, and interspecies microbial antagonism as potent inducers of VBNC-state transition in beer-spoilage \u003cem\u003eLactobacillus plantarum\u003c/em\u003e, \u003cem\u003eL. acetotolerans\u003c/em\u003e, and \u003cem\u003ePediococcus damnosus\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan additionalcitationids=\"CR9\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e\u003c/sup\u003e. Despite losing culturability under standard laboratory protocols, these VBNC-transformed LAB retain their pathogenic potential to induce turbidity and generate off-flavor metabolites, thereby compromising beer quality. Recent studies has further substantiated that biofilm communities colonizing brewing apparatus serve as microbial sanctuaries, where sessile spoilage bacteria readily adopt the VBNC phenotype under sustained environmental pressures \u003csup\u003e\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e. These cryptic VBNC biofilms elude conventional detection methodologies, representing the most insidious microbial hazard within contemporary beer production paradigms.\u003c/p\u003e \u003cp\u003eThe quorum sensing (QS) system represents a fundamental bacterial mechanism employed for the detection of population density through the utilization of chemical signaling molecules, subsequently orchestrating the regulation of physiological behaviors. Upon attainment of a critical population threshold, bacteria secrete autoinducers, the accumulation of which initiates a sequential cascade of gene expression, thereby coordinating the modulation of biofilm formation, virulence factor secretion, and bacteriocin synthesis \u003csup\u003e\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u003c/sup\u003e. QS systems are classified into three primary categories: Gram-negative, Gram-positive, and interspecies communication types. Notably, the LuxS/AI-2 system functions as a ubiquitous interspecies QS mechanism, widely distributed among both Gram-positive and Gram-negative bacteria. The central signal molecule AI-2, encoded by the luxS gene, demonstrates a high degree of structural conservation across intra- and interspecies LAB strains \u003csup\u003e\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. Research findings corroborate that \u003cem\u003eluxS\u003c/em\u003e overexpression in \u003cem\u003eL. plantarum\u003c/em\u003e L-ZS9 markedly augments AI-2 production and biofilm formation \u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e\u003c/sup\u003e. Further explorations have unveiled that AI-2 activates the LuxR regulator to upregulate \u003cem\u003erpoS\u003c/em\u003e expression, consequently inducing the overexpression of the catalase gene \u003cem\u003ekatG\u003c/em\u003e, which enhances environmental resistance and sustains survival in the VBNC state of \u003cem\u003eVibrio vulnificus\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. It is noteworthy that, while contemporary VBNC research predominantly concentrates on planktonic bacteria, biofilm-associated cells may exhibit unique VBNC formation mechanisms attributable to metabolic divergence, implying a specialized function for QS systems in the regulation of biofilm-associated VBNC states.\u003c/p\u003e \u003cp\u003eThis study utilizes \u003cem\u003eL. plantarum\u003c/em\u003e, a widespread beer-spoilage bacterium renowned for its potent biofilm-forming capabilities and a well-conserved LuxS/AI-2 QS system \u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e\u003c/sup\u003e, as the exprimental model. Leveraging this model, we seek to unravel the molecular intricacies governing the regulation of VBNC transition in biofilm-encased cells by the \u003cem\u003eluxS\u003c/em\u003e gene, thereby surmounting the constraints inherent in traditional planktonic bacteria-centric research. The insights garnered from this study will furnish a theoretical framework for the development of QS-directed interventions aimed at mitigating beer-spoilage microorganisms.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eInduction and recovery of VBNC state\u003c/h2\u003e \u003cp\u003eAs illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, L. \u003cem\u003eplantarum\u003c/em\u003e L-PB01 was effectively induced into the viable but non-culturable (VBNC) state through exposure to iso-α-acids. The concentration of iso-α-acids exerted a pronounced effect on bacterial culturability and survival. In the untreated control group, cells maintained full viability and culturability over the entire experimental duration (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). For cultures subjected to 9\u0026ndash;27 mg/L iso-α-acids, total cell counts remained consistent, yet viable cell numbers demonstrated a marginal decline. Notably, culturability was entirely eradicated at 18 mg/L following 24 hours of exposure and at 27 mg/L after 12 hours of exposure, while viable cell counts remained relatively high, thereby confirming successful VBNC induction (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb\u0026ndash;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). Partial culturability was restored following the alleviation of stress through 24 hours of incubation in MRS medium at 37\u0026deg;C, underscoring the reversible nature of VBNC entry under iso-α-acids-induced stress. These findings imply that biofilm-associated spoilage bacteria within brewing systems may leverage this mechanism to circumvent conventional detection methodologies.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe present study advances the comprehension of the molecular mechanisms governing weak organic acid-mediated VBNC state induction. Chaveerach et al. previously demonstrated that formic acid can elicit VBNC entry in \u003cem\u003eCampylobacter\u003c/em\u003e within 2-hour timeframe \u003csup\u003e\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e, and the Bai group subsequently validated that \u003cem\u003eStaphylococcus aureus\u003c/em\u003e induced into the VBNC state via citric acid treatment retains elevated ATP levels and exhibits recovery potential \u003csup\u003e\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e. Significantly, as a representative weak organic acid, the mechanism through which hop-derived iso-α-acids induce \u003cem\u003eL. brevis\u003c/em\u003e to enter the VBNC state has been elucidated \u003csup\u003e\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u003c/sup\u003e. This investigation represents the inaugural confirmation of the inductive effect of iso-α-acids on \u003cem\u003eL. plantarum\u003c/em\u003e VBNC transition, which, in conjunction with the distinctive beer microenvironment (characterized by low pH, high ethanol/CO₂ concentrations, and hop antimicrobial constituents), establishes a complex microbial stress network \u003csup\u003e\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e. However, the phenotypic crypticity of the VBNC state in spoilage bacteria obscures their true physiological condition, thereby substantially elevating microbial safety risks in beer. Future research endeavors are imperative to dissect the regulatory intricacies of pivotal genes, such as \u003cem\u003eluxS\u003c/em\u003e, in VBNC state formation, thereby furnishing a theoretical foundation for precise prevention and control strategies.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eMorphological and structural differences of bacteria in different states\u003c/h3\u003e\n\u003cp\u003eTo evaluate the morphological disparities exhibited by \u003cem\u003eL. plantarum\u003c/em\u003e under varying physiological conditions, this study conducted a systematic analysis of cellular ultrastructure utilizing scanning electron microscopy. Biofilm-associated cells, in contrast to planktonic counterparts, displayed a notable augmentation in cell adhesion, leading to the formation of multicellular aggregates, alongside an accumulation of extracellular matrix constituents (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed-f). This observation may be intricately linked to the deposition of extracellular polysaccharides and other secretory products during biofilm development. Subsequent examination unveiled distinctive phenotypic traits in biofilm-associated cells that had fully transitioned into the VBNC state. Compared to planktonic and conventional biofilm cells, VBNC cells were enveloped by a dense polymeric layer on their surface (highlighted in green in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eg), resulting in a marked roughening of the surface topography and the emergence of high-density cell clusters. This polymer likely comprises composite extracellular materials secreted by the cells. This discovery aligns closely with the phenotypic alterations observed by Vattakaven et al. in the VBNC state of \u003cem\u003eVibrio tasmaniensis\u003c/em\u003e, wherein pathogens induce surface roughening and compact cell aggregation via the secretion of polymer-like substances \u003csup\u003e\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u003c/sup\u003e. Quantitative assessments revealed that the average cell volume of \u003cem\u003eL. plantarum\u003c/em\u003e diminished from 1.63 \u0026micro;m\u0026sup3; in the initial state to 1.13 \u0026micro;m\u0026sup3; in the VBNC state. This contractile effect corresponds with the volume change patterns observed in \u003cem\u003eSalmonella Typhi\u003c/em\u003e and \u003cem\u003eEscherichia coli\u003c/em\u003e during their respective VBNC states \u003csup\u003e\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003ch3\u003eRelationship between AI-2 and biofilm and VBNC state formation\u003c/h3\u003e\n\u003cp\u003eBy examining the impact of culture medium constituents on bacterial AI-2 QS activity, this study uncovered that no AI-2 activity was discernible in the cell-free supernatant (CFS) of \u003cem\u003eL. plantarum\u003c/em\u003e L-PB01 cultivated in MRS medium (encompassing the pH 7.0-adjusted cohort), whereas pronounced activity was evident in CFS derived from skim milk medium (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea-c). This phenomenon could be ascribed to transcriptional suppression of the \u003cem\u003eluxS\u003c/em\u003e gene cluster in the \u003cem\u003eVibrio harveyi\u003c/em\u003e BB170 reporter strain, induced by the elevated glucose concentration (20 g/L) and the initially low pH inherent in MRS medium. Building upon these observations, the influence of endogenous AI-2 present in CFS on biofilm formation was further scrutinized. As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, graded supplementation of CFS did not elicit substantial dose-dependent effects on biofilm biomass, with enhanced biofilm formation observed solely under 75% CFS treatment after a 36-hour incubation period (\u003cem\u003eP\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05). This observation may be rationalized by two plausible mechanisms: (1) the AI-2 concentration within CFS did not attain the QS threshold \u003csup\u003e\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e\u003c/sup\u003e, and (2) subinhibitory concentrations of AI-2 might exert regulatory effects on bacterial proliferation via metabolic modulation \u003csup\u003e\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003ePrior research posits that biofilm-associated cells may orchestrate VBNC state transition via the LuxS/AI-2 QS system. In this present investigation, the temporal dynamics of \u003cem\u003eluxS\u003c/em\u003e gene expression during VBNC induction were meticulously tracked through quantitative reverse transcription polymerase chain reaction (qRT-PCR). The findings revealed an initial upregulation followed by a decline in \u003cem\u003eluxS\u003c/em\u003e expression, culminating in a peak at the 4-hour induction mark (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea-b). Given that LuxS is implicated in both AI-2 biosynthesis and the methionine cycle metabolism in \u003cem\u003eL. plantarum\u003c/em\u003e, the interplay between \u003cem\u003eluxS\u003c/em\u003e expression and AI-2 production warrants further validation. This study also assessed fluctuations in AI-2 activity throughout the VBNC process, revealing a striking concordance with the \u003cem\u003eluxS\u003c/em\u003e expression pattern, thereby underscoring a robust correlation between \u003cem\u003eluxS\u003c/em\u003e expression and AI-2 synthesis in this bacterial strain. This observation stands in contrast to a study on \u003cem\u003eStreptococcus suis\u003c/em\u003e, wherein \u003cem\u003eluxS\u003c/em\u003e overexpression failed to influence AI-2 production \u003csup\u003e\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e. Considering the discordance between VBNC induction conditions (characterized by low temperature, oligotrophic environments, and bitter acid stress) and the nutritional profile of the AI-2-enriched skim milk matrix, synthetic AI-2 was employed for functional validation in this study. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed, the supplementation of 80 \u0026micro;mol/L AI-2 prompted biofilm-associated cells to enter the VBNC state after 8 hours, whereas the 40 \u0026micro;mol/L group achieved conversion after 10 hours, both preceding the 12-hour conversion timeframe observed in the control group.\u003c/p\u003e \u003cp\u003eBuilding upon our previously established VBNC induction model, which involves a 12-hour treatment of biofilm-associated cells with 27 mg/L iso-α-acids, this study assessed the resuscitation potential of VBNC cells through the removal of stressors (specifically, transferring the cells to 37\u0026deg;C MRS medium). As illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee, the addition of 50%-75% CFS markedly augmented the efficiency of VBNC resuscitation, with viable cell counts increasing by approximately 10\u003csup\u003e3\u003c/sup\u003e colony-forming units per milliliter (CFU/mL) in comparison to control groups following an 8-hour culture period. This observation is congruent with prior findings from studies investigating VBNC resuscitation in \u003cem\u003eVibrio vulnificus\u003c/em\u003e \u003csup\u003e\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e. To clarify the functional specificity of AI-2 within CFS, synthetic AI-2 was utilized for validation purposes. Figure\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ef demonstrates that exogenous AI-2 supplementation accelerates resuscitation kinetics in a dose-dependent manner, with the 80 \u0026micro;mol/L treatment group exhibiting significantly superior resuscitation efficiency relative to the 40 \u0026micro;mol/L cohort. Notably, this finding contrasts with the report by Ayrapetyan et al., which indicated no AI-2-mediated enhancement of resuscitation in \u003cem\u003erpoS\u003c/em\u003e-deficient mutants. This discrepancy may arise from strain-specific responses and variations in signal molecule concentration gradients, suggesting that the intricate regulatory network governing VBNC recovery necessitates further exploration.\u003c/p\u003e \u003cp\u003e \u003cb\u003eRelationship between\u003c/b\u003e \u003cb\u003eluxS\u003c/b\u003e \u003cb\u003eand biofilm formation and VBNC state\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eluxS\u003c/em\u003e gene, a pivotal genetic element encoding an enzyme crucial for the metabolism of S-ribosylhomocysteine (SRH), plays an integral role in the biosynthesis of AI-2. To elucidate its functional significance, we engineered bacterial strains utilizing homologous overexpression technology and gene knockout methodologies grounded in homologous recombination principles. PCR-based validation was executed employing verification primers yzluxS-F/R and qcyz-F/R, as depicted in Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e. To ascertain the efficacy of \u003cem\u003eluxS\u003c/em\u003e overexpression, three PCR-positive strains were subjected to quantitative reverse transcription PCR (qRT-PCR) analysis. The findings revealed a substantial upregulation of \u003cem\u003eluxS\u003c/em\u003e mRNA expression, approximately 10-fold higher in the recombinant strain LP-luxS-36e-3 compared to the wild-type L-PB01 (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eg), thereby confirming the successful generation of both \u003cem\u003eluxS\u003c/em\u003e overexpression and knockout strains. The strain exhibiting the highest expression level was selected for subsequent experimental investigations. The influence of genetic manipulation on bacterial proliferation was evaluated by monitoring the kinetic alterations in optical density at 600 nm (OD\u003csub\u003e600\u003c/sub\u003e) over a 3-36-hour timeframe. The results indicated that the growth trajectories of the \u003cem\u003eluxS\u003c/em\u003e overexpression and knockout strains mirrored the overall growth pattern of the wild-type L-PB01, suggesting that the genetic modifications did not significantly perturb the fundamental growth attributes of the bacteria. In the biofilm formation assay (Fig. S2b), no statistically discernible differences in biofilm production were observed between the \u003cem\u003eluxS\u003c/em\u003e knockout strain and the wild-type strain, implying that the bacteria may possess multiple quorum sensing (QS) systems that synergistically regulate biofilm formation. The AI-2 synthesis deficiency induced by the single \u003cem\u003eluxS\u003c/em\u003e gene deletion could be compensated by alternative QS systems \u003csup\u003e\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u003c/sup\u003e. Notably, the biofilm-forming capacity of the \u003cem\u003eluxS\u003c/em\u003e overexpression strain was markedly elevated compared to the wild-type, corroborating the gene's involvement in modulating biofilm formation in L-PB01. This observation aligns with the canonical mechanism of LuxS/AI-2-mediated QS system regulation of biofilm formation \u003csup\u003e\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eFigures \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eh-i depicts the survival profiles of \u003cem\u003eluxS\u003c/em\u003e-edited strains and wild-type biofilm-associated cells under conditions of iso-α-acid stress. The findings reveal that the culturable colony count of the \u003cem\u003eluxS\u003c/em\u003e-deficient mutant exhibited a markedly accelerated decline relative to the wild-type strain (L-PB01), suggesting a diminished capacity for environmental stress resilience. Remarkably, the \u003cem\u003eluxS\u003c/em\u003e-overexpressing strain demonstrated a complete loss of culturability after 10-hour induction. However, live/dead cell staining indicated that, following an initial decline from 10\u003csup\u003e6\u003c/sup\u003e CFU/mL, the viable cell count stabilized at 10\u003csup\u003e5\u003c/sup\u003e CFU/mL, suggesting an elevated susceptibility to entering the VBNC state. Resuscitation experiments further corroborated that the \u003cem\u003eluxS\u003c/em\u003e-deficient mutant displayed a complete absence of resuscitative capability, whereas the overexpressing strain exhibited significantly enhanced resuscitation efficiency compared to the wild-type. This phenotypic congruence with outcomes from exogenous AI-2 supplementation experiments substantiates that \u003cem\u003eluxS\u003c/em\u003e modulates bacterial stress responses via the regulation of AI-2 biosynthesis. Current literature underscores the involvement of QS systems in mediating bacterial transitions into the VBNC state, and our findings provide empirical support for this mechanism: elevated \u003cem\u003eluxS\u003c/em\u003e expression may augment AI-2-dependent signaling pathways to facilitate VBNC entry while concurrently preserving resuscitative potential. It is imperative to acknowledge, however, that \u003cem\u003eluxS\u003c/em\u003e is concomitantly implicated in methyl cycle metabolism, suggesting that the observed phenotypic variations may arise from synergistic interactions across multiple metabolic pathways. Given the intrinsic complexity of VBNC transition mechanisms, the precise functional pathways of \u003cem\u003eluxS\u003c/em\u003e in this process necessitate comprehensive elucidation through integrated multi-omics strategies, encompassing proteomic and metabolomic analyses.\u003c/p\u003e\n\u003ch3\u003eIntegrative transcriptomic-proteomic analyses\u003c/h3\u003e\n\u003cp\u003eTo elucidate the molecular mechanisms underlying the regulation of the VBNC state within biofilms of L-PB01 by the \u003cem\u003eluxS\u003c/em\u003e gene, this study employed transcriptome sequencing to comparatively analyze gene expression profiles between the \u003cem\u003eluxS\u003c/em\u003e-overexpressing strain and its wild-type counterpart across various physiological stages. The experimental design encompassed six distinct treatment groups, which were categorized based on the strain type and physiological condition: the wild-type strain L-PB01 was subdivided into three groups representing the normal state (L-PB01), the biofilm-forming state (L-PB01-BF), and the biofilm-associated VBNC state (L-PB01-VBNC); correspondingly, the \u003cem\u003eluxS\u003c/em\u003e-overexpressing strain LP-LUXS-36e was allocated to analogous physiological states (LP-LUXS-36e, LP-LUXS-36e-BF, and LP-LUXS-36e-VBNC). Differential expression analysis conducted across these groups identified 1,082 genes exhibiting significant expression variations (with 520 upregulated and 310 downregulated) between LP-LUXS-36e and L-PB01; 902 differentially expressed genes (363 upregulated and 539 downregulated) in the biofilm state (LP-LUXS-36e-BF versus L-PB01-BF); and 646 genes displaying altered expression (403 upregulated and 243 downregulated) in the VBNC state (LP-LUXS-36e-VBNC versus L-PB01-VBNC). Subsequent gene set intersection analysis (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea-c) revealed the presence of 136 commonly differentially expressed genes across all three physiological stages examined (56 of which were upregulated and 30 downregulated). Furthermore, 229 genes exhibited shared differential expression between the biofilm and VBNC stages (86 upregulated and 70 downregulated), whereas 280 genes displayed differential expression specific to the VBNC state (259 upregulated and 141 downregulated). The dynamic profiling of key gene expression (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ed-f) demonstrated a notable upregulation of \u003cem\u003epgmB\u003c/em\u003e, \u003cem\u003erbsU\u003c/em\u003e, \u003cem\u003erbsD\u003c/em\u003e, \u003cem\u003erbsK\u003c/em\u003e, \u003cem\u003enrdD\u003c/em\u003e, \u003cem\u003epepc\u003c/em\u003e, and \u003cem\u003etetM\u003c/em\u003e during the biofilm-associated VBNC stage. Specifically, \u003cem\u003enrdD\u003c/em\u003e and \u003cem\u003epepc\u003c/em\u003e exhibited upregulation commencing at the biofilm stage, while \u003cem\u003epgmB\u003c/em\u003e, \u003cem\u003erbsU\u003c/em\u003e, \u003cem\u003erbsD\u003c/em\u003e, and \u003cem\u003erbsK\u003c/em\u003e displayed a sequential expression trend characterized by initial downregulation followed by subsequent upregulation. Functional enrichment analysis utilizing Gene Ontology (GO) terms (Fig. S3) consistently identified pathways associated with membrane structural components, developmental processes, and stress responses as being enriched across all three comparative groups. In parallel, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eg-i) highlighted significant enrichment of metabolic pathways, including ABC transporters, starch and sucrose metabolism, purine/pyrimidine metabolism, and the pentose phosphate pathway, among the upregulated gene sets.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo comprehensively evaluate the regulatory dynamic of these metabolic pathways, Gene Set Enrichment Analysis (GSEA) analysis was performed (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Within the framework of KEGG pathway analysis (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea-c and Fig. S4), the starch and sucrose metabolism pathway exhibited consistent upregulation across all three experimental groups, suggesting its activation during the process of biofilm-associated VBNC cell formation. Conversely, ABC transporters demonstrated a contrasting regulatory pattern, being downregulated in the biofilm state but upregulated in both the normal and VBNC states. The pentose phosphate and pyrimidine metabolism pathways displayed downregulation under normal and biofilm conditions, yet upregulation during the VBNC state, indicative of their activation specifically in the biofilm VBNC stage. Moreover, the purine metabolism pathway was uniformly downregulated across all three groups, suggesting a general suppression of this pathway irrespective of the physiological state.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo investigate the potential concordance between transcriptional alterations and corresponding changes at the protein level, we performed a comprehensive proteomic analysis and conducted differential expression profiling of proteins across samples with distinct genotypes at the same developmental stage. Subsequently, we carried out enrichment analysis on the differentially expressed proteins (DEPs) and integrated the KEGG pathway results derived from the proteomic data with those obtained from the transcriptomic differential expression analysis of genes (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed-f). Notably, both the transcriptomic and proteomic datasets exhibited significant enrichment in key metabolic pathways, including ABC transporters, starch and sucrose metabolism, purine metabolism, pyrimidine metabolism, and the pentose phosphate pathway. With the exception of the pentose phosphate pathway which did not demonstrate enrichment in the proteome during the biofilm-associated VBNC state, the enrichment of the other pathways was notably augmented, indicating a coordinated regulatory response across the transcriptomic and proteomic layers during this physiological transition.\u003c/p\u003e\n\u003ch3\u003eTranscriptional regulatory mechanism of LuxS on VBNC biofilm formation\u003c/h3\u003e\n\u003cp\u003eTo elucidate the direct regulatory impact of LuxS on gene expression, this study employed chromatin immunoprecipitation followed by sequencing (ChIP-seq) analysis on three LuxS-overexpressing samples, namely LP-LUXS-36e, LP-LUXS-36e-BF, and LP-LUXS-36e-VBNC. DNA fragments that were co-precipitated with the LuxS protein were enriched using a LuxS-specific antibody, thereby facilitating the identification of genes that interact with LuxS under conditions of overexpression. Subsequent peak calling and gene annotation of the ChIP-seq data derived from these three samples yielded 507, 232, and 111 annotated genes for LP-LUXS-36e, LP-LUXS-36e-BF, and LP-LUXS-36e-VBNC, respectively. By utilizing all peak regions as target areas, we conducted an analysis of the average signal intensity within a\u0026thinsp;\u0026plusmn;\u0026thinsp;5 kb window surrounding the peak summits (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed-f). The distribution patterns of the peaks revealed specific binding events that were markedly distinct from background signals within the central\u0026thinsp;\u0026plusmn;\u0026thinsp;1 kb region across all three samples (Figs.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea-c). Furthermore, an analysis of peak heights indicated no statistically significant variation in LuxS-DNA binding intensity among the three distinct physiological states, suggesting a consistent regulatory role of LuxS across these conditions.\u003c/p\u003e \u003cp\u003eIntersection analysis was performed to assess the overlap between genes enriched via ChIP-seq and those exhibiting differential expression in corresponding transcriptomic datasets (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ed-f). This analysis identified 4 genes that were common to both ChIP-seq-enriched and differentially expressed gene sets under normal conditions, 51 genes during biofilm formation, and 13 genes during the transition from biofilm to the VBNC state. Among the 13 overlapping genes identified in the biofilm-to-VBNC transition phase, 11 genes displayed unique upregulation specifically at this stage, including \u003cem\u003epgmB\u003c/em\u003e, \u003cem\u003erbsU\u003c/em\u003e, \u003cem\u003erbsD\u003c/em\u003e, \u003cem\u003erbsK\u003c/em\u003e, and \u003cem\u003etetM\u003c/em\u003e. Conversely, \u003cem\u003enrdD\u003c/em\u003e and \u003cem\u003epepc\u003c/em\u003e demonstrated co-upregulation in both the biofilm and biofilm-to-VBNC phases (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The examination of the track view (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eg) unveiled the presence of substantial binding enrichment peaks localized specifically at the \u003cem\u003epgmB\u003c/em\u003e genomic locus spanning 63,678 to 65,678 bp, as well as within the \u003cem\u003enrdD\u003c/em\u003e, \u003cem\u003etetM\u003c/em\u003e, and \u003cem\u003epepC\u003c/em\u003e gene-associated regions. These findings suggest a plausible mechanism whereby LuxS may exert directly regulatory influence over these target genes via direct DNA-binding interactions. Of particular significance is the observation that the identified binding peaks are predominantly concentrated within the mid-coding sequences of the respective genes, rather than at canonical promoter elements. This distinctive binding pattern prompted the formulation of a hypothesis postulating that LuxS might indirectly modulate gene expression profiles through the extracellular secretion of AI-2 signaling molecules, which could subsequently engage in regulatory interactions with trans-acting factors proximal to promoter regions. Complementary transcriptomic profiling analyses further corroborated these regulatory dynamics, revealing a temporal pattern of differential gene expression characterized by the progressive upregulation of \u003cem\u003enrdD\u003c/em\u003e, \u003cem\u003epepc\u003c/em\u003e, and \u003cem\u003etetM\u003c/em\u003e transcripts during the VBNC state transition, whereas \u003cem\u003epgmB\u003c/em\u003e, \u003cem\u003erbsU\u003c/em\u003e, \u003cem\u003erbsD\u003c/em\u003e, and \u003cem\u003erbsK\u003c/em\u003e exhibited downregulation during biofilm maturation followed by a compensatory upregulation during the biofilm-to-VBNC transitional phase (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eh).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGenes commonly up-regulated in the biofilm VBNC phase transcriptome and ChIP-seq.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"7\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene ID\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGene name\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003estart\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eend\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eGO\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eKEGG\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c7\"\u003e \u003cp\u003eStage\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGE000054\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epgmB\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e63678\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e65678\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eStarch and sucrose metabolism (ko00500)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eVBNC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGE002623\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2817838\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2819838\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eBiofilm, VBNC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGE002942\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003epepc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3177027\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3179027\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eDevelopmental process (GO:0032502, BP)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eBiofilm, VBNC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGE002926\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003erbsD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3154898\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3156898\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eABC transporters (ko02010)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eVBNC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGE002927\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003erbsK\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3155821\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3157821\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePentose phosphate pathway (ko00030)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eVBNC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGE000055\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e64565\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e66565\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eVBNC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGE002625\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ecpdA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2819198\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2821198\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eVBNC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGE002925\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003erbsU\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3154473\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3156473\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eMembrane part (GO:0044425, CC)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eVBNC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGE002342\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003enrdD\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2518057\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2520057\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ePurine metabolism (ko00230), Pyrimidine metabolism (ko00240)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eBiofilm, VBNC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGE002874\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e3101595\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e3103595\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eVBNC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGE000033\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e40144\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e42144\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eVBNC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGE000062\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003etetM\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e71724\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e73724\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eResponse to stimulus (GO:0050896, BP)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eVBNC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGE002758\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e2965332\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e2967332\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003e-\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c7\"\u003e \u003cp\u003eVBNC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eAs summarized in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, the KEGG pathway annotation analysis indicated functional affiliations of the studied genes: \u003cem\u003epgmB\u003c/em\u003e is implicated in starch and sucrose metabolism specifically within the pentose phosphate pathway, \u003cem\u003enrdD\u003c/em\u003e is engaged in purine and pyrimidine metabolism pathways, \u003cem\u003erbsD\u003c/em\u003e is categorized under the ABC transporter system, and \u003cem\u003erbsK\u003c/em\u003e contributes to the pentose phosphate pathway. It is noteworthy that \u003cem\u003erbsU\u003c/em\u003e, \u003cem\u003ePepc\u003c/em\u003e, and \u003cem\u003eTetM\u003c/em\u003e did not exhibit significant enrichment in any KEGG pathways. Subsequent functional enrichment analysis employing GO annotation revealed that \u003cem\u003erbsU\u003c/em\u003e was significantly enriched for the \u0026ldquo;membrane part\u0026rdquo; category, \u003cem\u003ePepc\u003c/em\u003e participated in \u0026ldquo;developmental process\u0026rdquo;-related functions, and \u003cem\u003etetM\u003c/em\u003e was associated with \u0026ldquo;response to stimulus\u0026rdquo; categories.\u003c/p\u003e \u003cp\u003eDuring the VBNC state formation, overexpression of the \u003cem\u003eluxS\u003c/em\u003e gene resulted in a statistically significant upregulation of the transcriptional expression levels of \u003cem\u003epgmB\u003c/em\u003e, \u003cem\u003erbsU\u003c/em\u003e, \u003cem\u003erbsD\u003c/em\u003e, \u003cem\u003erbsK\u003c/em\u003e, \u003cem\u003etetM\u003c/em\u003e, \u003cem\u003enrd\u003c/em\u003eD, and \u003cem\u003epepc\u003c/em\u003e. The ChIP-seq analysis further confirmed direct binding of LuxS to the promoter or regulatory regions of these genes, thereby substantiating its role as a positive transcriptional regulator. Notably, temporal expression profiling revealed a progressive upregulation trend for \u003cem\u003etetM\u003c/em\u003e, \u003cem\u003enrdD\u003c/em\u003e, and \u003cem\u003epepc\u003c/em\u003e across three distinct physiological stages namely the normal state, biofilm formation, and the biofilm-to-VBNC transition (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eh). Among these, \u003cem\u003enrdD\u003c/em\u003e encodes ribonucleotide reductase, an enzyme that catalyzes the conversion of ribonucleotides to deoxyribonucleotides and is intricately involved in purine and pyrimidine metabolism pathways. \u003cem\u003epepc\u003c/em\u003e encodes phosphoenolpyruvate during gluconeogenesis \u003csup\u003e\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003etetM\u003c/em\u003e, functioning as a 30S ribosomal subunit-binding protein, is recognized for its role in mediating tetracycline resistance by stabilizing the ribosome structure \u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u003c/sup\u003e, although its upregulation did not attain statistical significance prior to the onset of the VBNC state. In the terminal stage of the examined physiological progression (specifically, the biofilm-to-VBNC transition), \u003cem\u003epgmB\u003c/em\u003e, \u003cem\u003erbsU\u003c/em\u003e, \u003cem\u003erb\u003c/em\u003es\u003cem\u003eD\u003c/em\u003e, and \u003cem\u003erbsK\u003c/em\u003e exhibited significant upregulation. Specifically, \u003cem\u003epgmB\u003c/em\u003e encodes glycogen phosphorylase, an enzyme whose augmented expression facilitates the conversion of glycogen into D-glucose-6-phosphate and β-D-glucose-1-phosphate, thereby modulating central metabolism. Notably, these genes are components of the \u003cem\u003erbsUDK\u003c/em\u003e operon (spanning genomic coordinates 3,177,027 to 3,179,027 bp), which orchestrates ribose utilization pathways. Within this operon, \u003cem\u003erbsU\u003c/em\u003e encodes a ribose transport membrane protein, responsible for the translocation of ribose across cellular membranes. \u003cem\u003erbsD\u003c/em\u003e encodes D-ribopyranose isomerase, an enzyme that catalyzes the conversion of β-D-ribopyranose (imported via the ABC transporter system) to β-D-ribofuranose, a critical step in ribose metabolism \u003csup\u003e\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u003c/sup\u003e. \u003cem\u003erbsK\u003c/em\u003e encodes ribokinase, which phosphorylates β-D-ribopyranose and ribose to generate ribose-5-phosphate \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. This metabolite serves a dual role: it participates in nucleotide biosynthesis as a precursor for purine and pyrimidine nucleotides and is further metabolized to D-glucose-6-phosphate via the non-oxidative phase of the pentose phosphate pathway, thereby linking ribose metabolism to central carbon metabolism \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the context of industrial beer production, a distinctive microbial safety concern arises from the biofilm-mediated survival strategy employed by LAB \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e\u003c/sup\u003e. Under environmental stressors, LAB associated with beer spoilage initially form biofilms, which serve as physical protective barriers, subsequently triggering a molecular transition mechanism that leads to the VBNC state \u003csup\u003e\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. While VBNC-state bacteria lose their proliferative capacity under standard culture conditions, their metabolic activity persists, and their environmental resistance is markedly augmented through stress-response pathways. Notably, these microorganisms not only withstand extreme conditions inherent to beer systems, such as high osmotic pressure and low pH, but also exhibit remarkable resistance to routine ultrasonic sterilization and chemical disinfectants, thereby posing dual challenges to existing microbial control systems in the brewing industry \u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u003c/sup\u003e. This study, for the first time, demonstrates that iso-α-acids, characteristic constituents of beer, specifically induce the VBNC state transition in L. plantarum within biofilms formed on production equipment. In this state, bacterial cells undergo substantial morphological alterations, enhancing their ability to penetrate filtration membranes and evade conventional detection methods. Our findings reveal a significant positive correlation between \u003cem\u003eluxS\u003c/em\u003e gene expression levels and AI-2 synthesis during the biofilm-to-VBNC transition. Exogenous AI-2 supplementation was also shown to significantly promote VBNC formation. Remarkably, both overexpression and knockout of the \u003cem\u003eluxS\u003c/em\u003e gene profoundly influenced the induction of the VBNC state, underscoring the critical role of LuxS/AI-2 quorum sensing in this process.\u003c/p\u003e \u003cp\u003eThrough a comprehensive, integrated analysis of transcriptomic, proteomic, and ChIP-seq datasets, this study elucidates the molecular mechanisms governing the heightened propensity of \u003cem\u003eluxS\u003c/em\u003e-overexpressing strains to enter the VBNC state within biofilms and evade environmental stressors. During the pre-VBNC phase, upregulation of \u003cem\u003enrdD\u003c/em\u003e may suppress RNA synthesis, potentially as a stress-adaptive response, while activation of \u003cem\u003epepc\u003c/em\u003e may initiate gluconeogenesis and biofilm formation, thereby laying the groundwork for subsequent VBNC transition. The concerted expression of these two genes likely acts synergistically to accelerate the VBNC transition, highlighting their interdependent roles in this adaptive process. Upon establishment of the VBNC state, marked upregulation of \u003cem\u003eTetM\u003c/em\u003e may serve to preserve ribosomal integrity against environmental insults, thereby maintaining essential translational activity despite the dormant state of the bacteria. Notably, the \u003cem\u003epepc\u003c/em\u003e, \u003cem\u003epmgB\u003c/em\u003e, and \u003cem\u003erbsUDK\u003c/em\u003e gene clusters collectively regulate D-glucose-6-phosphate metabolism, a critical metabolic hub that not only fuels glycolysis for energy production but also participates in the oxidative phase of the pentose phosphate pathway to generate substantial NADPH, a key antioxidant cofactor that counteracts oxidative damage \u003csup\u003e\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e\u003c/sup\u003e. The acidic microenvironment induced by hop bitter acid components has been shown to exacerbate bacterial oxidative stress \u003csup\u003e\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e\u003c/sup\u003e, and under such conditions, activation of the PPP serves as a crucial antioxidant defense mechanism supporting VBNC survival. Intriguingly, while LuxS interacts with \u003cem\u003epgmB\u003c/em\u003e, \u003cem\u003erbsU\u003c/em\u003e, \u003cem\u003erbsD\u003c/em\u003e, and \u003cem\u003erbsK\u003c/em\u003e throughout the three biofilm developmental stages- attachment, maturation, and dispersal\u0026mdash;these genes exhibit stage-specific regulation: they are downregulated during biofilm formation but significantly upregulated in the terminal phase of biofilm development and VBNC state establishment. This temporal regulation pattern suggests a dynamic interplay between LuxS and these metabolic genes, which may be fine-tuned by additional regulatory networks to optimize bacterial survival under stressful conditions. Whether these additional regulatory networks govern the observed temporal expression pattern of \u003cem\u003epgmB\u003c/em\u003e, \u003cem\u003erbsU\u003c/em\u003e, \u003cem\u003erbsD\u003c/em\u003e, and \u003cem\u003erbsK\u003c/em\u003e warrants further investigation to fully elucidate the molecular mechanisms underlying VBNC state induction and maintenance.\u003c/p\u003e \u003cp\u003eAccumulating empirical evidence indicates that although bacteria in the VBNC state exhibit dormancy-like traits characterized by reduced energy expenditure, their metabolic activities do not diminish in a proportionate manner \u003csup\u003e\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e. Rather, specific metabolic pathways remain notably active during this physiological state, underscoring the adaptive potential of VBNC bacteria. In \u003cem\u003eRhodococcus biphenylivorans\u003c/em\u003e, the activation of starch and sucrose metabolism pathways during the VBNC transition has been posited to augment energy provisioning, thereby facilitating adaptation to environmental stressors. This metabolic reconfiguration likely represents a strategic response to ensure survival under nutrient-limited or otherwise adverse conditions \u003csup\u003e\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e\u003c/sup\u003e. Consistently, proteomic analyses of VBNC-state \u003cem\u003eE. coli\u003c/em\u003e have revealed upregulation of ABC transporter systems. These transporters not only modulate pentose phosphate pathway activity\u0026mdash;a critical metabolic route for generating reducing equivalents and ribose-5-phosphate\u0026mdash;but also potentially sustain metabolic activities by enhancing nutrient acquisition under adverse environmental conditions \u003csup\u003e\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e\u003c/sup\u003e. Our current investigation has unveiled that \u003cem\u003eluxS\u003c/em\u003e overexpression functions as a regulatory nexus orchestrating the temporal activation of metabolic pathways via targeted gene regulation. Specifically, sustained upregulation of \u003cem\u003epmgB\u003c/em\u003e, a pivotal gene within the starch and sucrose metabolism pathway, serves to maintain pathway activity throughout the VBNC transition, thereby ensuring a continuous supply of metabolic intermediates. Concurrently, the induction of the \u003cem\u003erbsUDK\u003c/em\u003e gene cluster, which is associated with ABC transporters, plays a critical role in coordinating the simultaneous upregulation of both ABC transporter systems and the pentose phosphate pathway in established VBNC cells.\u003c/p\u003e \u003cp\u003eThis study meticulously elucidates the fundamental role of the LuxS/AI-2 QS system in orchestrating the transition from Lactobacillus plantarum biofilms to the VBNC state. By unraveling the intricate regulatory networks governing this transition, our findings significantly advance theoretical comprehension of bacterial environmental adaptation mechanisms, particularly in response to nutrient-limited or stress-induced conditions. The elucidated molecular dialogues mediated by the LuxS/AI-2 QS system underscore the adaptive plasticity of \u003cem\u003eL. plantarum\u003c/em\u003e, enabling it to persist in dormant yet metabolically active states under adverse circumstances. Moreover, these findings provide a pivotal theoretical foundation and robust scientific rationale for developing targeted prevention and control strategies against beer-spoilage bacteria within brewing industries. Understanding the molecular underpinnings of VBNC induction in \u003cem\u003eL. plantarum\u003c/em\u003e offers valuable insights into the ecological resilience of these microbes, thereby facilitating the design of innovative interventions aimed at mitigating biofilm formation and preventing microbial contamination in brewing processes. Collectively, this study not only enriches our theoretical understanding of bacterial stress responses but also translates fundamental knowledge into actionable strategies for enhancing the quality and safety of brewed beverages.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eBacterial strain\u003c/h2\u003e \u003cp\u003e \u003cem\u003eL. plantarum\u003c/em\u003e L-PB01 (originally isolated from commercial beer as described by Deng et al. \u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e) was cultured anaerobically in MRS broth or agar at 37\u0026deg;C. \u003cem\u003eE. coli\u003c/em\u003e DH5α was maintained in LB agar medium at 37\u0026deg;C, with those carrying either pMG36e-luxs or pNG5319△\u003cem\u003eluxS\u003c/em\u003e plasmids being cultured in erythromycin-supplemented LB medium. The recombinant \u003cem\u003eL. plantarum\u003c/em\u003e strains harboring pMG36e-luxs or pNG5319△\u003cem\u003eluxS\u003c/em\u003e plasmids were cultivated in MRS broth/agar containing 3 \u0026micro;g/ml erythromycin. \u003cem\u003eVibrio harveyi\u003c/em\u003e BB170 was propagated in either Marine Broth 2216 or AB medium. All bacterial strains and plasmids employed in this study is illustrated in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e, whereas the primer sequences used for genetic manipulations are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eStrains and plasmids used in this study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStrains and plasmids\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGenotype/description\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSource or ref.\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eL-PB01\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eIsolated from finished beer\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLP-△LUXS-5319\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eL-PB01 with plasmid pNG5319△\u003cem\u003eluxS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eL-PB01 with plasmid pMG36e-luxs\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eThis study\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eE. coli\u003c/em\u003e DH5α\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLab collection\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers used in this study.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequences (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eluxS-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eATTCGTAATTCGAGCTCGCCTTGCTCTAGGAAGGCTAAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eluxS-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGTTTTCAGACTTTGCAAGCTCCGCTCGAGCTATTCAACGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMG36e-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCTTGCAAAGTCTGAAAACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003epMG36e-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCGAGCTCGAATTACGAATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eyzluxS-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGCAATCGTTTCAGCAGAAAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eyzluxS-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTACCAACTGTCTTGGCCGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003exxh-L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCACTGGAGCACGTTTAAACAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003exxh-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGCGTTATCGGTCCTTTAATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eluxS-L-f\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTTTGGGCGAATTTGTCGTGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eluxS-L-r\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGTCCACATCCAGTGTGTTGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eluxS-R-f\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCGTAGTTGATAGTGCTAATC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eluxS-R-r\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGCACGGGAATATTATGTTCTTTGGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003exxh2-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eggctgtaccgttcgtatagcatac\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eXxh2-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003egatctctaaagctgacggggtaaac\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eqcyz-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eggcaatgtgctacacttgagtt\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eqcyz-L\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eagtggctctaacttatcccaat\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePreparation and identification of biofilm cells\u003c/h2\u003e \u003cp\u003eFollowing activation, \u003cem\u003eL. plantarum\u003c/em\u003e cultures were inoculated at 2% (v/v) into fresh MRS broth and incubated statically at 37\u0026deg;C for 36 hours. Bacterial cells were harvested by centrifugation at 12,000 \u0026times; g for 5 min, washed twice with sterile physiological saline, and resuspended to a final concentration of 1\u0026times;10\u003csup\u003e7\u003c/sup\u003e CFU/mL to prepare biofilm-embedded cells.\u003c/p\u003e \u003cp\u003eBiofilm formation capacity of both recombinant and wild-type strains was quantitatively assessed using crystal violet staining. Activated cultures were inoculated at 1% (v/v) into MRS medium and incubated statically at 37\u0026deg;C for 36 hours. Subsequently, planktonic cells were removed by gentle PBS washing, and adherent biofilms were air-dried at room temperature. The bound crystal violet was solubilized using 100 \u0026micro;L of 95% ethanol, and biofilm biomass was quantified by measuring optical density at 600 nm using a microplate reader.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eInduction and identification of VBNC state\u003c/h2\u003e \u003cp\u003eTo induce the VBNC state, 1 mL of biofilm-forming cells was added to 9 mL of sterile water containing 27 mg/L iso-α-acids, resulting in an initial bacterial concentration of 1\u0026times;10\u003csup\u003e6\u003c/sup\u003e CFU/mL. The mixture was incubated at 18\u0026deg;C for 12 hours under static conditions. The culturability of the bacterial strain was assessed using the MRS agar plate method. Specifically, 200 \u0026micro;L of the bacterial suspension was spread onto MRS agar plates and incubated anaerobically at 37\u0026deg;C for 24 hours, followed by colony counting. The total cell count was determined using the acridine orange direct counting (AODC) method. Cell viability was evaluated using the BacLight Live/Dead Bacterial Viability Kit, which employs SYTO 9 and propidium iodide (PI) staining solutions to assess membrane integrity. After staining, the cell suspension was analyzed using a Guava easyCyte 8HT flow cytometer with 488 nm blue excitation light.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ePreparation of cell-free supernatant and AI-2 activity detection\u003c/h2\u003e \u003cp\u003e \u003cem\u003eL. plantarum\u003c/em\u003e was inoculated into MRS broth and skim milk medium, respectively, and incubated at 37\u0026deg;C for 12 hours under static conditions. The cultures were then centrifuged at 12,000 \u0026times; g for 15 minutes, and the supernatants were collected. The supernatants were filtered through a 0.22 \u0026micro;m sterile membrane filter, adjusted to pH 7.0, and stored at -80\u0026deg;C as cell-free supernatants (CFS).\u003c/p\u003e \u003cp\u003eFor AI-2 activity detection, \u003cem\u003eV. harveyi\u003c/em\u003e BB170 was diluted 1:5000 in AB medium. The CFS was added to the diluted BB170 culture at a ratio of 1:10 (v/v), and the mixture was incubated at 28\u0026deg;C for 5 hours. Subsequently, 100 \u0026micro;L of the sample was transferred to a white 96-well plate to measure AI-2 activity. The CFS from \u003cem\u003eE. coli\u003c/em\u003e DH5α was used as a negative control. Luminescence was quantified using a microplate reader.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eConstruction of Plasmids and Strains\u003c/h2\u003e \u003cp\u003eThe genomic DNA of \u003cem\u003eL. plantarum\u003c/em\u003e was extracted using a bacterial DNA extraction kit (Sangon Biotech Co., Shanghai, China). The \u003cem\u003eluxS\u003c/em\u003e gene was amplified using primers \u003cem\u003eluxS\u003c/em\u003e-F and \u003cem\u003eluxS\u003c/em\u003e-R, which contained homologous arms. The amplified \u003cem\u003eluxS\u003c/em\u003e gene was then seamlessly cloned into the linearized pMG36e vector, resulting in the construction of the recombinant plasmid \u003cem\u003eluxS\u003c/em\u003e-pMG36e. This plasmid was subsequently transformed into \u003cem\u003eE.coli\u003c/em\u003e DH5α, and the transformants were verified by PCR using primers yz\u003cem\u003eluxS\u003c/em\u003e-F and yz\u003cem\u003eluxS\u003c/em\u003e-R. Both the \u003cem\u003eluxS\u003c/em\u003e-pMG36e plasmid and the empty pMG36e vector were electroporated into competent cells of \u003cem\u003eL. plantarum\u003c/em\u003e. The recombinants were selected on erythromycin-containing plates and further confirmed by PCR and DNA sequencing.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative Real-Time Reverse Transcription PCR (qRT-PCR)\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted using TRIpure reagent (Aidlab Biotech Co., Ltd., Beijing, China) following the manufacturer\u0026rsquo;s protocol. First-strand cDNA synthesis was performed with the TUREscript 1st Strand cDNA Synthesis Kit (Aidlab Biotech Co., Ltd.) according to the following protocol: 50 ng-5 \u0026micro;g of total RNA, 1 \u0026micro;L of random primer, 4 \u0026micro;L of 5\u0026times;RT Reaction Mix, 1 \u0026micro;L of TUREscript H-RTase, and RNase-free H\u003csub\u003e2\u003c/sub\u003eO to a final volume of 20 \u0026micro;L. The reaction conditions included an initial incubation at 25\u0026deg;C for 10 minutes, followed by reverse transcription at 42\u0026deg;C for 30\u0026ndash;50 minutes, and enzyme inactivation at 65\u0026deg;C for 15 minutes.\u003c/p\u003e \u003cp\u003eThe \u003cem\u003eluxS\u003c/em\u003e gene sequence was subjected to comprehensive analysis leveraging whole-genome sequencing data, and specific primers were meticulously designed utilizing Primer3 software (version 0.4.0) with the 16S rRNA gene serving as the internal reference control (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). qRT-PCR was executed empolying a SYBR Green-based detection system to ensure high sensitivity and specificity. The relative expression levels of the \u003cem\u003eluxS\u003c/em\u003e were subsequently quantified using the 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔΔCT method, which facilitates the normalization of gene expression data against the internal reference gene and the calculation of fold changes relative to a calibrator sample.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers for Real-time PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSequences (5\u0026rsquo;-3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003er-luxS-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTTTGGTTGCCGGACTGGTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003er-luxS-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAATCGTCGTTCCTTGAACATCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e16s RNA-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCCGACCTGAGAGGGTAAT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e16s RNA-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAATCGTCGTTCCTTGAACATCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eMorphological Structure Observation\u003c/h2\u003e \u003cp\u003eCells in planktonic, biofilm, and VBNC states were centrifuged at 4,000 rpm for 10 minutes. The supernatant was discarded, and the cell pellets were retained. The pellets were immediately fixed with glutaraldehyde at a final concentration of 2.5% and stored at 4\u0026deg;C overnight. Subsequently, the samples were dehydrated using a graded ethanol series up to 100% and mounted on a scanning electron microscopy (SEM) stage for morphological and structural observation.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eGrowth Curve Determination\u003c/h2\u003e \u003cp\u003eThe recombinant strains LP-LUXS-36e and LP-△LUXS-5319, as well as the wild-type strain L-PB01, were cultured in MRS broth. The cell density was measured at OD\u003csub\u003e600\u003c/sub\u003e using a UV-1800 spectrophotometer at 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, and 36 hours. Each measurement was performed in triplicate.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eSample preparation for transcriptomics and proteomics\u003c/h2\u003e \u003cp\u003eTwelve samples (including normal strain and LP-LUXS-36e in both planktonic and biofilm states, with three biological replicates per group) were immediately flash-frozen in liquid nitrogen for 30 minutes. Yeast RNA was extracted following the instructions of the fungal RNA extraction kit, followed by flash-freezing in liquid nitrogen and storage at -80\u0026deg;C. RNA purity was assessed via 1% agarose gel electrophoresis, while RNA integrity was evaluated using an Agilent 2200 TapeStation. RNA concentration and quality were determined using a Nanodrop spectrophotometer. The transcriptomic library was constructed using the TruseqTM RNA Sample Prep Kit. Prior to PCR amplification, the cDNA second strand was digested with UNG enzyme to retain only the first-strand cDNA in the library. The library fragment size was quantified using Qubit 2.0 and Agilent 2100. The resulting libraries were sequenced on an Illumina NovaSeq 6000 in PE150 mode.\u003c/p\u003e \u003cp\u003eFor proteomic samples, an appropriate amount of frozen RNA powder was transferred to a 1.5 mL centrifuge tube and mixed with SDT lysis buffer (4% SDS, 100 mM Tris-HCl, 10 mM DTT, 1 mM PMSF, and 2 mM EDTA). After vortexing, the mixture was boiled at 95\u0026deg;C for 15 minutes, followed by ultrasonic lysis on ice for 10 min. The supernatant containing proteins was collected via centrifugation. Cold acetone (four times the volume) was added to the protein solution for overnight precipitation at -20\u0026deg;C. The precipitate was collected by centrifugation at 4\u0026deg;C and washed three times with cold acetone. Finally, the pellet was redissolved in 8M urea, and total protein concentration was measured using a BCA assay kit (Beyotime Biotechnology, Shanghai, China). Proteins exhibiting a fold change\u0026thinsp;\u0026ge;\u0026thinsp;2 and P-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 between sample groups were identified as differentially expressed proteins. These proteins were subsequently subjected to the GO functional clustering analysis and the KEGG pathway enrichment analyses.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eChromatin immunoprecipitation (ChIP)\u003c/h2\u003e \u003cp\u003e \u003cem\u003eL. plantarum\u003c/em\u003e cells (6 \u0026times; 10\u003csup\u003e10\u003c/sup\u003e) were crosslinked with 1% formaldehyde at 37\u0026deg;C for 20 minutes, followed by quenching with 125 mM glycine (Macklin, #810676). Cells were pelleted by centrifugation, washed twice with Tris-buffer (150 mM NaCl, 20 mM Tris-HCl pH 7.5) containing protease inhibitor cocktail (Roche, #4693116001), and resuspended in 40 mL lysis buffer (50 mM Tris-HCl pH 8.0, 10 mM EDTA, 1% SDS, 1% Triton X-100, Roche protease inhibitor #11836170001) for 30 minutes. Chromatin was sheared using a Covaris M220 sonicator (14 minutes, 200\u0026ndash;500 bp fragments). For immunoprecipitation, 2 \u0026micro;L of chromatin was saved as input DNA (\u0026minus;\u0026thinsp;20\u0026deg;C), while 100 \u0026micro;L was incubated overnight at 4\u0026deg;C with 5 \u0026micro;g anti-LuxS antibody (Invitrogen, #PA5-117653, 1:1000). Protein G magnetic beads (30 \u0026micro;L) were added and incubated for 3 hours at 4\u0026deg;C. Beads were sequentially washed with: Low-salt buffer (20 mM Tris-HCl pH 8.1, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% SDS); LiCl buffer (10 mM Tris-HCl pH 8.1, 250 mM LiCl (ThermoFisher, #AM9480), 1 mM EDTA, 1% NP-40 (ThermoFisher, #85124), 1% deoxycholate (Solarbio, #D8460)) twice;TE buffer (10 mM Tris-HCl pH 7.5, 1 mM EDTA) twice. Bound DNA was eluted with 300 \u0026micro;L elution buffer (100 mM NaHCO\u003csub\u003e3\u003c/sub\u003e (Macklin, #S837271), 1% SDS) and treated sequentially with RNase A (8 \u0026micro;g/mL, ThermoFisher #EN0531, 65\u0026deg;C, 6 hours) and proteinase K (345 \u0026micro;g/mL, Macklin #39450-01-6, 45\u0026deg;C, overnight). ChIP and input DNA were end-repaired/dA-tailed (NEB #E7442), ligated to adapters (NEB #E7445), amplified for 15 cycles, and sequenced on Illumina NovaSeq 6000 (PE150).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eThe values for each individual experiment are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) of three independent biological replicates. Data were analyzed with one-way or two-way analysis of variance (ANOVA), followed by the Tukey\u0026rsquo;s comparison test (Xlstat software). The differences were considered to be statistically significant at a \u003cem\u003eP-\u003c/em\u003evalue\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eChIP-seq Data Analysis\u003c/h2\u003e \u003cp\u003eRaw sequencing data were processed with fastp (v0.20.0) to remove adapter sequences and low-quality reads shorter than 35 bp, generating high-quality clean reads. Data quality was further verified using FastQC. Clean reads were aligned to the mouse reference genome (GRCm38 assembly) using Bowtie2 (v2.2.6). The aligned files were converted to BAM, bigWig, and bedGraph formats using samtools (v1.10) and deepTools (v3.3.2), with the latter also employed for read count normalization and visualization.\u003c/p\u003e \u003cp\u003ePeak calling was performed using MACS2 (v2.2.7.1) with a \u003cem\u003ep\u003c/em\u003e-value threshold\u0026thinsp;\u0026lt;\u0026thinsp;0.01. Annotated peaks were mapped to genomic features using the ChIPseeker R package. Differential peaks were identified by DESeq2 (for samples with replicates) or MAnorm2 (for non-replicated samples), with significance thresholds set as |log₂(fold change)| \u0026gt; 1 and adjusted \u003cem\u003ep\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05. GO and KEGG pathway enrichment analyses of significant peaks were conducted using clusterProfiler. False discovery rate (FDR) correction was applied to calculate adjusted \u003cem\u003eP\u003c/em\u003e-values for multiple testing. Only genes with adjusted \u003cem\u003eP\u003c/em\u003e-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were retained for downstream analysis. \u003cem\u003eDe novo\u003c/em\u003e motif discovery within peaks was performed using HOMER (v4.11).\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003ch2\u003eConflict of interest\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e \u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eX.L. and C.H. was responsible for conceptualization, data curation, formal analysis, investigation, methodology, validation, visualization, and writing of the original draft. H.L., Q.X. and Z.W. curated the data, performed formal analysis, methodology, and visualization, and wrote the original draft. J.L. Reviewed and edited the manuscript. P.S. and T.D. performed the conceptualization, supervised the study, and reviewed and edited the manuscript. Y.D. conceptualized the study, acquired funds, performed the methodology and project administration, managed resources, supervised the study, and reviewed and edited the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e \u003cp\u003eThis study was financially supported by the National Natural Science Foundation of China (Nos. 32272279 and 32202191), the Key R\u0026amp;D project of Shandong Province (2023CXPT007 and 2024CXPT014), and the Key R\u0026amp;D Project of Qingdao Science and Technology Plan (24-2-3-4-zyyd-jch).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eDeng, Y. et al. Reduction and restoration of culturability of beer-stressed and low-temperature-stressed Lactobacillus acetotolerans strain 2011-8. International Journal of Food Microbiology 206, 96\u0026ndash;101 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhu, Y., Li, C., Cui, H. \u0026amp; Lin, L. Feasibility of cold plasma for the control of biofilms in food industry. Trends in Food Science \u0026amp; Technology 99, 142\u0026ndash;151 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, S. et al. Strategy to combat biofilms: a focus on biofilm dispersal enzymes. npj Biofilms and Microbiomes 9, 63 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaifreni, M. et al. Bacterial biofilm as a possible source of contamination in the microbrewery environment. Food Control 50, 809\u0026ndash;814 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Z. et al. Formation of viable, but putatively non-culturable (VPNC) cells of beer-spoilage \u003cem\u003elactobacilli\u003c/em\u003e growing in biofilms. LWT 133, 109964 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAyrapetyan, M. \u0026amp; Oliver, J.D. The viable but non-culturable state and its relevance in food safety. Current Opinion in Food Science 8, 127\u0026ndash;133 (2016).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo, L., Ye, C., Yu, X. \u0026amp; Horn, H. Induction of bacteria in biofilm into a VBNC state by chlorine and monitoring of biofilm structure changes by means of OCT. Science of The Total Environment 891 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao, Y. et al. Formation and resuscitation of viable but non-culturable (VBNC) yeast in the food industry: A review. International journal of food microbiology 426, 110901 (2025).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXiao, Y. et al. Characterization and formation mechanisms of viable, but putatively non-culturable brewer's yeast induced by isomerized hop extract. LWT 155, 112974 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Z. et al. POX1 regulates the formation of viable but non-culturable brewer\u0026rsquo;s yeast induced by iso-alpha acid from hops. Food Science and Human Wellness (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlvarez-Ord\u0026oacute;\u0026ntilde;ez, A., Coughlan, L.M., Briandet, R. \u0026amp; Cotter, P.D. Biofilms in Food Processing Environments: Challenges and Opportunities. Annual Review of Food Science and Technology 10, 173\u0026ndash;195 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWhiteley, M., Diggle, S.P. \u0026amp; Greenberg, E.P. Progress in and promise of bacterial quorum sensing research. Nature 551, 313\u0026ndash;320 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGu, Y. et al. Dissecting signal molecule AI-2 mediated biofilm formation and environmental tolerance in \u003cem\u003eLactobacillus plantarum\u003c/em\u003e. Journal of Bioscience and Bioengineering 131, 153\u0026ndash;160 (2021).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, L., Wu, R., Zhang, J. \u0026amp; Li, P. Overexpression of \u003cem\u003eluxS\u003c/em\u003e Promotes Stress Resistance and Biofilm Formation of \u003cem\u003eLactobacillus paraplantarum\u003c/em\u003e L-ZS9 by Regulating the Expression of Multiple Genes. Frontiers in microbiology 9, 2628 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAyrapetyan, M., Williams, T.C., Oliver, J.D. \u0026amp; Griffiths, M.W. Interspecific Quorum Sensing Mediates the Resuscitation of Viable but Nonculturable Vibrios. Applied and Environmental Microbiology 80, 2478\u0026ndash;2483 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, J. et al. Study on spoilage capability and VBNC state formation and recovery of \u003cem\u003eLactobacillus plantarum\u003c/em\u003e. Microbial pathogenesis 110, 257\u0026ndash;261 (2017).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaveerach, P., ter Huurne, A.A., Lipman, L.J. \u0026amp; van Knapen, F. Survival and resuscitation of ten strains of Campylobacter jejuni and Campylobacter coli under acid conditions. Applied and environmental microbiology 69, 711\u0026ndash;714 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBai, H. et al. Citric acid can force Staphylococcus aureus into viable but nonculturable state and its characteristics. International Journal of Food Microbiology 305 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu, J. et al. Induction and Recovery of the Viable but Nonculturable State of Hop-Resistance \u003cem\u003eLactobacillus brevis\u003c/em\u003e. Frontiers in microbiology 9, 2076 (2018).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSakamoto, K. \u0026amp; Konings, W.N. Beer spoilage bacteria and hop resistance. International Journal of Food Microbiology 89, 105\u0026ndash;124 (2003).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVattakaven, T., Bond, P., Bradley, G. \u0026amp; Munn, C.B. Differential effects of temperature and starvation on induction of the viable-but-nonculturable state in the coral pathogens \u003cem\u003eVibrio shiloi\u003c/em\u003e and \u003cem\u003eVibrio tasmaniensis\u003c/em\u003e. Applied and environmental microbiology 72, 6508\u0026ndash;6513 (2006).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng, B. et al. Formation and Resuscitation of Viable but NonculturableSalmonella typhi. \u003cem\u003eBioMed Research International\u003c/em\u003e 2013, 1\u0026ndash;7 (2013).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGu, Y. et al. Effects of Exogenous Synthetic Autoinducer-2 on Physiological Behaviors and Proteome of Lactic Acid Bacteria. ACS Omega 5, 1326\u0026ndash;1335 (2020).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang, Y. et al. Exploring the relationship between the signal molecule AI-2 and the biofilm formation of Lactobacillus sanfranciscensis. Lwt 154 (2022).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBay, D.C. \u0026amp; Turner, R.J. Diversity and evolution of the small multidrug resistance protein family. BMC Evolutionary Biology 9 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, Q. et al. luxS Mutant Regulation: Quorum Sensing Impairment or Methylation Disorder? \u003cem\u003eSensors\u003c/em\u003e 12, 6176\u0026ndash;6185 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTannock, G.W. et al. Ecological behavior of \u003cem\u003eLactobacillus reuteri\u003c/em\u003e 100\u0026thinsp;\u0026ndash;\u0026thinsp;23 is affected by mutation of the \u003cem\u003eluxS\u003c/em\u003e gene. Applied and environmental microbiology 71, 8419\u0026ndash;8425 (2005).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuck, B.L., Azcarate-Peril, M.A. \u0026amp; Klaenhammer, T.R. Role of autoinducer-2 on the adhesion ability of \u003cem\u003eLactobacillus acidophilus\u003c/em\u003e. Journal of applied microbiology 107, 269\u0026ndash;279 (2009).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, R. et al. Identification and Analysis of PEPC Gene Family Reveals Functional Diversification in Orchidaceae and the Regulation of Bacterial-Type PEPC. International journal of molecular sciences 25 (2024).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD\u0026ouml;nh\u0026ouml;fer, A. et al. Structural basis for TetM-mediated tetracycline resistance. Proceedings of the National Academy of Sciences of the United States of America 109, 16900\u0026ndash;16905 (2012).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMcLeod, A., Snipen, L., Naterstad, K. \u0026amp; Axelsson, L. Global transcriptome response in \u003cem\u003eLactobacillus sakei\u003c/em\u003e during growth on ribose. BMC microbiology 11, 145 (2011).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLei, M.G. \u0026amp; Lee, C.Y. RbsR Activates Capsule but Represses the \u003cem\u003erbsUDK\u003c/em\u003e Operon in \u003cem\u003eStaphylococcus aureus\u003c/em\u003e. J Bacteriol 197, 3666\u0026ndash;3675 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, L., Mendis, N., Trigui, H., Oliver, J.D. \u0026amp; Faucher, S.P. The importance of the viable but non-culturable state in human bacterial pathogens. Frontiers in microbiology 5, 258 (2014).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePiao, M. et al. Induction of viable but putatively non-culturable \u003cem\u003eLactobacillus acetotolerans\u003c/em\u003e by thermosonication and its characteristics. LWT 109, 313\u0026ndash;318 (2019).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchurr, B.C., Hahne, H., Kuster, B., Behr, J. \u0026amp; Vogel, R.F. Molecular mechanisms behind the antimicrobial activity of hop iso-α-acids in \u003cem\u003eLactobacillus brevis\u003c/em\u003e. Food microbiology 46, 553\u0026ndash;563 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, H. et al. Metabolomic Differences between Viable but Nonculturable and Recovered \u003cem\u003eLacticaseibacillus paracasei\u003c/em\u003e Zhang. Foods (Basel, Switzerland) 12 (2023).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSu, X. et al. Identification, characterization and molecular analysis of the viable but nonculturable \u003cem\u003eRhodococcus biphenylivorans\u003c/em\u003e. Scientific reports 5, 18590 (2015).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSe, J. et al. Proteomic changes of viable but nonculturable (VBNC) \u003cem\u003eEscherichia coli O157:H7\u003c/em\u003e induced by low moisture in an artificial soil. Biology and Fertility of Soils 57, 219\u0026ndash;234 (2021).\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"beer spoilage Lactobacillus, biofilm, viable but noncuturable (VBNC) state, quorum sensing system, transcriptomics and proteomics, ChIP-seq","lastPublishedDoi":"10.21203/rs.3.rs-6435335/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6435335/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e \u003cem\u003eLactiplantibacillus plantarum\u003c/em\u003e is a major beer spoilage bacterium that poses significant challenges to industrial brewing processes. This study investigated the function of the \u003cem\u003eluxS\u003c/em\u003e gene in regulating the transformation of biofilm cells to a viable but non-culturable (VBNC) state induced by iso-α-acids from hops. Scanning electron microscopy revealed increased cell adhesion in biofilms versus planktonic cells, with VBNC cells exhibiting surface protrusions and reduced volume. Temporal analysis showed synchronized upregulation of \u003cem\u003eluxS\u003c/em\u003e expression and AI-2 levels during VBNC induction, peaking at 4 hours before declining. Exogenous AI-2 facilitated biofilm-to-VBNC transition and revival, whereas \u003cem\u003eluxS\u003c/em\u003e manipulation disrupted these processes, indicating \u003cem\u003eluxS\u003c/em\u003e regulates VBNC dynamics via AI-2 biosynthesis in the quorum sensing (QS) system. A \u003cem\u003eluxS\u003c/em\u003e-overexpressing strain was engineered to explore molecular mechanisms. Multi-omics analyses (transcriptomics, proteomics, ChIP-seq) demonstrated that \u003cem\u003eluxS\u003c/em\u003e directly activates genes involved in carbohydrate metabolism and stress responses, promoting energy homeostasis and stress resilience in the VBNC state. Differential gene enrichment analysis identified \u003cem\u003eluxS\u003c/em\u003e-regulated genes upregulated during VBNC entry, forming a regulatory network linked to QS and biofilm formation. This study integrates the multi-omics data, systematically elucidating the LuxS-AI-2 axis in VBNC-state establishment, providing a molecular framework for understanding beer spoilage and controlling biofilm-associated industrial contamination.\u003c/p\u003e","manuscriptTitle":"Mechanism insights into the regulation of the LuxS/AI-2 quorum sensing system on the formation of viable but nonculturable state in biofilm cells of beer-spoilage Lactiplantibacillus plantarum","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-04-15 03:50:12","doi":"10.21203/rs.3.rs-6435335/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cff15f88-7719-43da-8cde-543877352d4d","owner":[],"postedDate":"April 15th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[{"id":47080862,"name":"Biological sciences/Biological techniques"},{"id":47080863,"name":"Biological sciences/Microbiology"}],"tags":[],"updatedAt":"2025-04-15T12:23:28+00:00","versionOfRecord":[],"versionCreatedAt":"2025-04-15 03:50:12","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6435335","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6435335","identity":"rs-6435335","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00