METTL14/YTHDC1-mediated m6A modification in hippocampus improves pentylenetetrazol-induced acute seizures

METTL14/YTHDC1-mediated m6A modification in hippocampus improves pentylenetetrazol-induced acute seizures | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article METTL14/YTHDC1-mediated m6A modification in hippocampus improves pentylenetetrazol-induced acute seizures Xiaolin Zhong, Ling Chen, Yajuan Wang, Yue Liang, Yanmei Huang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3743108/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 4 You are reading this latest preprint version Abstract Epilepsy is a common neurological disorder which can cause significant morbidity and mortality. N6-methyladenosine (m6A), the most common chemical epigenetic modification among mRNA post-transcriptional modifications, implicated in various physiological and pathological processes, but its role in epilepsy is still unknown. Here, we provide strong evidences in support of an association of m6A and its regulatory proteins with epilepsy. Our results indicated that the level of m6A was declined in the hippocampus of pentylenetetrazol (PTZ)-induced seizure mice. Both the seizure-like behaviors and the excessive activation of hippocampal neuron were significantly mitigated after the administration of m6A agonist Betaine. Mechanically, we found both the hippocampal m6A methyltransferase METTL14 and recognition protein YTHDC1 were decreased in PTZ kindled mice, which might contribute to the reduced hippocampal m6A level. Additionally, hippocampal-specific over-expression of METTL14 or YTHDC1 by lentivirus injection could significantly ameliorate seizure-like behaviors and prevent the excessive activation of hippocampal neuron in epilepsy mice induced by PTZ injection, which might be due to the normalized hippocampal m6A level. Together, this study identified METTL14/YTHDC1-mediated m6A modification could participate in seizure-like behaviors, which might provide m6A regulation as a potential and novel therapeutic strategy for epilepsy. N6-methyladenosine (m6A) METTL14 YTHDC1 Epilepsy Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Introduction Epilepsy is a common neurological disorder characterized by unprovoked and recurrent seizures, which causes significant morbidity and mortality among the youth and adult populations [1]. It is estimated to affect more than 70 million people worldwide, resulting in an enormous burden on the patients, families and societies [2]. Even worse, over 30% of individuals with epilepsy are refractory to anti-epileptic drugs, and eventually become chronic cases to whom strong measures such as brain surgery are needed to control symptoms. To combat this disease, it is important to identify new pathogenesis and to develop more efficient therapeutics [3]. N6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic mRNA. The function of m6A modification, including capping, splicing, and polyadenylation, is regarded as a key factor controlling mammalian protein production [4] and participated in numerous human diseases [5]. In fact, m6A is a dynamic reversible post-transcriptional modification, which includes methylation, demethylation, and recognition. Post-transcriptional modification involves multiple protein molecules, including m6A methyltransferase complex, also known as the m6A “writer”, which includes methyltransferase-like 3/14 (METTL3/14) and Wilm’s tuner 1-associated protein (WTAP) [6]. The enzyme that removes m6A is called demethylase, also known as the m6A “eraser”, which is mainly composed of fat mass and obesity-associated protein (FTO) [7] and Alk B homolog 5 (ALKBH5) [8]. The enzyme that recognizes m6A and binds to the m6A methylation site to alter gene regulation is called the m6A “reader”, which referred to as YT521-B homology (YTH) domain family (YTHDF1-3 and YTHDC1-2) [9]. The expression of those enzymes influences m6A levels [10] and participates in the nervous system, thereby affecting neurogenesis, brain volume, learning and memory and consolidation [11]. Recent research elucidated the roles of m6A modifications participated in various neurological disorders, including Alzheimer's disease (AD), Parkinson's disease (PD), depression, cerebral apoplexy and brain injury [12]. Although a recent study identified m6A-related genes may regulate the immunologic process, cell death, drug-response, and glucose metabolism in patients with epilepsy [13, 14], no study has systematically evaluated the role of m6A in epilepsy. Herein, we examined the m6A level and the expression of m6A-related enzymes in the hippocampus of pentylenetetrazole (PTZ) kindled mice [15], and found hippocampal m6A level was significantly decreased, accompanied by the specific down-regulated METTL14 and YTHDC1. Moreover, m6A agonist treatment, or hippocampal-specific over-expression of METTL14 or YTHDC1, could significantly ameliorate seizure-like behaviors in mice challenged with PTZ. In line with the ameliorated seizure-like behavior, the markers of neuronal activity indicated by the expression of immediate early genes (IEGs) were also decreased after m6A agonist treatment, or hippocampal over-expression of METTL14 or YTHDC1. Thus, we showed that METTL14/YTHDC1-mediated m6A modification could participate in seizure-like behaviors and targeting m6A modification might provide novel therapeutic ideas for epilepsy. Materials and Methods Animals Eight-week-old adult male C57BL/6 mice (WT) were used in this study. All mice were group-housed (5 mice per cage) in a temperature (22 ± 2°C) and illumination (12 h light/dark cycle) controlled room, with free access to food and water. The project was approved by the Ethics Committee of the University of South China (2022usc05xs07). The experimental protocol was approved by the Animal Care and Use Committee of the University of South China in compliance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Drug administration Mice were treated with a single i.p. injection of pentylenetetrazol (PTZ, Sigma-Aldrich, P6500) at a dose of 50 mg/kg to establish the animal model of acute seizures [16]. Betaine (Sigma-Aldrich, B2629) was dissolved in normal saline, and administrated at a dose of 200 mg/kg or 600 mg/kg, i.p., to mice for 14 days before PTZ injection in reference to previous study [17]. Evaluation of seizure-like behaviors Seizure-like behaviors were observed immediately after PTZ injection. Mice were placed individually in cages immediately after PTZ injection, and the seizure activities were recorded using a video camera. An observer who was blinded to the experimental condition coded the videotapes. The seizure latency referred to the time between PTZ injection and seizure onset, which was the primary metric record. Seizures stage was classified according to the Racine scale [18] and the comprehensive list of seizures stage is provided in the Table 1 . Mice were observed continuously for at least 1 h with data record regarding time to achievement of respective Racine stage and duration of seizures. The susceptibility score was calculated as the follow formula: (0.2)(1/PC latency) + (0.3)(1/GC latency) + (0.5)(1/TC latency), wherein PC referred to partial clonus involving face, head or forelimb, GC referred to general clonus, including limbs and tail, TC referred to generalize tonic clonic seizure. Table 1 Seizures stage estimated according to the Racine scale Seizures stage Racine scale Stage 1 immobilization or lying on belly Stage 2 head nodding and facial, forelimb, or hindlimb myoclonus Stage 3 continuous whole-body myoclonus, myoclonic jerks or tail held up stiffly Stage 4 rearing, tonic seizure or falling down on its side Stage 5 tonic-clonic seizure, falling down on its back, wild rushing, jumping or death Stereotactic injection of lentivirus to hippocampus Surgery was performed using a mice brain stereotactic apparatus (RWD, Shenzhen, China). Microinjection of lentivirus labelled with green fluorescent protein (GFP) was administered into the hippocampus of both hemispheres as described in our previous study [19]. The lentivirus used in our study including Lv-METTL14 OE and Lv-YTHDC1 (Table 2 ), all lentivirus were purchased from Shanghai Jikai Gene Chemical Technology Co., Ltd. Briefly, anesthetized mice were fixed on the brain stereotactic apparatus, and small bilateral holes were drilled into the skull following the coordinates (relative to bregma), AP-2.1 mm, ML ± 1.9 mm, DV-2.55 mm from the dura. Lentivirus solution (0.1 µl) was injected at a rate of 0.1 µl per min sequentially into each side of the hippocampus. Penicillin powder was used to prevent infection. After surgery, mice were placed in a warm environment until they regained consciousness, and then the animals were allowed to recover in their home cages for 3 weeks. Table 2 Information for the lentivirus used in this study lentivirus Vector Component Sequence Target Sequence Mettl14(72995-1)-p1 GV513 Ubi-MCS-CBh-gcGFP-IRES-puromycin AGGTCGACTCTAGAGGATCCCGCCACCATGGATAGCCGCCTGCAGGAG Mettl14(72995-1)-p2 GV513 Ubi-MCS-CBh-gcGFP-IRES-puromycin ACCGTAAGTTATGTGCTAGCCTACCGAGGAGTAAAGCCGCCTC Ythdc1(75759-4)-p1 GV513 Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin AGGTCGACTCTAGAGGATCCCGCCACCATGGCGGCCGACAGCCGGGAG Ythdc1(75759-4)-p2 GV513 Ubi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin TCCTTGTAGTCCATACCTCTTCGATAACGACCTCTCTCCC GFP immunofluorescence Mice with lentivirus injection were rapidly anaesthetized with 10% sodium pentobarbital (80 mg/kg, i.p.). Brains were postfixed for 24 h in the same fixative solution and stored at 4 ℃. After dehydration with 30% sucrose in 0.01 M PBS for 24 h, 30-µm-thick coronal sections were obtained on a cryostat and immediately subjected to immunofluorescent staining. All images were captured by the ZEISS fluorescence microscope (ZEISS, Germany). Immunohistochemistry Free-floating sections were treated with 3% H 2 O 2 for 15 min to deplete endogenous peroxidase activity and then blocked by 5% goat serum containing 0.1% Triton X-100 for 2 h at room temperature. Sections were subsequently incubated with the rabbit anti-METTL14 primary antibody (1:500, abclonal, A8530), rabbit anti-YTHDC1 primary antibody (1:500, Abcam, Ab220159) or rabbit anti-m6A primary antibody (1:1000, Abclonal) for 2 h at room temperature at 4°C overnight. Sections were then incubated further in secondary reagents including biotinylated rabbit anti-goat immunoglobulin (CWBIO) for 2 h. Diaminobenzidine tetrahydrochloride (DAB) (ZSGB-BIO) was used as a peroxidase substrate. Sections were washed with the 0.01 M PBS for three times, and were mounted with resinene after desiccation. All images were captured in the same conditions using a Nikon microscope (Nikon, Japan). Western blot Mice were anesthetized and the hippocampus was rapidly removed following decapitation. The samples were homogenized in lysis buffer and the protein concentration was measured using a BCA Assay Kit (CWBIO). Protein extracts were then separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto PVDF membranes. Then, the membranes were blocked with 5% nonfat milk for 2 h and incubated with the primary antibodies which includes rabbit anti-METTL14 primary antibody (1:500, abclonal, A8530), rabbit anti-YTHDC1 primary antibody (1:1000, Abcam, Ab220159) or mouse anti-β-actin primary antibody (1:2000, Origene, TA811000) for 2 h at room temperature, then at 4°C overnight. After washing three times in 0.02 M Tween-Tris buffered solution, the membranes were incubated with horseradish peroxidase (HRP)-conjugated donkey anti-rabbit or donkey anti-goat polyclonal secondary antibodies (1:1000, CWBIO) for 2 h. The signals were detected by an enhanced chemiluminescence (ECL) system (CWBIO). The protein levels were quantified by densitometry using the NIH ImageJ software (NIH, Bethesda, MD, USA). RT-qPCR Mice were decapitated, with the orbital blood and hippocampus collected and frozen at -80°C. Total RNA was extracted by Trizol® reagent (CWBIO) according to the manufacturer’s instruction. The RNA purity was determined by the A260 nm/A280 nm absorption ratio ranging from 1.8 to 2.0. cDNA synthesis was performed with the RevertAid™ FirstStrand cDNA Synthesis Kit (Fermentas) according to the manufacturer’s instructions using 2 µg of total RNA. Gene expression was determined by Roche LC480 real-time PCR system with TB Green™ Premix Ex Taq™ II (Takara). The primers were designed with Primer 3 software, the sequences are given in Table 3 . The PCR cycling conditions were 30 sec at 95°C followed by 40 cycles at 95°C for 10 sec, and further 60°C for 30 sec. The 2 −△△Ct method was used to determine the relative gene expression as described in our previous study [20]. Table 3 Information for the primers used in this study Genes Primers Sequence 5’-3’ c-Fos forwards reverse TCTCTAGTGCCAACTTTATCCC GAGATAGCTGCTCTACTTTGCC Egr1 forwards reverse CCCAGGACTTAAAGGCTCTTAA TGGTCACTACGACTGAAGTTAC Arc forwards reverse GACTATACCGTTAGCCCCTATG CTCGAAGATCTGTGTATCCACA NPAS4 forwards reverse GCAGTCATGTACCGATCCACCAAG GCGAGTGTAGATGCAGGCAAGAC METTL3 forwards reverse CTTCAGCAGTTCCTGAATTAGC ATGTTAAGGCCAGATCAGAGAG METTL14 forwards reverse ACCAAAATCGCCTCCTCCCAAATC AGCCACCTCTTTCTCCTCGGAAG WTAP forwards reverse CTGACAAACGGACCAAGTAATG AAAGTCATCTTCGGTTGTGTTG FTO forwards reverse GTTCACAACCTCGGTTTAGTTC CATCATCATTGTCCACATCGTC ALKBH5 forwards reverse TCCTTTCCCTTCCCTTCTCCACTG TGAAGCGGAGGAGGCACCAG YTHDC1 forwards reverse AGTGACTCTGGTTCTGAATCTG CTGGTTTGATCTTTTCGGACAG YTHDC2 forwards reverse GAGAATTGGGCTGTCGTTAAAG TGAAGCAGGATGAAATCGTACT YTHDF1 forwards reverse ATGACAATGACTTTGAGCCCTA AGGGAGTAAGGAAATCCAATGG YTHDF2 forwards reverse ACTTCTCAGCATGGGGAAATAA TATTCATGCCAGGAGCCTTATT YTHDF3 forwards reverse GCTCCACCAACCCAACCAGTTC CTGAGGTCCTTGTTGCTGCTGTG GAPDH forwards reverse ACCACCATGGAGAAGGCTGG CTCAGTGTAGCCCAGGATGC m6A-dot blot Total RNA was extracted with Trizol reagent and denatured by heating at 65℃for 5 min. Next, RNA was spotted on Biodyne Nylon Transfer Membranes (Thermo Scientific) and cross-linked by 365 nm UVP for 15 min. After blocked with 5% nonfat milk for 2 h, m6A levels were measured using an anti-m6A antibody (Abclonal, A17924) through Western blot. m6A-ELISA Levels of m6A modification on total RNA were assessed using the m6A RNA Methylation Quantification Kit (Colorimetric) (abcam, ab185912) according to manufacturer’s instruction. Briefly, following addition of 80 µl binding solution in each well, the negative control, diluted positive control and 200 ng sample (1–8 µl) RNA were separately coated on the designated wells and incubated at 37 ℃ for 90 min, followed by incubation in diluted capture antibody at room temperature for 60 min and further in detection antibody solution for another 30 min. The developer and stop solution was used for signal detection. The m6A levels were quantified by reading the absorbance of each well at a wavelength of 450 nm (OD450), and then calculations were performed based on the standard curve. Statistical analysis Statistical analysis in this study was conducted with GraphPad Prism 8.0 software (GraphPad Software, San Diego, CA, USA). Data are presented as the mean ± SEM. Student’s t -test was used for two-group comparison, ANOVAs with Bonferroni’s post hoc test was used for multiple comparisons among more than two groups. p < 0.05 was considered statistically significant. Results Acute seizures induces the decreased level of total m6A in the hippocampus of mice To determine whether m6A could participate in seizures, we used m6A-ELISA assay to assess the hippocampal m6A in PTZ treated mice and the result showed that hippocampal m6A content was significantly decreased in mice with seizures when compared with the normal saline (NS) mice (t = 4.717, p = 0.0001) (Fig. 1 , A). Next, we verified the m6A level by immunohistochemistry assay, and the results showed that PTZ-treated mice exhibited significantly decreased level of m6A compared to normal saline (NS) mice (t = 5.135, p = 0.0021) (Fig. 1 , B). In addition, m6A-dot blot further showed that hippocampal m6A level was decreased in PTZ-treated mice when compared with the NS group (t = 3.420, p = 0.0091) (Fig. 1 , C). These results suggested that acute seizures induced by PTZ injection could down-regulate the hippocampal m6A level. Betaine treatment mitigates seizure discharge and neuron overactivity Betaine, considered as a m6A agonist, could significantly elevate the systemic m6A levels [21]. We investigated the effect of betaine on acute seizures and hippocampal m6A level in PTZ treated mice. One-way ANOVA results showed that the m6A level (F (2,12) = 20.54, p = 0.0001) was significant different in NS, PTZ and Betaine-PTZ group. Bonferroni post-test analysis revealed that betaine (600mg/kg) treatment increased the level of m6A compared to mice with seizures (t = 6.408, p = 0.0001) (Fig. 2 , A). Then behavioral tests showed that 600 mg/kg, but not 200 mg/kg, dosage suppressed seizure-like behaviors, as reflected by reduced seizure latency (t = 3.037, p < 0.05) and seizure grade (t = 2.637, p < 0.05), and alleviation of susceptibility score (t = 2.754, p < 0.05) (Fig. 2 , B). Moreover, transcription of immediate early genes (IEGs) in neurons is highly sensitive to neuronal activity induced by sensory and behavioral stimuli [22]. Epileptic seizures can induce rapid and dramatic changes in IEGs expression [23], which have been used to estimate the degree of seizure-like activity [24]. We next examined the effect of betaine on the expression of IEGs including c-Fos, Egr1, Arc and NPAS4, at 1 h after PTZ injection. RT-qPCR analysis of hippocampal tissues showed remarkably increasing mRNA levels of c-Fos (t = 6.013, p < 0.0001), Egr1 (t = 5.512, p = 0.0001), Arc (t = 5.168, p = 0.0003) and NPAS4 (t = 5.732, p < 0.0001) in mice injected with PTZ compared to mice injected with NS group, while betaine treatment remarkably decreased the expression of c-Fos (t = 6.742, p < 0.0001), Egr1 (t = 5.052, p = 0.0004), Arc (t = 5.199, p = 0.0003) and NPAS4 (t = 4.931, p = 0.0005) (Fig. 6 B, C) (Fig. 2 , C). All these results indicated that systematic m6A agonist treatment mitigated PTZ-induced seizure-like behaviors and inhibited neuron overactivity, which might be due to the enhanced hippocampal m6A level. METTL14-dependent m6A modification participates in acute seizures As m6A modification is installed by m6A methyltransferases (METTL3, METTL14 and WTAP), and removed by m6A demethylases (FTO and ALKBH5) [25], we used RT-qPCR to detect the relative expression levels of m6A methyltransferases and dimethyl transferases that might lead to altered hippocampal m6A level. We found that only the METTL14 mRNA level was significantly lower in the hippocampus of PTZ-treated mice (t = 2.646, p = 0.0151) (Fig. 3 , A). Western blot confirmed a reduced level of METTL14 in the hippocampus of PTZ mice (t = 5.205, p = 0.0004) (Fig. 3 , B). Furthermore, we investigated the expression of METTL14 by using immunohistochemistry, and representative images of METTL14-positive cells are shown in Fig. 3 , C. The results showed that PTZ stimulation decreased the expression of METTL14 (t = 4.265, p = 0.0053) (Fig. 3 , C). Thus, the decreased hippocampal m6A level in mice with acute seizures might be due to the down-regulated METTL14. METTL14 over-expression in hippocampus of mice attenuates seizure discharge and neuron overactivity To further explore the role of METTL14 in acute seizures induced by PTZ stimulation, METTL14 over-expression lentivirus was injected into dentate gyrus (DG) using stereotaxic apparatus (Fig. 4 , A). RT-qPCR and western blot demonstrated that both the mRNA level (t = 4.971, p < 0.0001) (Fig. 4 , B) and the protein level (t = 3.485, p = 0.0059) (Fig. 4 , C, D) of METTL14 were up-regulated significantly in METTL14 over-expression lentivirus injection group compared with the control GFP-labeled lentivirus injection group. Furthermore, m6A dot-blot verified METTL14 over-expression could significantly increase the levels of m6A (t = 2.515, p = 0.0361) (Fig. 4 , E). Importantly, seizure latency (t = 2.186, p = 0.0388), seizure grade (t = 2.237, p = 0.0358), and susceptibility score (t = 2.550, p = 0.0179) were also ameliorated in acute seizure condition after METTL14 up-regulation (Fig. 4 , F, G and H). Similarly, we also examined the effect of METTL14 over-expression on the expression of IEGs. RT-qPCR analysis revealed that METTL14 over-expression could remarkably decrease mRNA levels of c-Fos (t = 5.232, p = 0.0001), Egr1 (t = 3.142, p = 0.0161), Arc (t = 5.007, p = 0.0002) and NPAS4 (t = 4.166, p = 0.0014) induced by PTZ compared to mice injected with control lentivirus (Fig. 4 , I). These findings demonstrated that METTL14 over-expression could attenuate PTZ-induced seizure-like behaviors and inhibited neuron overactivity. YTHDC1-dependent m6A modification participates in acute seizures m6A modification has been shown affected by m6A reader proteins (YTHDC1, YTHDC2, YTHDF1, YTHDF2 and YTHDF3), which bind to the m6A methylation site to alter gene regulation, such as mRNA splicing, nuclear exporting, translation and decay [26]. We used RT-qPCR to detect mRNA levels of these “readers”, which showed only the mRNA level of YTHDC1 was decreased in the hippocampus of PTZ treated mice (t = 2.693, p = 0.0136) (Fig. 5 , A). The protein variation of YTHDC1 was also demonstrated by western blot analysis (t = 13.29, p < 0.0001) (Fig. 5 , B and C). In addition, the YTHDC1 protein level was also up-regulated by METTL14 over-expression (t = 6.182, p = 0.0001) (Fig. 5 , D). Furthermore, immunohistochemistry assay demonstrated the expression of YTHDC1 was decreased induced by PTZ administration (t = 7.822, p = 0.0002). These results indicated that YTHDC1 may be a key “readers” of m6A in acute seizures. YTHDC1 over-expression in hippocampus of mice alleviates seizure discharge and neuron overactivity We further determined the potential role of YTHDC1 in acute seizures. YTHDC1 over-expression lentivirus was injected into dentate gyrus (DG) to promote YTHDC1 expression (Fig. 6 , A). RT-qPCR and western blot demonstrated that YTHDC1 over-expression lentivirus injection could up-regulate both the mRNA level (t = 4.971, p < 0.0001) (Fig. 6 , B) and the protein level (t = 3.485, p = 0.0059) (Fig. 6 , C) of YTHDC1 increased significantly when compared with the control lentivirus. Then behaviour tests revealed that YTHDC1 over-expression could significantly ameliorate seizure latency (t = 2.119, p = 0.0456) (Fig. 6 , D), seizure grade (t = 2.853, p = 0.0095) (Fig. 6 , E), and susceptibility score (t = 5.097, p < 0.0001) (Fig. 6 , F) in acute seizure condition. Additionally, RT-qPCR analysis revealed that the mRNA levels of c-Fos (t = 4.409, p = 0.0006), Egr1 (t = 2.731, p = 0.0357), Arc (t = 4.762, p = 0.0002) and NPAS4 (t = 3.084, p = 0.0137) were significantly decreased in YTHDC1 OE-PTZ mice compared to GFP-PTZ group (Fig. 6 , G). Therefore, our data indicated that YTHDC1 over-expression could attenuate PTZ-induced seizure-like behaviors and suppress neuron overactivity. Discussion Epilepsy is a transient brain dysfunction syndrome characterized by seizures caused by hippocampal neuron injury [27, 28], thus identification of novel therapeutic targets for epilepsy is urgently needed. Our current study demonstrated that low expression of METTL14 could induce m6A level and YTHDC1 expression down-regulated in the hippocampus of mice under the acute seizures condition. While m6A agonist treatment, or hippocampal-specific over-expression of METTL14 or YTHDC1, could significantly mitigate seizure discharge and restore the abnormal activation of neurons. Therefore, we provide new ideas for alleviating the progression of acute seizures, particularly targeting the METTL14 /YTHDC1 mediated m6A modification. The N6-methyladenine (m6A) modification is one of the most common posttranscriptional RNA modifications in eukaryotes. Although m6A modification is involved in epileptogenesis, such as a recent research verified that m6A modification play a vital role in hippocampal neuron injury and the progression of epilepsy in a rat model [29]; another study also demonstrated that m6A modification was related to immune cell components, cell death patterns and glucose metabolism in the pathogenesis of epilepsy [14]. The results of our tests similarly showed that in acute seizures induced by PTZ injection, the m6A level was significantly reduced in the hippocampal of mice, as revealed by m6A-ELISA, m6A-IHC and m6A-dot blot tests, indicating lower m6A level could aggravate the progression of epilepsy. A study has validated the promotion of m6A synthesis could exert antiepileptic effects [30]. As a major methyl donor, researches have reported that betaine (N,N,N-trimethylglycine) treatment could significantly restore the m6A level [31, 32]. Our study also demonstrated the level of m6A in the hippocampus of mice increased significantly after betaine administration, as shown by m6A-dot blot assay. Beneficial effects of betaine in neurodegeneration, excitatory and inhibitory imbalance and against oxidative stress in the central nervous system (CNS) have been verified [33]. Herein, we found betaine treatment could alleviate seizure-like behaviors induced by PTZ stimulation, as reflected by reduced seizure latency and seizure grade, and alleviation of susceptibility score. Previous study also reported that patients received metabolic treatment comprising betaine could stop the occurrence of seizures [34]. Subsequently, because immediate early genes (IEGs) are coordinately activated in response to epileptic seizures [35]. So, we also detected the impact of betaine on the expression of IEGs (c-Fos, Egr1, Arc and NPAS4) induced by PTZ injection in our present study, and found PTZ kindling could remarkably increase the expression of c-Fos, Egr1, Arc and NPAS4, while betaine administration could reverse the levels of IEGs, suggesting betaine could inhibit the abnormal overactivity of neuron under acute seizures condition. These results suggest an close association between m6A and epilepsy. m6A modification is installed by m6A methyltransferases (METTL3, METTL14 and WTAP), and removed by m6A demethylases (FTO and ALKBH5) under different conditions [25]. Researches have shown m6A-related proteins are expressed in almost all cells and participates in the nervous system [36]. Previous study has identified seven significant m6A regulator genes including HNRNPC, WATP, RBM15, YTHDC1, YTHDC2, CBLL1, and RBMX in epileptic and non-epileptic patients [14]. We then explored the potential specific protein involved in the m6A modification after PTZ stimulation. In line with the decreased hippocampal m6A level, we found remarkably reduced METTL14 mRNA and protein levels in the PTZ treated mice, leaving other proteins unchanged, indicating METTL14 may play a key role in acute seizures induced by PTZ kindling. Deletion of METTL14 impairs striatal-mediated behavior by reducing m6A levels in the striatum [37]. Critically, we also found that hippocampal specific over-expression of METTL14 could increase m6A level significantly, as well as alleviate seizure-like behaviors and decrease the expression of IEGs induced by PTZ stimulation. These results further supports that METTL14-mediated m6A modification is functionally involved in the regulation of seizure-like behaviors. After demonstrating the effect of METTL14 in regulating hippocampal m6A level on acute seizures, we sought to validate the role of m6A reader proteins (YTHDC1, YTHDC2, YTHDF1, YTHDF2 and YTHDF3) [38]. As PTZ challenges only lead to reduced expression of hippocampal YTHDC1, and METTL14 over-expression increased the expression of YTHDC1, so we can conclude YTHDC1 may be the key m6A-binding protein under acute seizures condition. Although previous study showed YTHDF2 was up-regulated in rat epileptic models induced by lithium chloride and pilocarpine [29]. Exactly, YTHDC1 is preferentially expressed in the hippocampus of mouse brains. A study has verified genetic deletion of YTHDC1 impaired the learning and memory of mice [39]. Electrophysiological data showed that YTHDC1-deficient neurons had reduced spine density and decreased amplitude and frequency of miniature excitatory postsynaptic currents [39]. We then also determined the role of YTHDC1 in acute seizures induced by PTZ kindling, and the results revealed that hippocampal-specific over-expression of YTHDC1 could alleviate seizure-like behaviors, as well as decrease the expression of IEGs induced by PTZ administration. According to these findings, we propose that the METTL14-YTHDC1-m6A axis plays a key role during seizure-like behaviors. Future studies should devote more effort to uncovering the key target genes that modified by m6A and participates in epilepsy. Conclusion Taken together, the present work is the first study to show that METTL14/YTHDC1-mediated m6A modification could participate in seizure-like behaviors and targeting to m6A modification might provide novel therapeutic ideas for epilepsy. Declarations Author contributions Xiaolin Zhong and Ling Chen designed the experiments, performed PCR and Western Blot tests, performed data analysis and drafted the manuscript. Yajuan Wang, Yue Liang and Yanmei Huang performed stereotactic injection and behavior tests. Zuyao Chen and Wenyu Cao performed ELISA and Immunohistochemistry tests. Xuyu Zu and Jianghua Liu conceived the project and provided funds and manuscript revision. Funding This work was supported by the National Natural Science Foundation of China (No. (grants: 82271506 to Xuyu Zu, 81873651 and 82270939 to Jianghua Liu) , the Hunan Provincial Natural Science Foundation of China (2023JJ30553 to Xiaolin Zhong and 2023JJ30537 to Ling Chen) and the Education Project of Hunan Provincial (23A0341). Ethical Approval The project was approved by the Ethics Committee of the University of South China (2022usc05xs07). Consent to Participate Informed consent was obtained from all individual participants included in the study. Consent for Publication All authors have approved for publication. Competing Interests The authors declare no competing interests. References Pitkanen A, Lukasiuk K (2011) Mechanisms of epileptogenesis and potential treatment targets. Lancet Neurol 10:173-186. https://doi.org/10.1016/S1474-4422(10)70310-0 Fisher R S, Acevedo C, Arzimanoglou A et al (2014) ILAE official report: a practical clinical definition of epilepsy. Epilepsia 55:475-482. https://doi.org/10.1111/epi.12550 Loscher W (2020) The holy grail of epilepsy prevention: Preclinical approaches to antiepileptogenic treatments. Neuropharmacology 167:107605. https://doi.org/10.1016/j.neuropharm.2019.04.011 Chen Z, Zhong X, Xia M et al (2021) The roles and mechanisms of the m6A reader protein YTHDF1 in tumor biology and human diseases. Mol Ther Nucleic Acids 26:1270-1279. https://doi.org/10.1016/j.omtn.2021.10.023 Jiang X, Liu B, Nie Z et al (2021) The role of m6A modification in the biological functions and diseases. Signal Transduct Target Ther 6:74. https://doi.org/10.1038/s41392-020-00450-x Bokar J A, Rath-Shambaugh M E, Ludwiczak R et al (1994) Characterization and partial purification of mRNA N6-adenosine methyltransferase from HeLa cell nuclei. Internal mRNA methylation requires a multisubunit complex. J Biol Chem 269:17697-17704. Jia G, Fu Y, Zhao X et al (2011) N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat Chem Biol 7:885-887. https://doi.org/10.1038/nchembio.687 Zheng G, Dahl J A, Niu Y et al (2013) ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Mol Cell 49:18-29. https://doi.org/10.1016/j.molcel.2012.10.015 Al Hayek A A, Al Dawish M A (2022) Evaluation of Patient-Reported Satisfaction and Clinical Efficacy of Once-Weekly Semaglutide in Patients with Type 2 Diabetes: An Ambispective Study. Adv Ther 39:1582-1595. https://doi.org/10.1007/s12325-022-02053-0 Wang X, He C (2014) Reading RNA methylation codes through methyl-specific binding proteins. RNA Biol 11:669-672. https://doi.org/10.4161/rna.28829 Zhang N, Ding C, Zuo Y et al (2022) N6-methyladenosine and Neurological Diseases. Mol Neurobiol 59:1925-1937. https://doi.org/10.1007/s12035-022-02739-0 Lv J, Xing L, Zhong X et al (2023) Role of N6-methyladenosine modification in central nervous system diseases and related therapeutic agents. Biomed Pharmacother 162:114583. https://doi.org/10.1016/j.biopha.2023.114583 Dong Z, Min F, Zhang S et al (2023) EGR1-Driven METTL3 Activation Curtails VIM-Mediated Neuron Injury in Epilepsy. Neurochem Res 48:3349-3362. https://doi.org/10.1007/s11064-023-03950-8 Liu X, Sun Q, Cao Z et al (2022) Identification of RNA N6-methyladenosine regulation in epilepsy: Significance of the cell death mode, glycometabolism, and drug reactivity. Front Genet 13:1042543. https://doi.org/10.3389/fgene.2022.1042543 Peng L, Li C, Tang X et al (2023) Blocking salt-inducible kinases with YKL-06-061 prevents PTZ-induced seizures in mice. Brain Behav e3305. https://doi.org/10.1002/brb3.3305 El Yacoubi M, Ledent C, Parmentier M et al (2008) Evidence for the involvement of the adenosine A(2A) receptor in the lowered susceptibility to pentylenetetrazol-induced seizures produced in mice by long-term treatment with caffeine. Neuropharmacology 55:35-40. https://doi.org/10.1016/j.neuropharm.2008.04.007 Zhao G, He F, Wu C et al (2018) Betaine in Inflammation: Mechanistic Aspects and Applications. Front Immunol 9:1070. https://doi.org/10.3389/fimmu.2018.01070 Musto A E, Rosencrans R F, Walker C P et al (2016) Dysfunctional epileptic neuronal circuits and dysmorphic dendritic spines are mitigated by platelet-activating factor receptor antagonism. Sci Rep 6:30298. https://doi.org/10.1038/srep30298 Li M, Zhong X, Zhao Z et al (2022) The expression of m6A enzymes in the hippocampus of diabetic cognitive impairment mice and the possible improvement of YTHDF1. Brain Res 1777:147766. https://doi.org/10.1016/j.brainres.2021.147766 Zhong X, Cao W, Zhao H et al (2020) MicroRNA-32-5p knockout eliminates lipopolysaccharide-induced depressive-like behavior in mice through inhibition of astrocyte overactivity. Brain Behav Immun 84:10-22. https://doi.org/10.1016/j.bbi.2019.11.001 Hao J, Huang S, Wang D et al (2021) Loss of WTAP Impairs Early Parthenogenetic Embryo Development. Animals (Basel) 11:https://doi.org/10.3390/ani11061675 He Q, Wang J, Hu H (2019) Illuminating the Activated Brain: Emerging Activity-Dependent Tools to Capture and Control Functional Neural Circuits. Neurosci Bull 35:369-377. https://doi.org/10.1007/s12264-018-0291-x Kalinina A, Krekhno Z, Yee J et al (2022) Effect of repeated seizures on spatial exploration and immediate early gene expression in the hippocampus and dentate gyrus. IBRO Neurosci Rep 12:73-80. https://doi.org/10.1016/j.ibneur.2021.12.008 Baxendale S, Holdsworth C J, Meza Santoscoy P L et al (2012) Identification of compounds with anti-convulsant properties in a zebrafish model of epileptic seizures. Dis Model Mech 5:773-784. https://doi.org/10.1242/dmm.010090 He L, Li H, Wu A et al (2019) Functions of N6-methyladenosine and its role in cancer. Mol Cancer 18:176. https://doi.org/10.1186/s12943-019-1109-9 Liu S, Li G, Li Q et al (2020) The roles and mechanisms of YTH domain-containing proteins in cancer development and progression. Am J Cancer Res 10:1068-1084. Thijs R D, Surges R, O'Brien T J et al (2019) Epilepsy in adults. Lancet 393:689-701. https://doi.org/10.1016/S0140-6736(18)32596-0 Wang X, Zhang W, Ge P et al (2022) Parthanatos participates in glutamate-mediated HT22 cell injury and hippocampal neuronal death in kainic acid-induced status epilepticus rats. CNS Neurosci Ther 28:2032-2043. https://doi.org/10.1111/cns.13934 Tian M Q, Li J, Shu X M et al (2023) The increase of Nrf2 m6A modification induced by FTO downregulation promotes hippocampal neuron injury and aggravates the progression of epilepsy in a rat model. Synapse 77:e22270. https://doi.org/10.1002/syn.22270 Zaman T, Helbig K L, Clatot J et al (2020) SCN3A-Related Neurodevelopmental Disorder: A Spectrum of Epilepsy and Brain Malformation. Ann Neurol 88:348-362. https://doi.org/10.1002/ana.25809 Hao J, Hu H, Jiang Z et al (2020) microRNA-670 modulates Igf2bp1 expression to regulate RNA methylation in parthenogenetic mouse embryonic development. Sci Rep 10:4782. https://doi.org/10.1038/s41598-020-61816-3 Zhou X, Chen J, Chen J et al (2015) The beneficial effects of betaine on dysfunctional adipose tissue and N6-methyladenosine mRNA methylation requires the AMP-activated protein kinase alpha1 subunit. J Nutr Biochem 26:1678-1684. https://doi.org/10.1016/j.jnutbio.2015.08.014 Bhatt M, Di Iacovo A, Romanazzi T et al (2023) Betaine-The dark knight of the brain. Basic Clin Pharmacol Toxicol 133:485-495. https://doi.org/10.1111/bcpt.13839 Gales A, Masingue M, Millecamps S et al (2018) Adolescence/adult onset MTHFR deficiency may manifest as isolated and treatable distinct neuro-psychiatric syndromes. Orphanet J Rare Dis 13:29. https://doi.org/10.1186/s13023-018-0767-9 Tsukada T, Sakata-Haga H, Shimada H et al (2021) Mid-pregnancy maternal immune activation increases Pax6-positive and Tbr2-positive neural progenitor cells and causes integrated stress response in the fetal brain in a mouse model of maternal viral infection. IBRO Neurosci Rep 11:73-80. https://doi.org/10.1016/j.ibneur.2021.07.003 Du K, Zhang L, Lee T et al (2019) m(6)A RNA Methylation Controls Neural Development and Is Involved in Human Diseases. Mol Neurobiol 56:1596-1606. https://doi.org/10.1007/s12035-018-1138-1 Koranda J L, Dore L, Shi H et al (2018) Mettl14 Is Essential for Epitranscriptomic Regulation of Striatal Function and Learning. Neuron 99:283-292 e285. https://doi.org/10.1016/j.neuron.2018.06.007 Zhang J, Bai R, Li M et al (2019) Excessive miR-25-3p maturation via N(6)-methyladenosine stimulated by cigarette smoke promotes pancreatic cancer progression. Nat Commun 10:1858. https://doi.org/10.1038/s41467-019-09712-x Shi H, Zhang X, Weng Y L et al (2018) m(6)A facilitates hippocampus-dependent learning and memory through YTHDF1. Nature 563:249-253. https://doi.org/10.1038/s41586-018-0666-1 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 05 Jan, 2024 Submission checks completed at journal 04 Jan, 2024 Editor assigned by journal 04 Jan, 2024 First submitted to journal 12 Dec, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3743108","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":265423485,"identity":"b595b972-2955-4fa5-8698-14ebfdfeae91","order_by":0,"name":"Xiaolin Zhong","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Xiaolin","middleName":"","lastName":"Zhong","suffix":""},{"id":265423486,"identity":"486bd71c-d4ba-4010-b083-9ef5c862e2ae","order_by":1,"name":"Ling Chen","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Ling","middleName":"","lastName":"Chen","suffix":""},{"id":265423487,"identity":"b932fd11-47fc-4371-aab2-383eecd30cd2","order_by":2,"name":"Yajuan Wang","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Yajuan","middleName":"","lastName":"Wang","suffix":""},{"id":265423488,"identity":"4812e0ff-3e4a-418f-b0cf-adeb4da1f58c","order_by":3,"name":"Yue Liang","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Yue","middleName":"","lastName":"Liang","suffix":""},{"id":265423489,"identity":"46471d0b-68fb-4a80-8a48-751fc7a0eda0","order_by":4,"name":"Yanmei Huang","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Yanmei","middleName":"","lastName":"Huang","suffix":""},{"id":265423490,"identity":"d339ec4f-f840-4ad0-9699-851217e94d67","order_by":5,"name":"Zuyao Chen","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Zuyao","middleName":"","lastName":"Chen","suffix":""},{"id":265423491,"identity":"8252d6ec-f812-470a-9288-3017c439b226","order_by":6,"name":"Wenyu Cao","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Wenyu","middleName":"","lastName":"Cao","suffix":""},{"id":265423492,"identity":"6c515d8f-86f7-4b43-9575-616679e4dfec","order_by":7,"name":"Jianghua Liu","email":"","orcid":"","institution":"University of South China","correspondingAuthor":false,"prefix":"","firstName":"Jianghua","middleName":"","lastName":"Liu","suffix":""},{"id":265423493,"identity":"ae7f142d-64cc-48d7-8214-360dedc3ee0b","order_by":8,"name":"Xuyu Zu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA5UlEQVRIiWNgGAWjYPACCR429uZjYCYbO3FabGT4eY6lMTAkALUwE6clzUZyRo4ZWAsDIS3yQJXSvG2HeQzOnPn24OOPbfJ8zAyMHz7m4NbCOCMtDaLleO92wxkJtw3bmBmYJWduw62FWSL5GNSWs9ukeRJuMwK1sDHz4tHCJpHYBtFyI+cZSIs9QS08EFvSeIDeZwNpSSSoRYLnWbLlnHM2PMBANpOckXY7uY2ZsRmvX+TbcwxvvCmTsAdG5TOJDza3bee3Nx/88BGPFhBg4kHlMzbgVw9S8oOgklEwCkbBKBjRAABbMkiZ4LquVgAAAABJRU5ErkJggg==","orcid":"","institution":"University of South China","correspondingAuthor":true,"prefix":"","firstName":"Xuyu","middleName":"","lastName":"Zu","suffix":""}],"badges":[],"createdAt":"2023-12-12 09:59:30","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3743108/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3743108/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":49305482,"identity":"83d08ece-59f3-462e-b255-93e03e90d37b","added_by":"auto","created_at":"2024-01-08 11:23:02","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2228296,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe total m6A level in the hippocampus of mice induced by PTZ kindled. \u003c/strong\u003e(\u003cstrong\u003eA\u003c/strong\u003e) Total m6A level in the hippocampus of PTZ-induced mice determined by using ELISA kits (n=12 per group). (\u003cstrong\u003eB\u003c/strong\u003e) Immunohistochemical labeling and the quantitative analysis of the average optical density (OD) of m6A in the hippocampus of PTZ-induced mice (n=4 per group), Bar=200 μm. (\u003cstrong\u003eC\u003c/strong\u003e) Total m6A level in the hippocampus of PTZ-induced mice determined by using dot blot assay (n=5 per group). Data are shown as means ± SEM. \u003csup\u003e**\u003c/sup\u003e p\u0026lt;0.01 and \u003csup\u003e***\u003c/sup\u003e p\u0026lt;0.001 by Student’s t-test for the two-groups comparison.\u003c/p\u003e","description":"","filename":"Figure.1.png","url":"https://assets-eu.researchsquare.com/files/rs-3743108/v1/97df9b5d369ea5fce2d47b1a.png"},{"id":49305950,"identity":"64c4f816-fcbc-4b1d-bedd-d628daca03da","added_by":"auto","created_at":"2024-01-08 11:31:02","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1014133,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effects of betaine on the seizure-like behaviors and neuron activity induced by PTZ kindling. (A) \u003c/strong\u003eThe effect of 600mg/kg betaine intervention on the level of m6A in the hippocampus of PTZ-induced mice determined by m6A-dot blot assay (n=5 for each group).\u003cstrong\u003e(B-D) \u003c/strong\u003eThe effects of intraperitoneal injection of betaine with dose of 200 mg/kg or 600 mg/kg on the seizure-like behaviors induced by PTZ injection (n=7-9 for each group). \u003cstrong\u003e(E)\u003c/strong\u003e The effects of intraperitoneal injection of betaine with dose of 600 mg/kg on the levels of mRNA expression of IEGs (c-Fos,Arc, Egr1 and NPAS4) induced by PTZ administration (n=5-8 per group). Data are shown as means ± SEM. * p \u0026lt; 0.05 and *** p \u0026lt; 0.001 by one way ANOVA followed with Bonferroni’s post hoc test for three-groups comparison.\u003c/p\u003e","description":"","filename":"Figure.2.png","url":"https://assets-eu.researchsquare.com/files/rs-3743108/v1/861852c04da73d773ec38634.png"},{"id":49305483,"identity":"54f2f830-df21-499c-aff1-feda5d66b153","added_by":"auto","created_at":"2024-01-08 11:23:02","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":2432781,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of METTL14 in the hippocampus of mice induced by PTZ kindling. (A)\u003c/strong\u003e Levels of m6A methyltransferase mRNAs (METTL3, METTL14 and WTAP) and demethylases (FTO and ALKBH5) in the hippocampus of PTZ-induced mice detected by RT-qPCR (n=12 per group). \u003cstrong\u003e(B) \u003c/strong\u003eThe protein level of METTL14 in the hippocampus of seizure mice (n=6 per group) detected by western blot. \u003cstrong\u003e(C) \u003c/strong\u003eRepresentative immunohistochemistry images and the quantitative analysis of the average optical density (OD) of METTL14 in the hippocampus of NS and PTZ group (Bar=200 µm) (n=6 per group). Data are shown as means ± SEM. * p \u0026lt; 0.05, ** p \u0026lt; 0.01 and *** p\u0026lt;0.001 by Student’s t-test for the two-groups comparison.\u003c/p\u003e","description":"","filename":"Figure.3.png","url":"https://assets-eu.researchsquare.com/files/rs-3743108/v1/897b2f1e27bf1dcf2cb159b6.png"},{"id":49305484,"identity":"adc778d9-8529-4610-b399-efa3bde58305","added_by":"auto","created_at":"2024-01-08 11:23:02","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":2207053,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effects of hippocampal-specific over-expression of METTL14 on the seizure-like behaviors and neuron activity induced by PTZ. (A) \u003c/strong\u003eThe GFP fluorescence demonstrating the site of METTL14 over-expression in the hippocampus, Bar =200 μm. (\u003cstrong\u003eB-D\u003c/strong\u003e) The verification of METTL14 over-expression by RT-qPCR (n=14 for GFP-PTZ group and n=16 for METTL14 OE-PTZ group) and Western Blot (n= 6 for each group). (\u003cstrong\u003eE\u003c/strong\u003e) The effects of METTL14 over-expression on the level of m6A demonstrated by m6A-dot blot (n=5 for each group). (\u003cstrong\u003eF-H\u003c/strong\u003e) The effects of hippocampal specific up-regulation of METTL14 on seizure-like behaviors (n=11-14 for each group). (\u003cstrong\u003eI\u003c/strong\u003e) The effects of hippocampal specific up-regulation of METTL14 on the levels of mRNA expression of IEGs (c-Fos, Arc, Egr1 and NPAS4) induced by PTZ kindling (n=7-8 per group). Data are shown as means ± SEM. * p \u0026lt; 0.05, **p \u0026lt; 0.01 and *** p \u0026lt; 0.001 by Student’s t-test for the two-groups comparison and by one way ANOVA followed with Bonferroni’s post hoc test for three-groups comparison.\u003c/p\u003e","description":"","filename":"Figure.4.png","url":"https://assets-eu.researchsquare.com/files/rs-3743108/v1/24e68c74851e5681ad799783.png"},{"id":49305487,"identity":"9058a1b8-87a8-4f1a-886e-b8ad05b5c9e5","added_by":"auto","created_at":"2024-01-08 11:23:02","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":2653953,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression of YTHDC1 in the hippocampus of PTZ kindled mice . (A) \u003c/strong\u003eAltered mRNA expression levels of reader proteins (YTHDC1, YTHDC2, YTHDF1, YTHDF2 and YTHDF3) induced by PTZ injection (n=12 per group) detected by RT-qPCR. (\u003cstrong\u003eB-C\u003c/strong\u003e) The protein level of YTHDC1 induced by PTZ (n=6 per group) detected by western blot. (\u003cstrong\u003eD\u003c/strong\u003e) The protein level of YTHDC1 influenced by METTL14 over-expression (n=6 per group). (\u003cstrong\u003eE\u003c/strong\u003e) Representative immunohistochemistry images and the quantitative analysis of the average optical density (OD) of YTHDC1 in the hippocampus of NS and PTZ group (Bar=200 µm) (n=4 per group). Data are shown as means ± SEM. * p\u0026lt;0.05 and *** p\u0026lt;0.001 by Student’s t-test for the two-groups comparison.\u003c/p\u003e","description":"","filename":"Figure.5.png","url":"https://assets-eu.researchsquare.com/files/rs-3743108/v1/995706b756d3e0b4585e4160.png"},{"id":49305949,"identity":"5ce6b6de-02fc-4101-9cee-711808ee4b91","added_by":"auto","created_at":"2024-01-08 11:31:02","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1643592,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe effects of hippocampal-specific over-expression of YTHDC1 on the seizure-like behaviors and neuron activity induced by PTZ kindling. (A) \u003c/strong\u003eThe GFP fluorescence demonstrating the site of YTHDC1 over-expression in the hippocampus (Bar=200 μm). (\u003cstrong\u003eB-C\u003c/strong\u003e) The verification of YTHDC1 over-expression by RT-qPCR (n=10 for GFP-PTZ group and n=13 for YTHDC1 OE-PTZ group) and Western Blot (n=6 for each group). (\u003cstrong\u003eD-F\u003c/strong\u003e) The effects of hippocampal specific YTHDC1 over-expression on seizure-like behaviors (n=10-13 for each group). (\u003cstrong\u003eG\u003c/strong\u003e) The effects of hippocampal specific up-regulation of YTHDC1 on the levels of mRNA expression of IEGs (c-Fos, Arc, Egr1 and NPAS4) induced by PTZ kindling (n=7-8 per group). Data are shown as means ± SEM. * p \u0026lt; 0.05, **p \u0026lt; 0.01 and *** p \u0026lt; 0.001 by Student’s t-test for the two-groups comparison and by one way ANOVA followed with Bonferroni’s post hoc test for three-groups comparison.\u003c/p\u003e","description":"","filename":"Figure.6.png","url":"https://assets-eu.researchsquare.com/files/rs-3743108/v1/d8e9577f721398b2f1ca01ee.png"},{"id":49306083,"identity":"77cdfdff-110a-40d6-bd31-63b70dc44d6b","added_by":"auto","created_at":"2024-01-08 11:39:04","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2779937,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3743108/v1/abdc801e-6202-4df2-b7c6-5b969a111265.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"METTL14/YTHDC1-mediated m6A modification in hippocampus improves pentylenetetrazol-induced acute seizures","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEpilepsy is a common neurological disorder characterized by unprovoked and recurrent seizures, which causes significant morbidity and mortality among the youth and adult populations [1]. It is estimated to affect more than 70\u0026nbsp;million people worldwide, resulting in an enormous burden on the patients, families and societies [2]. Even worse, over 30% of individuals with epilepsy are refractory to anti-epileptic drugs, and eventually become chronic cases to whom strong measures such as brain surgery are needed to control symptoms. To combat this disease, it is important to identify new pathogenesis and to develop more efficient therapeutics [3].\u003c/p\u003e \u003cp\u003eN6-methyladenosine (m6A) is the most prevalent internal modification of eukaryotic mRNA. The function of m6A modification, including capping, splicing, and polyadenylation, is regarded as a key factor controlling mammalian protein production [4] and participated in numerous human diseases [5]. In fact, m6A is a dynamic reversible post-transcriptional modification, which includes methylation, demethylation, and recognition. Post-transcriptional modification involves multiple protein molecules, including m6A methyltransferase complex, also known as the m6A \u0026ldquo;writer\u0026rdquo;, which includes methyltransferase-like 3/14 (METTL3/14) and Wilm\u0026rsquo;s tuner 1-associated protein (WTAP) [6]. The enzyme that removes m6A is called demethylase, also known as the m6A \u0026ldquo;eraser\u0026rdquo;, which is mainly composed of fat mass and obesity-associated protein (FTO) [7] and Alk B homolog 5 (ALKBH5) [8]. The enzyme that recognizes m6A and binds to the m6A methylation site to alter gene regulation is called the m6A \u0026ldquo;reader\u0026rdquo;, which referred to as YT521-B homology (YTH) domain family (YTHDF1-3 and YTHDC1-2) [9]. The expression of those enzymes influences m6A levels [10] and participates in the nervous system, thereby affecting neurogenesis, brain volume, learning and memory and consolidation [11]. Recent research elucidated the roles of m6A modifications participated in various neurological disorders, including Alzheimer's disease (AD), Parkinson's disease (PD), depression, cerebral apoplexy and brain injury [12]. Although a recent study identified m6A-related genes may regulate the immunologic process, cell death, drug-response, and glucose metabolism in patients with epilepsy [13, 14], no study has systematically evaluated the role of m6A in epilepsy.\u003c/p\u003e \u003cp\u003eHerein, we examined the m6A level and the expression of m6A-related enzymes in the hippocampus of pentylenetetrazole (PTZ) kindled mice [15], and found hippocampal m6A level was significantly decreased, accompanied by the specific down-regulated METTL14 and YTHDC1. Moreover, m6A agonist treatment, or hippocampal-specific over-expression of METTL14 or YTHDC1, could significantly ameliorate seizure-like behaviors in mice challenged with PTZ. In line with the ameliorated seizure-like behavior, the markers of neuronal activity indicated by the expression of immediate early genes (IEGs) were also decreased after m6A agonist treatment, or hippocampal over-expression of METTL14 or YTHDC1. Thus, we showed that METTL14/YTHDC1-mediated m6A modification could participate in seizure-like behaviors and targeting m6A modification might provide novel therapeutic ideas for epilepsy.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eEight-week-old adult male C57BL/6 mice (WT) were used in this study. All mice were group-housed (5 mice per cage) in a temperature (22\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C) and illumination (12 h light/dark cycle) controlled room, with free access to food and water. The project was approved by the Ethics Committee of the University of South China (2022usc05xs07). The experimental protocol was approved by the Animal Care and Use Committee of the University of South China in compliance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eDrug administration\u003c/h2\u003e \u003cp\u003eMice were treated with a single i.p. injection of pentylenetetrazol (PTZ, Sigma-Aldrich, P6500) at a dose of 50 mg/kg to establish the animal model of acute seizures [16]. Betaine (Sigma-Aldrich, B2629) was dissolved in normal saline, and administrated at a dose of 200 mg/kg or 600 mg/kg, i.p., to mice for 14 days before PTZ injection in reference to previous study [17].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eEvaluation of seizure-like behaviors\u003c/h2\u003e \u003cp\u003eSeizure-like behaviors were observed immediately after PTZ injection. Mice were placed individually in cages immediately after PTZ injection, and the seizure activities were recorded using a video camera. An observer who was blinded to the experimental condition coded the videotapes. The seizure latency referred to the time between PTZ injection and seizure onset, which was the primary metric record. Seizures stage was classified according to the Racine scale [18] and the comprehensive list of seizures stage is provided in the Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. Mice were observed continuously for at least 1 h with data record regarding time to achievement of respective Racine stage and duration of seizures. The susceptibility score was calculated as the follow formula: (0.2)(1/PC latency) + (0.3)(1/GC latency) + (0.5)(1/TC latency), wherein PC referred to partial clonus involving face, head or forelimb, GC referred to general clonus, including limbs and tail, TC referred to generalize tonic clonic seizure.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSeizures stage estimated according to the Racine scale\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSeizures stage\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eRacine scale\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStage 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eimmobilization or lying on belly\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStage 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ehead nodding and facial, forelimb, or hindlimb myoclonus\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStage 3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003econtinuous whole-body myoclonus, myoclonic jerks or tail held up stiffly\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStage 4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003erearing, tonic seizure or falling down on its side\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eStage 5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003etonic-clonic seizure, falling down on its back, wild rushing, jumping or death\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eStereotactic injection of lentivirus to hippocampus\u003c/h2\u003e \u003cp\u003eSurgery was performed using a mice brain stereotactic apparatus (RWD, Shenzhen, China). Microinjection of lentivirus labelled with green fluorescent protein (GFP) was administered into the hippocampus of both hemispheres as described in our previous study [19]. The lentivirus used in our study including Lv-METTL14 OE and Lv-YTHDC1 (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), all lentivirus were purchased from Shanghai Jikai Gene Chemical Technology Co., Ltd. Briefly, anesthetized mice were fixed on the brain stereotactic apparatus, and small bilateral holes were drilled into the skull following the coordinates (relative to bregma), AP-2.1 mm, ML\u0026thinsp;\u0026plusmn;\u0026thinsp;1.9 mm, DV-2.55 mm from the dura. Lentivirus solution (0.1 \u0026micro;l) was injected at a rate of 0.1 \u0026micro;l per min sequentially into each side of the hippocampus. Penicillin powder was used to prevent infection. After surgery, mice were placed in a warm environment until they regained consciousness, and then the animals were allowed to recover in their home cages for 3 weeks.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eInformation for the lentivirus used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003elentivirus\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVector\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eComponent Sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTarget Sequence\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMettl14(72995-1)-p1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGV513\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eUbi-MCS-CBh-gcGFP-IRES-puromycin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGGTCGACTCTAGAGGATCCCGCCACCATGGATAGCCGCCTGCAGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMettl14(72995-1)-p2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGV513\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eUbi-MCS-CBh-gcGFP-IRES-puromycin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eACCGTAAGTTATGTGCTAGCCTACCGAGGAGTAAAGCCGCCTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYthdc1(75759-4)-p1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGV513\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eUbi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAGGTCGACTCTAGAGGATCCCGCCACCATGGCGGCCGACAGCCGGGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYthdc1(75759-4)-p2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGV513\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eUbi-MCS-3FLAG-CBh-gcGFP-IRES-puromycin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eTCCTTGTAGTCCATACCTCTTCGATAACGACCTCTCTCCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eGFP immunofluorescence\u003c/h2\u003e \u003cp\u003eMice with lentivirus injection were rapidly anaesthetized with 10% sodium pentobarbital (80 mg/kg, i.p.). Brains were postfixed for 24 h in the same fixative solution and stored at 4 ℃. After dehydration with 30% sucrose in 0.01 M PBS for 24 h, 30-\u0026micro;m-thick coronal sections were obtained on a cryostat and immediately subjected to immunofluorescent staining. All images were captured by the ZEISS fluorescence microscope (ZEISS, Germany).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry\u003c/h2\u003e \u003cp\u003eFree-floating sections were treated with 3% H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e for 15 min to deplete endogenous peroxidase activity and then blocked by 5% goat serum containing 0.1% Triton X-100 for 2 h at room temperature. Sections were subsequently incubated with the rabbit anti-METTL14 primary antibody (1:500, abclonal, A8530), rabbit anti-YTHDC1 primary antibody (1:500, Abcam, Ab220159) or rabbit anti-m6A primary antibody (1:1000, Abclonal) for 2 h at room temperature at 4\u0026deg;C overnight. Sections were then incubated further in secondary reagents including biotinylated rabbit anti-goat immunoglobulin (CWBIO) for 2 h. Diaminobenzidine tetrahydrochloride (DAB) (ZSGB-BIO) was used as a peroxidase substrate. Sections were washed with the 0.01 M PBS for three times, and were mounted with resinene after desiccation. All images were captured in the same conditions using a Nikon microscope (Nikon, Japan).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eWestern blot\u003c/h2\u003e \u003cp\u003eMice were anesthetized and the hippocampus was rapidly removed following decapitation. The samples were homogenized in lysis buffer and the protein concentration was measured using a BCA Assay Kit (CWBIO). Protein extracts were then separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto PVDF membranes. Then, the membranes were blocked with 5% nonfat milk for 2 h and incubated with the primary antibodies which includes rabbit anti-METTL14 primary antibody (1:500, abclonal, A8530), rabbit anti-YTHDC1 primary antibody (1:1000, Abcam, Ab220159) or mouse anti-β-actin primary antibody (1:2000, Origene, TA811000) for 2 h at room temperature, then at 4\u0026deg;C overnight. After washing three times in 0.02 M Tween-Tris buffered solution, the membranes were incubated with horseradish peroxidase (HRP)-conjugated donkey anti-rabbit or donkey anti-goat polyclonal secondary antibodies (1:1000, CWBIO) for 2 h. The signals were detected by an enhanced chemiluminescence (ECL) system (CWBIO). The protein levels were quantified by densitometry using the NIH ImageJ software (NIH, Bethesda, MD, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eRT-qPCR\u003c/h2\u003e \u003cp\u003eMice were decapitated, with the orbital blood and hippocampus collected and frozen at -80\u0026deg;C. Total RNA was extracted by Trizol\u0026reg; reagent (CWBIO) according to the manufacturer\u0026rsquo;s instruction. The RNA purity was determined by the A260 nm/A280 nm absorption ratio ranging from 1.8 to 2.0. cDNA synthesis was performed with the RevertAid\u0026trade; FirstStrand cDNA Synthesis Kit (Fermentas) according to the manufacturer\u0026rsquo;s instructions using 2 \u0026micro;g of total RNA. Gene expression was determined by Roche LC480 real-time PCR system with TB Green\u0026trade; Premix Ex Taq\u0026trade; II (Takara). The primers were designed with Primer 3 software, the sequences are given in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e. The PCR cycling conditions were 30 sec at 95\u0026deg;C followed by 40 cycles at 95\u0026deg;C for 10 sec, and further 60\u0026deg;C for 30 sec. The 2\u003csup\u003e\u0026minus;△△Ct\u003c/sup\u003e method was used to determine the relative gene expression as described in our previous study [20].\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eInformation for the primers used in this study\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimers\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eSequence 5\u0026rsquo;-3\u0026rsquo;\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec-Fos\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCTCTAGTGCCAACTTTATCCC\u003c/p\u003e \u003cp\u003eGAGATAGCTGCTCTACTTTGCC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eEgr1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCCCAGGACTTAAAGGCTCTTAA\u003c/p\u003e \u003cp\u003eTGGTCACTACGACTGAAGTTAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eArc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGACTATACCGTTAGCCCCTATG\u003c/p\u003e \u003cp\u003eCTCGAAGATCTGTGTATCCACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eNPAS4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCAGTCATGTACCGATCCACCAAG\u003c/p\u003e \u003cp\u003eGCGAGTGTAGATGCAGGCAAGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMETTL3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTTCAGCAGTTCCTGAATTAGC\u003c/p\u003e \u003cp\u003eATGTTAAGGCCAGATCAGAGAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMETTL14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCAAAATCGCCTCCTCCCAAATC\u003c/p\u003e \u003cp\u003eAGCCACCTCTTTCTCCTCGGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWTAP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCTGACAAACGGACCAAGTAATG\u003c/p\u003e \u003cp\u003eAAAGTCATCTTCGGTTGTGTTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFTO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTTCACAACCTCGGTTTAGTTC\u003c/p\u003e \u003cp\u003eCATCATCATTGTCCACATCGTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eALKBH5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCTTTCCCTTCCCTTCTCCACTG\u003c/p\u003e \u003cp\u003eTGAAGCGGAGGAGGCACCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYTHDC1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGTGACTCTGGTTCTGAATCTG\u003c/p\u003e \u003cp\u003eCTGGTTTGATCTTTTCGGACAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYTHDC2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGAGAATTGGGCTGTCGTTAAAG\u003c/p\u003e \u003cp\u003eTGAAGCAGGATGAAATCGTACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYTHDF1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGACAATGACTTTGAGCCCTA\u003c/p\u003e \u003cp\u003eAGGGAGTAAGGAAATCCAATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYTHDF2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACTTCTCAGCATGGGGAAATAA\u003c/p\u003e \u003cp\u003eTATTCATGCCAGGAGCCTTATT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eYTHDF3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTCCACCAACCCAACCAGTTC\u003c/p\u003e \u003cp\u003eCTGAGGTCCTTGTTGCTGCTGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGAPDH\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cem\u003eforwards\u003c/em\u003e\u003c/p\u003e \u003cp\u003e\u003cem\u003ereverse\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACCACCATGGAGAAGGCTGG\u003c/p\u003e \u003cp\u003eCTCAGTGTAGCCCAGGATGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003em6A-dot blot\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted with Trizol reagent and denatured by heating at 65℃for 5 min. Next, RNA was spotted on Biodyne Nylon Transfer Membranes (Thermo Scientific) and cross-linked by 365 nm UVP for 15 min. After blocked with 5% nonfat milk for 2 h, m6A levels were measured using an anti-m6A antibody (Abclonal, A17924) through Western blot.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003em6A-ELISA\u003c/h2\u003e \u003cp\u003eLevels of m6A modification on total RNA were assessed using the m6A RNA Methylation Quantification Kit (Colorimetric) (abcam, ab185912) according to manufacturer\u0026rsquo;s instruction. Briefly, following addition of 80 \u0026micro;l binding solution in each well, the negative control, diluted positive control and 200 ng sample (1\u0026ndash;8 \u0026micro;l) RNA were separately coated on the designated wells and incubated at 37 ℃ for 90 min, followed by incubation in diluted capture antibody at room temperature for 60 min and further in detection antibody solution for another 30 min. The developer and stop solution was used for signal detection. The m6A levels were quantified by reading the absorbance of each well at a wavelength of 450 nm (OD450), and then calculations were performed based on the standard curve.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analysis in this study was conducted with GraphPad Prism 8.0 software (GraphPad Software, San Diego, CA, USA). Data are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Student\u0026rsquo;s \u003cem\u003et\u003c/em\u003e-test was used for two-group comparison, ANOVAs with Bonferroni\u0026rsquo;s post hoc test was used for multiple comparisons among more than two groups. p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\n\u003ch2\u003eAcute seizures induces the decreased level of total m6A in the hippocampus of mice\u003c/h2\u003e\n\u003cp\u003eTo determine whether m6A could participate in seizures, we used m6A-ELISA assay to assess the hippocampal m6A in PTZ treated mice and the result showed that hippocampal m6A content was significantly decreased in mice with seizures when compared with the normal saline (NS) mice (t\u0026thinsp;=\u0026thinsp;4.717, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e, A). Next, we verified the m6A level by immunohistochemistry assay, and the results showed that PTZ-treated mice exhibited significantly decreased level of m6A compared to normal saline (NS) mice (t\u0026thinsp;=\u0026thinsp;5.135, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0021) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e, B). In addition, m6A-dot blot further showed that hippocampal m6A level was decreased in PTZ-treated mice when compared with the NS group (t\u0026thinsp;=\u0026thinsp;3.420, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0091) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e, C). These results suggested that acute seizures induced by PTZ injection could down-regulate the hippocampal m6A level.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\n\u003ch2\u003eBetaine treatment mitigates seizure discharge and neuron overactivity\u003c/h2\u003e\n\u003cp\u003eBetaine, considered as a m6A agonist, could significantly elevate the systemic m6A levels [21]. We investigated the effect of betaine on acute seizures and hippocampal m6A level in PTZ treated mice. One-way ANOVA results showed that the m6A level (F\u003csub\u003e(2,12)\u003c/sub\u003e\u0026thinsp;=\u0026thinsp;20.54, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0001) was significant different in NS, PTZ and Betaine-PTZ group. Bonferroni post-test analysis revealed that betaine (600mg/kg) treatment increased the level of m6A compared to mice with seizures (t\u0026thinsp;=\u0026thinsp;6.408, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, A). Then behavioral tests showed that 600 mg/kg, but not 200 mg/kg, dosage suppressed seizure-like behaviors, as reflected by reduced seizure latency (t\u0026thinsp;=\u0026thinsp;3.037, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and seizure grade (t\u0026thinsp;=\u0026thinsp;2.637, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05), and alleviation of susceptibility score (t\u0026thinsp;=\u0026thinsp;2.754, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, B). Moreover, transcription of immediate early genes (IEGs) in neurons is highly sensitive to neuronal activity induced by sensory and behavioral stimuli [22]. Epileptic seizures can induce rapid and dramatic changes in IEGs expression [23], which have been used to estimate the degree of seizure-like activity [24]. We next examined the effect of betaine on the expression of IEGs including c-Fos, Egr1, Arc and NPAS4, at 1 h after PTZ injection. RT-qPCR analysis of hippocampal tissues showed remarkably increasing mRNA levels of c-Fos (t\u0026thinsp;=\u0026thinsp;6.013, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), Egr1 (t\u0026thinsp;=\u0026thinsp;5.512, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0001), Arc (t\u0026thinsp;=\u0026thinsp;5.168, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0003) and NPAS4 (t\u0026thinsp;=\u0026thinsp;5.732, \u003cem\u003ep\u0026thinsp;\u0026lt;\u003c/em\u003e\u0026thinsp;0.0001) in mice injected with PTZ compared to mice injected with NS group, while betaine treatment remarkably decreased the expression of c-Fos (t\u0026thinsp;=\u0026thinsp;6.742, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), Egr1 (t\u0026thinsp;=\u0026thinsp;5.052, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0004), Arc (t\u0026thinsp;=\u0026thinsp;5.199, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0003) and NPAS4 (t\u0026thinsp;=\u0026thinsp;4.931, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0005) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eB, C) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, C). All these results indicated that systematic m6A agonist treatment mitigated PTZ-induced seizure-like behaviors and inhibited neuron overactivity, which might be due to the enhanced hippocampal m6A level.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\n\u003ch2\u003eMETTL14-dependent m6A modification participates in acute seizures\u003c/h2\u003e\n\u003cp\u003eAs m6A modification is installed by m6A methyltransferases (METTL3, METTL14 and WTAP), and removed by m6A demethylases (FTO and ALKBH5) [25], we used RT-qPCR to detect the relative expression levels of m6A methyltransferases and dimethyl transferases that might lead to altered hippocampal m6A level. We found that only the METTL14 mRNA level was significantly lower in the hippocampus of PTZ-treated mice (t\u0026thinsp;=\u0026thinsp;2.646, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0151) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, A). Western blot confirmed a reduced level of METTL14 in the hippocampus of PTZ mice (t\u0026thinsp;=\u0026thinsp;5.205, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0004) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, B). Furthermore, we investigated the expression of METTL14 by using immunohistochemistry, and representative images of METTL14-positive cells are shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, C. The results showed that PTZ stimulation decreased the expression of METTL14 (t\u0026thinsp;=\u0026thinsp;4.265, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0053) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, C). Thus, the decreased hippocampal m6A level in mice with acute seizures might be due to the down-regulated METTL14.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\n\u003ch2\u003eMETTL14 over-expression in hippocampus of mice attenuates seizure discharge and neuron overactivity\u003c/h2\u003e\n\u003cp\u003eTo further explore the role of METTL14 in acute seizures induced by PTZ stimulation, METTL14 over-expression lentivirus was injected into dentate gyrus (DG) using stereotaxic apparatus (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, A). RT-qPCR and western blot demonstrated that both the mRNA level (t\u0026thinsp;=\u0026thinsp;4.971, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, B) and the protein level (t\u0026thinsp;=\u0026thinsp;3.485, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0059) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, C, D) of METTL14 were up-regulated significantly in METTL14 over-expression lentivirus injection group compared with the control GFP-labeled lentivirus injection group. Furthermore, m6A dot-blot verified METTL14 over-expression could significantly increase the levels of m6A (t\u0026thinsp;=\u0026thinsp;2.515, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0361) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, E). Importantly, seizure latency (t\u0026thinsp;=\u0026thinsp;2.186, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0388), seizure grade (t\u0026thinsp;=\u0026thinsp;2.237, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0358), and susceptibility score (t\u0026thinsp;=\u0026thinsp;2.550, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0179) were also ameliorated in acute seizure condition after METTL14 up-regulation (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, F, G and H). Similarly, we also examined the effect of METTL14 over-expression on the expression of IEGs. RT-qPCR analysis revealed that METTL14 over-expression could remarkably decrease mRNA levels of c-Fos (t\u0026thinsp;=\u0026thinsp;5.232, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0001), Egr1 (t\u0026thinsp;=\u0026thinsp;3.142, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0161), Arc (t\u0026thinsp;=\u0026thinsp;5.007, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0002) and NPAS4 (t\u0026thinsp;=\u0026thinsp;4.166, \u003cem\u003ep\u0026thinsp;=\u003c/em\u003e\u0026thinsp;0.0014) induced by PTZ compared to mice injected with control lentivirus (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, I). These findings demonstrated that METTL14 over-expression could attenuate PTZ-induced seizure-like behaviors and inhibited neuron overactivity.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n\u003ch2\u003eYTHDC1-dependent m6A modification participates in acute seizures\u003c/h2\u003e\n\u003cp\u003em6A modification has been shown affected by m6A reader proteins (YTHDC1, YTHDC2, YTHDF1, YTHDF2 and YTHDF3), which bind to the m6A methylation site to alter gene regulation, such as mRNA splicing, nuclear exporting, translation and decay [26]. We used RT-qPCR to detect mRNA levels of these \u0026ldquo;readers\u0026rdquo;, which showed only the mRNA level of YTHDC1 was decreased in the hippocampus of PTZ treated mice (t\u0026thinsp;=\u0026thinsp;2.693, \u003cem\u003ep\u0026thinsp;=\u003c/em\u003e\u0026thinsp;0.0136) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, A). The protein variation of YTHDC1 was also demonstrated by western blot analysis (t\u0026thinsp;=\u0026thinsp;13.29, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, B and C). In addition, the YTHDC1 protein level was also up-regulated by METTL14 over-expression (t\u0026thinsp;=\u0026thinsp;6.182, \u003cem\u003ep\u0026thinsp;=\u003c/em\u003e\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, D). Furthermore, immunohistochemistry assay demonstrated the expression of YTHDC1 was decreased induced by PTZ administration (t\u0026thinsp;=\u0026thinsp;7.822, \u003cem\u003ep\u0026thinsp;=\u003c/em\u003e\u0026thinsp;0.0002). These results indicated that YTHDC1 may be a key \u0026ldquo;readers\u0026rdquo; of m6A in acute seizures.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n\u003ch2\u003eYTHDC1 over-expression in hippocampus of mice alleviates seizure discharge and neuron overactivity\u003c/h2\u003e\n\u003cp\u003eWe further determined the potential role of YTHDC1 in acute seizures. YTHDC1 over-expression lentivirus was injected into dentate gyrus (DG) to promote YTHDC1 expression (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, A). RT-qPCR and western blot demonstrated that YTHDC1 over-expression lentivirus injection could up-regulate both the mRNA level (t\u0026thinsp;=\u0026thinsp;4.971, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, B) and the protein level (t\u0026thinsp;=\u0026thinsp;3.485, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0059) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, C) of YTHDC1 increased significantly when compared with the control lentivirus. Then behaviour tests revealed that YTHDC1 over-expression could significantly ameliorate seizure latency (t\u0026thinsp;=\u0026thinsp;2.119, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0456) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, D), seizure grade (t\u0026thinsp;=\u0026thinsp;2.853, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0095) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, E), and susceptibility score (t\u0026thinsp;=\u0026thinsp;5.097, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, F) in acute seizure condition. Additionally, RT-qPCR analysis revealed that the mRNA levels of c-Fos (t\u0026thinsp;=\u0026thinsp;4.409, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0006), Egr1 (t\u0026thinsp;=\u0026thinsp;2.731, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0357), Arc (t\u0026thinsp;=\u0026thinsp;4.762, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0002) and NPAS4 (t\u0026thinsp;=\u0026thinsp;3.084, \u003cem\u003ep\u0026thinsp;=\u003c/em\u003e\u0026thinsp;0.0137) were significantly decreased in YTHDC1 OE-PTZ mice compared to GFP-PTZ group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, G). Therefore, our data indicated that YTHDC1 over-expression could attenuate PTZ-induced seizure-like behaviors and suppress neuron overactivity.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eEpilepsy is a transient brain dysfunction syndrome characterized by seizures caused by hippocampal neuron injury [27, 28], thus identification of novel therapeutic targets for epilepsy is urgently needed. Our current study demonstrated that low expression of METTL14 could induce m6A level and YTHDC1 expression down-regulated in the hippocampus of mice under the acute seizures condition. While m6A agonist treatment, or hippocampal-specific over-expression of METTL14 or YTHDC1, could significantly mitigate seizure discharge and restore the abnormal activation of neurons. Therefore, we provide new ideas for alleviating the progression of acute seizures, particularly targeting the METTL14 /YTHDC1 mediated m6A modification.\u003c/p\u003e \u003cp\u003eThe N6-methyladenine (m6A) modification is one of the most common posttranscriptional RNA modifications in eukaryotes. Although m6A modification is involved in epileptogenesis, such as a recent research verified that m6A modification play a vital role in hippocampal neuron injury and the progression of epilepsy in a rat model [29]; another study also demonstrated that m6A modification was related to immune cell components, cell death patterns and glucose metabolism in the pathogenesis of epilepsy [14]. The results of our tests similarly showed that in acute seizures induced by PTZ injection, the m6A level was significantly reduced in the hippocampal of mice, as revealed by m6A-ELISA, m6A-IHC and m6A-dot blot tests, indicating lower m6A level could aggravate the progression of epilepsy. A study has validated the promotion of m6A synthesis could exert antiepileptic effects [30]. As a major methyl donor, researches have reported that betaine (N,N,N-trimethylglycine) treatment could significantly restore the m6A level [31, 32]. Our study also demonstrated the level of m6A in the hippocampus of mice increased significantly after betaine administration, as shown by m6A-dot blot assay. Beneficial effects of betaine in neurodegeneration, excitatory and inhibitory imbalance and against oxidative stress in the central nervous system (CNS) have been verified [33]. Herein, we found betaine treatment could alleviate seizure-like behaviors induced by PTZ stimulation, as reflected by reduced seizure latency and seizure grade, and alleviation of susceptibility score. Previous study also reported that patients received metabolic treatment comprising betaine could stop the occurrence of seizures [34]. Subsequently, because immediate early genes (IEGs) are coordinately activated in response to epileptic seizures [35]. So, we also detected the impact of betaine on the expression of IEGs (c-Fos, Egr1, Arc and NPAS4) induced by PTZ injection in our present study, and found PTZ kindling could remarkably increase the expression of c-Fos, Egr1, Arc and NPAS4, while betaine administration could reverse the levels of IEGs, suggesting betaine could inhibit the abnormal overactivity of neuron under acute seizures condition. These results suggest an close association between m6A and epilepsy.\u003c/p\u003e \u003cp\u003em6A modification is installed by m6A methyltransferases (METTL3, METTL14 and WTAP), and removed by m6A demethylases (FTO and ALKBH5) under different conditions [25]. Researches have shown m6A-related proteins are expressed in almost all cells and participates in the nervous system [36]. Previous study has identified seven significant m6A regulator genes including HNRNPC, WATP, RBM15, YTHDC1, YTHDC2, CBLL1, and RBMX in epileptic and non-epileptic patients [14]. We then explored the potential specific protein involved in the m6A modification after PTZ stimulation. In line with the decreased hippocampal m6A level, we found remarkably reduced METTL14 mRNA and protein levels in the PTZ treated mice, leaving other proteins unchanged, indicating METTL14 may play a key role in acute seizures induced by PTZ kindling. Deletion of METTL14 impairs striatal-mediated behavior by reducing m6A levels in the striatum [37]. Critically, we also found that hippocampal specific over-expression of METTL14 could increase m6A level significantly, as well as alleviate seizure-like behaviors and decrease the expression of IEGs induced by PTZ stimulation. These results further supports that METTL14-mediated m6A modification is functionally involved in the regulation of seizure-like behaviors.\u003c/p\u003e \u003cp\u003eAfter demonstrating the effect of METTL14 in regulating hippocampal m6A level on acute seizures, we sought to validate the role of m6A reader proteins (YTHDC1, YTHDC2, YTHDF1, YTHDF2 and YTHDF3) [38]. As PTZ challenges only lead to reduced expression of hippocampal YTHDC1, and METTL14 over-expression increased the expression of YTHDC1, so we can conclude YTHDC1 may be the key m6A-binding protein under acute seizures condition. Although previous study showed YTHDF2 was up-regulated in rat epileptic models induced by lithium chloride and pilocarpine [29]. Exactly, YTHDC1 is preferentially expressed in the hippocampus of mouse brains. A study has verified genetic deletion of YTHDC1 impaired the learning and memory of mice [39]. Electrophysiological data showed that YTHDC1-deficient neurons had reduced spine density and decreased amplitude and frequency of miniature excitatory postsynaptic currents [39]. We then also determined the role of YTHDC1 in acute seizures induced by PTZ kindling, and the results revealed that hippocampal-specific over-expression of YTHDC1 could alleviate seizure-like behaviors, as well as decrease the expression of IEGs induced by PTZ administration. According to these findings, we propose that the METTL14-YTHDC1-m6A axis plays a key role during seizure-like behaviors. Future studies should devote more effort to uncovering the key target genes that modified by m6A and participates in epilepsy.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eTaken together, the present work is the first study to show that METTL14/YTHDC1-mediated m6A modification could participate in seizure-like behaviors and targeting to m6A modification might provide novel therapeutic ideas for epilepsy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003eXiaolin Zhong and Ling Chen designed the experiments, performed PCR and Western Blot tests, performed data analysis and drafted the manuscript. Yajuan Wang, Yue Liang and Yanmei Huang performed stereotactic injection and behavior tests. Zuyao Chen and Wenyu Cao performed ELISA and Immunohistochemistry tests. Xuyu Zu and Jianghua Liu conceived the project and provided funds and manuscript revision.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u0026nbsp;\u003c/strong\u003eThis work was supported by the National Natural Science Foundation of China (No. (grants: 82271506 to Xuyu Zu, 81873651 and 82270939 to Jianghua Liu) , the Hunan Provincial Natural Science Foundation of China (2023JJ30553 to Xiaolin Zhong and 2023JJ30537 to Ling Chen) and the Education Project of Hunan Provincial (23A0341).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthical Approval\u003c/strong\u003e The project was approved by the Ethics Committee of the University of South China (2022usc05xs07).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent to Participate\u003c/strong\u003e Informed consent was obtained from all individual participants included in the study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for Publication\u0026nbsp;\u003c/strong\u003eAll authors have approved for publication.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting Interests\u003c/strong\u003e The authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003ePitkanen A, Lukasiuk K (2011) Mechanisms of epileptogenesis and potential treatment targets. Lancet Neurol 10:173-186. https://doi.org/10.1016/S1474-4422(10)70310-0\u003c/li\u003e\n\u003cli\u003eFisher R S, Acevedo C, Arzimanoglou A et al (2014) ILAE official report: a practical clinical definition of epilepsy. Epilepsia 55:475-482. https://doi.org/10.1111/epi.12550\u003c/li\u003e\n\u003cli\u003eLoscher W (2020) The holy grail of epilepsy prevention: Preclinical approaches to antiepileptogenic treatments. Neuropharmacology 167:107605. https://doi.org/10.1016/j.neuropharm.2019.04.011\u003c/li\u003e\n\u003cli\u003eChen Z, Zhong X, Xia M et al (2021) The roles and mechanisms of the m6A reader protein YTHDF1 in tumor biology and human diseases. Mol Ther Nucleic Acids 26:1270-1279. https://doi.org/10.1016/j.omtn.2021.10.023\u003c/li\u003e\n\u003cli\u003eJiang X, Liu B, Nie Z et al (2021) The role of m6A modification in the biological functions and diseases. Signal Transduct Target Ther 6:74. https://doi.org/10.1038/s41392-020-00450-x\u003c/li\u003e\n\u003cli\u003eBokar J A, Rath-Shambaugh M E, Ludwiczak R et al (1994) Characterization and partial purification of mRNA N6-adenosine methyltransferase from HeLa cell nuclei. Internal mRNA methylation requires a multisubunit complex. J Biol Chem 269:17697-17704. \u003c/li\u003e\n\u003cli\u003eJia G, Fu Y, Zhao X et al (2011) N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat Chem Biol 7:885-887. https://doi.org/10.1038/nchembio.687\u003c/li\u003e\n\u003cli\u003eZheng G, Dahl J A, Niu Y et al (2013) ALKBH5 is a mammalian RNA demethylase that impacts RNA metabolism and mouse fertility. Mol Cell 49:18-29. https://doi.org/10.1016/j.molcel.2012.10.015\u003c/li\u003e\n\u003cli\u003eAl Hayek A A, Al Dawish M A (2022) Evaluation of Patient-Reported Satisfaction and Clinical Efficacy of Once-Weekly Semaglutide in Patients with Type 2 Diabetes: An Ambispective Study. Adv Ther 39:1582-1595. https://doi.org/10.1007/s12325-022-02053-0\u003c/li\u003e\n\u003cli\u003eWang X, He C (2014) Reading RNA methylation codes through methyl-specific binding proteins. RNA Biol 11:669-672. https://doi.org/10.4161/rna.28829\u003c/li\u003e\n\u003cli\u003eZhang N, Ding C, Zuo Y et al (2022) N6-methyladenosine and Neurological Diseases. Mol Neurobiol 59:1925-1937. https://doi.org/10.1007/s12035-022-02739-0\u003c/li\u003e\n\u003cli\u003eLv J, Xing L, Zhong X et al (2023) Role of N6-methyladenosine modification in central nervous system diseases and related therapeutic agents. Biomed Pharmacother 162:114583. https://doi.org/10.1016/j.biopha.2023.114583\u003c/li\u003e\n\u003cli\u003eDong Z, Min F, Zhang S et al (2023) EGR1-Driven METTL3 Activation Curtails VIM-Mediated Neuron Injury in Epilepsy. Neurochem Res 48:3349-3362. https://doi.org/10.1007/s11064-023-03950-8\u003c/li\u003e\n\u003cli\u003eLiu X, Sun Q, Cao Z et al (2022) Identification of RNA N6-methyladenosine regulation in epilepsy: Significance of the cell death mode, glycometabolism, and drug reactivity. Front Genet 13:1042543. https://doi.org/10.3389/fgene.2022.1042543\u003c/li\u003e\n\u003cli\u003ePeng L, Li C, Tang X et al (2023) Blocking salt-inducible kinases with YKL-06-061 prevents PTZ-induced seizures in mice. Brain Behav e3305. https://doi.org/10.1002/brb3.3305\u003c/li\u003e\n\u003cli\u003eEl Yacoubi M, Ledent C, Parmentier M et al (2008) Evidence for the involvement of the adenosine A(2A) receptor in the lowered susceptibility to pentylenetetrazol-induced seizures produced in mice by long-term treatment with caffeine. Neuropharmacology 55:35-40. https://doi.org/10.1016/j.neuropharm.2008.04.007\u003c/li\u003e\n\u003cli\u003eZhao G, He F, Wu C et al (2018) Betaine in Inflammation: Mechanistic Aspects and Applications. Front Immunol 9:1070. https://doi.org/10.3389/fimmu.2018.01070\u003c/li\u003e\n\u003cli\u003eMusto A E, Rosencrans R F, Walker C P et al (2016) Dysfunctional epileptic neuronal circuits and dysmorphic dendritic spines are mitigated by platelet-activating factor receptor antagonism. Sci Rep 6:30298. https://doi.org/10.1038/srep30298\u003c/li\u003e\n\u003cli\u003eLi M, Zhong X, Zhao Z et al (2022) The expression of m6A enzymes in the hippocampus of diabetic cognitive impairment mice and the possible improvement of YTHDF1. Brain Res 1777:147766. https://doi.org/10.1016/j.brainres.2021.147766\u003c/li\u003e\n\u003cli\u003eZhong X, Cao W, Zhao H et al (2020) MicroRNA-32-5p knockout eliminates lipopolysaccharide-induced depressive-like behavior in mice through inhibition of astrocyte overactivity. Brain Behav Immun 84:10-22. https://doi.org/10.1016/j.bbi.2019.11.001\u003c/li\u003e\n\u003cli\u003eHao J, Huang S, Wang D et al (2021) Loss of WTAP Impairs Early Parthenogenetic Embryo Development. Animals (Basel) 11:https://doi.org/10.3390/ani11061675\u003c/li\u003e\n\u003cli\u003eHe Q, Wang J, Hu H (2019) Illuminating the Activated Brain: Emerging Activity-Dependent Tools to Capture and Control Functional Neural Circuits. Neurosci Bull 35:369-377. https://doi.org/10.1007/s12264-018-0291-x\u003c/li\u003e\n\u003cli\u003eKalinina A, Krekhno Z, Yee J et al (2022) Effect of repeated seizures on spatial exploration and immediate early gene expression in the hippocampus and dentate gyrus. IBRO Neurosci Rep 12:73-80. https://doi.org/10.1016/j.ibneur.2021.12.008\u003c/li\u003e\n\u003cli\u003eBaxendale S, Holdsworth C J, Meza Santoscoy P L et al (2012) Identification of compounds with anti-convulsant properties in a zebrafish model of epileptic seizures. Dis Model Mech 5:773-784. https://doi.org/10.1242/dmm.010090\u003c/li\u003e\n\u003cli\u003eHe L, Li H, Wu A et al (2019) Functions of N6-methyladenosine and its role in cancer. Mol Cancer 18:176. https://doi.org/10.1186/s12943-019-1109-9\u003c/li\u003e\n\u003cli\u003eLiu S, Li G, Li Q et al (2020) The roles and mechanisms of YTH domain-containing proteins in cancer development and progression. Am J Cancer Res 10:1068-1084. \u003c/li\u003e\n\u003cli\u003eThijs R D, Surges R, O\u0026apos;Brien T J et al (2019) Epilepsy in adults. Lancet 393:689-701. https://doi.org/10.1016/S0140-6736(18)32596-0\u003c/li\u003e\n\u003cli\u003eWang X, Zhang W, Ge P et al (2022) Parthanatos participates in glutamate-mediated HT22 cell injury and hippocampal neuronal death in kainic acid-induced status epilepticus rats. CNS Neurosci Ther 28:2032-2043. https://doi.org/10.1111/cns.13934\u003c/li\u003e\n\u003cli\u003eTian M Q, Li J, Shu X M et al (2023) The increase of Nrf2 m6A modification induced by FTO downregulation promotes hippocampal neuron injury and aggravates the progression of epilepsy in a rat model. Synapse 77:e22270. https://doi.org/10.1002/syn.22270\u003c/li\u003e\n\u003cli\u003eZaman T, Helbig K L, Clatot J et al (2020) SCN3A-Related Neurodevelopmental Disorder: A Spectrum of Epilepsy and Brain Malformation. Ann Neurol 88:348-362. https://doi.org/10.1002/ana.25809\u003c/li\u003e\n\u003cli\u003eHao J, Hu H, Jiang Z et al (2020) microRNA-670 modulates Igf2bp1 expression to regulate RNA methylation in parthenogenetic mouse embryonic development. Sci Rep 10:4782. https://doi.org/10.1038/s41598-020-61816-3\u003c/li\u003e\n\u003cli\u003eZhou X, Chen J, Chen J et al (2015) The beneficial effects of betaine on dysfunctional adipose tissue and N6-methyladenosine mRNA methylation requires the AMP-activated protein kinase alpha1 subunit. J Nutr Biochem 26:1678-1684. https://doi.org/10.1016/j.jnutbio.2015.08.014\u003c/li\u003e\n\u003cli\u003eBhatt M, Di Iacovo A, Romanazzi T et al (2023) Betaine-The dark knight of the brain. Basic Clin Pharmacol Toxicol 133:485-495. https://doi.org/10.1111/bcpt.13839\u003c/li\u003e\n\u003cli\u003eGales A, Masingue M, Millecamps S et al (2018) Adolescence/adult onset MTHFR deficiency may manifest as isolated and treatable distinct neuro-psychiatric syndromes. Orphanet J Rare Dis 13:29. https://doi.org/10.1186/s13023-018-0767-9\u003c/li\u003e\n\u003cli\u003eTsukada T, Sakata-Haga H, Shimada H et al (2021) Mid-pregnancy maternal immune activation increases Pax6-positive and Tbr2-positive neural progenitor cells and causes integrated stress response in the fetal brain in a mouse model of maternal viral infection. IBRO Neurosci Rep 11:73-80. https://doi.org/10.1016/j.ibneur.2021.07.003\u003c/li\u003e\n\u003cli\u003eDu K, Zhang L, Lee T et al (2019) m(6)A RNA Methylation Controls Neural Development and Is Involved in Human Diseases. Mol Neurobiol 56:1596-1606. https://doi.org/10.1007/s12035-018-1138-1\u003c/li\u003e\n\u003cli\u003eKoranda J L, Dore L, Shi H et al (2018) Mettl14 Is Essential for Epitranscriptomic Regulation of Striatal Function and Learning. Neuron 99:283-292 e285. https://doi.org/10.1016/j.neuron.2018.06.007\u003c/li\u003e\n\u003cli\u003eZhang J, Bai R, Li M et al (2019) Excessive miR-25-3p maturation via N(6)-methyladenosine stimulated by cigarette smoke promotes pancreatic cancer progression. Nat Commun 10:1858. https://doi.org/10.1038/s41467-019-09712-x\u003c/li\u003e\n\u003cli\u003eShi H, Zhang X, Weng Y L et al (2018) m(6)A facilitates hippocampus-dependent learning and memory through YTHDF1. Nature 563:249-253. https://doi.org/10.1038/s41586-018-0666-1\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"molecular-neurobiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"moln","sideBox":"Learn more about [Molecular Neurobiology](https://www.springer.com/journal/12035)","snPcode":"12035","submissionUrl":"https://submission.nature.com/new-submission/12035/3","title":"Molecular Neurobiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"N6-methyladenosine (m6A), METTL14, YTHDC1, Epilepsy","lastPublishedDoi":"10.21203/rs.3.rs-3743108/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3743108/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEpilepsy is a common neurological disorder which can cause significant morbidity and mortality. N6-methyladenosine (m6A), the most common chemical epigenetic modification among mRNA post-transcriptional modifications, implicated in various physiological and pathological processes, but its role in epilepsy is still unknown. Here, we provide strong evidences in support of an association of m6A and its regulatory proteins with epilepsy. Our results indicated that the level of m6A was declined in the hippocampus of pentylenetetrazol (PTZ)-induced seizure mice. Both the seizure-like behaviors and the excessive activation of hippocampal neuron were significantly mitigated after the administration of m6A agonist Betaine. Mechanically, we found both the hippocampal m6A methyltransferase METTL14 and recognition protein YTHDC1 were decreased in PTZ kindled mice, which might contribute to the reduced hippocampal m6A level. Additionally, hippocampal-specific over-expression of METTL14 or YTHDC1 by lentivirus injection could significantly ameliorate seizure-like behaviors and prevent the excessive activation of hippocampal neuron in epilepsy mice induced by PTZ injection, which might be due to the normalized hippocampal m6A level. Together, this study identified METTL14/YTHDC1-mediated m6A modification could participate in seizure-like behaviors, which might provide m6A regulation as a potential and novel therapeutic strategy for epilepsy.\u003c/p\u003e","manuscriptTitle":"METTL14/YTHDC1-mediated m6A modification in hippocampus improves pentylenetetrazol-induced acute seizures","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-08 11:22:57","doi":"10.21203/rs.3.rs-3743108/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-01-05T14:05:05+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-04T11:34:55+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-04T11:34:55+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular Neurobiology","date":"2023-12-12T09:48:42+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"molecular-neurobiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"moln","sideBox":"Learn more about [Molecular Neurobiology](https://www.springer.com/journal/12035)","snPcode":"12035","submissionUrl":"https://submission.nature.com/new-submission/12035/3","title":"Molecular Neurobiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"d4a2162c-c2cb-41f9-840d-2a6d31e2f7fa","owner":[],"postedDate":"January 8th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-05-19T01:23:26+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-08 11:22:57","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3743108","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3743108","identity":"rs-3743108","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}