Full text
131,028 characters
· extracted from
preprint-html
· click to expand
Functional Equivalence of the Proneural Genes Neurog1 and Neurog2 in the Developing Dorsal Root Ganglia Highlights the Importance of Timing of Neurogenesis in Biasing Somatosensory Precursor Fates | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Functional Equivalence of the Proneural Genes Neurog1 and Neurog2 in the Developing Dorsal Root Ganglia Highlights the Importance of Timing of Neurogenesis in Biasing Somatosensory Precursor Fates Simon Desiderio , Pauline Cabochette , Stephanie Venteo , Gautier Tejedor , Farida Djouad , Patrick Carroll , Fabrice Ango , Alexandre Pattyn doi: https://doi.org/10.1101/2025.01.08.631905 Simon Desiderio 1 Institute for Neurosciences of Montpellier, University of Montpellier, INSERM , Montpellier, France 2 Department of Molecular Biology, ULB Neuroscience Institute (UNI), Université libre de Bruxelles (ULB) , B-6041 Gosselies, Belgium Find this author on Google Scholar Find this author on PubMed Search for this author on this site Pauline Cabochette 1 Institute for Neurosciences of Montpellier, University of Montpellier, INSERM , Montpellier, France 2 Department of Molecular Biology, ULB Neuroscience Institute (UNI), Université libre de Bruxelles (ULB) , B-6041 Gosselies, Belgium Find this author on Google Scholar Find this author on PubMed Search for this author on this site Stephanie Venteo 1 Institute for Neurosciences of Montpellier, University of Montpellier, INSERM , Montpellier, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Gautier Tejedor 3 IRMB, University of Montpellier, INSERM , Montpellier, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Farida Djouad 3 IRMB, University of Montpellier, INSERM , Montpellier, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Patrick Carroll 1 Institute for Neurosciences of Montpellier, University of Montpellier, INSERM , Montpellier, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Fabrice Ango 1 Institute for Neurosciences of Montpellier, University of Montpellier, INSERM , Montpellier, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site Alexandre Pattyn 1 Institute for Neurosciences of Montpellier, University of Montpellier, INSERM , Montpellier, France Find this author on Google Scholar Find this author on PubMed Search for this author on this site For correspondence: alexandre.pattyn{at}inserm.fr Abstract Full Text Info/History Metrics Supplementary material Preview PDF Abstract Distinct subfamilies of proneural bHLH transcription factors (TFs) control neurogenesis and influence neuronal fate specification throughout the developing nervous system. While members of different subfamilies generally display divergent expression and functions, those within the same subfamily are often co-expressed, raising questions about their respective roles. Here, we assess the functional equivalence of the two paralogous proneural TFs Neurog1 and Neurog2, focusing on neurons of the dorsal root ganglia (DRG) which underlie our ability to process somatosensory information. During development, distinct classes of DRG neurons -classified as mechano/proprioceptors or thermo/nociceptors-are generated during two successive neurogenic phases, which are respectively controlled by Neurog2 and Neurog1, in line with their dynamic and complementary spatiotemporal expression patterns. Therefore, in this system, each TF appears to play unique roles in regulating neurogenesis and specifying distinct neuronal identities. Yet, using a gene replacement strategy in vivo , we show that, despite subtle divergences masked by dose-compensation effects, Neurog1 and Neurog2 are essentially functionally interchangeable in all aspects of DRG development, indicating that their apparent functional discrepancies primarily stem from divergent evolution of their gene regulatory regions, rather than of their respective biochemical properties. Notably, we definitively establish that neither TF directly specifies specific somatosensory neuron identities. This result, combined with : (i) a new series of birth-dating experiments supporting that most mechano/proprioceptive and thermo/nociceptive subtypes are predominantly born during successive time-windows; and (ii) analyses of complementary transgenic mouse models in which opposite temporal shifts of neurogenesis -either delayed onset or premature arrest-have predictable opposite impacts on their DRG content, highlight that the fate choice of somatosensory precursors toward the mechano/proprioceptive or thermo/nociceptive lineages critically depends on the timing of their birth. Introduction During development, the multiple neuronal types that form the central (CNS) and peripheral (PNS) nervous systems are generated at specific times and locations and in definite numbers from neural stem cells, notably through the coordinated action of several families of transcriptional regulators. Among them, the proneural basic-helix-loop-helix (bHLH) family of transcription factors (TFs) plays a pivotal role by controlling neurogenesis and influencing neuronal fate specification ( Bertrand et al., 2002 ; Huang et al., 2014 ). In Vertebrates, many bHLH TFs have been identified, but only a subset has a clear proneural activity in vivo. Those notably include Mash1/Ascl1 of the Ascl subfamily, Atoh1 and Atoh7 of the Atoh subfamily or Neurog1 and Neurog2 of the Neurogenin subfamily ( Huang et al., 2014 ; Baker and Brown, 2018 ). Members of different subfamilies generally control neurogenesis in complementary regions of the CNS and PNS and participate in the specification of distinct neuronal types ( Huang et al. 2014 ). Accordingly, gene swapping strategies in mice have highlighted their functional divergences ( Baker and Brown, 2018 ), as shown for Atoh1 and Neurog1 ( Jahan et al., 2015 ), Ascl1 and Atoh7 ( Hufnagel et al., 2013 ) or Ascl1 and Neurog2 ( Fode et al., 2000 ; Parras et al., 2002 ; Pattyn et al., 2004 , 2006 ; Kele et al. 2006 , McNay et al; 2006). However, such approaches have not been employed to assess to which extent paralogous genes of the same subfamily are functionally interchangeable. Replacement of drosophila atonal by its mouse orthologues Atoh1 or Atoh7 has nevertheless provided indirect evidence that both paralogous TFs are not fully equivalent ( Weinberger et al., 2017 ). In contrast, this question remains largely open for the Neurogenin subfamily. Neurog1 and Neurog2 share a close, though not identical, bHLH domain, and have largely dissimilar NH2- and COOH-terminal regions ( Hand et al., 2005 ; Figure S2A). With few exceptions (e.g Anderson et al., 2006; Kele et al., 2006 ), they are often detected in the same regions of the developing nervous system, albeit with distinct spatio-temporal patterns, where they fulfill specific, complementary and/or partially redundant roles ( Sommer et al., 1996 ; Fode et al., 1998 , 2000 ; Ma et al., 1998 , 1999 ; Scardigli et al., 2001 ; Gowan et al., 2001 ; Hand et al., 2005 ; Ma et al., 2008 ; Shaker et al., 2012 ; Takano-Maruyama et al., 2012 ; Dixit et al., 2014 ; Han et al., 2018 ; Venteo et al., 2019 ). The developing dorsal root ganglia (DRG) provide a good model illustrating their dynamic expression and complementary requirements. DRG contain a wide variety of specialized neurons involved in the detection of mechanical, proprioceptive, thermal or nociceptive environmental stimuli. Based on anatomical, functional and developmental properties, somatosensory neurons are commonly classified into the mechano/proprioceptive and thermo/nociceptive classes. Both classes ultimately comprise multiple functional subtypes, and it is well-documented that this intra-lineage diversity is progressively established until postnatal stages through binary fate decisions governed by the interplay of environmental cues and intrinsic transcriptional modules ( Levanon et al., 2002 ; Kramer et al., 2006 ; Chen et al., 2006 ; Abdo et al., 2011 ; Scott et al., 2011 ; Lallemend and Ernfors, 2012 ; Usoskin et al., 2015 ; Faure et al., 2020 ; Sharma et al., 2020 ; Cranfill & Luo, 2021 ; Meltzer et al., 2021 ; de Nooj, 2022). In contrast, the timing and mechanisms by which the mechano/proprioceptive and thermo/nociceptive lineages initially segregate remain elusive and debated (e.g. Sharma et al., 2020 ; Faure et al, 2020 ). All somatosensory neurons are produced within a fixed embryonic period, between E9.5 and E13.5, from heterogeneous neural crest (NC)-derived progenitors that emigrate from the dorsal neural tube as “early” or “late” populations, with limited or extensive proliferative capacities, respectively (Serbedjiza et al., 1990; Frank and Sanes, 1991 ; Maro et al., 2004 ; Marmigere and Ernfors, 2007; George et al., 2010 ; Gresset et al., 2015 ; Ohayon et al., 2015 ; Vermeiren et al., 2020 ). These progenitor pools differentiate during two main successive waves of neurogenesis classically assumed to contribute to specific neuronal amounts and identities: the first produces 20% of the DRG neurons between E9.5 and E11.5, mainly mechano/proprioceptors; the second generates 80% of the DRG neurons between E11.5 and E14, mostly thermo/nociceptors (Figure S1A; Lawson and Biscoe, 1979 ; Kitao et al., 1996 ; Ma et al., 1999 ; Lallemend and Ernfors, 2012 ; Ohayon et al., 2015 ; Vermeiren et al., 2020 ). However, recent studies have partly challenged this classical view by suggesting that both functional classes of neurons exhibit more extensive overlapping birth periods and segregate at later stages than previously thought ( Sharma et al., 2020 ; Landy et al., 2021 ; Meltzer et al., 2021 ). In this system, Neurog1 and Neurog2 exhibit dynamic and complementary expression profiles which roughly correlate with the two neurogenic waves. Neurog2 is the first to be induced from E9, in all migrating NC-derived somatosensory progenitors at some point, and is subsequently maintained in the coalescing DRG until E11.5, specifically during the first neurogenic period (Figure S1A). Neurog1 is induced slightly later, at E9.5, under the transient control of Neurog2 , in post-migratory progenitors settling in the DRG anlagen, and is maintained until E14, encompassing the second neurogenic period (Figure S1A; Ma et al., 1999 ; Venteo et al., 2019 ; Soldatov et al., 2019 ; Faure et al., 2020 ; Sharma et al., 2020 ). Accordingly, in Neurog1 -/- knock-outs (KO), the second wave of neurogenesis is specifically abolished and most thermo/nociceptors are missing (Figure S1B; Ma et al., 1999 ; Bachy et al., 2011 ; Ohayon et al., 2015 ). In addition, the complete agenesis of all neuronal classes in Neurog1 -/- ;Neurog2 -/- double-knockouts (dKO) indicates that Neurog2 control the first neurogenic wave and the formation of mechano/proprioceptors (Figure S1C; Ma et al., 1999 ). Nevertheless, the individual requirement of Neurog2 is more complex (Figure S1D). In Neurog2 -/- single-KO, Neurog1 expression and onset of neurogenesis are delayed by 1.5 days, and during this transient “dKO-like” state, pools of progenitors either die or switch fate to become melanoblasts. After E10.5, however, Neurog1 is eventually induced in these KO and neurogenesis is in turn initiated, albeit at a lower rate due to progenitor depletion, resulting in a global neuronal deficit of about 30% affecting all functional classes (Figure S1D; Ma et al., 1999 ; Venteo et al., 2019 ). Therefore, during DRG development Neurog1 and Neurog2 play unique, complementary and only partially redundant roles in maintaining the integrity of somatosensory progenitors and ensuring the generation of accurate neuronal numbers and identities. Notably, Neurog2 seems the sole factor responsible for the repression of the melanocyte fate, while Neurog1 appears the only factor involved in the specification of the thermo/nociceptive identity. However, it remains unclear whether these apparent functional discrepancies reflect distinct biochemical properties between the two TFs and/or their unique spatio-temporal expression patterns. Here, we have assessed the functional equivalence of Neurog1 and Neurog2 in the developing DRG using a classical in vivo gene replacement approach. Our findings definitively establish that, despite subtle divergences masked by gene-dosage compensation, Neurog1 and Neurog2 are essentially functionally interchangeable in all aspects of DRG development, including fate specification, indicating that their functional specificities primarily reflect their complementary expression patterns. This result, along with new birth dating studies and functional analyses on complementary transgenic mice models in which defined alterations of the timing and pace of neurogenesis have predictable consequences on their DRG content, underscores that the identity of somatosensory precursors as either mechano/proprioceptor or thermo/nociceptor, is early determined but critically relies on the timing of their differentiation. Materials and Methods Animal models Neurog1 2neo ( 1 2neo ) and Neurog2 1neo ( 2 1neo ) knock-in (KI) lines were first produced via a classical homologous recombination-based strategy in embryonic stem (ES) cells, using specific targeting constructs (Figures S2C,F). To generate the 1 2neo targeting construct, the so-called PBS-X7.5 and PBS-E8.0 Neurog1 genomic clones covering the entire region of the Neurog1 locus were used (gift of Dr. Q. Ma). The 5’-arm of homology consisted in a 3.56kb fragment ranging from an upstream XhoI site to the start codon of the endogenous Neurog1 coding sequence (CDS). The region of the start codon was slightly modified to insert a NsiI restriction site. The CDS of Neurog2 was then amplified by PCR and cloned into the NsiI site. An “ ires-gfp ” reporter cassette and a “ floxed-pgk-neo ” positive selection cassette (respective gifts of Drs J. Livet and J-F. Brunet) were then introduced. The 3’-arm of homology consisted in a 3.15kb fragment ranging from the endogenous stop codon of Neurog1 to a downstream XhoI site. Finally, a “ pgk-DTA ” negative selection cassette was introduced (Figure S2C). To generate the 2 1neo targeting construct, the so-called PBS-Λ7A genomic clone covering the Neurog2 locus was used (gift of Dr Q. Ma). The 5’-arm of homology consisted in a 3.15kb fragment ranging from an upstream HindIII site to the start codon of the endogenous Neurog2 CDS. The region of the start codon was again modified to insert a NsiI restriction site. The CDS of Neurog1 was then amplified by PCR and cloned into the NsiI site. The “ ires-gfp ” and the “ floxed-pgk-neo ” cassettes were also introduced. The 3’- arm of homology consisted in a 4.5kb fragment ranging from a XbaI site encompassing the stop codon of the endogenous Neurog2 CDS to a downstream NsiI site. Finally, the “ pgk- DTA ” negative selection cassette was also inserted (Figure S2F). Both constructs were sequence-verified (Cogenics). ES cells were then electroporated, grown and selected using Geneticin (G418; Sigma), and resistant clones were tested for accurate homologous recombination events by Southern blot analyses. For the 1 2neo allele, genomic DNA was digested by XbaI, migrated in a 0.8% agarose gel, blotted onto a Nylon membrane (Hybond N+, Amersham) and hybridized with a P 32 -labeled DNA probe corresponding to a XbaI/XhoI fragment located just upstream of the 5’-arm of homology (Figure S2C). Membranes were then analyzed using a phosphoimager. The size of the WT allele was of 11kb while the size of the KI allele was around 6kb (Figure S2D). For the 2 1neo allele, genomic DNA was digested by NsiI and a DNA probe corresponding to a NsiI/HindIII fragment upstream of the 5’-arm of homology was used (Figure S2F). The size of the WT allele was of 5.65kb, and that of the KI allele was of 3.95kb (Figure S2G). Recombinant ES clones were then used to generate chimeric males (S.E.A.T facility, Villejuif) that were subsequently bred with WT C57BL/6J females to stably establish the 1 2neo and 2 1neo transgenic mouse strains which both still contained the “ floxed-pgk-neo ” cassette. 1 2neo and 2 1neo animals were genotyped by PCR. For 1 2neo mice, the following pairs of oligonucleotides were used: i) Neurog1KI2F (5’- acggacagtaagtgcgct-3’) and Neurog2KI1R (5’-ttggctttgacgcgacgact-3’) to assess the Neurog1 WT allele; ii) Neurog1KI2F and Neurog1KI2R (5’-tcgtgagcttggcatcct-3’) for the Neurog1 2neo allele; and iii) NeoF (5’-ctattcggctatgactgggc-3’) and NeoR (5’- aatatcacgggtagccaacg-3’) for the neomycin gene. Expected band sizes were respectively of 368bp, 526bp and 630bp (Figure S2E). For 2 1neo animals: i) VD187 (5’-ggacattcccggacacacac- 3’) and Neurog1KI2R oligonucleotides were used to assess the Neurog2 WT allele; ii) Neurog2KIF (5’-agcgacactttaccctgtcc-3’) and Neurog2KI1R for the Neurog2 1neo allele; and iii) NeoF and NeoR for the neomycin gene. Expected band sizes were respectively of 779bp, 361bp and 630bp (Figure S2H). To excise the “ floxed-pgk-neo ” cassette, the CMV-Cre ubiquitous deleter mice ( Schwenk et al., 1995 ) was used, thus allowing the production of the Neurog1 2 and Neurog2 1 mice that represent “clean” KI (Figures S2C,F). These animals were PCR-tested for the deletion of the neomycin gene and were subsequently genotyped using the same pairs of oligonucleotides as described above (Figures S2E,H). Note that both KI strains are viable and fertile at the homozygous state. Neurog1 ( Ma et al., 1999 ) and Neurog2 ( Andersson et al., 2006 ) knockouts (KO) lines were also used. They were maintained and genotyped as previously described ( Venteo et al., 2019 ). 1 2neo/2neo ; Neurog2 -/- , and 2 1neo/1neo ; Neurog1 -/- compound transgenic embryos as well as Neurog1 2/2 ; Neurog2 -/- , and Neurog2 1neo/1neo ; Neurog1 -/- KI;KO models were obtained by successive breeding of appropriate KI and KO animals. Histological analyses were performed on embryos issued from single-KI, single-KO or compound KI;KO lines harvested between embryonic day (E) 9.5 and E18.5. The morning of the vaginal plug was considered as embryonic stage E0.5. Parents were provided ad libitum with standard mouse pellet food and water and housed at room temperature with a 12h light/dark cycle. All procedures were conducted according to the French Ministry of Agriculture and the European Community Council Directive no. 86/609/EEC, OJL 358. Protocols were validated by the Direction Départementale des Services Vétérinaires de l’Hérault (Certificate of Animal Experimentation no. 34-376). B16F10 cell cultures and transfection of expression vectors B16F10 cells (ATCC) were cultured in DMEM/F12 medium (Lonza) supplemented with 10% heat-inactivated fetal bovine serum (FBS, Gibco) and Penicillin/Streptomycin (Gibco). Cell line were maintained at 37°C in a humified incubator with 5% CO 2 . B16F10 cells were transfected at 80% confluency in 6-well plates using lipofectamine 2000 (Thermo Fisher Scientific), Opti-MEM Reduced Serum Medium (Gibco) and 1µg of total plasmid DNA. Cells were fixed with 4% paraformaldehyde for 15 min at room temperature 24 hours post-transfection. GFP, Neurog1, Neurog2, Neurog1-bhlh2 and Neurog2-bhlh1 were expressed from the CMV promoter of the pCS2+ vector. Myc-mNeurog1-PCS2 was kindly provided by Eric Bellefroid (ULB, Belgium). HA-mNeurog2-PCS2 was cloned using the In-Fusion cloning strategy (Takara) using PCR product generated with Phusion DNA polymerase (NEB). The primer sequences used were: Fwd:5’- CTTTTTGCAGGATCCCATCGATGCCACCATGTATCCGTATGATGTTCCGGATTATG CATTCGTCAAATCTGAGACTCTGGAGTTG-3’ and Reverse: 5’- CTATAGTTCTAGAGGCTCGAGCTAGATACAGTCCCTGGCGAGG-3’. Chimeras Neurog1-bHLH2 and Neurog2-bHLH1 were synthetized using the Genewiz Gene synthesis service. All constructs were confirmed by Sanger sequencing. Quantitative RT-PCR RNA extractions were performed using RNeasy Mini kit (Qiagen) according to the manufacturer’s instructions. A total of 1µg of RNA was used to retrotranscribe in cDNA with the Superscript II First-Strand Synthesis System (Thermo Fhisher Scientific). Real-time PCR was carried out using SYBR Green I dye detection on the Light Cycler system (Roche Molecular Biochemicals). The results are expressed as relative mRNA levels of gene expression and obtained using the ΔΔCT-method. The normalization was performed with GAPDH as a housekeeping gene and compared to control condition. The primer sequences used were: GAPDH Fwd: 5’-GTGAAGGTCGGTGTGAACG-3’; GAPDH Rev: 5’-AGGGGTCGTTGATGGCAACA-3’; MitF Fwd: 5’- ACCTCTGAAGAGCAGCAGTT-3’; Mitf Rev: 5’- AGTTGCTGGCGTAGCAAGAT-3’ Immunofluorescence staining Primary antibodies used in this study were as follows: Chicken anti-GFP (1/1000; Abcam), Goat anti-TrkB (1/2000; R&D Systems), Goat anti-TrkC (1/1000; R&D Systems), Mouse anti-MitF (1/100; C5/D5 Sigma), Rabbit anti-activated Caspase3 (1/2000; Cell Signaling), Rabbit anti-Parvalbumin (PV; 1/10000; SWANT) and Rabbit anti-TrkA (1/500; Millipore). Secondary antibodies (Molecular Probes) used were as follows; Donkey anti-rabbit IgG Alexa Fluor 594-conjugated (1/2000); Donkey anti-goat IgG Alexa Fluor 488-conjugated (1/1000); Goat anti-chicken IgG Alexa Fluor 488-conjugated (1/1000). For staining on cryosections, slides were dried 20 min at RT, rinsed with PBS, blocked for 30 min at RT in 4% Serum-PBS-0.1% Triton X100 and incubated o.n. at 4°C with the appropriate primary antibody(ies) diluted in the same buffer. Slides were then washes 3 times 10 min in PBS-0.1% Triton X100 and incubated 1h at RT with secondary antibody(ies) diluted in the same buffer. They were then washed 3 times 10 min at RT, mounted under coverslips in Mowiol and rapidly imaged. Note that pictures showing ISH or immunofluorescence staining are representative of at least three independent animals. For staining on cell cultures, cells were permeabilized in PBTT (PBS 0.1% Tween-20; 0.5% triton X-100) and then blocked in 3% BSA-PBS for 45 min before being exposed to primary antibodies for 1h at room temperature. After three PBS washes, cells were incubated with secondary antibodies for 1h at room temperature. Cells were stained for 2 min with Hoechst diluted to 10 µg/mL in PBS. In situ hybridization (ISH) on cryosections Antisense RNA probes for Cgrp, gfp, MafA , Mitf , MrgprD , NeuroD , Neurog1, Neurog2, Ret, SCG10 , Sox10, TrkA, TrkB, TrkC, TrpM8 and TrpV1 were labeled using the Dig RNA labeling kit (Roche) and purified on G50 columns (GE Healthcare). For staining on cryosections, staged embryos were dissected out in cold Phosphate Buffer Saline (PBS), fixed overnight (o.n.) at 4°C in 4% Paraformaldehyde(PFA)- PBS, cryoprotected in 20% Sucrose-PBS o.n. at 4°C, embedded in OCT-compound (Tissue- Tek) and stored at -80°C until use. 14µm thoracic transverse sections were cut using a cryostat (Microm), placed on glass slides (Superfrost Plus, Menzel-Gläser) and stored at - 20°C until use. For the staining procedure, slides were dried at room temperature (RT) for 20 minutes (min) and incubated o.n. at 70°C with the appropriate probes diluted 1/100-1/200 in the hybridization buffer (50% Formamide-10% Dextran Sulfate-1X Salt Solution-1mg/ml yeast tRNA-1X Denhardt’s). They were washed twice 1h at 70°C in 50% Formamide-1X Sodium/Sodium Citrate buffer-0.1% Tween 20. They were then washed 3 times 10 min at RT in MABT (1X Maleic acid buffer-0.1% Tween20), blocked in 20% Sheep Serum-2% Blocking Reagent (Roche)-MABT and incubated o.n. at 4°C with the anti-DIG antibody (Roche) diluted 1/2000 in the same buffer. Slides were washed 3 times for 10 min at RT in MABT, incubated twice for 15 min in buffer B3 (100mM Tris pH 9.5, 100mM NaCl, 50mM MgCl2, 0.1% Tween 20) and incubated with the NBT and BCIP substrates (Roche) diluted in B3. Slides were washed several times in water for 2h, dried at RT and mounted in Mowiol under coverslips. Birth dating analyses Birth dating experiments were performed using intraperitoneal injections of BrdU into pregnant mice (2mg/mouse in PBS) at either E9.5, E10.5, E11.5, E12.5 or E13.5. Embryos were then collected at E18.5 and a column containing their spinal cord and DRG was dissected out, fixed in 4% Paraformaldehyde(PFA)-PBS, cryoprotected in 20% Sucrose-PBS and embedded in OCT-compound. 14µm thoracic transverse sections were then processed for double-staining, either by combined ISH and BrdU immunofluorescence ( TrkB /BrdU, TrkC /BrdU, MafA /BrdU, MrgprD /BrdU, Cgrp /BrdU, TrpM8 /BrdU and TrpV1 /BrdU) or by double-immunofluorescence (PV/BrdU) (Figure S5A). For ISH and BrdU double-staining, ISH was first performed until appropriate coloration of the cytoplasm. Slides were then washed in PBS and incubated in 10 mM sodium citrate buffer (pH 6.0) at 95°C for 15 min, then at room temperature (RT) for further 15 min, and washed several times in PBS at RT. They were then subjected to immunofluorescence staining to detect BrdU in the nucleus. For double immunofluorescence, slides were dried at RT, washed once in PBS and incubated in 10 mM sodium citrate buffer (pH 6.0) at 95°C for 15 min, then at room temperature (RT) for further 15 min, and washed several times in PBS at RT. They were then subjected to double-immunostaining staining as described above. Quantification and statistical analyses Quantitative analyses on B16F10 cells were performed on 3 independent transfection experiments. Quantitative analyses on mice were carried out on at least 3 independent animals for each genotype or conditions. Thoracic DRG sections processed either for ISH or immunofluorescence were imaged using a Zeiss microscope. Cell counts were performed on 6-8 sections (12-16 hemisections) for each animal, depending on the stage, using the Image J software. Only cells with a clearly identifiable nucleus were counted. For birth dating experiments, only cells with a clear BrdU- positive nucleus was taken into consideration. Nuclei containing only few fluorescent dots were not considered to avoid potential overestimation. For RT-qPCR experiments, statistical analyses were performed using one-way analysis of variance (ANOVA), followed by a post-hoc Newman-Keuls test. For cell countings in vitro and on sections of mouse embryos, statistical analyses were performed using Unpaired Student t tests. Results are expressed as mean ± standard error to the mean (s.e.m). p <0.05 (*), p < 0.01 (**) and p < 0.001 (***) were considered as statistically significant. Note that no statistical methods were used to predetermine sample sizes, but numbers of animals and sections analyzed for each genotype and for each stage are consistent with those typically used in the field. Results Generation and Validation of Neurog1 and Neurog2 Knock-in Mouse Models To assess functional similarities and divergences of Neurog1 and Neurog2 in the developing DRG, we generated knock-in (KI) mouse lines where their coding sequences (CDS) were mutually swapped, while preserving the overall genes structure. This was facilitated by the relatively simple organization of their respective loci in which the CDS is encoded by a single exon (Figures S2C,F). Using conventional gene targeting in mouse embryonic stem (ES) cells, the endogenous Neurog1-CDS and Neurog2-CDS were precisely replaced by a “ Neurog2-CDS/ires-gfp/Floxed-PGK-neo ” construct (Figure S2C) and a “ Neurog1-CDS/ires- gfp/Floxed-PGK-Neo ” construct (Figure S2F), respectively. After ES cells electroporation, selection and genotyping, we identified several recombinant clones (Figures S2D,G) that were used to initially produce the so-called Neurog2 KINeurog1neo (hereafter referred to as 2 1neo transgenic line; Figure S2C) and Neurog1 KINeurog2neo (hereafter referred to as 1 2neo transgenic line; Figure S2F) lines, which both contain the Floxed-PGK-neo cassette. Having in mind that the PGK promoter can perturb the activity of the locus in which it is inserted (e.g Scacheri et al, 2001 ; see below), both lines were subsequently crossed with a CMV-Cre deleter line to establish the Neurog2 KINeurog1 (hereafter referred to as Neurog2 1 or 2 1 line) and Neurog1 KINeurog2 (hereafter referred to as Neurog1 2 or 1 2 line) lines which constitute “clean” KI models (Figures S2C,E,F,H; see below). Each model was then validated by analyzing the expression of the different transgenes, focusing on the developing DRG. For the Neurog2 1/1 KI animals, considering the transient expression of Neurog2 in this structure between E9 and E11.5 and its extensive overlap with Neurog1 at these stages ( Ma et al., 1999 ; Figures S1A and 1M), we initially took advantage of the gfp reporter gene. Thereby, we determined that the spatio-temporal profile and number of gfp -positive (+) cells were similar to that of Neurog2 + cells in WT, starting at E9 and ending at E11.5 ( Figures 1A-C ). Consistent with this, at E9.5, the number of Neurog1 + cells in Neurog2 1/1 embryos was increased compared to WT, and was similar to Neurog2 + cells in WT (Left graph in Figure 1C ). From E10.5, when endogenous Neurog1 expression normally overrides that of Neurog2 in WT, no difference in the number of Neurog 1+ cells was observed between Neurog2 1/1 and WT embryos (Middle and right graphs in Figure 1C ). Importantly, the larger amount of Neurog1 + cells at E10.5 in Neurog2 1/1 compared to Neurog2 + cells in WT (Middle graph in Figure 1C ), indicates that exogenous Neurog1 is able to activate the endogenous Neurog1 locus, as Neurog2 normally does (Summarized in Figures 1M,N ; Ma et al., 1999 ; Venteo et al., 2019 ). In parallel, analyses on Neurog1 2/2 embryos between E10.5 and E13.5, revealed that the spatio-temporal profile and number of Neurog2 + cells were fully reminiscent of that of Neurog1 + cells in WT ( Figures 1D-F ). Notably, from E11.5 when the Neurog2 locus is normally turned off in WT ( Figure 1A ), expression of exogenous Neurog2 was still expectedly detected in the KI animals, as Neurog1 in WT ( Figures 1D,E ; Middle and right graphs in Figure 1F ; summarized in Figure 1O ). These results thus show that in Neurog2 1/1 and Neurog1 2/2 KI models, exogenous Neurog1 and Neurog2 are properly expressed (Summarized in Figures 1M-O ). Download figure Open in new tab Figure 1. Characterization and validation of Knock-In alleles of Neurog1 and Neurog2 A,B. Representative images of in situ hybridization for Neurog2 in WT (A) and for gfp in Neurog2 1/1 KI (B) embryos on transverse thoracic sections of the spinal cord at E9.5, E10.5 and E11.5, as indicated. Scale bars, 50µm. C. Quantitative analysis of the numbers of Neurog2 + cells in WT (dark blue columns), of gfp + cells in Neurog2 1/1 KI (green columns) and of Neurog1 + cells in WT (light blue columns) and Neurog2 1/1 (green-framed white columns) KI at E9.5, E10.5 and E11.5, as indicated. Data are represented as means ± SEM. D,E. Representative images of in situ hybridization for Neurog1 in WT (D) and for Neurog2 in Neurog1 2/2 (E) on transverse thoracic spinal cord or DRG sections at E10.5, E11.5, E12.5 and E13.5, as indicated. Scale bars, 50µm. F. Quantitative analysis of the numbers of Neurog1 + cells in WT DRG (light blue columns), and of Neurog2 + cells in Neurog1 2/2 (light brown columns) and WT DRG (dark blue columns) at E10.5, E11.5 and E12.5 as indicated. Data are represented as means ± SEM. G,H. Representative images of in situ hybridization for Neurog1 in 2 1neo/1neo ;Neurog1 -/- (G) and Neurog2 1/1 ;Neurog1 -/- (H) embryos on transverse thoracic spinal cord sections at E9.5 and E10.5, as indicated. Red arrowheads in G point to the coalescing DRG that abnormally express low levels of Neurog1 in E10.5 2 1neo/1neo ;Neurog1 -/- embryos. Scale bars, 50µm. I. Quantitative analysis of the numbers of Neurog2 + cells in the DRG of WT (dark blue columns) and Neurog1 -/- KO (orange columns), and of Neurog1 + cells in the DRG of 2 1neo/1neo ;Neurog1 -/- (striped dark green columns) and Neurog2 1/1 ;Neurog1 -/- (dark green columns) embryos at E9.5 and E10.5, as indicated. Data are represented as means ± SEM. ***p < 0.001. Blue asterisks indicate significant differences with WT. J,K. Representative images of in situ hybridization for Neurog2 in 1 2neo/2neo ;Neurog2 -/- (J) and Neurog1 2/2 ;Neurog2 -/- (K) embryos on transverse thoracic spinal cord or DRG sections at E11.5 and E12.5, as indicated. Scale bars, 50µm. L. Quantitative analysis of the numbers of Neurog1 + cells in the DRG of Neurog2 -/- KO (green columns), and of Neurog2 + cells in the DRG of 1 2neo/2neo ;Neurog2 -/- DRG (striped-dark brown columns) and Neurog1 2/2 ;Neurog2 -/- (dark brown columns) embryos at E11.5 and E12.5, as indicated. Data are represented as means ± SEM. ***p < 0.001. Green asterisks indicate significant differences with Neurog2 -/- KO. M-U. Schematic summary of the dynamic expression profiles of Neurog2 (green colors) and Neurog1 (orange colors) in migrating (oval frames) and/or post-migratory (rectangle frames) somatosensory progenitors in WT (M), Neurog2 1/1 (N), Neurog1 2/2 (O), Neurog1 -/- (P), 2 1neo/1neo ;Neurog1 -/- (Q), Neurog2 1/1 ;Neurog1 -/- (R), Neurog2 -/- (S), 1 2neo/2neo ;Neurog2 -/- (T) and Neurog1 2/2 ;Neurog2 -/- (U) embryos between E9.5 and E13.5. Red arrows in M,N,O illustrate the ability of earlier-expressed gene from the Neurog2 locus in regulating the onset of the later-expressed gene from the Neurog1 locus. Red crosses illustrate that when the endogenous Neurog2 locus is deleted, expression onset from the endogenous Neurog1 locus is impaired. Note that the PGK-neo cassette in the 2 1neo/1neo ;Neurog1 -/- (Q) and the 1 2neo/2neo ;Neurog2 -/- (T) models affects the activities of the Neurog2 and Neurog1 loci, respectively. During the course of this study, we noticed that in the 2 1neo and 1 2neo transgenic lines, the PGK-neo cassette perturbs the expression of the knocked-in genes. This effect was particularly evident in 2 1neo/1neo embryos, where the gfp reporter gene was induced at E9.5 but prematurely down-regulated by E10.5, one day earlier than Neurog2 in WT (Figures S3A,B). Surprisingly though, the number of Neurog1 + cells was essentially normal in these animals over time, including at E10.5 (Figures S3C,D). This likely reflects that transient expression of exogenous Neurog1 is sufficient to activate the endogenous Neurog1 locus which, in turn, maintains its own expression (Summarized in Figure S3E). Supporting this, analyses on 2 1neo/1neo ; Neurog1 -/- compound transgenic embryos in which the endogenous Neurog1 locus was additionally deleted, revealed that Neurog1 solely expressed from the Neurog2 locus was induced at E9.5, but became barely detectable by E10.5 ( Figures 1G,I ; summarized in Figure 1Q ). Importantly, this premature down-regulation of the Neurog2 locus was not observed in Neurog1 -/- single-KO or in Neurog2 1/1 ; Neurog1 -/- KI/KO animals ( Figures 1H,I ; summarized in Figures 1P,R ). In the same line, analyses of 1 2neo/2neo ;Neurog2 -/- compound transgenic embryos revealed that induction of exogenous Neurog2 from the Neurog1 locus was further delayed, and eventually occurred in fewer cells, compared to the endogenous Neurog1 in Neurog2 -/- single-KO ( Figures 1J,L ; summarized in Figures 1S,T ; Ma et al., 1999 ; Venteo et al., 2019 ). Importantly, these defects were not observed in Neurog1 2/2 ; Neurog2 -/- KI/KO embryos, although we noted a slight tendency towards a reduction in the number of Neurog2 + cells compared to that of Neurog1 + cells in Neurog2 -/- single-KO ( Figure 1K,L ; summarized in Figures 1S,U ; see below). These data thus establish that presence of the “ PGK-neo cassette” shortens the periods of activity of the Neurog2 and Neurog1 loci, albeit in strikingly opposite ways: in 2 1neo/1neo ; Neurog1 -/- embryos, it causes a premature down-regulation of the Neurog2 locus compared to WT or Neurog1 -/- single-KO ( Figures 1P,Q ), while in 1 2neo/2neo ;Neurog2 -/- animal, it triggers a delayed activation of the Neurog1 locus compared to Neurog2 -/- single-KO ( Figures 1S,T ). Altogether, these data validate the Neurog2 1/1 and Neurog1 2/2 single-KI lines, as well as the Neurog2 1/1 ;Neurog1 -/- and Neurog1 2/2 ;Neurog2 -/- KI/KO lines, as reliable and complementary models for evaluating the functional equivalence of Neurog1 and Neurog2 in the developing DRG ( Figures 1M,N ,O,R,U). They also fortuitously establish the 2 1neo/1neo ; Neurog1 -/- and the 1 2neo/2neo ;Neurog2 -/- compound transgenic lines as interesting tools for studying the consequences of temporal alterations of proneural genes expression in this structure, complementary to the Neurog1 -/- and Neurog2 -/- single-KO models ( Figures 1P,Q ,S,T). Proper Neurog2 locus activity, regardless of whether it encodes Neurog2 or Neurog1, is essential to repress the melanocyte fate in migrating somatosensory progenitors We next assessed the extent to which the defects observed in the developing DRG of Neurog2 -/- and Neurog1 -/- KO models are rescued in Neurog2 1/1 and Neurog1 2/2 KI models, respectively. We first focused on the specific requirement of Neurog2 in controlling survival and lineage commitment of NC-derived somatosensory progenitors at early developmental stages (Figure S1D; Ma et al., 1999 ; Soldatov et al., 2019 ; Venteo et al., 2019 ). To evaluate whether Neurog1 can replace Neurog2 in these processes, we performed a comparative time- course analysis of the Sox10 + somatosensory progenitor population between WT, Neurog2 -/- KO and Neurog2 1/1 KI animals, from E10.5 to E12.5. In line with previous findings, at E10.5, Neurog2 -/- KO exhibited an increased number of Sox10 + cells compared to WT ( Figure 2A ), due to delayed neurogenesis ( Venteo et al., 2019 ; see also Figures 3A-C ). However, from E11.5, this cell population was significantly depleted in these mutants ( Figures 2A,B ,B’), reflecting that pools of progenitors either undergo apoptosis ( Figures 2C,C ’) or switch fate toward the melanocyte lineage ( Figures 2D,E ; quantified in Figure 2N ; Venteo et al., 2019 ). Analysis of Neurog2 1/1 KI embryos showed that the number of Sox10 + progenitors in their DRG anlagen was strikingly similar to that of WT at all stages analyzed ( Figures 2A,B ,B’’). Consistent with this, no apoptotic figures at E10.75 ( Figure 2C ’’) and no supernumerary Mitf + melanoblasts at E11.5 ( Figures 2F,N ) were detected in these KI animals. These results thus show that Neurog1 can substitute for Neurog2 to preserve the integrity of somatosensory progenitors at early stages and, notably, that Neurog1 has the potential to inhibit the melanocyte fate, even though it is normally not necessary during this process ( Venteo et al., 2019 ). In addition, analysis of Neurog2 1/1 ; Neurog1 -/- KI;KO embryos established that only two copies of the Neurog1-CDS exclusively expressed from the Neurog2 locus are sufficient to prevent the formation of supernumerary melanoblasts ( Figures 2G,N ). In contrast, in Neurog1 2/2 ; Neurog2 -/- KI;KO embryos, re-expressing two copies of the Neurog2-CDS from the Neurog1 locus did not rescue the fate switch phenotype triggered by the loss of Neurog2 function ( Figures 2E,H ,N). These data thus show that, regardless of whether Neurog1 or Neurog2 protein is encoded, the specific activity of the Neurog2 locus is essential for inhibiting the melanocyte fate in a pool of somatosensory progenitors, while that of the Neurog1 locus is dispensable. Download figure Open in new tab Figure 2. Neurog1 can replace Neurog2 function to maintain somatosensory progenitors integrity and repress the melanocyte fate, albeit with slightly reduced efficiency A. Comparative quantitative time-course analysis of the number of Sox10 + somatosensory progenitors in WT, Neurog2 -/- ( 2 -/- ) and Neurog2 1/1 ( 2 1/1 ) embryos between E10.5 and E12.5. Data are represented as means ± SEM. *p < 0.05; **p< 0.01; ***p < 0.001. B-C’’. Representative images of in situ hybridization for Sox10 at E11.5 (B-B’’) or of immunofluorescent staining using an activated-Caspase3 (Caps3*) antibody at E10.75 (C-C’’) on transverse thoracic DRG sections of WT (B,C), Neurog2 -/- (B’,C’) and Neurog2 1/1 (B’’,C’’) embryos. Red dotted lines in C-C’’ delimit the DRG. Scale bars, 50µm. D-M. Representative images of in situ hybridization for Mitf at E11.5 on transverse thoracic sections of WT (D), Neurog2 -/- (E), Neurog2 1/1 (F), Neurog2 1/1 ; Neurog1 -/- (G), Neurog1 2/2 ; Neurog2 -/- (H), 2 neo1/neo1 (I), 2 neo1/neo1 ; Neurog1 -/- (J), Neurog2 +/- (K), Neurog2 1/- (L) and Neurog2 1/+ (M) embryos, showing the dorso-lateral migratory path of NCC. Scale bar, 50µm. N. Quantification of the number of Mitf + melanoblasts located in the NCC dorso-lateral migratory path of WT, Neurog2 -/- ( 2 -/- ), Neurog2 1/1 ( 2 1/1 ), Neurog2 1/1 ;Neurog1 -/- ( 2 1/1 ;1 -/- ), Neurog1 2/2 ; Neurog2 -/- (1 2/2 ; 2 -/- ), 2 1neo/1neo , 2 1neo1/1neo ; Neurog1 - /- (2 1neo1/1neo ;1 -/ - ), Neurog2 +/- ( 2 +/- ), Neurog2 1/- ( 2 1/- ) and Neurog2 1/+ ( 2 1/+ ) embryos at E11.5. Data are represented as means ± SEM. *p < 0.05; ***p < 0.001. Blue asterisks indicate significant differences with WT. Light green asterisk indicate significant differences between Neurog2 +/- and Neurog2 1/- embryos. O. Quantitative analysis of the level of Mitf expression assessed by RT-qPCR on B16F10 cell cultures after transfection of 1µg of a gfp -expression vector (blue columns) or after co- transfection of either 500ng or 200ng of a Neurog1 -expression vector (orange columns) or a Neurog2 -expression vector (green column) together with either 500ng or 800ng of the gfp - expression vector, respectively. Data are represented as means ± SEM. *p < 0.05; **p< 0.01; ***p < 0.001. Blue asterisks indicate significant differences with the control gfp condition, while the orange asterisk indicate significant differences between the Neurog1 and the Neurog2 conditions at 200ng. P. Quantification of the proportion of GFP+Mitf+ (Magenta columns) and GFP+Mitf- (Green columns) B16F10 cells after transfection of 1µg of a control GFP-expression vector, or after co-transfection of 800ng of the gfp-expression vector together with 200ng of expression vectors encoding either native Neurog1, native Neurog2, chimeric Neurog1-bHLH2 or chimeric Neurog2-bHLH1 proteins, as indicated. Data are represented as means ± SEM. *p < 0.05. Black asterisks indicate significant differences with the control GFP condition, while orange asterisks indicate significant differences with the “native Neurog1” condition. Q-U. Representative images of co-immunofluorescent staining using GFP (green) and Mitf (magenta) antibodies on B16F10 cells after transfection of control gfp vector alone (Q) or co- transfection of GFP and with expression vectors for either native Neurog1 (R), native Neurog2 (S), chimeric Neurog1-bHLHNeurog2 (T) or chimeric Neurog2-bHLHNeurog1 (U) proteins, as indicated on the graph. Blue arrowheads in S, T and U, point to GFP+Mitf- cells. Scale bar, 20µm. Download figure Open in new tab Figure 3. Neurog1 and Neurog2 are functionally interchangeable for controlling neurogenesis and fate specification in the developing DRG A,B. Quantitative time-course analysis of NeuroD + differentiating precursors between E10.5 and E14.5 (A) or of Scg10 + post-mitotic neurons between E10.5 and 13.5 (B) in WT (blue curves), Neurog2 -/- KO ( 2 -/- ; green curves) and Neurog2 1/1 ( 2 1/1 ; dark green curves). Data are represented as means ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001. Blue asterisks indicate significant differences with WT. Green asterisks indicate significant differences with 2 1/1 KI. C. Representative images of in situ hybridization for NeuroD and SCG10 on transverse spinal cord sections of WT, Neurog2 -/- and Neurog2 1/1 embryos at E10.5. Red arrowheads point to the coalescing DRG of Neurog2 -/- KO which are devoid of staining at this stage. Scale bar, 50µm. D,E. Quantitative time-course analysis of NeuroD + differentiating precursors between E10.5 and E14.5 (D) and of Scg10 + post-mitotic neurons between E10.5 and E13.5 (E) in WT (blue curves), Neurog1 -/- KO ( 1 -/- ; orange curves) and Neurog1 2/2 ( 1 2/2 ; brown curves). Data are represented as means ± SEM. **p < 0.01; ***p < 0.001. Blue asterisks indicate significant differences with WT. Brown asterisks indicate significant differences with 1 2/2 KI. F. Representative images of in situ hybridization for NeuroD and Scg10 on transverse DRG sections of WT, Neurog1 -/- KO and Neurog1 2/2 embryos at E12.5. The red dotted line delimits the DRG of Neurog1 -/- KO which are devoid of NeuroD staining at this stage. Scale bar, 50µm. G. Relative quantification of TrkB+, TrkC+ and TrkA+ neuronal precursors in the DRG of WT (blue columns), Neurog1 2/2 KI ( 1 2/2 ; brown columns) and Neurog2 1/1 ( 2 1/1 , green columns) at E13.5. Data are represented as means ± SEM. H. Relative quantification of TrkB +, MafA +, TrkC +/PV- ( TrkC *) and PV+ mechano/proprioceptive subtypes, and MrgprD +, Cgrp +, TrpV1 + and TrpM8 + thermo/nociceptive subtypes in WT (blue columns), Neurog1 2/2 KI ( 1 2/2 ; brown columns) and Neurog2 1/1 ( 2 1/1 , green columns) at E18.5. Data are represented as means ± SEM. I. Graphic summaries showing the distribution of each neuronal subtype analyzed in this study: the TrkB +, MafA +, TrkC +/PV- ( TrkC *) and PV+ mechano/proprioceptors (blue colors) and the MrgprD +, CGRP +, TrpV1 + and TpM8 + thermo/nociceptors (reddish colors) in WT, Neurog2 1/1 and Neurog1 2/2 embryos at E18.5. Numbers inside the graphics indicate the percentage of each neuronal subtypes. Blue and red numbers outside the graphics indicate the relative proportions of mechano/proprioceptors vs. thermo/nociceptors, respectively. Between E9.5 and E11, expression of Neurog1 and Neurog2 largely overlap. Yet, Neurog2 is uniquely induced in migrating somatosensory progenitors ( Ma et al., 1999 ), suggesting that proper activity of the Neurog2 locus in this cell population is critical during this process. To test this hypothesis, we took advantage of the 2 1neo1/1neo transgenic model in which the Neurog2 locus is correctly activated at E9.5 but prematurely turned off by E10.5, while the activity of the Neurog1 locus in post-migratory progenitors remains largely unaffected (Figure S3E). In these transgenic embryos, we found a significant increase in the number of Mitf + melanoblasts compared to WT, strikingly similar to that observed in Neurog2 -/- KO ( Figures 2D,E ,I,N). An identical phenotype was also observed in 2 1neo1/1neo ; Neurog1 -/- compound transgenic models ( Figures 2J,N ), further illustrating that the Neurog1 locus activity is not required. These results thus establish that precise spatiotemporal regulation of the Neurog2 locus activity in migrating progenitors is essential for committing them to the somatosensory lineage and preventing their differentiation into melanoblasts. Neurog1 is slightly less effective than Neurog2 in inhibiting a melanocyte identity in vivo and in vitro During the course of this study, we uncovered a dose-dependent requirement for Neurog2 in repressing the melanocyte identity. Indeed, in E11.5 Neurog2 +/- heterozygous embryos, we detected a higher number of Mitf + melanoblasts compared to WT, which nevertheless remained far below that of Neurog2 -/- homozygous mutants ( Figures 2D,E ,K,N). This prompted us to also analyze Neurog2 1/- hemizygous animals in which one copy of the endogenous Neurog2-CDS is replaced by the Neurog1-CDS , while the other copy is deleted. In this model, we found a significant increase in the number of melanoblasts, not only compared to WT but also compared to Neurog2 +/- heterozygous embryos ( Figures 2D,E ,K,L,N). In contrast, in Neurog2 1/+ heterozygous KI animals in which one copy of the Neurog2-CDS and one copy of the Neurog1- CDS are expressed from the endogenous Neurog2 loci, no supernumerary melanoblasts were detected ( Figures 2M,N ). These findings illustrate that, beyond its spatiotemporal regulation, the level of activity of the Neurog2 locus is also a key parameter. Importantly, they also provide evidence that Neurog1 is slightly less efficient than Neurog2 in repressing the melanocyte fate, revealing subtle functional differences between the two TFs. To gain further insights into this observation, we conducted in vitro analyses using the B16F10 melanoma cell line. We first transfected varying concentrations of Neurog1 or Neurog2 expression vectors and quantified the amount of MitF mRNA by RT-qPCR 24h later. We found that at a concentration of 500ng/µl, Neurog1 and Neurog2 were equally able to significantly reduce MitF expression, while at a lower concentration of 200ng/µl, only Neurog2 was efficient in triggering such down-regulation ( Figure 2O ). To refine this analysis, we co-transfected a gfp -vector with either the Neurog1 -vector or the Neurog2 -vector at a concentration of 200ng/µl and quantified the proportion of GPF+ cells that were Mitf+ or Mitf-negative (-). At this concentration, we found that Neurog2 , but not Neurog1 , was able to significantly decrease the proportion of GFP+/Mitf+ cells compared to the control condition ( Figure 2P-S ). These data show that both Neurog1 and Neurog2 can down-regulate Mitf in vitro . They also confirm that Neurog1 is not as efficient as Neurog2 during this process. Although Neurog1 and Neurog2 are considered as close paralogous TFs, their bHLH domains are not identical, and their N- and C-terminus domains are highly divergent (Figure S2A; Hand et al., 2005 ). This prompted us to investigate whether the functional discrepancies between the two TFs stem from divergences in their bHLH domains and/or in other regions of the proteins. To test this, we designed chimeric versions of Neurog1 and Neurog2 with swapped bHLH domains (Figure S2B), and overexpressed them at a concentration of 200ng/µl in B16F10 cells. Strikingly, we found that the Neurog1-bHLH2 chimera was as efficient as the native Neurog2 protein to decrease the proportion of GFP+Mitf+ cells, compared to the control or “native Neurog1” conditions ( Figures 2P,Q ,S,T). Nevertheless, the Neurog2-bHLH1 chimera had also a significant, albeit milder, effect ( Figure 2P,Q ,U). These results thus support that the slight functional differences between Neurog1 and Neurog2 in repressing the melanocyte identity are primarily due to divergences in their bHLH sequences, although contribution of other domains cannot be ruled out. Four copies of either Neurog1-CDS or Neurog2-CDS ensure proper neurogenesis and fate specification in the developing DRG Neurog1 and Neurog2 act in a combinatorial manner to regulate the successive waves of DRG neurogenesis which generate specific neuron numbers and functional classes (Figure S1A; Ma et al., 1999 , Ohayon et al., 2015 ; Venteo et al., 2019 ; Vermeiren et al., 2020 ). We thus investigated whether exchanging the Neurog1 -CDS and the Neurog2- CDS in Neurog1 2/2 and Neurog2 1/1 KI models might affect the number and identities of the neurons generated or, conversely, ensure proper DRG development and rescue the defects of Neurog1 -/- and Neurog2 -/- KO models. First, we monitored neurogenesis through time course analyses of NeuroD and SCG10 expression between E10.5 and E13.5, which identify differentiating precursors and newly born post-mitotic neurons, respectively. On one hand, in Neurog2 1/1 KI embryos we found that neurogenesis was initiated on time, as evidenced by normal numbers of NeuroD + and SCG10 + precursors at E10.5, in contrast to the delay observed in the Neurog2 -/- KO ( Figures 3A-C ; Ma et al., 1999 ; Venteo et al., 2019 ). Furthermore, the rate of neurogenesis over time in the KI was strikingly similar to WT, leading to the production of accurate numbers of neurons at E13.5, which contrasted with the 30% deficit reported in Neurog2 -/- KO ( Figures 3A,B ; Venteo et al., 2019 ). On the other hand, in Neurog1 2/2 KI embryos, neurogenesis also proceeded normally over time and at E13.5 their DRG contained appropriate neuron numbers ( Figures 3D,E ). This differed markedly from the premature arrest of neurogenesis at E11.5 and the resulting 80% neuronal deficit observed in the Neurog1 -/- KO ( Figures 3D,E ; Ma et al., 1999 ; Ohayon et al., 2015 ). Notably, at E12.5 when no NeuroD + differentiating precursors and fewer SCG10 + neurons were detected in Neurog1 -/- KO, both populations were clearly present in Neurog1 2/2 KI embryos, as in WT ( Figure 3F ). These data thus show that four copies of either the Neurog1 -CDS or Neurog2 -CDS faithfully control the successive waves of neurogenesis and rescue the defects caused by Neurog1 or Neurog2 loss of function. They also indicate that Neurog1 and Neurog2 do not directly and differentially regulate the number of neurons generated from the different NC-derived somatosensory progenitor populations ( Frank and Sanes, 1991 ; Marmigere et al., 2007; Ohayon et al., 2015 ). Next, we assessed the identities of the somatosensory neurons generated in the Neurog1 2/2 and Neurog2 1/1 KI models. We primarily focused on E13.5, at the end of DRG neurogenesis, and E18.5, at the end of embryogenesis, as Neurog1 -/- and Neurog2 -/- KO models die around birth. At E13.5, we classically used the tyrosine kinase receptor TrkA to identify thermo/nociceptive precursors, and TrkB and TrkC to identify mechano/proprioceptive precursors. At E18.5, although neuronal diversification and maturation are still ongoing, the expression of several molecular markers already identify specific subtypes within each functional class. Those include TrkB , TrkC and MafA for mechanoceptors, TrkC and Parvalbumin (PV) for proprioceptors, and MrgprD , TrpV1 , TrpM8 or Cgrp for Thermo/Nociceptors ( Lallemend and Ernfors, 2012 ; Usoskin et al., 2015 ; Sharma et al., 2020 ; Cranfill & Luo, 2021 ). Analysis of this set of markers in Neurog1 2/2 and Neurog2 1/1 KI animals revealed that all somatosensory neuron subtypes were present in normal numbers compared to controls at both E13.5 ( Figure 3G ) and E18.5 ( Figure 3H ). Notably, while Neurog1 is necessary to generate most thermo/nociceptors (Figures S1B; see also Figures 4D,F ,G; Ma et al., 1999 ; Ohayon et al., 2015 ), its sole expression in Neurog2 1/1 KI embryos was not sufficient to trigger the overproduction of this neuronal class. Accordingly, in both KI models the relative distribution of each neuron subtype as well as the overall proportions of Mechano/Proprioceptors versus Thermo/Nociceptors were fully comparable to WT ( Figure 3I ). These results thus show that four copies of either the Neurog1 or Neurog2 CDS can efficiently support the differentiation of all DRG neuron subtypes, establishing that both paralogous TFs do not preferentially specify distinct neuronal identities. Download figure Open in new tab Figure 4. Specific combinations of KI and KO alleles uncover subtle functional differences between Neurog1 and Neurog2 during DRG neuron differentiation A,B. Quantitative time-course analysis of NeuroD + differentiating precursors between E10.5 and E14.5 (A) and Scg10 + post-mitotic neurons between E10.5 and 13.5 (B) in Neurog1 -/- KO ( 1 -/- ; orange curves) and Neurog2 1/1 ; Neurog1 -/- KI;KO models ( 2 1/1 ; 1 -/- dark green curves) showing no significant difference between the two genotypes over time. Data are represented as means ± SEM. C,D. Relative quantification of Scg10 + (C) and TrkB+, TrkC+ and TrkA+ (D) neuronal precursors in the DRG of WT (blue columns), Neurog1 -/- KO (orange columns) and Neurog2 1/1 ; Neurog1 -/- KI;KO ( 2 1/1 ; 1 -/- dark green columns) embryos at E13.5. Data are represented as means ± SEM. *p < 0.05; ***p < 0.001. Blue asterisks indicate significant differences with WT. Orange asterisks indicate significant differences with Neurog1 -/- KO. E. Relative quantification of the TrkB +, MafA +, TrkC +/PV- ( TrkC* ) and PV+ mechano/proprioceptive subtypes in WT (blue columns), Neurog1 -/- KO (orange columns) and Neurog2 1/1 ; Neurog1 -/- KI;KO ( 2 1/1 ; 1 -/- dark green columns) embryos at E18.5. Data are represented as means ± SEM. F. Quantification of the numbers of MrgprD +, Cgrp +, TrpV1 + and TrpM8 + thermo/nociceptive subtypes, reported by hemi-section, in WT (blue columns), Neurog1 -/- KO (orange columns) and Neurog2 1/1 ; Neurog1 -/- KI;KO ( 2 1/1 ; 1 -/- dark green columns) embryos at E18.5. Data are represented as means ± SEM. *p < 0.05; ***p < 0.001. Blue asterisks indicate significant differences with WT. Orange asterisks indicate significant differences with Neurog1 -/- KO. G. Illustrative images of in situ hybridization for MrgprD , Cgrp , TrpV1 and TrpM8 on transverse DRG sections of Neurog1 -/- KO and Neurog2 1/1 ; Neurog1 -/- KI;KO embryos at E18.5. Scale bar, 50µm. H,I. Quantitative time-course analysis of NeuroD + differentiating precursors between E10.5 and E14.5 (A) and of Scg10 + post-mitotic neurons between E10.5 and 13.5 (B) in Neurog2 -/- KO ( 2 -/- ; green curves) and Neurog1 2/2 ; Neurog2 -/- KI;KO embryos ( 1 2/2 ; 2 -/- dark brown curves) revealing exacerbated neurogenesis defects at E11.5 and E12.5 in the KI;KO model. Data are represented as means ± SEM. *p < 0.05; ***p < 0.001. Green asterisks indicate significant differences with Neurog2 -/- KO. J,K. Relative quantification of Scg10 + (J) and TrkB+, TrkC+ and TrkA+ (K) neuronal precursors in the DRG of WT (blue columns), Neurog2 -/- KO (green columns) and Neurog1 2/2 ; Neurog2 -/- KI;KO ( 1 2/2 ; 2 -/- dark brown columns) embryos at E13.5. Data are represented as means ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001. Blue asterisks indicate significant differences with WT. Green asterisks indicate significant differences with Neurog2 -/- KO. L,M . Relative quantification of TrkB +, MafA +, TrkC +/PV- ( TrkC* ) and PV+ mechano/proprioceptive subtypes (L) and MrgprD +, Cgrp +, TrpV1 + and TrpM8 + thermo/nociceptive (M) subtypes in WT (blue columns), Neurog2 -/- KO ( 2 -/- ; green columns) and Neurog1 2/2 ; Neurog2 -/- KI;KO ( 1 2/2 ; 2 -/- dark brown columns) embryos at E18.5. Data are represented as means ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001. Blue asterisks indicate significant differences with WT. Green asterisks indicate significant differences with Neurog2 -/- KO. N. Illustrative images of in situ hybridization for TrkB , MafA , TrkC and MrgprD , or immunostaining for PV, on transverse DRG sections of Neurog2 -/- KO and Neurog1 2/2 ; Neurog2 -/- KI;KO embryos at E18.5 showing reduced numbers of positive neurons for all these markers in the KI;KO model compared to KO. Scale bar, 50µm. O,P. Graphic summaries showing the distribution of the TrkB +, MafA +, TrkC +/PV- ( TrkC* ) and PV+ mechano/proprioceptive subtypes (blue colors) and the MrgprD +, CGRP +, TrpV1 + and TpM8 + thermo/nociceptive subtypes (reddish colors) in the DRG of Neurog1 -/- KO and Neurog2 1/1 ; Neurog1 -/- KI;KO embryos (O), and of Neurog2 -/- KO and Neurog1 2/2 ; Neurog2 -/- KI;KO embryos (P) at E18.5. Numbers inside the graphics indicate the percentage of each neuronal subtypes. Blue and red numbers outside the graphics indicate the relative proportions of mechano/proprioceptors vs. thermo/nociceptors in each model, respectively. Note that the neuronal distribution between the KO and the corresponding KI;KO models are changed. Taken altogether, these data show that in the developing DRG, Neurog1 and Neurog2 are essentially functionally interchangeable during the processes of neurogenesis and fate specification, further illustrating that their apparent functional specificities primarily stem from differences in their spatio-temporal expression profiles. Combinations of KI and KO alleles reveal s ubtle functional differences between Neurog1 and Neurog2 in DRG neuron development To complement this study, we analyzed Neurog2 1/1 ; Neurog1 -/- and Neurog1 2/2 ; Neurog2 -/- KI;KO in comparison to Neurog1 -/- KO and Neurog2 -/- KO embryos, respectively. These models all express only two copies of the Neurog1-CDS or the Neurog2 -CDS, either from the endogenous loci in the KO ( Figures 1P,S ) or from the counterpart loci in the KI;KO ( Figures 1R,U ). In the light of the melanocyte data, we aimed to uncover potential functional divergences between the two TFs that might be masked in single-KI models, considering the transient overlapping activities of the Neurog1 and Neurog2 gene loci between E9.5 and E11.5 ( Figures 1M-O and S1A). On one hand, comparative time course analysis of NeuroD and Scg10 expression between Neurog2 1/1 ; Neurog1 -/- KI;KO and Neurog1 -/- KO embryos showed that the timing and rate of neurogenesis over time were similar in both models, with a normal onset at E9.5 but a premature end at E11.5 ( Figures 4A,B ; Ma et al.1999 ; Ohayon et al., 2015 ). As a result, at E13.5, the overall number of Scg10 + neurons was equally reduced by approximately 80% in both models compared to controls ( Figures 4B,C and S4A). Analyses of neuron identities at E13.5 revealed a relatively mild reduction of the numbers of TrkB+ and TrkC+ mechano/proprioceptive precursors in both KI;KO and KO embryos compared to WT ( Figures 4D and S4A), which was, however, no longer evident at E18.5 ( Figures 4E and S4B). In contrast, the number of TrkA+ thermo/nociceptive precursors at E13.5 was drastically reduced by 93% in the Neurog1 -/- KO and by 86% in the Neurog2 1/1 ; Neurog1 -/- KI;KO embryos, compared to WT ( Figures 4D and S4A). Strikingly, this depletion was significantly less severe in the KI;KO than in the single-KO ( Figure 4D ), a result also observed at E18.5. At this stage, in Neurog1 -/- single-KO embryos (n=5), virtually no MrgprD + (0/5) or TrpV1 + (0/5), and only few, if any, TrpM8 + (1/5) neurons were present ( Figures 4F,G ). The only remaining thermo/nociceptors in the KO were Cgrp + ( Figures 4F,G ) and likely derived from the first neurogenic wave (Figure S1B; Bachy et al., 2011 ; Lallemend and Ernfors, 2012 ). In contrast, in Neurog2 1/1 ; Neurog1 -/- KI;KO embryos (n=6), we systematically detected few MrgprD + (5/6), TrpV1 + (6/6) and TrpM8 + (5/6) neurons, as well as a significant increase of the Cgrp + population (6/6) compared to Neurog1 -/- KO ( Figure 4F,G ). Consequently, the relative distribution of neuron subtypes and the proportions of mechano/proprioceptors versus thermo/nociceptors differed between the KI;KO and KO models ( Figure 4O ). This phenotypic difference remains relatively marginal, affecting only 3% of the entire DRG population, and the underlying mechanism remains unclear. It may reflect the ability of Neurog1 to impose a thermo/nociceptive identity on a small subset of progenitors that would normally generate mechano/proprioceptors under the control of Neurog2 , although no difference in the latter population was observed between the KI;KO and KO models (see Figures 4D,E ). Alternatively, it may result from a slight temporal shift of neurogenesis in the KI;KO compared to the KO which may influence neuron subtype specification (see below). In any case, these data highlight subtle functional differences between Neurog1 and Neurog2 in regulating DRG neuron differentiation. On the other hand, comparative studies of Neurog1 2/2 ; Neurog2 -/- KI;KO and Neurog2 -/- KO models led to similar observations. Time course analysis of NeuroD and Scg10 expression showed that onset of neurogenesis was delayed by 24 hours in both models, beginning after E10.5 instead of E9.5 ( Figures 4H,I ; Ma et al., 1999 ; Venteo et al., 2019 ). Once initiated, however, we found that neurogenesis proceeded at a lower rate in the KI;KO compared to KO embryos, notably between E11.5 and E12.5 ( Figure 4H ). Consequently, Scg10 + post-mitotic precursors accumulated in fewer numbers in Neurog1 2/2 ; Neurog2 -/- KI;KO embryos over time ( Figure 4I ), leading to an overall neuronal depletion at E13.5 of approximately 20% compared to Neurog2 -/- KO, and 50% compared to WT ( Figures 4J and S4C). In addition, analysis of the neuronal identities at E13.5 showed a decrease of all neuronal classes in the KI;KO compared to the KO, albeit more pronounced for the TrkB+ and TrkC+ mechano/proprioceptive precursors than the TrkA+ thermo/nociceptive precursors ( Figures 4K and S4C), a result also confirmed at E18.5. At this stage, the depletion of all mechano/proprioceptive subtypes reported in the Neurog2 -/- KO, was exacerbated in the Neurog1 2/2 ; Neurog2 -/- KI;KO embryos, although we noticed that the TrkB +, MafA +, TrkC + mechanoceptors appeared slightly more affected than the PV+ proprioceptors ( Figures 4L,N ). In the same line, if all thermo/nociceptive subtypes showed at least a tendency to decrease in the KI;KO compared to the KO, the MrgprD + population appeared particularly more impacted ( Figures 4M,N and S4D). As a consequence, the distribution of neuron subtypes, as well as the relative proportions of mechano/proprioceptors versus thermo/nociceptors, were altered in the Neurog1 2/2 ; Neurog2 -/- KI;KO compared to the Neurog2 -/- KO, with a stronger impact on the mechano/proprioceptive class ( Figure 4P ). Taken together, these findings uncover subtle functional discrepancies between the Neurog1 and Neurog2 proteins in regulating DRG neurogenesis which are, however, masked by dose- compensation effects, as no neuronal defects were detected in Neurog2 1/1 and Neurog1 2/2 single-KI models (see Figure 3 ). Mechano/Proprioceptive and Thermo/nociceptive subtypes are preferentially born during distinct developmental time-windows The fact that Neurog1 and Neurog2 are essentially functionally interchangeable in controlling fate specification in the forming DRG notably indicates that Neurog1 is not uniquely involved in specifying the thermo/nociceptive identity. Therefore, the specific loss of the vast majority of this neuronal class in Neurog1 -/- KO, which correlates with impaired neurogenesis from E11.5 ( Figures 4 and S1B), implies that mechano/proprioceptors and thermo/nociceptors are primarily born during distinct developmental periods. Previous birth-dating studies have indeed reported successive peaks of birth for both neuronal classes ( Lawson and Biscoe, 1979 ; Kitao et al., 1996 ). However, this view has been challenged by a more recent study suggesting that many thermo/nociceptors are already generated at E10.5, concurrently with mechano/proprioceptors ( Landy et al., 2021 ). These contradictory outcomes prompted us to conduct a new series of birth-dating experiments. To do so, we injected BrdU into pregnant mice at E8.5, E9.5, E10.5, E11.5, E12.5, E13.5 or E14.5, harvested the embryos at E18.5 (for consistency with analyses on KO and KI models), and performed double-labeling experiments using BrdU with either TrkB , TrkC , MafA , PV, MrgprD , Cgrp , TrpV1 or TrpM8 as subtypes markers, or with Scg10 as a pan-neuronal marker (Figure S5A). As a prerequisite, we ensured that all “Marker X+” (X+) populations analyzed were properly represented in our experimental paradigm, by verifying that the distribution of each X+/BrdU+ subtype relative to the total number of Scg10 +/BrdU+ neurons across all experiments was comparable to the normal distribution of each X+ subtype relative to the total number of Scg10 + DRG neurons in E18.5 WT embryos (Figure S5B). We then evaluated the global temporal pattern of neuron production by determining the proportion of Scg10+ BrdU+ neurons after each BrdU injection, relative to the total number of Scg10 +BrdU+ neurons counted across all experiments. As expected, we found that DRG neuron differentiation began at E9.5, peaked between E11.5 and E12.5, and ended after E13.5 ( Figure 5A ). We also confirmed that at E9.5- E11.5 and E11.5-E13.5, encompassing the two main neurogenic phases, approximately 25% and 75% of neurons were generated, respectively ( Figure 5A ; summarized in 5F). Next, we assessed the birth of the different mechano/proprioceptive and thermo/nociceptive subtypes over time. Given the variable size of each population, we first determined the raw number of each X+BrdU+ subtypeat E18.5 after each BrdU injection ( Figures 5B ). Using this specific combination of molecular markers, we observed that although most neuronal subtypes were continuously born between E9.5 and E13.5, mechano/proprioceptors were preferentially generated at E9.5 and E10.5, while thermo/nociceptors were predominantly born between E11.5 and E13.5 ( Figure 5B ). Accordingly, by separately grouping mechano/proprioceptors and thermo/nociceptors and assessing their relative proportions at each time point, we found that 93% and 76% of the neurons generated at E9.5 and E10.5, respectively, were mechano/proprioceptors, whereas approximately 95% of the neurons produced at each time point from E11.5 were thermo/nociceptors ( Figure 5C ; summarized in 5F). Next, we assessed the birth rate of each X+ subtype over time by analyzing the percentage of X+BrdU+ neurons after each BrdU injection, relative to the total number of X+BrdU+ neurons across all experiments. Thereby, we found that all subtypes within a given class exhibited a similar peak of birth: between E10.5 and E11.5 for mechano/proprioceptors and between E11.5 and E12.5 for thermo/nociceptors ( Figure 5D ). Furthermore, by separately grouping each neuronal class, we determined that about 85% of the mechano/proprioceptors were born between E9.5 and E11.5, while 95% of the thermo/nociceptors were born between E11.5 and E13.5 ( Figure 5E ; summarized in 5F). Download figure Open in new tab Figure 5. Mechano/proprioceptive and thermo/nociceptive subtypes are preferentially born during successive developmental periods A. Quantification of the proportion of Scg10 + neurons born at each stage between E8.5 and E14.5, showing that: (i) DRG neurogenesis proceeds between E9.5 and E13.5; (ii) the peak of DRG neuron production occurs between E11.5 and E12.5; and (iii) during the two main neurogenic waves of the DRG, at E9.5-E11.5 and E11.5-E13.5, approximately 25% and 75% of the DRG neurons are produced, respectively. Data are represented as means ± SEM. B. Numbers of TrkB +/BrdU+, MafA +/BrdU+, TrkC +/BrdU+, PV+/BrdU+, MrgprD +/BrdU+, Cgrp +/BrdU+, TrpV1 +/BrdU+ and TrpM8 +/BrdU+ (globally referred to as X+/BrdU+) neurons at E18.5, reported by hemisection, after each BrdU injection between at E9.5 and E13.5, as indicated. This shows that although all subtypes are produced continuously over time, all mechano/proprioceptors (blue bars) and all thermo/nociceptors (reddish bars) are predominantly produced during distinct periods. C. Relative proportions of mechano/proprioceptors (MP, blue curve) vs. thermo/nociceptors (TN, red curve) generated at each stage between E9.5 and E13.5. Data are represented as means ± SEM. D. Quantitative analysis of the birth rate of each X+ subtype over time, determined by calculating the proportions of X+BrdU+ neurons at E18.5 after each BrdU injection between E9.5 and E13.5, relative to the total number of X+BrdU+ neurons across all experiments. This shows that all analyzed mechano/proprioceptive subtypes (blue curves) and thermo/nociceptive subtypes (reddish curves) exhibit successive peaks of birth: E10.5-E11.5 for the former and E11.5-E12.5 for the latter. Data are represented as means ± SEM. E. Proportions (i) of mechano/proprioceptors generated at each stage between E9.5 and E13.5, relative to the whole population of mechano/proprioceptors (blue curve), and (ii) of thermo/nociceptors generated at each stage relative to the whole population of thermo/nociceptors. This further that each class of neurons exhibit successive birth peaks and establishes that approximately 85% of mechano/proprioceptors are born before E11.5, whereas 93% of thermo/nociceptors are born after E11.5. Data are represented as means ± SEM. F. Summary of the birth dating data. The graph illustrates the proportions of mechano/proprioceptors (MP, blue columns and numbers) and thermo/nociceptors (TN, red columns and numbers) generated at each stage between E9.5 and E13.5, relative to the total numbers of Scg10 + DRG neurons at E18.5. The table below recapitulates the percentages of Scg10 + neurons (see A), of mechano/proprioceptors (MP; see E) and of thermo/nociceptors (TN; see E) born at each stage between E9.5 and E13.5 relative to the whole Scg10 + population, MP population and TN population, respectively. Altogether, these data establish that the majority of the mechano/proprioceptive and thermo/nociceptive subtypes are preferentially born during successive developmental periods. It is of note that this analysis excluded some subtypes, notably the population of C-fiber low threshold mechanoceptors known to emerge from the thermo/nociceptive lineage ( Lou et al., 2013 ; Vermeiren et al. 2021), and are likely born later than the “classical” mechanoceptors assessed here (see Landy et al., 2021 ). However, despite this drawback, our findings are fully consistent with previous studies supporting that the successive neurogenic waves in the DRG generate 20% and 80% of the DRG neurons, mainly mechano/proprioceptors and thermo/nociceptors, respectively (Figure S1A; Lawson and Biscoe, 1979 ; Kitao et al., 1996 ; Ma et al., 1999 ; Marmigere et al., 2007; Lallemend and Ernfors; 2012; Ohayon et al., 2015 ; Vermeiren et al., 2021). Defined alterations of neurogenesis predictably alter DRG content, highlighting the critical influence of differentiation timing in biasing neuronal fates Birth-dating and functional studies notably on Neurog1 -/- KO, Neurog2 -/- KO and Neurog1 2/2 ;Neurog2 -/- KI;KO models suggest a strong correlation between the timing and rate of differentiation and the identities and numbers of somatosensory neurons generated. This prompted us to assess whether defined alterations of neurogenesis can have predictable consequences on the DRG content. To address this issue, we first retrospectively analyzed Neurog1 -/- KO , Neurog2 -/- KO and Neurog1 1/1 ;Neurog2 -/- KI;KO which exhibit distinct and specific neurogenic defects (see Figure 4 ). In these models, we determined the ratio of neurogenesis at each stage between E9.5 and 13.5 relative to WT (set to 1), by calculating the relative number of neurons produced over time compared to control embryos ( Figure 6A ). Based on these ratios and the birth-dating quantifications summarized in the table of Figure 5F , we estimated for each model the proportions of overall Scg10 + neurons, of mechano/proprioceptors (MP) and of thermo/nociceptors (TN) generated at each stage and, in turn, the relative numbers of each neuronal population predicted to ultimately reside in their DRG compared to controls ( Figure 6B-D ). Particularly for the Neurog2 -/- KO and Neurog1 1/1 ;Neurog2 -/- KI;KO models, experimental data collected at E18.5 strikingly matched the predicted decreases in the numbers of overall Scg10 + neurons (29.9% vs. 33.5% and 51.8% vs. 54.5%, respectively), of thermo/nociceptors (37.3% vs. 50.3%, and 70.5% vs. 72.4%, respectively) and of mechano/proprioceptors (24.8% vs. 29% and 47.8% vs. 49.8%, respectively) ( Figures 6B-C ’). In Neurog1 -/- KO, the drastic reduction in the numbers of overall Scg10 + neurons and thermo/nociceptors at E18.5 also closely aligned with the predictions (76% vs. 77.1% and 98% vs. 92%, respectively) ( Figure 6D,D ’). Intriguingly, however, the mechano/proprioceptive class, expected to be reduced by 27% in these mutants, were largely unaffected ( Figure 6D,D ’), although they were significantly decreased by 17% at E13.5 (see Figure 4D ; brackets in Figure 6D ’). The reasons for this phenotypic differences between the two stages remain unclear, but they may reflect: (i) a normalization effect of the naturally occurring cell death, (ii) a compensatory mechanism possibly involving an identity switch of a small population of thermo/nociceptive precursors toward the mechano/proprioceptive fate, and/or (iii) more dynamic neurogenic defects than reported so far. Nonetheless, aside from this exception, experimental data from these transgenic models generally aligned well with the predictions, establishing a close link between timing and rate of neurogenesis and DRG content (Summarized in Figures 7A-D ). Download figure Open in new tab Figure 6. Defined alterations of the rate and timing of neurogenesis have predictable consequences on DRG content. A. Rate of neurogenesis at each stage between E9.5 and E13.5 in Neurog1 -/- ( 1 -/- ; orange curve), Neurog2 -/- ( 2 -/- ; green curve) and Neurog1 2/2 ;Neurog2 -/- ( 1 2/2 ;2 -/- ; dark brown curve) models, relative to WT (set at 1; blue curve). Data are represented as means ± SEM. *p < 0.05; **p < 0.01; ***p < 0.001. Blue asterisks indicate significant differences with WT. Green asterisks indicate significant differences between Neurog1 2/2 ;Neurog2 -/- KI;KO and Neurog2 -/- KO. For each model, the mean ratios of neurogenesis over time are indicated below. B-D. Proportions of Scg10 + neurons, mechano/proprioceptors (MP neurons), or thermo/nociceptors (TN neurons), predicted to be generated at each stage between E9.5 and E13.5 in Neurog2 -/- ( 2 -/- ) (B), Neurog1 2/2 ;Neurog2 -/- ( 1 2/2 ;2 -/- ) (C) and Neurog1 -/- ( 1 -/- ) (D) models. This was calculated based on the neurogenic ratios determined in Figure 6A and on the birth-dating data shown in the table of Figure 5F . Adding the predicted numbers from all stages provided an estimation of the overall numbers of Scg10 + neurons, mechano/proprioceptors, and thermo/nociceptors in each model, relative to WT (set at 100%). B’-D’. Experimentally determined numbers of Scg10 + neurons, mechano/proprioceptors (MP neurons) and thermo/nociceptors (TN neurons) in the DRG of Neurog2 -/- ( 2 -/- ) (B’), Neurog1 2/2 ;Neurog2 -/- ( 1 2/2 ;2 -/- ) (C’) and Neurog1 -/- ( 1 -/- ) (D’) embryos at E18.5 relative to WT, revealing a striking match with the predictions. The only exception concerned the mechano/proprioceptive population in Neurog1 -/- KO (D’), although this population was reduced at E13.5 (number in brackets in D’). E. Ratio of neurogenesis at each stage between E9.5 and E13.5 in 2 1neo/1neo ;Neurog1 -/- ( 2 1neo/1neo ;1 -/- ; dark green curve) and 1 2neo/2neo ;Neurog2 -/- ( 1 2neo/2neo ;2 -/- : dark brown curve) models, relative to WT (set to 1; blue curve), showing opposite temporal shifts and reduced neurogenic rates over time in both models compared to WT. Data are represented as means ± SEM. ***p < 0.001. Blue asterisks indicate significant differences with WT. For each model, the mean ratios of neurogenesis over time are indicated below. F,G. Relative numbers of Scg10 + neurons, mechano/proprioceptors (MP neurons), and thermo/nociceptors (TN neurons), predicted to reside in the DRG of 2 1neo/1neo ;Neurog1 -/- (F) and 1 2neo/2neo ;Neurog2 -/- (G) transgenic models, compared to WT. See text for details. F’,G’. Experimentally determined numbers of Scg10 + neurons, mechano/proprioceptors (MP neurons), and thermo/nociceptors (TN neurons), in 2 1neo/1neo ;Neurog1 -/- (D) and 1 2neo/2neo ;Neurog2 -/- (E) embryos at E18.5, relative to WT. H-J. Relative numbers of Scg10 + neurons (H), thermos/nociceptors (I) and mechano/proprioceptors (J) in WT (set at 100%; blue columns) 2 1neo/1neo ;Neurog1 -/- (dark green columns) and 1 2neo/2neo ;Neurog2 -/- (dark brown columns) embryos at E18.5. Data are represented as means ± SEM. *** p<0.001. Blue asterisks indicate significant differences with WT. K,L. Illustrative images of in situ hybridization for Scg10 , TrkB , MafA , TrkC , Cgrp , TrpV1 TpM8 , MrgprD and Ret , and immunostaining for PV, on thoracic DRG transverse sections of 2 1neo/1neo ;Neurog1 -/- (G) and 1 2neo/2neo ;Neurog2 -/- (H) embryos at E18.5 showing opposite defects in both models. M. Relative numbers of TrkB +, MafA +, TrkC+ /PV- ( TrkC* ), PV + mechano/proprioceptors, and Cgrp +, TrpV1 + and TpM8 +, MrgprD +, as well as of small-diameter Ret + (s- Ret ) thermo/nociceptors, in WT (set to 100%; blue columns), 2 1neo/1neo ;Neurog1 -/- (dark green columns) and 1 2neo/2neo ;Neurog2 -/- (dark brown columns) embryos at E18.5. Note that quantification of the large-diameter Ret + mechanoceptors which are also MafA + is not represented. Data are represented as means ± SEM. ***p < 0.001. Blue asterisks indicate significant differences with WT. Download figure Open in new tab Figure 7. Summary of the phenotypes in transgenic mouse models linking timing and rate of neurogenesis, somatosensory neuron birth dates, and (iii) DRG content. A-F. Schematic summaries of the phenotypes of WT (A), Neurog2 1/1 single-KI (A), Neurog1 2/2 single-KI (A), Neurog1 -/- single-KO (B), Neurog2 -/- single-KO (C), Neurog1 2/2 ; Neurog2 -/- KI;KO (D), 2 1neo/1neo ;Neurog1 -/- (E) and 1 2neo/2neo ;Neurog2 -/- (F) models, illustrating a close link between timing and rate of neurogenesis over time, birth dates of mechano/proprioceptive and thermo/nociceptive neurons, and DRG content. For each model, the graph on the left shows the relative rate of neurogenesis between E9.5 and E13.5 (colored thick lines) compared to WT (set at 100%), in relation with the relative birth of mechano/proprioceptors (Mechano/Proprio.; blue-filled curve) vs. thermo/nociceptors (Thermo/Noci.; red-filled curve) over time. The pie chart on the right schematizes the DRG composition. The black percentage below each pie chart indicate the overall number of DRG neurons relative to WT (set at 100%). The white percentages inside each pie chart indicate the numbers of mechano/proprioceptors (Mechno/Proprio.) and thermo/nociceptors (Thermo/Noci.) relative to WT (set at 100%). The blue and red percentages outside each pie charts indicate the relative proportions of mechano/proprioceptors vs. thermo/nociceptors, respectively. To complement this study, we took advantage of the 2 1neo/1neo ;Neurog1 -/- and 1 2neo/2neo ;Neurog2 -/- compound transgenic mouse models, in which the timing of Neurog1/2 expression is altered in complementary ways, characterized by a premature down-regulation shortly after E10.5 in the former, and a delayed onset around E11.5 in the latter (see Figures 1Q,T ). Accordingly, analysis of neurogenesis over time in these models, revealed opposite defects ( Figure 6E ). In 2 1neo/1neo ;Neurog1 -/- , neurogenesis began on time at E9.5, albeit at a lower rate compared to controls and Neurog1 -/- KO, and ended prematurely shortly after E10.5 -approximately 48h and 24h earlier than in WT and Neurog1 -/- KO, respectively ( Figure 6E ; compare with Figure 6A ). Conversely, in 1 2neo/2neo ;Neurog2 -/- , neurogenesis started around E115, with a delay of approximately 48h and 24h compared to WT and Neurog2 -/- KO, respectively. Moreover, from E11.5 to E13.5, neurogenesis proceeded at a lower rate compared to both WT and Neurog2 -/- KO ( Figure 6E ; compare with Figure 6A ). Estimations of the relative numbers of total DRG neurons, mechano/proprioceptors, and thermo/nociceptors generated in both models compared to WT, suggested that their DRG would be massively atrophied and predominantly composed of distinct neuronal classes ( Figures 6F,G ). On one hand, in the 2 1neo/1neo ;Neurog1 -/- model, we anticipated a decrease of 94.3% in the total number of neurons, 99% for the thermo/nociceptive class, and 78.9% for the mechano/proprioceptive class ( Figure 6F ). Experimental assessment of marker subtypes at E18.5 largely confirmed these predictions, showing a 92.6% reduction in the number of Scg10 + neurons ( Figures 6F ’,H,K), a nearly complete absence of thermo/nociceptors ( Figures 6F ’,I,K,M), and a 72.1% decrease in the number of mechano/proprioceptors ( Figures 6F ’,J,K,M). Therefore, temporally restricting the period of neurogenesis to E9.5-E10.5 particularly affected the thermo/nociceptive class, more drastically than in the Neurog1 -/- KO, consistent with this population being primarily generated after E10.5 (Summarized in Figure 7E ). Nevertheless, due to the reduced neurogenic rate at these stages compared to controls ( Figures 6E ), mechano/proprioceptive subtypes were also expectedly impacted ( Figures 6F,F ’,J,K,M and 7E). On the other hand, in the 1 2neo/2neo ;Neurog2 -/- model, we also observed a strong match between the experimentally determined, and the anticipated, decreases in the numbers of Scg10 + neurons (86.7% vs. 80.3%, respectively; Figures 6G,G ’,H,L), thermo/nociceptors (76.1% vs. 77.2%, respectively; Figures 6G,G ’,I,L,M) and mechano/proprioceptors (90.5% vs. 94.1%, respectively; Figures 6G,G ’,J,L,M). Therefore, compared to the Neurog2 -/- KO, further delaying the onset of neurogenesis, particularly affected the mechano/proprioceptive class, consistent with this population being mostly generated before E11.5 (Summarized in Figure 7F ). However, again, due to the lower rate of neurogenesis in 1 2neo/2neo ;Neurog2 -/- embryos compared to Neurog2 -/- KO, notably at E11.5- E12.5 (compare Figures 6A and 6E ), the thermo/nociceptive class was also expectedly severely impacted ( Figures 6 G,G’,I,L,M and 7F). It is of note that, considered individually, all neuron subtypes were not equally altered in the 1 2neo/2neo ;Neurog2 -/- embryos. Indeed, within the mechano/proprioceptive class, the PV+ proprioceptors appeared relatively less affected than the other subtypes ( Figures 6L,M ). In the same line, within the thermo/nociceptive class, while the Cgrp +, TrpV1 + and TrpM8 + populations were reduced but still present, very few, if any, MrgprD + neurons were detected ( Figures 6L,M ). This population of small-diameter thermo/nociceptors also expresses the gene encoding the Ret receptor ( Usoskin et al., 2015 ; Cranfill & Luo, 2021 ). Analysis of Ret expression in 1 2neo/2neo ;Neurog2 -/- embryos at E18.5, revealed the presence of significant numbers of small- sized Ret + neurons (s-Ret, Figures 6L,M ), suggesting that this neuronal population is produced but exhibits incomplete subtype-specific differentiation. Definite explanation for these observations remains elusive, but they may, at least in part, reflect developmental cooperation between the different precursor subtypes, as previously reported ( Hadjab et al., 2013 ). Taken altogether, these findings establish that opposite temporal shifts of neurogenesis -either delayed onsets in 1 2neo/2neo ;Neurog2 -/- or premature arrests in 2 1neo/1neo ;Neurog1 -/- -, have largely predictable and opposite impacts on DRG content, highlighting the critical importance of the timing of differentiation in biasing somatosensory precursors fate toward either mechano/proprioceptive or thermo/nociceptive lineages. Discussion In this study, we have addressed the not formally tested issue of the functional equivalence of the two paralogous proneural bHLH TFs Neurog1 and Neurog2, by focusing on the developing DRG. This question was not trivial, not only because of their sequence dissimilarities ( Hand et al., 2005 ) and the phenotypic complementarities of their respective mutants ( Ma et al., 1999 , Venteo et al., 2019 ), but also because the proneural TF Ascl1 was shown unable to substitute for Neurog2 in this structure ( Bertrand et al., 2002 ; Parras et al., 2002 , Baker and Brown, 2018 ), likely illustrating their divergent, cell-dependent, modes of target genes regulation ( Aydin et al., 2019 ; Vainorius et al., 2023 ). In contrast, we report here that replacing Neurog2 by Neurog1 , and vice versa, efficiently rescues the defects respectively triggered by the loss of Neurog2 or Neurog1 function, and that four copies of either gene are equally capable of ensuring progenitors integrity and the genesis of accurate numbers and identities of all somatosensory neuron subtypes. This establishes that Neurog1 and Neurog2 are functionally interchangeable in the forming DRG, implying that their respective and complementary spatio-temporal expression profiles and regulatory interactions primarily account for their apparent functional specificities, more than major differences of their biochemical properties, although subtle divergences could be uncovered in particular genetic contexts. This is particularly well illustrated by the respective implications and efficiencies of Neurog2 and Neurog1 in suppressing the melanocyte identity. Previous findings on Neurog1/2 single- KO and dKO have suggested a specific role for Neurog2 in this process. They have also uncovered a developmental plasticity period -initially set between E9 and E11.5, covering the period of Neurog2 expression- during which a group of somatosensory progenitors retains the competence to become melanoblasts ( Venteo et al., 2019 ). Our in vivo analyses on Neurog2 1/1 KI and Neurog2 1/1 ;Neurog1 -/- KI;KO models, as well as in vitro on B16/F10 melanoblastoma cells, establish that Neurog1 does also have the ability to block the melanocyte fate. Nevertheless, the exacerbated fate switch phenotype observed in Neurog2 1/- hemizygous compared to Neurog2 +/- heterozygous embryos, as well as the higher doses of Neurog1 necessary to alter the molecular identity of B16F10 cells, also indicate that Neurog1 is less efficient than Neurog2 in controlling this process. This appears to mainly reflects sequence dissimilarities in their bHLH domain that may influence their respective affinity for common target sequences, despite conservation of the key residues involved in DNA binding ( Bertrand et al., 2002 ). Yet, a role for other domains outside the bHLH is also probable since the “Neurog2-bHLHNeurog1” chimeric protein exhibits a better ability than the native Neurog1 protein to down-regulate Mitf in vitro. Interestingly, phosphorylable amino acids in the COOH-terminal region of Neurog2, absent from Neurog1, are important for some aspects of its function ( Ma et al., 2008 ; Hand et al., 2005 ). Whether these residues also influence Neurog2 efficacy to repress the melanocyte fate remains open. In addition, the striking sensory-to-melanocyte fate conversion of the 2 1neo/1neo transgenic model, in which exogenous Neurog1 is properly induced at E9 but prematurely down-regulated around E10.5, restricts the developmental plasticity period at E10-E11, and further supports that this phenotype mainly concerns late-migrating somatosensory progenitors, before they settle in the DRG primordium ( Venteo et al., 2019 ; this study). This provides a rationale to the observation that in all relevant models, supernumerary Mitf + melanoblasts are systematically found in the dorso- lateral migratory path of the NCC, never in the DRG anlage, and are always detected after E10.5 ( Soldatov et al., 2019 ; Venteo et al., 2019 ; this study), concomitantly to the emergence of the endogenous melanoblast population ( Hari et al., 2012 ). This likely also explains why not all somatosensory progenitors switch fate, although heterogeneity in the developmental competence among this cell population cannot be excluded. These data also provide insights into the phenotypic differences of Neurog1 -/- and Neurog2 -/- single-KO in this regard: 1) In Neurog1 -/- KO, Neurog2 is normally expressed in migrating somatosensory progenitors during the plasticity period, and can thus block the melanocyte fate; 2) On the opposite, in Neurog2 -/- KO, Neurog1 cannot compensate for the loss of Neurog2 , primarily because its induction in post-migratory progenitors, is incompatible with such a role, and anyway also because its onset transiently depends on Neurog2 and only occurs after E10.5 in the mutants, after the plasticity period ( Ma et al., 1999 ; Venteo et al., 2019 ). Therefore, although Neurog1 has the potential to block the melanocyte fate, regulation of its spatio-temporal expression profile renders it dispensable in this process in vivo. This study also provides definitive evidence that Neurog1 and Neurog2 do not differentially instruct the identity of distinct classes of somatosensory neurons in the forming DRG. This issue has been remaining ambiguous and led to heterogeneous statements within the fields of developmental and stem cell biology. The specific agenesis of most thermo/nociceptors in Neurog1 -/- single-KO and the additional lack of all mechano/proprioceptors in Neurog1 -/- ;Neurog2 -/- dKO, combined to their dynamic expression profiles, have suggested that Neurog1 and Neurog2 may participate in the specification of different fates ( Ma et al., 1999 ; Marmigere and Ernfors, 2007; Lallemend and Ernfors, 2012 ; Ohayon et al., 2015 ). Yet, presence of few thermo/nociceptors in Neurog1 -/- single-KO and of substantial numbers of mechano/proprioceptors in Neurog2 -/- single-KO ( Ma et al., 1999 ; Bachy et al., 2011 ; Ohayon et al., 2015 ; Venteo et al., 2019 ), as well as recent findings showing that most, if not all, NCC-derived somatosensory progenitors transiently express both TFs at some point ( Venteo et al., 2019 ; Faure et al., 2020 ; Sharma et al., 2020 ), already challenged this view. In addition, in vitro strategies based on Neurog1/2 overexpression to differentiate iPS or ES cells into distinct somatosensory neuron subtypes have yielded varied outcomes ( Labau et al., 2022 ). In some studies, overexpression of Neurog1 or Neurog2 have been successfully used to specifically generate nociceptors or mechanoceptors, respectively, favoring their divergent implications (Schrenk-Siemens et al., 2014; Boisvert et al., 2015 ; Nickolls et al., 2020 ). In contrast, other studies have provided evidence that either gene can trigger the differentiation of all neuronal classes, with Neurog2 being notably efficient in promoting the formation of thermo/nociceptors ( Blanchard et al., 2015 ; Hulme et al., 2020 ; Plumbly et al., 2023 ). However, the use of various cell lines and (re)programming protocols ( Labau et al., 2022 ) made it difficult to draw definitive conclusions. In vivo gene replacement strategies enabling functional comparisons within similar cellular environments and physiological conditions, appeared therefore particularly well suited to solve this issue. The functional interchangeability of Neurog1 and Neurog2 in fate specification, along with the phenotypes of complementary transgenic mouse models in which definite temporal shifts in neurogenesis -either delayed onsets or premature arrests- have opposite effects on their DRG content, highlights the importance of differentiation timing in influencing neuronal fates: early differentiation primarily produces mechano/proprioceptors, while late differentiation mainly forms thermo/nociceptors ( Figure 7 ). This aligns with our, and other previous birth-dating analyses establishing successive peaks of birth for both neuronal classes: E10.5-E11.5 for mechano/proprioceptors and E11.5-E12.5 for thermo/nociceptors (this study; Lawson and Biscoe, 1979 ; Kitao et al., 1996 ). However, it contrasts with another birth-dating study suggesting that the peak of genesis of thermo/nociceptors spans E10.5-E12.5, encompassing that of mechano/proprioceptors ( Landy et al., 2021 ). Although we also found here that both neuronal classes are produced concomitantly and continuously throughout DRG neurogenesis, we observed two clear separate phases during which their respective proportions are reversed: about 85% of mechano/proprioceptors are born before E11.5, while 90% of thermo/nociceptors are born after E11.5. The reasons for these discrepancies are unclear, but the deficit of 95% of thermo/nociceptors in Neurog1 -/- mutants, where neurogenesis is impaired from E11.5 onwards ( Ma et al., 1999 ; Ohayon et al., 2015 ; this study), rather supports that the majority of these neurons are generated after E11.5. Time-dependent specification and diversification of neuronal subtypes in the developing nervous system is a recurring theme, particularly well-illustrated in the retina, neocortex and ventral hindbrain. In these structures, temporal patterning mechanisms regulate the developmental potential of neural precursors over time through the sequential action of specific combinations of transcriptional regulators and environmental cues (Cepko et al., 2014; Llorca and Marin 2021; Pattyn et al., 2003 ; Dias et al., 2014 ). Functional and time- course transcriptomic analyses in the forming DRG have established that subtype diversification and maturation within both, the mechano/proprioceptive and the thermo/nociceptive lineages involve similar processes ( Levanon et al., 2002 ; Kramer et al., 2006 ; Faure et al., 2020 ; Sharma et al., 2020 ; de Nooj, 2022; Chen et al., 2006 ; Abdo et al., 2011 ; Scott et al., 2011 ). However, the question of when these two lineages segregate remains debated. Faure et al. (2020) describe newly-born somatosensory neurons as being early committed to a particular fate. In contrast, Sharma et al. (2020) describe them as unspecified until relatively late stages, based on their initial co-expression of a set of TFs that are later maintained in specific subtypes where they control maturation features. Our functional and birth dating analyses support that the choice for a somatosensory precursor to adopt either fate is rapidly biased but depends on the developmental stage. This is consistent with the fact that populations of proprioceptive and mechanoceptive precursors, including the MafA+/cMaf+/Ret+ rapidly-adapting low-threshold mechanoreceptors, are already largely established by E11.5-E12, well before the end of DRG neurogenesis ( Levanon et al., 2002 ; Kramer et al., 2006 ; Bourane et al., 2009 ; Luo et al., 2009 ; Wende et al., 2012 ). In the same line, Prdm12, a major determinant of the thermo/nociceptive lineage, is early detected, first in few precursor cells at E9.5-E10, and then in larger populations ( Bartesaghi et al., 2019 ; Desiderio et al., 2019 ), paralleling the gradual increase in the production of this neuronal class over time. The mechanisms underlying this time-dependent lineage segregation remain however unclear. Evidence indicates that somatosensory progenitors as well as young post- mitotic precursors, are not intrinsically and irreversibly fated but exhibit developmental plasticity. Indeed, in a mouse model where late-migrating NCC-derived somatosensory progenitors are specifically depleted, early progenitors mainly generate mechano/proprioceptors when they normally differentiate at E9.5-E11, but mostly produce thermo/nociceptors when they atypically differentiate at E11-E13.5 ( Ohayon et al., 2015 ; Venteo et al., 2019 ), further underscoring the importance of the differentiation timing. Moreover, forced expression of the neurotrophin receptor TrkC from the TrkA locus, can induce some TrkA+ nociceptive precursors to become proprioceptors ( Moqrich et al., 2004 ). Together, these data suggest key roles for extrinsic instructive signals emanating from the rapidly evolving environment around the DRG anlagen (de Nooj, 2022). Yet, the continuous production of both neuronal classes throughout neurogenesis ( Landy et al., 2021 ; Kitao et al., 1996 ; this study) also suggests that these signals might be active concomitantly, with their respective intensities and/or the capacity of precursor cells to respond varying over time. This simultaneous activity could also explain the temporary co-expression of several genes encoding subtype-restricted maturation TFs ( Sharma et al., 2020 ). Alternatively, this may reflect early active pan-somatosensory regulatory elements in their promoter regions, later overridden by subtype-specific elements, ultimately limiting their expression at stages when their function is engaged. As proneural TFs, Neurog1 and Neurog2 also influence cell proliferation by notably promoting cell cycle exit and activating the Notch signaling pathway which is critical for maintaining the integrity of undifferentiated proliferative precursors throughout neurogenesis ( Bertrand et al., 2002 ; Hu et al., 2011 ). Their respective expression, which roughly coincides with the two successive neurogenic phases of the DRG generating, respectively, about 25% and 75% of the somatosensory neurons, raised the possibility that they may actively and differently control the distinct proliferative properties of early- and late-migrating progenitors ( Lawson and Biscoe, 1979 ; Franck and Sanes, 1991; Ma et al., 1999 ; Marmigere et al., 2007; Ohayon et al., 2015 ; this study). Nevertheless, the normal numbers of neurons in the DRG of Neurog1 2/2 and Neurog2 1/1 single-KI models establish that both TFs are also essentially interchangeable in this process and, therefore, do not account for the distinct contributions of the different progenitor pools. This result, together with the observation that early progenitors consistently form about 20% of the DRG neurons regardless of whether they differentiate between E9.5-E11 or E11- E13.5 ( Ohayon et al., 2015 ; Venteo et al., 2019 ), suggests that their proliferative capacities are early intrinsically fixed, in contrast to their fate. Functional equivalence of Neurog1 and Neurog2 in the developing DRG raises the issue of the evolutionary rationale for having selected and maintained two paralogous genes with similar functions. It has been proposed that duplication of proneural genes followed by subsequent modifications of their coding sequences and/or regulatory elements, have contributed to the complexification and diversification of the nervous system ( Furlong and Graham, 2005 ; Baker and Brown, 2018 ). In this regards, it is interesting to note that the development of the zebrafish DRG which contain only few neurons, is controlled by a single Neurogenin family member orthologous to Neurog1 (Raible and Eisen 1992; MacGraw et al., 2008). It is thus conceivable that in higher Vertebrates, after duplication of an ancestral gene, the regulatory elements of Neurog1 and Neurog2 have evolved independently of each other, and along with the diversification and expansion of the populations of NC-derived progenitors, allowing the formation of increased numbers of neurons and the emergence of new functional identities. In this context, our findings suggest a model in which, regardless of their nature, combined expression of Neurog1 and Neurog2 allows a continuum of neurogenesis between E9.5 and E13.5, so that early –low-proliferating–, and late – highly- proliferating– progenitor populations differentiate during successive time-windows, and within distinct environments, that determine their fate as either mechano/proprioceptors or thermo/nociceptors, thus underlying the relative proportions of 20% and 80% of both neuronal classes. In this model, shortening the periods of Neurog1/2 expression in a way or another, consequently restricts neurogenesis to defined periods with predictable impacts on DRG content. Beyond the spinal peripheral somatosensory system, Neurog1 and Neurog2 also control neurogenesis in several other regions of the nervous system, either individually, like in the ventral midbrain dopaminergic nuclei (Anderson et al., 2006; Kele et al., 2006 ), or on a combinatorial mode, like in the olfactory system ( Shaker et al., 2012 ; Dixit et al., 2014 ) and cranial sensory ganglia ( Ma et al., 1998 ; Fode et al., 1998 ). Preliminary evidences suggest that Neurog1 can efficiently replace Neurog2 during the genesis of midbrain dopaminergic neurons (data not shown). Similarly, the complementary defects observed in the cranial sensory ganglia of Neurog1 -/- and Neurog2 -/- single-KO are also rescued in the single-KI models (data not shown). It is noteworthy that the latter result was expected since in the chick embryo, the spatio-temporal dynamic of Neurog1 and Neurog2 expression in cranial sensory progenitors originating from the neurogenic placodes and the neural crest, are strikingly inverted compared to the mouse ( Begbie et al., 2002 ; Furlong and Graham, 2005 ). It will be interesting to evaluate other Neurog1/2 -dependent neural structures to determine whether their functional specificities generally rely solely on their complementary expression profiles. Author contributions S.D., P.Cabochette, S.V. and A.P. performed the experiments. S.D., P.Cabochette., A.P., P.Carroll and F.A. designed the experiments and interpreted the data. S.D., P.Cabochette and A.P. wrote the manuscript. Declaration of interests The authors declare no competing interests. Acknowledgments We thank F. Guillemot for Neurog mutants, Q. Ma, JF. Brunet and E. Bellefroid for materials, and M. Simonelig and A. Chartier for technical help. This work was supported by INSERM, France; CNRS, France; Fondation pour la Recherche Medicale, France; Agence Nationale pour la Recherche, France; and University of Montpellier, France. References 1. ↵ Abdo H , Li L , Lallemend F , Bachy I , Xu XJ , Rice FL , Ernfors P . ( 2011 ). Dependence on the transcription factor Shox2 for specification of sensory neurons conveying discriminative touch . Eur J Neurosci 34 , 529 – 41 . OpenUrl 2. ↵ Andersson E , Jensen JB , Parmar M , Guillemot F , Björklund A . ( 2006 ). Development of the mesencephalic dopaminergic neuron system is compromised in the absence of neurogenin 2 . Development 133 , 507 – 516 . OpenUrl Abstract / FREE Full Text 3. ↵ Aydin B , Kakumanu A , Rossillo M , Moreno-Estellés M , Garipler G , Ringstad N , Flames N , Mahony S , Mazzoni EO . ( 2019 ). Proneural factors Ascl1 and Neurog2 contribute to neuronal subtype identities by establishing distinct chromatin landscapes . Nat Neurosci 22 , 897 – 908 . OpenUrl CrossRef PubMed 4. ↵ Bachy I , Franck M , Li L , Abdo H , Pattyn A , Ernfors P . ( 2011 ). The transcription factor Cux2 marks development of an A-delta sublineage of TrkA sensory neurons . Dev Biol 360 , 77 – 86 . OpenUrl CrossRef PubMed 5. ↵ Baker NE , Brown NL . ( 2018 ). All in the family: proneural bHLH genes and neuronal diversity . Development 145 , dev159426 . OpenUrl Abstract / FREE Full Text 6. ↵ Bartesaghi L , Wang Y , Fontanet P , Wanderoy S , Berger F , Wu H , Akkuratova N , Bouçanova F , Médard JJ , Petitpré C et al. ( 2019 ). PRDM12 Is Required for Initiation of the Nociceptive Neuron Lineage during Neurogenesis . Cell Rep 26 , 3484 – 3492 . OpenUrl CrossRef PubMed 7. ↵ Begbie J , Ballivet M , Graham A . Early steps in the production of sensory neurons by the neurogenic placodes . ( 2002 ). Mol Cell Neurosci 21 , 502 – 511 . OpenUrl CrossRef PubMed 8. ↵ Bertrand N , Castro DS , Guillemot F . ( 2002 ). Proneural genes and the specification of neural cell types . Nat Rev Neurosci 3 , 517 – 30 . OpenUrl CrossRef PubMed Web of Science 9. ↵ Blanchard JW , Eade KT , Szűcs A , Lo Sardo V , Tsunemoto RK , Williams D , Sanna PP , Baldwin KK . ( 2015 ). Selective conversion of fibroblasts into peripheral sensory neurons . Nat Neurosci 18 , 25 – 35 . OpenUrl CrossRef PubMed 10. ↵ Boisvert EM , Engle SJ , Hallowell SE , Liu P , Wang ZW , Li XJ . ( 2015 ). The Specification and Maturation of Nociceptive Neurons from Human Embryonic Stem Cells . Sci Rep 5 , 16821 . OpenUrl CrossRef PubMed 11. ↵ Bourane S , Garces A , Venteo S , Pattyn A , Hubert T , Fichard A , Puech S , Boukhaddaoui H , Baudet C , Takahashi S , Valmier J , Carroll P . ( 2009 ). Low-threshold mechanoreceptor subtypes selectively express MafA and are specified by Ret signaling . Neuron 64 , 857 – 70 . OpenUrl CrossRef PubMed Web of Science 12. Cepko C . ( 2014 ). Intrinsically different retinal progenitor cells produce specific types of progeny . Nat Rev Neurosci 15 , 615 – 27 . OpenUrl CrossRef PubMed 13. ↵ Chen C. , Broom DC , Liu Y , de Nooij JC , Li Z , Cen C , Samad OA , Jessell TM , Woolf CJ , and Ma Q. ( 2006 ). Runx1 determines nociceptive sensory neuron phenotype and is required for thermal and neuropathic pain . Neuron 49 , 365 – 377 . OpenUrl CrossRef PubMed Web of Science 14. ↵ Cranfill SL , Luo W . ( 2021 ). The development of somatosensory neurons: Insights into pain and itch . Curr Top Dev Biol 142 , 443 – 475 . OpenUrl CrossRef PubMed 15. de Nooij JC. ( 2023 ). Influencers in the Somatosensory System: Extrinsic Control of Sensory Neuron Phenotypes . Neuroscientist 29 , 472 – 487 . OpenUrl CrossRef PubMed 16. ↵ Desiderio S , Vermeiren S , Van Campenhout C , Kricha S , Malki E , Richts S , Fletcher EV , Vanwelden T , Schmidt BZ , Henningfeld KA , et al. ( 2019 ). Prdm12 directs nociceptive sensory neuron development by regulating the expression of the NGF receptor TrkA . Cell Rep 26 , 3522 – 3536 . OpenUrl CrossRef PubMed 17. ↵ Dias JM , Alekseenko Z , Applequist JM , Ericson J . ( 2014 ). Tgfβ signaling regulates temporal neurogenesis and potency of neural stem cells in the CNS . Neuron 84 , 927 – 39 . OpenUrl CrossRef PubMed 18. ↵ Dixit R , Wilkinson G , Cancino GI , Shaker T , Adnani L , Li S , Dennis D , Kurrasch D , Chan JA , Olson EC , Kaplan DR , Zimmer C , Schuurmans C . ( 2014 ). Neurog1 and Neurog2 control two waves of neuronal differentiation in the piriform cortex . J Neurosci 34 , 539 – 53 . OpenUrl Abstract / FREE Full Text 19. ↵ Faure L , Wang Y , Kastriti ME , Fontanet P , Cheung KKY , Petitpré C , Wu H , Sun LL , Runge K , Croci L , Landy MA , Lai HC , Consalez GG , de Chevigny A , Lallemend F , Adameyko I , Hadjab S. ( 2020 ). Single cell RNA sequencing identifies early diversity of sensory neurons forming via bi-potential intermediates . Nat Comm 11 , 4175 . OpenUrl CrossRef 20. ↵ Fode C , Gradwohl G , Morin X , Dierich A , LeMeur M , Goridis C , Guillemot F . ( 1998 ). The bHLH protein NEUROGENIN 2 is a determination factor for epibranchial placode-derived senrory neurons . Neuron 20 , 483 – 94 . OpenUrl CrossRef PubMed Web of Science 21. ↵ Fode C , Ma Q , Casarosa S , Ang SL , Anderson DJ , Guillemot F . ( 2000 ). A role for neural determination genes in specifying the dorsoventral identity of telencephalic neurons . Genes Dev 14 , 67 – 80 . OpenUrl Abstract / FREE Full Text 22. ↵ Frank E and Sanes JR . ( 1991 ). Lineage of neurons and glia in chick dorsal root ganglia: analysis in vivo with a recombinant retrovirus . Development 111 , 895 – 908 . OpenUrl Abstract / FREE Full Text 23. ↵ Furlong RF and Graham A . ( 2005 ). Vertebrate neurogenin evolution: long-term maintenance of redundant duplicates . Dev Genes Evol 215 , 639 – 44 . OpenUrl CrossRef PubMed Web of Science 24. ↵ George L , Kasemeier-Kulesa J , Nelson BR , Koyano-Nakagawa N , Lefcort , F . ( 2010 ). Patterned assembly and neurogenesis in the chick dorsal root ganglion . J Comp Neurol 518 , 405 – 422 . OpenUrl CrossRef PubMed Web of Science 25. ↵ Gowan K , Helms AW , Hunsaker TL , Collisson T , Ebert PJ , Odom R , Johnson JE . ( 2001 ). Crossinhibitory activities of Ngn1 and Math1 allow specification of distinct dorsal interneurons . Neuron 31 , 219 – 32 . OpenUrl CrossRef PubMed Web of Science 26. ↵ Gresset A , Coulpier F , Gerschenfeld G , Jourdon A , Matesic G , Richard L , Vallat JM , Charnay P , Topilko P . ( 2015 ). Boundary Caps Give Rise to Neurogenic Stem Cells and Terminal Glia in the Skin . Stem Cell Reports 5 , 278 – 90 . OpenUrl CrossRef PubMed 27. ↵ Hadjab S , Franck MC , Wang Y , Sterzenbach U , Sharma A , Ernfors P , Lallemend , F . ( 2013 ). A local source of FGF initiates development of the unmyelinated lineage of sensory neurons . J Neurosci 33 , 17656 – 17666 . OpenUrl Abstract / FREE Full Text 28. ↵ Han S , Dennis DJ , Balakrishnan A , Dixit R , Britz O , Zinyk D , Touahri Y , Olender T , Brand M , Guillemot F , Kurrasch D , Schuurmans C . ( 2018 ). A non-canonical role for the proneural gene Neurog1 as a negative regulator of neocortical neurogenesis . Development 145 , dev157719 . OpenUrl Abstract / FREE Full Text 29. ↵ Hand R , Bortone D , Mattar P , Nguyen L , Heng JI , Guerrier S , Boutt E , Peters E , Barnes AP , Parras C , Schuurmans C , Guillemot F , Polleux F . ( 2005 ). Phosphorylation of Neurogenin2 specifies the migration properties and the dendritic morphology of pyramidal neurons in the neocortex . Neuron 48 , 45 – 62 . OpenUrl CrossRef PubMed Web of Science 30. ↵ Hari L , Miescher I , Shakhova O , Suter U , Chin L , Taketo M , Richardson WD , Kessaris N , Sommer L . ( 2012 ). Temporal control of neural crest lineage generation by Wnt/b-catenin signaling . Development 139 , 2107 – 2117 . OpenUrl Abstract / FREE Full Text 31. ↵ Hu ZL , Shi M , Huang Y , Zheng MH , Pei Z , Chen JY , Han H , Ding YQ . ( 2011 ). The role of the transcription factor Rbpj in the development of dorsal root ganglia . Neural Dev 21 , 6 – 14 . OpenUrl 32. ↵ Huang C , Chan JA , Schuurmans C . ( 2014 ). Proneural bHLH genes in development and disease . Curr Top Dev Biol 110 , 75 – 127 . OpenUrl CrossRef PubMed 33. ↵ Hufnagel RB , Riesenberg AN , Quinn M , Joseph A , Brzezinski JA , Glaser T , Nadean L , Brown NL . ( 2013 ). Heterochronic misexpression of Ascl1 in the Atoh7 retinal cell lineage blocks cell cycle exit . Mol Cell Neurosci 54 , 108 – 20 . OpenUrl CrossRef PubMed 34. ↵ Hulme AJ , McArthur JR , Maksour S , Miellet S , Ooi L , Adams DJ , Finol-Urdaneta RK , Dottori M . ( 2020 ). Molecular and Functional Characterization of Neurogenin-2 Induced Human Sensory Neurons . Front Cell Neurosci 14 , 600895 . OpenUrl CrossRef PubMed 35. ↵ Jahan I , Pan N , Kersigo J , Fritzsch B . ( 2015 ). Neurog1 can partially substitute for Atoh1 function in hair cell differentiation and maintenance during organ of Corti development . Development 142 , 2810 – 21 . OpenUrl Abstract / FREE Full Text 36. ↵ Kele J , Simplicio N , Ferri AL , Mira H , Guillemot F , Arenas E , Ang SL . ( 2006 ). Neurogenin 2 is required for the development of ventral midbrain dopaminergic neurons . Development 133 , 495 – 505 . OpenUrl Abstract / FREE Full Text 37. ↵ Kitao Y , Robertson B , Kudo M , Grant G . ( 1996 ). Neurogenesis of subpopulations of rat lumbar dorsal root ganglion neurons including neurons projecting to the dorsal column nuclei . J Comp Neurol 371 , 249 – 57 . OpenUrl CrossRef PubMed Web of Science 38. ↵ Kramer I , Sigrist M , de Nooij JC , Taniuchi I , Jessell TM , Arber S. ( 2006 ). A role for Runx transcription factor signaling in dorsal root ganglion sensory neuron diversification . Neuron 49 , 379 – 393 . OpenUrl CrossRef PubMed Web of Science 39. ↵ Labau JIR , Andelic M , Faber CG , Waxman SG , Lauria G , Dib-Hajj SD . ( 2022 ). Recent advances for using human induced-pluripotent stem cells as pain-in-a-dish models of neuropathic pain . Exp Neurol 358 , 114223 . OpenUrl CrossRef PubMed 40. ↵ Lallemend F and Ernfors P . ( 2012 ). Molecular interactions underlying the specification of sensory neurons . Trends Neurosci 35 , 373 – 381 . OpenUrl CrossRef PubMed Web of Science 41. ↵ Landy MA , Goyal M , Lai HC . ( 2021 ). Nociceptor subtypes are born continuously over DRG development . Dev Biol 479 , 91 – 98 . OpenUrl CrossRef PubMed 42. ↵ Lawson SN and Biscoe TJ . ( 1979 ). Development of mouse dorsal root ganglia: an autoradiographic and quantitative study . J Neurocytol 8 , 265 – 274 . OpenUrl CrossRef PubMed Web of Science 43. ↵ Levanon D , Bettoun D , Harris-Cerruti C , Woolf E , Negreanu V , Eilam R , Bernstein Y , Goldenberg D , Xiao C , Fliegauf M , Kremer E , Otto F , Brenner O , Lev-Tov A , Groner Y . ( 2002 ). The Runx3 transcription factor regulates development and survival of TrkC dorsal root ganglia neurons . EMBO J . 21 , 3454 – 63 . OpenUrl Abstract / FREE Full Text 44. Llorca A , Marín O . ( 2021 ). Orchestrated freedom: new insights into cortical neurogenesis . Curr Opin Neurobiol 66 , 48 – 56 . OpenUrl CrossRef PubMed 45. ↵ Lou S , Duan B , Vong L , Lowell BB , Ma Q . ( 2013 ). Runx1 controls terminal morphology and mechanosensitivity of VGLUT3-expressing C-mechanoreceptors . J Neurosci 33 , 870 – 82 . OpenUrl Abstract / FREE Full Text 46. ↵ Luo W , Enomoto H , Rice FL , Milbrandt J , Ginty DD . ( 2009 ). Molecular identification of rapidly adapting mechanoreceptors and their developmental dependence on ret signaling . Neuron 64 , 841 – 56 . OpenUrl CrossRef PubMed Web of Science 47. ↵ Ma Q , Chen Z , del Barco Barrantes I , de la Pompa JL , Anderson DJ . ( 1998 ). neurogenin1 is essential for the determination of neuronal precursors for proximal cranial sensory ganglia . Neuron 20 , 469 – 82 . OpenUrl CrossRef PubMed Web of Science 48. ↵ Ma Q , Fode C , Guillemot F , Anderson DJ . ( 1999 ). Neurogenin1 and neurogenin2 control two distinct waves of neurogenesis in developing dorsal root ganglia . Genes Dev 13 , 1717 – 1728 . OpenUrl Abstract / FREE Full Text 49. ↵ Ma YC , Song MR , Park JP , Henry Ho HY , Hu L , Kurtev MV , Zieg J , Ma Q , Pfaff SL , Greenberg ME . ( 2008 ). Regulation of motor neuron specification by phosphorylation of neurogenin 2 . Neuron 58 , 65 – 77 . OpenUrl CrossRef PubMed Web of Science 50. Marmigère F and Ernfors P . ( 2007 ). Specification and connectivity of neuronal subtypes in the sensory lineage . Nat Rev Neurosci 8 , 114 – 27 . OpenUrl CrossRef PubMed Web of Science 51. ↵ Maro GS , Vermeren M , Voiculescu O , Melton L , Cohen J , Charnay P , Topilko P . ( 2004 ). Neural crest boundary cap cells constitute a source of neuronal and glial cells of the PNS . Nat Neurosci 7 , 930 – 938 . OpenUrl CrossRef PubMed Web of Science 52. McGraw HF , Nechiporuk A , Raible DW . ( 2008 ). Zebrafish dorsal root ganglia neural precursor cells adopt a glial fate in the absence of neurogenin1 . J Neurosci 28 , 12558 – 69 . OpenUrl Abstract / FREE Full Text 53. McNay DE , Pelling M , Claxton S , Guillemot F , Ang SL . ( 2006 ). Mash1 is required for generic and subtype differentiation of hypothalamic neuroendocrine cells . Mol Endocrinol 20 , 1623 – 32 . OpenUrl CrossRef PubMed Web of Science 54. ↵ Meltzer S , Santiago C , Sharma N , Ginty DD . ( 2021 ). The cellular and molecular basis of somatosensory neuron development . Neuron 109 , 3736 – 3757 . OpenUrl CrossRef PubMed 55. ↵ Moqrich A , Earley TJ , Watson J , Andahazy M , Backus C , Martin-Zanca D , Wright DE , Reichardt LF , and Patapoutian A . ( 2004 ). Expressing TrkC from the TrkA locus causes a subset of dorsal root ganglia neurons to switch fate . Nat Neurosci 7 , 812 – 818 . OpenUrl CrossRef PubMed Web of Science 56. ↵ Nickolls AR , Lee MM , Espinoza DF , Szczot M , Lam RM , Wang Q , Beers J , Zou J , Nguyen MQ , Solinski HJ , AlJanahi AA , Johnson KR , Ward ME , Chesler AT , Bönnemann CG . ( 2020 ). Transcriptional Programming of Human Mechanosensory Neuron Subtypes from Pluripotent Stem Cells . Cell Rep 30 , 932 – 946 . OpenUrl CrossRef PubMed 57. ↵ Ohayon D , Venteo S , Sonrier C , Lafon PA , Garcès A , Valmier J , Rivat C , Topilko P , Carroll P , Pattyn A . ( 2015 ). Zeb family members and boundary cap cells underlie developmental plasticity of sensory nociceptive neurons . Dev Cell 33 , 343 – 350 . OpenUrl CrossRef PubMed 58. ↵ Parras CM , Schuurmans C , Scardigli R , Kim J , Anderson DJ , Guillemot F . ( 2002 ). Divergent functions of the proneural genes Mash1 and Ngn2 in the specification of neuronal subtype identity . Genes Dev 16 , 324 – 38 . OpenUrl Abstract / FREE Full Text 59. ↵ Pattyn A , Vallstedt A , Dias JM , Samad OA , Krumlauf R , Rijli FM , Brunet JF , Ericson J . ( 2003 ). Coordinated temporal and spatial control of motor neuron and serotonergic neuron generation from a common pool of CNS progenitors . Genes Dev 17 , 729 – 37 . OpenUrl Abstract / FREE Full Text 60. ↵ Pattyn A , Simplicio N , van Doorninck JH , Goridis C , Guillemot F , Brunet JF. ( 2004 ). Ascl1/Mash1 is required for the development of central serotonergic neurons . Nat Neurosci 7 , 589 – 95 . OpenUrl CrossRef PubMed Web of Science 61. ↵ Pattyn A , Guillemot F , Brunet JF . ( 2006 ). Delays in neuronal differentiation in Mash1/Ascl1 mutants . Dev Biol 295 , 67 – 75 . OpenUrl CrossRef PubMed Web of Science 62. ↵ Plumbly W , Patikas N , Field SF , Foskolou S , Metzakopian E . ( 2023 ). Derivation of nociceptive sensory neurons from hiPSCs with early patterning and temporally controlled NEUROG2 overexpression . Cell Rep Methods 2 , 100341 . OpenUrl 63. Raible DW , Wood A , Hodsdon W , Henion PD , Weston JA , Eisen JS . ( 1992 ). Segregation and early dispersal of neural crest cells in the embryonic zebrafish . Dev Dyn 195 , 29 – 42 . OpenUrl CrossRef PubMed Web of Science 64. ↵ Scacheri PC , Crabtree JS , Novotny EA , Garrett-Beal L , Chen A , Edgemon KA , Marx SJ , Spiegel AM , Chandrasekharappa SC , Collins FS . ( 2001 ). Bidirectional transcriptional activity of PGK-neomycin and unexpected embryonic lethality in heterozygote chimeric knockout mice . Genesis 30 , 259 – 63 . OpenUrl CrossRef PubMed Web of Science 65. ↵ Scardigli R , Schuurmans C , Gradwohl G , Guillemot F . ( 2001 ). Crossregulation between Neurogenin2 and pathways specifying neuronal identity in the spinal cord . Neuron 31 , 203 – 17 . OpenUrl CrossRef PubMed Web of Science 66. Schrenk-Siemens K , Wende H , Prato V , Song K , Rostock C , Loewer A , Utikal J , Lewin GR , Lechner SG , Siemens J . ( 2015 ). PIEZO2 is required for mechanotransduction in human stem cell-derived touch receptors . Nat Neurosci 18 , 10 – 16 . OpenUrl CrossRef PubMed 67. ↵ Schwenk F , Baron U , Rajewsky K . ( 1995 ). A cre-transgenic mouse strain for the ubiquitous deletion of loxP-flanked gene segments including deletion in germ cells . Nucleic Acids Res 23 , 5080 – 1 . OpenUrl CrossRef PubMed Web of Science 68. ↵ Scott A , Hasegawa H , Sakurai K , Yaron A , Cobb J , Wang F . ( 2011 ). Transcription factor short stature homeobox 2 is required for proper development of tropomyosin-related kinase B-expressing mechanosensory neurons . J Neurosci 31 , 6741 – 9 . OpenUrl Abstract / FREE Full Text 69. Serbedzija GN , Fraser SE , Bronner-Fraser M . ( 1990 ). Pathways of trunk neural crest cell migration in the mouse embryo as revealed by vital dye labelling . Development 108 , 605 – 612 . OpenUrl Abstract / FREE Full Text 70. ↵ Shaker T , Dennis D , Kurrasch DM , Schuurmans C . ( 2012 ). Neurog1 and Neurog2 coordinately regulate development of the olfactory system . Neural Dev 7 , 28 . OpenUrl CrossRef PubMed 71. ↵ Sharma N , Flaherty K , Lezgiyeva K , Wagner DE , Klein AM , Ginty DD . ( 2020 ). The emergence of transcriptional identity in somatosensory neurons . Nature 577 , 392 – 398 OpenUrl CrossRef PubMed 72. ↵ Soldatov R , Kaucka M , Kastriti ME , Petersen J , Chontorotzea T , Englmaier L , Akkuratova N , Yang Y , Häring M , Dyachuk V , Bock C , Farlik M , Piacentino ML , Boismoreau F , Hilscher MM , Yokota C , Qian X , Nilsson M , Bronner ME , Croci L , Hsiao WY , Guertin DA , Brunet JF , Consalez GG , Ernfors P , Fried K , Kharchenko PV , Adameyko I . ( 2019 ). Spatiotemporal structure of cell fate decisions in murine neural crest . Science 364 , eaas9536 . OpenUrl Abstract / FREE Full Text 73. ↵ Sommer L , Ma Q , Anderson DJ . ( 1996 ). Neurogenins, a novel family of atonal-related bHLH transcription factors, are putative mammalian neuronal determination genes that reveal progenitor cell heterogeneity in the developing CNS and PNS . Mol Cell Neurosci 8 , 221 – 241 . OpenUrl CrossRef PubMed Web of Science 74. ↵ Takano-Maruyama M , Chen Y , Gaufo GO . ( 2012 ). Differential contribution of Neurog1 and Neurog2 on the formation of cranial ganglia along the anterior-posterior axis . Dev Dyn 241 , 229 – 41 . OpenUrl CrossRef PubMed 75. ↵ Usoskin D , Furlan A , Islam S , Abdo H , Lönnerberg P , Lou D , Hjerling-Leffler J , Haeggström J , Kharchenko O , Kharchenko PV , Linnarsson S , Ernfors P . ( 2015 ). Unbiased classification of sensory neuron types by large-scale single-cell RNA sequencing . Nat Neurosci . 18 , 145 – 53 . OpenUrl CrossRef PubMed 76. ↵ Vainorius G , Novatchkova M , Michlits G , Baar JC , Raupach C , Lee J , Yelagandula R , Marius Wernig M , Elling U . ( 2023 ). Ascl1 and Ngn2 convert mouse embryonic stem cells to neurons via functionally distinct paths . Nat Comm 14 , 5341 . OpenUrl CrossRef 77. ↵ Venteo S , Desiderio S , Cabochette P , Deslys A , Carroll P , Pattyn A . ( 2019 ). Neurog2 Deficiency Uncovers a Critical Period of Cell Fate Plasticity and Vulnerability among Neural- Crest-Derived Somatosensory Progenitors . Cell Rep 29 , 2953 – 2960 . OpenUrl CrossRef PubMed 78. ↵ Vermeiren S , Bellefroid EJ , Desiderio S . ( 2020 ). Vertebrate Sensory Ganglia: Common and Divergent Features of the Transcriptional Programs Generating Their Functional Specialization . Front Cell Dev Biol 8 , 587699 . OpenUrl CrossRef PubMed 79. ↵ Weinberger S , Topping MP , Yan J , Claeys A , Geest N , Ozbay D , Hassan T , He X , Albert JT , Hassan BA , Ramaekers A . ( 2017 ). Evolutionary changes in transcription factor coding sequence quantitatively alter sensory organ development and function . Elife 6 , e26402 . OpenUrl CrossRef PubMed 80. ↵ Wende H , Lechner SG , Cheret C , Bourane S , Kolanczyk ME , Pattyn A , Reuter K , Munier FL , Carroll P , Lewin GR , Birchmeier C . ( 2012 ). The transcription factor c-Maf controls touch receptor development and function . Science 335 , 1373 – 6 . OpenUrl Abstract / FREE Full Text View the discussion thread. Back to top Previous Next Posted January 08, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Functional Equivalence of the Proneural Genes Neurog1 and Neurog2 in the Developing Dorsal Root Ganglia Highlights the Importance of Timing of Neurogenesis in Biasing Somatosensory Precursor Fates Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Functional Equivalence of the Proneural Genes Neurog1 and Neurog2 in the Developing Dorsal Root Ganglia Highlights the Importance of Timing of Neurogenesis in Biasing Somatosensory Precursor Fates Simon Desiderio , Pauline Cabochette , Stephanie Venteo , Gautier Tejedor , Farida Djouad , Patrick Carroll , Fabrice Ango , Alexandre Pattyn bioRxiv 2025.01.08.631905; doi: https://doi.org/10.1101/2025.01.08.631905 Share This Article: Copy Citation Tools Functional Equivalence of the Proneural Genes Neurog1 and Neurog2 in the Developing Dorsal Root Ganglia Highlights the Importance of Timing of Neurogenesis in Biasing Somatosensory Precursor Fates Simon Desiderio , Pauline Cabochette , Stephanie Venteo , Gautier Tejedor , Farida Djouad , Patrick Carroll , Fabrice Ango , Alexandre Pattyn bioRxiv 2025.01.08.631905; doi: https://doi.org/10.1101/2025.01.08.631905 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Developmental Biology Subject Areas All Articles Animal Behavior and Cognition (7622) Biochemistry (17650) Bioengineering (13871) Bioinformatics (41880) Biophysics (21424) Cancer Biology (18566) Cell Biology (25461) Clinical Trials (138) Developmental Biology (13365) Ecology (19866) Epidemiology (2067) Evolutionary Biology (24290) Genetics (15590) Genomics (22475) Immunology (17713) Microbiology (40328) Molecular Biology (17148) Neuroscience (88473) Paleontology (666) Pathology (2827) Pharmacology and Toxicology (4816) Physiology (7635) Plant Biology (15114) Scientific Communication and Education (2044) Synthetic Biology (4286) Systems Biology (9815) Zoology (2268)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.