A breakdown of metabolic reprogramming in microglia caused by CKLF1 exacerbates immune tolerance in the ischemic stroke

A breakdown of metabolic reprogramming in microglia caused by CKLF1 exacerbates immune tolerance in the ischemic stroke | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article A breakdown of metabolic reprogramming in microglia caused by CKLF1 exacerbates immune tolerance in the ischemic stroke Wenyu Ma, Qinglin Wu, Shasha Wang, Hongyun Wang, Junrui Ye, Hongsuo Sun, and 5 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-2344526/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 25 Apr, 2023 Read the published version in Journal of Neuroinflammation → Version 1 posted 7 You are reading this latest preprint version Abstract Ischemic stroke has a prominent pathogenic hallmark called reactive microglia, which is a predictor of prognosis. The precise involvement of microglia in stroke etiology, however, is still unknown. We found that chemokine like factor 1 (CKLF1) causes acute microglial inflammation and metabolic reprogramming from oxidative phosphorylation to glycolysis utilizing metabolic profiling, which was reliant on the AMPK-mTOR-HIF-1α signaling pathway. Microglia, once activated, entered a chronic tolerant state as a result of widespread energy metabolism abnormalities and therefore reduced immunological responses, including cytokine release and phagocytosis. It was also found metabolically dysfunctional microglia in the mice using genome-wide RNA sequencing by chronic administration of CKLF1 directly, as well as the decrease of inflammation response. Finally, we showed that loss of CKLF1 reversed the defective immune response of microglia, as manifested by kept its phagocytosis to neutrophils, thereby mitigating long term outcomes of ischemic stroke. Overall, CKLF1 plays a crucial part in the relationship between microglial metabolic status and immune function in stroke, which prepares a potential therapeutic strategy for ischemic stroke. CKLF1 microglia metabolic reprogramming immune tolerance ischemic stroke phagocytosis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 1. Introduction Ischemic stroke is the most common type of stroke, and neurological injury has been associated with a variety of pathological indicators, including inflammation, oxidative stress, and blood-brain barrier breakdown. The innate immune response is a highly complex physiological process during the acute stage of ischemic stroke. Microglia, the brain's resident immune cells, were activated initially and have the most intricate effects during the post-stroke stage [ 1 ]. It has been revealed that overactivation of microglia was the primary drive of neuroinflammation, while loss of microglia also exacerbated neuronal damage, and that repopulating microglia following a stroke promoted the neurorepair alleviated it significantly [ 2 ][ 3 ], suggested that the immune status of microglia is important for stroke outcome. However, its regulatory mechanism remains unclear. Microglia are polysynaptic and flexible immunological effector cells found in the central nervous system, which may develop an inflammatory phenotype in response to "danger signals" such as pathogens and tissue damage, as evidenced by increased production of pro-inflammatory cytokines such as interleukin-1β (IL-1β), interleukin-6 (IL-6) and tumor necrosis factor-a (TNF-α), as well as enhanced immune responses, including cellular recruitment (e.g., chemotaxis, and phagocytosis) [ 4 ]. Consequently, activated immune cells are attracted to the inflammatory region and facilitate in the elimination of pathogens. However, once began, the process must be tightly monitored, as uncontrolled or severe inflammation can cause host tissue damage [ 5 ][ 6 ]. Many pathways regulating these characteristics have been elucidated [ 7 ]. Nonetheless, the distinction between homeostatic and disease-related signaling is not absolute [ 8 ], and this simplistic view does not adequately describe the complex physiology of microglia [ 9 ]. As a result of immune cells becoming polarized during inflammation, "innate immunological tolerance" occurs, a host-protective mechanism in which these cells become unresponsive to recurrent stimulation. Immune tolerance may protect host tissue from the detrimental effects of excessive inflammatory responses, However, it has been paradoxically associated with immune cell malfunction in a variety of disorders, including cancer, sepsis, autoimmune diseases, and metabolic diseases [ 10 ][ 11 ], both in vitro and in vivo. Therefore, central to our understanding of microglia function in disease and our ability to target microglia is the need for more biomarkers and underlying mechanisms that reflect the functioning of microglia at different stages of travel [ 12 ]. Recently, research on cellular metabolic reprogramming has provided new clues for the activation of immune cells. Because immune cells perform a variety of functions with different energy demands, the metabolic pathways utilized to fabricate energy change by cellular phenotype. Relevant research results show that the transformation of cell metabolic state to aerobic glycolysis state will be beneficial for the immune cells to play a pro-inflammatory role. The inflammatory response of immune cells is dependent on aerobic glycolysis, through understanding this mechanism, we can provide cells with a rapid supply of adenosine triphosphate (ATP), thus regulating the enzyme, and regulating the production of pro-inflammatory cytokines by releasing some substances [ 13 ], although glycolysis is less efficient than mitochondrial in terms of ATP production, glycolysis' rate of glucose metabolism is 10–100 times faster than oxidative phosphorylation (OXPHOS), allowing it to perform energy-intensive activities like proliferation, migration, cytokine release, and phagocytosis. On the other hand, owing of its high efficiency, naïve and resting cells, which require a continuous energy source, rely mostly on mitochondrial respiration. As a result, microglia might adopt a phenotype known as "trained-immunity," in which immunological responses are reinforced by an increase in glycolysis [ 14 ][ 15 ][ 16 ]. As a unique metabolic organ, brain will provide a unique environment for immune metabolism control of microglia [ 17 ][ 18 ]. Metabolic reprogramming will produce a large number of pro-inflammatory factors to increase immune memory. The change of cell metabolic state is also closely related to the formation of immune memory by macrophages [ 19 ]. However, it is still uncertain whether metabolic reprogramming will affect the immune function of microglia. CKLF1 is a CC chemokine that was cloned in 2001 and has multiple biological activities [ 20 ]. As a secreted protein [ 21 ][ 22 ], CKLF1 plays a key role in a variety of tissues and has potential effects, which has attracted extensive attention by researchers [ 23 ]. Studies have shown that CKLF1 is highly expressed after cerebral ischemia. In the acute phase following stroke, knocking out (KO) CKLF1 or inhibiting its activity might cause severe nerve injury and decrease the amount of activated microglia. A single dose of CKLF1 administered 1 h prior to ischemia can exacerbate nerve damage and the inflammatory response, implying that CKLF1 can be immunologically trained for microglia and then rapidly activate microglia in the presence of subsequent ischemic injury [ 24 ][ 25 ]. However, it is unknown whether CKLF1 might induce immunological tolerance or mitigate nerve damage following stroke, the regulation of CKLF1 expression and its molecular mechanism on microglia phenotypic changes have not yet been elucidated, which seriously hinders its research as a new anti-stroke therapeutic target. In this study, it was found that CKLF1 causes acute microglial inflammation and metabolic reprogramming from oxidative phosphorylation to glycolysis, which was reliant on the AMPK-mTOR-HIF-1α signaling pathway. Microglia, once activated, entered a chronic tolerant phase as a result of widespread energy metabolism abnormalities and therefore reduced immunological responses, including cytokine release and phagocytosis. It was also found metabolically dysfunctional microglia in the mice using genome-wide RNA sequencing by chronic administration of CKLF1 directly, as well as the decrease of inflammation response. Finally, we showed that loss of CKLF1 reversed the defective immune response of microglia, as manifested by kept its phagocytosis to neutrophils, thereby mitigating long term outcomes of ischemic stroke. Overall, CKLF1 plays a crucial role in the relationship between microglial metabolic status and immune function in stroke, which provides a potential therapeutic strategy for the treatment of ischemic stroke. 2. Materials And Methods 2.1. Animals All animal procedures were performed according to protocols approved by the Animal Care and Use Committee of the Peking Union Medical College and the Chinese Academy of Medical Sciences. Adult male (7–8 weeks old) C57BL/6N mice (Charles river, China) housed under constant temperature and a 12:12 h light/dark cycle were used. Feed and water sources were consumed ad libitum by the mice. CKLF1 −/− mice were generous provided by Professor Zhang (Institute of Laboratory Animal Science, Peking Union Medicine College, Chinese Academy of Medical Sciences)[ 24 ]. Generation of CKLF1 −/− mice were using CRISPR/Cas9 system. Investigators designed sgRNA-target sequences (gene ID: 75458, target site 1: cctggagcagcgtttgctcgg, target site 2: gatattatacttgtaatctgg) based on the first coding exon of the CKLF1 gene and transcribed sgRNA and Cas9 mRNA in vitro. After injection into fertilized eggs, investigators got 23 pups of F0 generation, two of which were KO mice with the test of PCR and sequencing. After mating for 10 generations, investigators got the homozygote CKLF1 −/− mice with genetic stability. In this line, 957 bp nucleic acid in CKLF1 was deleted, and frameshift mutation occurred in the subsequent protein coding region. 2.2. Stereotaxic injection and photothrombotic stroke The surgery was performed under isoflurane anesthesia, and the mice were fixed using a stereotactic frame (RWD Life Science, China). The injection site is the right M1 area according to the second edition of the mouse brain in Stereotaxic Coordinates from the bregma point as follows: AP, + 1.5 mm; ML, -2.0 mm; DV, -1.7 mm. After the injection, the needle was remained in the M1 area for the next 10 min to prevent drug leakage. For the administration cannula, surgical operation needs to be performed with brain stereotaxic apparatus. After the animals were anesthetized, the scalp was opened to expose the skull, and the site was drilled. The cannula is clamped by a holder and implanted to a suitable depth. The dental cement was fixed and the catheter cap was inserted to complete the surgery. For acute stimulation of CKLF1, 24 h after stereotactic injection of C27 at the dose of 10 µg, who is the CKLF1 active peptide sequenced by ALIYRKLLFNPSGPYQKKPVHEKKEVL with 99% of purity provided by Guoping Pharmaceutical (Anhui, China), brains were taken after heart perfusion. For tolerated stimulation, 10 µg C27 was administered once a day for four times by same manner. After 24 hours of last injection, the brains were taken followed heart perfusion. For anti-CKLF1 antibody treatment, 10 µg anti-CKLF1 or control IgG were administered by the stereotactic injection prior to the photothrombotic stroke. After that, 200 µL of 10 mg/mL Rose Bengal sodium salt (Solarbio, China) solution was administered via tail vein. After 5 min, green laser with spot diameter of 2 mm (wavelength 532 nm) was turned on and irradiated for 7 min to form an ischemia model of specific brain regions. 2.3. Primary Microglia Culture Primary Microglia (PMG) was obtained in the cerebral of C57BL/6 neonatal mouses at 24 h of birth. The mouse decapitations were placed in pre-cooled DMEM/F12 medium. Brain tissue was cut to pieces to digest the cells, and then sieved and a single cell suspension from the brain was placed in culture flasks coated with poly-lysine (PLL). After 3 days of incubation at 37°C and 5% CO 2 , the medium (DMEM/F12 containing 10% fetal bovine serum and 1% Penicillin-Streptomycin) was changed. Microglia were isolated from the mixed glial cultures on Day 10 by oscillating, and the shaking was repeated 3–5 days later. Isolated PMG was seeded at 1.5-2.0×10 5 cells /mL on a PLL-coated cell culture plate and incubated until stable (37°C, 5% CO 2 ) prior to use. 2.4. Stimulation of PMG PMG was stimulated by LPS (100 ng/mL) and IFN-γ (20 ng/mL) or C27 (500 nM, 1000 nM, 2000 nM) for 24 h. In some conditions of experiments, PMG was preincubated with 2-DG (4 mM, Topscience, China) to inhibit glycolysis, or was incubated with rapamycin (50 nM, Topscience, China) or metformin (2 mM, Topscience, China) to block the mTOR pathway. Experiments for the tolerance model mimicked chronic conditions by incubating cells with vehicle or C27 (1000 nM) for 24 h, washing with preheated phosphate buffered saline (PBS), followed by further incubation with PMG for 3 days. After that, the cells were re-stimulated with C27 (1000 nM) for 24 h. 2.5. Measurement of Lactate and Pyruvate kinase PMG (2.0×10 5 cells/mL) was spread on a 6-well plate, and was administered as described above. Thereafter, the lactic acid and pyruvate kinase in the cells were quantified by utilizing the lactic acid content assay kit (Solarbio, China) and pyruvate kinase activity detection kit (Solarbio, China) according to the manufacturer's instructions. 2.6. Live Cell Mitochondrial Imaging PMG was cultured on fluorodish cell culture dish (World precision instruments, China) for imaging of live mitochondria and treated with MitoTracker Green (300 nM, Thermo Fisher Scientific, USA) solution protected from light for 30 min (37℃, 5% CO 2 ) to label mitochondria. Fresh complete medium was added after rinsing by preheated PBS. Real-time mitochondrial imaging was performed using confocal laser scanning microscopy (Leica, Germany) and mitochondrial morphology was analyzed by using ImageJ software [ 26 ]. 2.7. Western Blotting The cultured cells were collected and then lysed with RIPA lysis buffer (Beyotime, China) containing a mixture of protease and phosphate inhibitor. Protein was separated by electrophoresis on a 10% SDS-PAGE gel containing an equal amount of protein (25–60 µg) of the lysates and transferred to a PVDF (Merck Millipore, USA) membrane. After 2 h of blocking with 5% BSA formulated with Tris-buffered saline containing 0.1% Tween-20 (TBS-T) at room temperature (RT), the membranes were incubated overnight with primary antibody at 4℃: anti-IL-6 (1: 1000, abcam, UK), Anti-mTOR antibody [Y391] (1:1000, abcam, UK), Anti-mTOR (phospho S2481) antibody (1:1000, abcam, UK), Anti-AMPK alpha 1 + AMPK alpha 2(1:1000, abcam, UK), Anti-AMPK alpha 1 (phospho T183) + AMPK alpha 2 (phospho T172) (1:1000, abcam, UK), Anti-TREM2 antibody (1:500, abcam, UK), Anti-HIF-1 alpha antibody (1:1000, abcam, UK). After 3 washes, the specific blot was incubated with a secondary antibody of the appropriate species at RT for 2 h. The expression of each protein was examined with enhanced chemiluminescence plus detection system (Molecular Device, Lmax). Analysis was performed by FIJI software. 2.8. Isolation of RNA and quantitative real-time polymerase chain reaction (RT-PCR) Total RNA was extracted from isolated microglia by using Trizol (Invitrogen, Carlsbad, CA, USA), and dissolved in 20 µL DEPC (Beyotime, China) to obtain total RNA. RNA was quantified by measuring OD at 260 and 280 nm using a NanoDrop 2000 spectrophotometer and stored at -80℃. The synthesis of cDNA was referred to instruction of the reverse transcription of cDNA synthesis kit (Transgen, China). In brief, 2 µg total RNA was incubated for 15 min at 42℃ and for 5 seconds at 85℃ to obtain cDNA, which could be diluted with DEPC water and stored at -20℃. qPCR System (Foster City, CA, USA) using TransStart Tip Green qPCR Supermix kit (TransGen, China). The PCR amplifcation conditions were as follows: 94°C for 30 s for pre-denaturation, 94°C for 5 s and 60°C for 30 s to denaturation for 40 cycles to extension. The primer is following: Mouse-iNOS, forward primer: 5’-CAAGCACCTTGGAAGAGGAG-3’ and reverse primer: 5’-AAGGCCAAACACAGCATACC-3’. Mouse-CD16, forward primer: 5’-TTTGGACACCCAGATGTTTCAG-3’ and reverse primer: 5’-GTCTTCCTTGAGCACCTGGATC-3’. Mouse-CD32, forward primer:5’-AATCCTGCCGTTCCTACTGATC-3’ and reverse primer: 5’-GTGTCACCGTGTCTTCCTTGAG-3’. Mouse-IL-6, forward primer:5’-GGAGCCCACCAAGAACGATA-3’ and reverse primer: 5’-TCACCAGCATCAGTCCCAAG-3’. Mouse-IL-1β, forward primer: 5’-GCCCATCCTCTGTGACTCAT-3’ and reverse primer: 5’-AGCTCATATGGGTCCGACAG-3’. Mouse-TNF-α, forward primer: 5’-AGAAGTTCCCAAATGGCCTC-3’ and reverse primer: 5’-CCACTTGGTGGTTTGCTACG-3’. Mouse-Arg-1, forward primer: 5’-CTCCAAGCCAAAGTCCTTAGAG-3’ and reverse primer: 5’-AGGAGCTGTCATTAGGGACATC-3’. Mouse-CCL-22, forward primer: 5’-CTGATGCAGGTCCCTATGGT-3’ and reverse primer: 5’-GCAGGATTTTGAGGTCCAGA-3’. Mouse-TGF-β, forward primer: 5’-TGCGCTTGCAGAGATTAAAA-3’ and reverse primer: 5’-CGTCAAAAGACAGCCACTCA-3’. Mouse-PKM2, forward primer: 5’-AGTACGCCCGAGGACTTC-3’ and reverse primer: 5’-AAATGATGCCAGTGTTGCGG-3’. Mouse-G6P, forward primer: GCTGGAGTCTTGTCAGGCATT-3’ and reverse primer: 5’-AATCCAAGCGCGAAACCAAA-3’. Mouse-PFKFB3, forward primer: CGGGAGAGGTCAGAGAACATGAA-3’ and reverse primer: 5’-CTTCAACATGCCGACCTCCA-3’. Mouse-GLUT1, forward primer: AGCAGAGGCTTGCTTGTAGAG-3’ and reverse primer: 5’-GCCCGTCACCTTCTTGCT-3’. Mouse-β-actin, forward primer: 5’-CATCCGTAAAGACCTCTATGCCAAC-3’ and reverse primer: 5’-ATGGAGCCACCGATCCACA-3’. For result interpretation, Ct value data during the reaction were collected using the corrected threshold setting. β-actin was used as an endogenous control by real-time quantitative PCR, and all fold changes are expressed normalized to the control group. The 2-ΔΔCt method was used for relative quantification. 2.9. Measurement of Real-Time ECAR and OCR Real-time extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) were estimated using a Seahorse XF24 analyzer (Agilent, USA). 4×10 4 cells were plated in XF24 cell culture microplates and cultured as instructed and stimulated by drug administration. The plates were hydrated and incubated overnight (37°C, no carbon dioxide) with XF calibration buffer; Assay medium (XF minimal medium containing 1 mM pyruvic acid, 4 mM glutamine and 25 mM glucose) was confected prior to assay. For ECAR measurement, after the cell plate and the probe plate were loaded with and stabilized by an XF analyzer, glucose, oligomycin, and 2-DG were successively injected into the cells, and then the change level of ECAR was monitored in real time. After the ECAR experiment, the key parameters of glycolysis flux were calculated, including basic glycolysis, maximum glycolysis capacity, and glycolysis reserve and non-glycolysis acidification. For OCR measurement, the mixture of Oligomycin, FCCP and Rotenone & antimycin A was sequentially injected to monitor the change level of OCR in real time [ 27 ], and each well sample on the cell culture plate was quantified, followed by normalization of the data. Basal respiration, ATP production, maximal respiration, spare capacity, and proton leak were calculated. 2.10. Microparticle-Uptake assay The density of 5×10 5 /mL was seeded in a 6 cm dish and cultured for 24 h until cells adhered. Negative control, medication control and each medication administration group were set, and the medication stimulated the cells for 24 h. 0.75 mg (1.0×10 7 Zymosan A particles) of microsphere particles (Zymosan A (S. Cerevisiae) Bioparticles, Alexa Fluor™ 488 conjugate) were coated by incubating with 1.5 mL DMEM containing 50% FBS for 15 min in shaking at 37°C (1000 rpm) and diluting 10-fold in preheated DMEM containing 10% FBS. 1 ×10 6 /mL of the prepared microspheres were added and co-incubated with cells at 37°C for 120 min (Negative control without particles). The cells were washed by PBS, blown off with complete medium, transferred to EP tube for centrifugation at 1000 rpm for 4 min and discarded the supernatant. The cells were re-suspended for a second time with PBS containing 2% FBS, blown evenly, passed through a 70 µm sieve, and centrifuged at 1000 rpm for 4 min. 50 µL cell suspension was discarded and retained in 1.5 mL EP tube. The phagocytic rate of the cells was then detected by ImageStream system flow cytometry (Merck, France). Results were analyzed by using IDEAS 6.2 software. 2.11. LDH Assay and TUNEL Assay To quantify cytotoxicity in the different stimulations, lactate dehydrogenase (LDH) was determined using the LDH cytotoxicity assay kit (Zhongshengbeikong Biotechnology, China) following the manufacturer's instructions. Microglia (4×10 4 / well) were inoculated on 96-well plates and treated as described herein. The medium containing the released lactate dehydrogenase was transferred into EP tubes and the LDH activity was detected using a biochemistry analyzer. To quantify apoptosis under experimental conditions, microglia (4×10 4 / well) were seeded on 96-well plates and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) (Beyotime, China) was performed according to the manufacturer's instructions with DNaseI (100 U/mL) treated cells as the positive control. The images were observed through fluorescence microscope and analyzed using Image J software. 2.12. Microglia Isolation from Adult Mouse Brain For the sorting experiment, the in vivo acute stimulation model was constructed by brain-targeted injection of C27 for 24 h, and the in vivo immune tolerance model was constructed by brain-targeted injection of PBS or C27 for four consecutive days, and microglia were isolated from the mouse brain. In short, the cells were incubated with pre-cooling Dulbecco's PBS (dPBS; Sigma-Aldrich, USA) to transfer the brain (excluding the olfactory bulb and cerebellum) to a solution containing Enzyme mix (Miltenyi Biotec, Germany). The tissue was cut as pieces and enzymolysized using the gentleMACS Dissociator Homogenizer (Miltenyi Biotec, Germany) running program brain-01-03. The cell solutions were passed through a 70 µm cell filter (Falcon) to obtain a single cell suspension and debris was depleted using a fragment removal solution (Miltenyi Biotec, Germany). CD11b (microglia) microbeads (Miltenyi Biotec, Germany) and magnetically activated cell sorting (MACS; Miltenyi Biotec, Germany) system were used. The isolated microglia were lysed with pre-cooling Trizol and stored at -80°C. 2.13. RNA Sequencing of Microglia Total RNA was extracted from the isolated microglia and subjected to RNA quality testing, and messenger RNA in the total RNA was purified by mRNA-specific polyA structure using Truseq Stranded mRNA Lt Sample Prepkit. The first strand cDNA was synthesized by the action of random primers and reverse transcriptase, and the second strand cDNA was synthesized using the first strand cDNA as a template. After purifying the double-stranded cDNA and performing terminal repair, adding an A at the 3 end, adding a sequencing linker under the action of the ligase, and performing fragment selection on the product with the linker added by a magnetic bead mode. The pooled libraries were uniformly diluted to 2 nM and denatured with base to form a single-stranded library. Sequencing was performed on the Novaseq 6000 PE150 platform. Filtering to obtain high-quality clean data, comparing the clean data with a designated reference genome, calculating the comparison efficiency of the sequencing data with the reference genome, and evaluating the saturation of the sequencing data and the gene coverage. Differential genes were screened in different sample groups, and visualized displays such as clustering analysis and volcanic diagram were conducted for the differential genes. GO/KEGG functional annotation and functional enrichment analysis were conducted for the differential genes to explore the functions and regulatory relationships for differential expression of the differential genes. 2.14. Immunohistochemistry and immunofluorescence For immunofluorescence, the mice were anesthetized with cold PBS perfusion and the brains were incubated for 24 h in 4% PFA and then in 30% sucrose paraformaldehyde for fully dehydration. Serial coronal sections (30 µm thick) of the brain were prepared using a cryomicrotome (Leica, Germany). The sections were immersed sequentially in antigen fix for 15 min, in 1% Triton X-100 for 10 min and in 5% bovine serum albumin (BSA) for 30 min and then incubated overnight at 4℃ with the following primary antibodies: Iba-1 (1: 1000, Wako Pure Chemical Industries, Japan). For cell immunofluorescence, cells were inoculated at 1.5×10 5 /mL. The cells were cultured at 37°C with 5% CO 2 until they reached 70% growth, and then stimulated with C27 and positive control LPS + IFN-γ. After 24 h, immunofluorescence detection was performed. After the cells were washed, 4% paraformaldehyde was overlaid on the cells and fixed for 20 min. The sections were washed with PBS, and the membrane was broken using 0.3% Triton X-100 for 10 min. The surface of the sections was covered with 3% BSA and blocked at RT for 1 h. The primary antibodies were incubated overnight at 4°C. Next day, the corresponding species of Alexa 488 or 546-coupled IgG secondary antibody (Thermo fisher scientific, USA) was added and incubated in the dark at RT for 1 h. Then placed in PBS for washing for 5 min. Hoechst was added and covered with a cover glass, protected from light. After the slices were sealed, they were observed under a a confocal laser scanning microscope (Citation 10, Bioteck, USA) and the acquired images were analyzed by Image J software. 2.15. Behavioral Assessment 2.15.1. Cylinder test The mice were placed in a cylindric transparent plexiglass (D×H: 15 cm×20 cm) and moved freely. The whole process was recorded, with a mirror mounted behind the cylinder to capture the mice as they turned their back to the camera. Each upper limb contact with the cylinder wall in an upright position until the end (marked by the return of both upper limbs to the ground) is counted as a set of movements, and the first 20 groups were recorded. Their performance was evaluated by the number of impaired forelimb contacts are calculated as a percentage of total contacts. 2.15.2. Grid-walk test Forelimb motor function was evaluated by the number of foot errors by grid-walk test. Mice were placed on a square grid with a 3 cm × 3 cm mesh at a vertical height of 60 cm and were subjected to noise or stimulation to traverse the mesh surface for 1 min. It was counted as a misstep when the mice inaccurately placed the limb and fell from the grid. The number of misstep on the left forelimb and the total number of use of both forelimbs were calculated. The test was performed three times with an interval of 1 min. Injury analysis: number of misstep on left forelimb (injured side) / total number of use of both forelimbs. 2.15.3. Pole climbing test The limb coordination ability and adhesion ability of the mice in the pole test were evaluated by rod climbing time. The device consists of a piece of wood with a long 50 cm diameter of 1 cm, wrapped around gauze to prevent animals from slipping, and the bottom is placed in a feeding cage and covered with padding to prevent mice from being injured. A wooden ball is attached to the top of the stick to help the mouse stay on top of the stick. Record the time that the mouse crawls from the top of the stick to the bottom. There were three consecutive measurements, and the interval between each measurement was at least 30 minutes to ensure the recovery of the physical strength of the mice. The average value of the three measurements was selected for data analysis. 2.16. Quantification and statistical analysis Statistical analyses were implemented using GraphPad prism 7.0 (GraphPad Software La Jolla, CA, USA). All values are presented as the mean ± SEM. Statistical significance between multiple groups was calculated with one-way ANOVA, Dunnett's multiple comparisons test; two-way ANOVA, Tukey's multiple comparisons test, p < 0.05 was considered statistically significant. 3. Results 3.1. Acute microglial inflammation induced by CKLF1 accompanied by metabolic reprogramming of glycolysis Primary microglia (PMG) from fetal mouse brain were cultured to examine their response to CKLF1. After 14 days of culture, higher purity PMG is obtained (Fig. S1A). PMG were treated with varying concentrations of CKLF1 peptide (C27) for different time. The levels of inflammatory cytokine IL-6 were determined by western blot. It was found that the expression of inflammatory cytokine IL-6 was up-regulated after CKLF1 treatment and gradually increased at 12 h, and peaked at 20–24 h (Fig. 1 A). Next, we incubated microglia with different concentrations of CKLF1 for 24 h, using lipopolysaccharide and interferon γ (LPS + IFN-γ) as positive controls, it was found that the mRNA level of IL-6 could be significantly up-regulated by CKLF1 exposure (Fig. S1B), and there is a concentration-dependent effect relationship from 500 nM to 2000 nM. The increase of IL-6 caused by CKLF1 showed no significantly different from that of the positive control. Elevated cytokines indicated that CKLF1 led to the activation of microglia. qPCR analysis showed that exposure of CKLF1 significantly increased the levels of fcgamma receptor type III (CD16), fcgamma receptor type II (CD32), and inducible nitric oxide synthase (iNOS), the marker genes of M1-type polarization. In the detection of M2 type marker genes, CKLF1 inhibited the expression of chemokine (CC motif) ligand-22 (CCL-22), but had no effect on transforming growth factor β (TGF-β) and arginase-1 (Arg-1) (Fig. S1D and S1E). The above results suggest that CKLF1 induces an acute inflammatory response in microglia, reflecting recognition of CKLF1 as a danger signal by microglia. Phagocytosis is the first step of immune cells in driving defense. The normal phagocytosis of microglia plays an important role in maintaining the normal homeostasis of the brain, brain development, pathological process and regeneration of the brain [ 28 ][ 29 ]. Therefore, we used imaging flow cytometry to detect the phagocytic ability of microglia microspheres to assess the effect of CKLF1 on microglia physiological function. Our study showed that CKLF1 significantly enhanced phagocytosis (Fig. S1C). According to the analysis of single-cell imaging, it was found that CKLF1 not only increased the proportion of microglia with phagocytic function, but also significantly increase the proportion of cells phagocytosing 1, 2, 3, and 4 globules, which suggested that phagocytic ability of microglia was improved by CKLF1 (Fig. 1 B). Apoptosis was detected by TdT-mediated dUTP nick end labeling (TUNEL) staining (Fig. S1F), and necrosis was detected by lactate dehydrogenase (Fig. S1G). The results showed that the enhancement of CKLF1 on microglial activation and inflammatory response was not related to apoptosis or necrosis. Based on the close relationship between microglia state and energy metabolism, we monitored the metabolic dynamics of microglia by detecting extracellular acidification rates (ECAR) in real time with Seahorse xFe24. The results showed that CKLF1 could significantly enhance the basal and maximal glycolytic capacity of microglia, manifested as a rapid increase in ECAR value after adding a saturated concentration of glucose or inhibiting ATP synthase activity by application of oligomycin. 2-Deoxy-D-glucose (2-DG) was the last drug added, which inhibited glycolysis by competitively binding to glycolytic pathway's hexokinase, causing a decrease in ECAR, thus confirming that the ECAR in the experiment was derived from glycolytic pathway (Fig. 1 C and D) [ 30 ]. Elevated glycolysis is further evidenced by the enhancement of lactate production and pyruvate kinase activity (Fig. 1 E and F). Furthermore, it was also found that CKLF1 at a concentration of 1000nM significantly increased the levels of key molecules in the glycolytic pathway, including the levels of glucose-6-phosphate (G6P), glucose transporter type 1 (GLUT1), 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3 (PFKFB3) and pyruvate kinase M2 (PKM2) (Fig. 1 G), The above results indicated that CKLF1 enhanced the glycolytic capacity of microglia (Fig. 1 H). In addition to glycolysis, we also found that CKLF1 significantly reduced basal oxidative phosphorylation levels and maximal oxidative phosphorylation capacity in microglia by detecting changes in the oxygen consumption rate (OCR) of microglia in real time (Fig. S2A and S2B), suggesting that CKLF1 disrupted microglia’s mitochondrial function. Further, we used MitoTracker Green to counted the form factor and aspect ratio of mitochondrial morphology in living cells (Fig. S2C and S2D). The results showed that exposure of CKLF1-induced mitochondrial fission, which may be related to the disruption of the electron transport chain related [ 31 ]. These data further confirmed that microglia metabolism switched from OXPHOS to aerobic glycolysis during CKLF1-induced microglia activation. 3.2. Inhibition of glycolytic pathway blocks CKLF1-induced microglia activation In order to observe the role of glycolysis in CKLF1-induced microglial activation and acute inflammatory response, this study used 2-DG to block the glycolysis process, which could competitively bind to Hexokinase to inhibit the glycolytic pathway. As mentioned above, in the ECAR assay, 2-DG could offset the difference in ECAR elevation induced by different concentrations of CKLF1, suggesting that the functional status of microglia may also undergo corresponding changes. To test our speculation, this study observed the effects of glycolysis on microglial function both in vivo and in vitro (Fig. 2 A). In vitro studies, qPCR analysis showed that the increased cytokine induced by CKLF1 could be blocked by 2-DG (Fig. 2 B), and microparticle-uptake assay found that CKLF1-induced enhancement of phagocytosis was also significantly counteracted by 2-DG (Fig. 2 C). Furthermore, we injected 2-DG into mice by intravenous injection, and then the stereotaxically injected CKLF1 into the cortex area. The results found that compared with the Vehicle group, the morphology of microglia in the injected C27 group showed a significantly activated state, showing a decrease in branches and an increase in the cell body. After 2-DG injection, there was no obvious activation of microglia (Fig. 2 D), which illustrated inhibition of glycolytic pathway could significantly abolishacute activation of microglia caused by CKLF1. 3.3. CKLF1-Induced glycolysis and inflammation are dependent on the AMPK-mTOR-HIF-1α Pathway As core of the cell's energy sensing mechanism, the mTOR pathway drives glucose metabolism pathway. In this cascade, AMP-activated protein kinase (AMPK) functions as a sensor for AMP and ADP, which indicate metabolic exhaustion, to inhibit mTOR phosphorylation. Hypoxia inducible factor 1α (HIF-1α), the glycolysis master transcription factor, is induced by phosphorylated mTOR [ 32 ]. To investigate whether the mTOR pathway is involved in the metabolic reprogramming caused by CKLF1, we determined the AMPK-mTOR-HIF-1α pathways in PMG after CKLF1 treatment. As shown in Fig. 3 A, CKLF1 exposure inhibited the phosphorylation of AMPK, which was followed by increased of phosphorylation of mTOR. Importantly, CKLF1 dramatically increased HIF-1α level comparable to LPS/IFNγ (Fig. 3 A and B). These results show that when microglia are exposed to CKLF1, the AMPK-mTOR-HIF-1α pathway is activated to promote glycolysis. Triggering receptor expressed on myeloid cells-2 (TREM2), one of metabolic switch for microglia, was decreased when mTOR pathway was activated. Loss of TREM2 has been well documented that lead to metabolic deficits including a reduced mitochondrial respiratory capacity and an inability to perform a glycolytic immunometabolic switch (Fig. 3 C). It was also confirmed that CKLF1 exposure improved the level of IL-6 in this study (Fig. 3 A and B), suggested that the activation of mTOR pathway accompanied with inflammation response. Furthermore, blocking the mTOR pathway with rapamycin (an allosteric mTOR inhibitor) or metformin (an AMPK activator and mTOR inhibitor) reduced CKLF1-induced production of the pro-inflammatory cytokines IL-1β, IL-6 and TNF-αat mRNA and protein levels (Fig. 3 D). Our findings suggest that CKLF1-induced microglial inflammation is dependent on the AMPK-mTOR-HIF-1α pathway. 3.4. Repeated exposure to CKLF1 resulted in metabolic abnormalities in microglia and immune tolerance. Given the prolonged expression of CKLF1 following stroke, we studied the chronic influence of CKLF1 on microglia metabolism. Within a day of exposure to danger signals, innate immune cells can be triggered and then persistently adopt either tolerance for the next 3 days, depending on the kind of stimulus. It may be simulated by cultivated cells being exposed to stimuli for 24 h and then being cultured in the absence of further stimulation for 3 days. As a result, we stimulated PMG for 24 h using C27 or vehicle. PBS washed away the drug, and after normal culture for 3 days, then stimulated with CKLF1 or vehicle for 24 h for the second time, producing three experimental groups: Veh, Acute, and Chronic (Fig. 4 A), the mRNA levels of IL-1β, IL-6 and TNF-α and protein levels of the pro-inflammatory cytokines IL-6 was lower after chronic treatment with CKLF1 than acute CKLF1 treatment and were even comparable to those in non-stimulated microglia (Fig. 4 B and C). Furthermore, chronic CKLF1 treatment dramatically decreased the phagocytic function of microglia as compared to that in acute group (Fig. 4 D, Fig. S4B), indicating that CKLF1 ultimately induced innate immune tolerance in microglia. To determine if cellular metabolism plays a role in the immune tolerant caused by chronic CKLF1 exposure, we examined the AMPK-mTOR pathway, in addition to glycolytic and OXPHOS metabolism in microglia. In seahorse test, it was found that ECAR triggered by glucose was significantly improved, suggested that the basal glycolysis was enhanced in acute group, but it was down-regulated after tolerance. Moreover, oligomycin was used to inhibit the production of mitochondrial ATP to reveal the maximum glycolysis, it was also found that the maximum glycolysis ability of microglia in the chronic group was still significantly inhibited when compared to that in acute group. Application of 2-DG to inhibit the glycolysis showed that there is no significant difference among vehicle, acute and chronic group (Fig. 4 E and F), suggested that the variation of ECAR in this study was rely on the glycolysis. qPCR analysis showed that the increased expression of glycolysis related genes by acute CKLF1 exposure was diminished in the chronic treated cells (Fig. 4 G), which provided another evidence for their metabolic reprogramming. The AMPK-mTOR-HIF-1α pathway, which induces acute inflammation in microglia, was downregulated in CKLF1-tolerant microglia (Fig. S3), ultimately leading to a decrease in the production of lactate to levels (Fig. S4A). The above results indicated that there were defects in glycolysis metabolism of the tolerant cells. Mitochondrial dysfunction as was the case in acutely activated microglia was still observed in CKLF1-tolerant microglia (Fig. S4C and S4D). Additionally, sustained exposure to enhanced necrotic microglia but not apoptotic microglia (Fig. S4E and S4F). These observations imply that broad defects in cellular metabolism including glycolysis and OXPHOS are present in CKLF1-tolerant microglia and lead to functional impairment of microglia. 3.5. Microglia isolated from adult mouse brain genome-wide RNA Sequencing identifies CKLF1-Induced acute inflammation and tolerance To evaluate whether chronic exposure of CKLF1 led to the immune tolerance of microglia in vivo , C27 was delivered into M1 cortex directly through stereotaxic injection for four consecutive days. As shown in fig.s 5 . the first injection of C27 led to a pronounce increase of IL-1β, TNF-α and IL-10 (Fig. S5). Upon the second injection, the level of IL-10 was diminished compared to the vehicle injection, while IL-1β and TNF-α release occurred at similar levels. The increase of IL-1β and TNF-α maintains to the third injection, and after the fourth injection of C27, the increased release of IL-1β and TNF-α was lost as compared to that with PBS group, indicated the brain was in immune tolerance status. Moreover, we performed genome-wide RNA sequencing (RNA-seq) on freshly isolated microglia from mice 24 h after stereotactic injection injection of PBS or CKLF1, or with acute inflammation and tolerance induced in 4 consecutive days. Compared to PBS-treated animals, there were 356 up-regulated genes and 236 down-regulated genes in acute CKLF1-treated mice (Fig. 5 A). In the up-regulated genes, significantly ( p < 0.05) enriched biological processes (BP) were identified as heat map. The term "inflammation response" includes genes involved in immune response or response to cytokine, are the most significantly enriched BP produced by acute CKLF1 injection. These findings suggest that acute exposure to CKLF1 in vivo leads to microglia inflammation and enhanced immune response. Subsequently, we analyzed changes in microglia gene expression between mice that were treated by chronic and acute CKLF1 injection. Compared with the acute stimulation group, we found 263 significantly up-regulated genes and 347 significantly down-regulated genes in the differential genes (Fig. 5 B). In the downregulated genes, inflammation response, immune response and regulation of IL-6 production are the most enriched BP induced by chronic CKLF1. In addition, the differential genes of the tolerance group and the Vehicle group included 128 up-regulated genes and 248 down-regulated genes (Fig. 5 C). Compared with the acute stimulation group, the overlap was reduced in the Vehicle group. Compare the differences between the first 20 acute stimuli and the Vehicle groups and the common differences between the Chronic and Acute groups BP. "Inflammatory Response", "Innate Immune Response", "Cytokine Response", "Neutrophic Chemotaxis" and “Immune system function regulation” were found to have significantly reduced correlations (Fig. 5 D).We also observed different alterations in microglia genes in acute and tolerant animals (Fig. 5 E). Together, they enrich the BP genome-wide transcriptional spectrum ("inflammatory response", "innate immune response", "response to cytokines", "phagocytosis", and "metabolic process" systemic processes) and associated selected genes (IL-6, TNF-α, GLUT1, PFKFB3, TREM2 CKLF1; Fig. 5 F) shows that microglia in the brain of the tolerant mice are almost not activated and are less reactive compared to microglia from CKLF1 stimulated acute inflammation mice. 3.6. The immune-tolerated microglia trained by CKLF1 loss its phagocytosis to neutrophil To examine how microglia respond to CKLF1 in vivo , we injected PBS or C27 into the cerebral cortex. For acute stimulation, the drug was given only once, and for chronic stimulation, it was administered for 4 consecutive days (Fig. 6 A). Microglia underwent marked morphological changes upon acute stimulation of C27 (Fig. 6 B), and resting microglia were highly branched and uniformly distributed throughout the brain parenchyma. When brain homeostasis is disrupted, such as when the central nervous system is injured or infected, the injured tissue and surrounding astrocytes release ATP to the outside of the cell, and the ATP receptors on the microglia sense ATP and then process the process toward the injury. The center extends while the remaining protrusions retract [ 33 ]. The structure of microglia was revealed by Iba-1 staining, which was further analyzed by skeleton analyzed in Image J (Fig. 6 C and D). The results demonstrated that acute CKLF1 caused substantial changes in microglia morphology, including the reduced process length and endpoints, indicating that microglia were activated. Chronic CKLF1 treatment also resulted in larger cell bodies in microglia, as manifested by the decreased endnotes and process length, which showed no obviously difference between acute and chronic stimulation of CKLF1. CKLF1 has been shown to have the biological function of inducing chemotactic movement of neutrophils. We also previously showed that CKLF1 can aggravate neutrophil infiltration after stroke, and the infiltrated neutrophils can be phagocytosed and cleared by microglia. In this study, we used green fluorescence to label microglia and red fluorescence to represent Ly6G, which is a marker protein of neutrophils. The results show that acute CKLF1 administration significantly increased the co-localization between neutrophil and microglia, indicating that microglia phagocytose neutrophils. The number of neutrophils in the chronic CKLF1 group was significantly higher than that in the acute CKLF1 group, and the yellow fluorescence was significantly reduced, indicating that the function of microglia to phagocytose neutrophils was reduced (Fig. 6 E). The above results demonstrate from the cellular function level that long-term administration of CKLF1 induced microglia into a state of immune tolerance. Furthermore, the levels of Lamp1, which is a biomarker of lysosomes, was also decreased in the chronic group as compared to acute administration of CKLF1 (Fig. 6 F), suggested that the degradation capacity of microglia is also diminished except for the phagocytic dysfunction. 3.7. Loss of CKLF1 restored the microglia phagocytosis and improved the long-term outcomes of stroke To confirm the biological role of CKLF1-trained immunological tolerance in microglial following stroke, we employed gene knockdown and antibody neutralization, to inhibit CKLF1's biological activity in photothrombotic stroke mice. In CKLF1-knockout mice, we observed a dramatic improvement in motor dysfunction, as seen by considerably reduced mistake rates in the cylinder test in CKLF1-KO animals compared to wild type (WT) mice from DPI 7 to 14 (Fig. 7 B). The grid walk test showed a dramatically reduces the amounts of mistakes in CKLF1-KO mice than wild type mice from DPI 3 to 14 (Fig. 7 C). Furthermore, the improvement of motor function by loss of CKLF1 was also found in pole test, manifested by decreased pole climbing time from DPI 7 to 14 (Fig. 7 D). All of results indicated that loss of CKLF1 improved the outcome of photothrombotic stroke. In addition, Loss of CKLF1 greatly increased the phagocytosis of infiltrating neutrophils by microglia, as evidenced by an increase in the co-localization of microglia and neutrophils in the ischemia marginal zone (Fig. 7 E), suggested that immune tolerance after stroke could be prevent by the loss of CKLF1. 3.8. Short term neutralize to CKLF1 produced long term improvement on the behavioral performance in photothrombotic stroke To exclude the likelihood that CKLF1 deficiency may result in aberrant brain function, we blocked CKLF1 activity by injecting CKLF1-neutralizing antibody into the lateral ventricle of the brain. The expression of CKLF1 in ischemic stroke began 8 hours after stroke and peaked 2 to 3 days after stroke, accordingly, the treatment window for CKLF1-neutralizing antibody was defined at four days following stroke, covered the peak period of CKLF1 production and neutrophil infiltration. Compared to the IgG control group, mice in the CKLF1 neutralizing antibody group exhibited considerably better behavior, and the phagocytic activity of microglia was significantly higher than in the IgG control group. In the cylinder test, neutralized to CKLF1 improved the percent of impaired forelimb use significantly as compared to IgG group at DPI 3 and 7 (Fig. 8 B). Grid test showed that there is a remarkable reduction of foot fault in the CKLF1 antibody treated animals at DPI 3 and 14 (Fig. 8 C). Pole test revealed that blockade of CKLF1 activity reduced the pole climbing time significantly (Fig. 8 D). More importantly, this improvement persisted for two weeks, indicating that short-term blockade of CKLF1 might produce a long-lasting effect after stroke. In addition, Neutralization of CKLF1 greatly increased the phagocytosis of infiltrating neutrophils by microglia, as evidenced by an increase in the co-localization of microglia and neutrophils in the ischemia marginal zone (Fig. 8 E), which provides a piece of evidence for the principal role of CKLF1 in the immune tolerance of microglia following stroke. 4. Discussion Microglia are the first line of defense for immune defense in the central nervous system. Early morphological studies have shown that microglia are in a balance between resting and activated states, and their phenotypic manifestations are highly plastic. Microglia maintain a high degree of basal activity involved in the interaction of neurons and glial cells [ 34 ]. Microglia also cause programmed cell death of immature or defective neurons and clear cell debris by phagocytosis. Therefore, resting microglia are mainly involved in neuronal development and the maintenance of normal function, playing a vital role in the central nervous system. When brain damage occurs, microglia will be activated to continuously detect the essence of the central nervous system through branched synapses, to detect changes in the central nervous system triggered by pathology-related substances. Our results reveal that the stroke target CKLF1 causes significant morphological alterations in microglia after stimulation. In this process of microglia detection, microglia undergo multi-stage activation under the stimulation of different pathogens and show corresponding different phenotypes, thus microglia playing a neuroprotective role in this process. Focal stimulation triggers microglia activation, when microglia pool at the injury site to produce an early response. Stroke induces microglia activation, which is the first step of the post-stroke inflammatory response. In the early stage of injury, activated microglia present with an amoebic phenotype, accompanied by changes in the expression of the corresponding receptors and the release of a large number of pro-inflammatory factors [ 35 ][ 36 ]. Amebic microglia have rapid motility and proliferation, and they are more susceptible to aggregation at and around the lesion. This was followed by infiltration of various immune cells including macrophages/monocytes, neutrophils, natural killer cells [ 37 ]. The end of microglia activation is represented when they show an irreversible phagocytic phenotype, i.e., different numbers of phagocytes are formed in their cytoplasm. Different microglia phenotypes and functions reveal microglia plasticity, therefore, it is crucial to observe the phenotypic changes of microglia after injury, but the identification of different phenotypes of microglia are challenging due to constantly dynamic microglia changes and susceptibility to stimulation. Our results confirm that CKLF1, a potential target of stroke, can cause phenotypic polarization of microglia inflammation and that acute induction of microglia inflammation is accompanied by metabolic reprogramming. Microglia response and function largely changed when exposed to a second inflammatory stimulus in adulthood [ 38 ][ 39 ]. Although microglia activation and inflammatory response are necessary for microglia to exert neuroprotective function, microglia continuous activation and its mediated neuroinflammation are the core pathological manifestations of neurodegenerative diseases. At present, this result is mainly explained from two aspects. On the one hand, microglia development is damaged, thus affecting brain development and function. On the other hand, these results also suggest that microglia may have long-term memories of previous inflammatory events. Mechanisms of both the innate and adaptive immune systems influence the brain injury cascade following ischemic stroke. Neutrophils and microglia, as well as other immune cells, each play complex interdependent roles that work synergistically to remove dead tissue but may also cause bystander damage to intact brain cells and create tolerance adaptations adverse chronic inflammation. Chronic systemic inflammation may adversely affect post-stroke outcomes and the risk of recurrence of further strokes [ 40 ]. In our experiments, after continuous stimulation of CKLF1 on the microglia of the innate immune system, the microglia were induced to develop immune tolerance, and changes in the physiological state of the tolerant microglia were observed. Changes in cytoplasmic metabolic function, tolerance to reduced ability of microglia to phagocytose neutrophils, and the process also needs reprogramming balance between glycolysis and OXPHOS. These results provide new insights for the future treatment of ischemic stroke in an inflammatory state, as well as for the study of the effects of glycolysis and oxidative phosphorylation on the immune function of microglia. Therefore, it is important to understand the effects on neurological diseases after the induction of immune tolerance by microglia in the central nervous system. Over the past few years, an increasing number of studies have shown that the interaction between metabolism and immune function has an important effect on cell function [ 41 ]. The central nervous system tightly regulates the main energy substrates (sugars, fats, and amino acids), so the brain microenvironment has unique metabolic characteristics. The field of immunometabolism is concerned with how reprogramming of intracellular metabolic pathways alter the immune response [ 42 ]. Metabolic reprogramming refers to the reuse of enzymes and metabolites to control various physiological and biochemical functions of cells through cell signal transduction pathways. At present, extensive research on the peripheral immune system has confirmed that metabolic reprogramming is an important role in inflammation and the polarization of immune cells [ 43 ]. Relevant research results show that the transformation of cell metabolic state to aerobic glycolysis state will be beneficial for the immune cells to play a pro-inflammatory role [ 44 ]. Although glycolysis is not as thorough as mitochondrial oxidative phosphorylation in the production of ATP, aerobic glycolysis can meet the multifunctional transformation of immune cells under the condition of adequate energy, so that they can play a role in proliferation, migration, cytokine expression and phagocytosis [ 45 ]. Our results showed that microglia could be directly activated by transforming their metabolism from oxidative phosphorylation to aerobic glycolysis after CKLF1 stimulation [ 46 ]. Microglia metabolism reprogramming is essential for microglia function in stroke. We demonstrated that the metabolic function of microglia is the key regulatory system to control immune function, and metabolic reprogramming mediates CKLF1-induced microglia polarization and directly affects cell physiological activities. Since changes in neurometabolism and microglia activity are the basis of a variety of neurological diseases or neurodevelopmental disorders, it is undoubtedly important to understand the effects of microglia metabolism reprogramming on neurons in both healthy and pathological states. mTOR not only regulate intracellular metabolism, but also works on immune cell activation. Studies have shown that multi-protein complexes of mTOR facilitate metabolic reprogramming, promoting glycolysis, glutamine decomposition, and protein and lipid synthesis, as well as GLUT1 surface expression and aerobic glycolysis. Cell growth, proliferation, and aerobic glycolysis are regulated by regulating downstream effectors in response to growth factor, nutrient, and receptor signals [ 47 ]. While AMPK promotes cellular catabolism by promoting mitochondrial adaptation and inhibiting anabolic processes [ 48 ], in addition, AMPK drives mitochondrial biogenesis and division, in addition to the removal of damaged mitochondria through mitochondrial phagocytosis/autophagy. In contrast, AMPK is crucial for lipid and cholesterol synthesis, respectively, and inhibits mTOR complex activity, because it inhibits acetyl-CoA carboxylase and HMG-CoA reductase [ 49 ]. Therefore, AMPK negatively regulates the mTOR complex to inhibit inflammation, accompanied by inhibition of protein and lipid synthesis required to produce an appropriate inflammatory response. This inhibition of anabolism and mTOR allows AMPK to inhibit metabolic rewiring and limit the activation of immune cells. We evaluated the status of the AMPK-mTOR-HIF-1α pathway in CKLF1-treated PMG to determine whether the mTOR pathway was involved in CKLF1-induced metabolic reprogramming. Overall, our results suggest that CKLF1-induced microglia inflammation is dependent on the mTOR pathway. Microglia are the earliest and longest activated immune cells after stroke. Under physiological conditions, microglia can monitor the energy metabolism and information transmission of neurons by forming connections with the neuron cell body and synapse, respectively [ 50 ]. When the ischemic necrosis area was gradually enlarged, the nucleosides released by the necrotic neurons could activate the purinergic receptors on the microglia, promote the microglia at the margin to change from M2-type polarization to M1-type polarization, and aggravate the inflammatory reaction [ 51 ]. With the increase of intracerebral CKLF1 content, the levels of microglia M1 polarization state markers iNOS and CD32 genes increased significantly in a dose-dependent manner, indicating that CKLF1 aggravated microglia M1 polarization after stroke [ 52 ]. In our experiment, after localization injection of neutralizing antibody against CKLF1 through the brain, in the mouse model of stroke established by light bolt method, the activation proportion of microglia in the brain of the mouse that inhibited the activity of CKLF1 was significantly increased, indicating that the deletion of CKLF1 could increase the activation of microglia and driving phagocytosis. In addition, the proportion of microglia in the CKLF1 gene knockout mice that swallowed the infiltrated neutrophils after stroke was significantly higher than that in the wild-type stroke mice. This indicates that the absence of CKLF1 can enhance the phagocytosis of neutrophils by microglia after stroke. The above studies have fully illustrated that CKLF1 is closely related to the functional state of microglia. Our previous work found that CKLF1 might aggravate the polarization of damaged microglia in the early stage of cerebral ischemia/reperfusion injury by regulating apoptosis. Inhibition of CKLF1 can protect the blood-brain barrier and reduce damage [ 53 ], and inhibit neutrophil infiltration [ 54 ]. As a target showing time-specific and encephalic region-specific expression after stroke, CKLF1 is not related to other neuropathological changes. Whether interfering or knocking out from the gene level or blocking the activity at the pharmacological level, they can exert the pharmacological effect against stroke, fully proving that CKLF1 is the advantage of potential therapeutic target for stroke. The current work demonstrates that CKLF1 directly activates microglia by reprogramming their metabolism to aerobic glycolysis. Microglia that have been activated release pro-inflammatory cytokines and showed a phagocytic capability. This activation requires targets for glycolysis and the AMPK-mTOR-HIF-1α pathway. However, microglia stimulated in vitro entered an innate immune tolerant state within 4 days, demonstrating abnormalities in both glycolysis and OXPHOS metabolism, as well as decreased inflammatory responses. Finally, we discovered that loss of CKLF1 or blockade of its activity restored the phagocytic activity of tolerant microglia from stroke animals, the motor function was reversed. With the deepening of research on microglia immune metabolism, neuroinflammation and related nervous system diseases, people are increasingly aware of the role of the immune response in the central nervous system diseases. Immune cells in the brain have unique and complex problems, so understanding the regulation of microglia metabolism will help to better develop targeted immune metabolism therapy. 5. Conclusions In summary, our findings suggested that metabolic reprogramming is the basis of CKLF1-induced microglia inflammation, and inhibition of mTOR pathway and glycolysis significantly reduces CKLF1-induced microglia inflammatory response. In addition, CKLF1-tolerant microglia show metabolic dysfunction and phagocytic dysfunction. Knocking out or blocking the activity of CKLF1 restores the microglia activation and increases the phagocytosis of neutrophils after photothrombotic stroke. Our results revealed a close correlation between cellular metabolic pathways and microglia function and phenotype. Finally, further studies are needed to better understand the metabolic dysfunction of microglia during stroke. Regulation of microglia bioenergy pathways may become a promising therapeutic strategy for stroke. Declarations Ethics approval and consent to participate All experiments were performed in accordance with the China Public Health Service Guide for the Care and Use of Laboratory Animals. Experiments involving mice and protocols were were performed according to protocols approved by the Animal Care and Use Committee of the Peking Union Medical College and the Chinese Academy of Medical Sciences. Consent for publication Not applicable. Availability of data and materials The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request. Competing interests The authors have no conflicts of interest to declare. Funding This work was supported by the National Key R&D Program of China (2022YFC3500301), National Natural Science Foundation of China (U2202214, 82074044, U21A20410, 82130109, 81730096, 81973499), the CAMS Innovation Fund for Medical Sciences (CIFMS) (2021-I2M-1-020), Key R&D Program of Shanxi Province (201803D421006, 201903D421018), High-End Foreign Experts introduction program（G20200001485） Authors' contributions Conception or design of the study: Naihong Chen, Shifeng Chu, Zhao Zhang, and Wenyu Ma; data collection: Wenyu Ma, Qinglin Wu, Shasha Wang, Hongyun Wang, and Junrui Ye; data analysis and interpretation: Hongsuo Sun, Zhongping Feng, and Wenbin He, drafting the article: Naihong Chen, Shifeng Chu, Zhao Zhang, and Wenyu Ma; critical revision of the article: Naihong Chen, Shifeng Chu, Zhao Zhang, Wenyu Ma, Hongsuo Sun, Zhongping Feng, and Wenbin He; All authors approved the final version of the manuscript. References ElAli A, Rivest S. Microglia in Alzheimer’s disease: A multifaceted relationship. Brain, Behavior, and Immunity. 2016;55:138–50. Ransohoff RM, Cardona AE. The myeloid cells of the central nervous system parenchyma. Nature. 2010;468:253–62. Helmut K, Hanisch UK, Noda M, Verkhratsky A. Physiology of microglia. Physiological Reviews. 2011;91:461–553. Lener MS. Microglia, Lifestyle Stress, and Neurodegeneration. Physiology & behavior. 2016;176:139–48. Hanisch UK, Kettenmann H. Microglia: Active sensor and versatile effector cells in the normal and pathologic brain. Nature Neuroscience. 2007;10:1387–94. Hanisch UK. Functional diversity of microglia - How heterogeneous are they to begin with? Frontiers in Cellular Neuroscience. 2013;7:1–18. Martinez FO, Gordon S. The M1 and M2 paradigm of macrophage activation: Time for reassessment. F1000Prime Reports. 2014;6:1–13. Cherry JD, Olschowka JA, O’Banion MK. Neuroinflammation and M2 microglia: The good, the bad, and the inflamed. Journal of Neuroinflammation. 2014;11:1–15. Ransohoff RM. A polarizing question: Do M1 and M2 microglia exist. Nature Neuroscience. 2016;19:987–91. Biswas SK, Lopez-Collazo E. Endotoxin tolerance: new mechanisms, molecules and clinical significance. Trends in immunology. England; 2009;30:475–87. Saeed S, Quintin J, Kerstens HHD, Rao NA, Aghajanirefah A, Matarese F, et al. Epigenetic programming of monocyte-to-macrophage differentiation and trained innate immunity. Science (New York, NY). 2014;345:1251086. Butovsky O, Howard L. Weiner. Microglial signatures and their role in health and disease. Nat Rev Neurosci. 2018;176:139–48. Chang C, Curtis JD, Jr LBM, Faubert B, Villarino A V, Sullivan DO, et al. Posttranscriptional Control of T Cell Effector Function by Aerobic Glycolysis. Cell. 2013;153:1239–51. Lampropoulou V, Sergushichev A, Bambouskova M, Nair S, Vincent EE, Loginicheva E, et al. Itaconate Links Inhibition of Succinate Dehydrogenase with Macrophage Metabolic Remodeling and Regulation of Inflammation. Cell metabolism. 2016;24:158–66. Netea MG, Joosten LAB, Latz E, Mills KHG, Natoli G, Stunnenberg HG, et al. Trained immunity: A program of innate immune memory in health and disease. Science (New York, NY). 2016;352:aaf1098. Tannahill GM, Curtis AM, Adamik J, Palsson-McDermott EM, McGettrick AF, Goel G, et al. Succinate is an inflammatory signal that induces IL-1β through HIF-1α. Nature. 2013;496:238–42. Fodelianaki G, Lansing F, Bhattarai P, Troullinaki M, Zeballos MA, Charalampopoulos I, et al. Nerve Growth Factor modulates LPS - induced microglial glycolysis and inflammatory responses. Experimental cell research. United States; 2019;377:10–6. Mills EL, Kelly B, Logan A, Costa ASH, Varma M, Bryant CE, et al. Succinate Dehydrogenase Supports Metabolic Repurposing of Mitochondria to Drive Inflammatory Macrophages. Cell. 2016;167:457–470.e13. Garaschuk O, Verkhratsky A. Physiology of Microglia. Methods in molecular biology (Clifton, NJ). United States; 2019;2034:27–40. Han W, Lou Y, Tang J, Zhang Y, Chen Y, Li Y, et al. Molecular cloning and characterization of chemokine-like factor 1 (CKLF1), a novel human cytokine with unique structure and potential chemotactic activity. The Biochemical journal. 2001;135:127–35. Liu DD, Song XY, Yang PF, Ai Q Di, Wang YY, Feng XY, et al. Progress in pharmacological research of chemokine like factor 1 (CKLF1). Cytokine. 2018;102:41–50. Cai X, Deng J, Ming Q, Cai H, Chen Z. Chemokine-like factor 1: A promising therapeutic target in human diseases. Experimental Biology and Medicine. 2020;245:1518–28. Han W, Lou Y, Tang J, Zhang Y, Chen Y, Li Y, et al. Molecular Cloning and Characterization of Chemokine-Like Factor 1 (Cklf1), a Novel Human Cytokine with Unique Structure and Potential Chemotactic Activity. The Biochemical journal. 2001;135:127–35. Chen C, Chu SF, Ai Q Di, Zhang Z, Guan FF, Wang SS, et al. CKLF1 Aggravates Focal Cerebral Ischemia Injury at Early Stage Partly by Modulating Microglia/Macrophage Toward M1 Polarization Through CCR4. Cellular and Molecular Neurobiology. 2019;39:651–69. Zhou X, Zhang Y-N, Li F-F, Zhang Z, Cui L-Y, He H-Y, et al. Neuronal chemokine-like-factor 1 (CKLF1) up-regulation promotes M1 polarization of microglia in rat brain after stroke. Acta Pharmacol Sin [Internet]. 2022; Available from: http://dx.doi.org/10.1038/s41401-021-00746-w Chaudhry A, Shi R, Luciani DS. A pipeline for multidimensional confocal analysis of mitochondrial morphology, function, and dynamics in pancreatic β-cells. American journal of physiology Endocrinology and metabolism. 2020;318:E87–101. Hu Y, Mai W, Chen L, Cao K, Zhang B, Zhang Z, et al. mTOR-mediated metabolic reprogramming shapes distinct microglia functions in response to lipopolysaccharide and ATP. Glia. United States; 2020;68:1031–45. Napoli I, Neumann H. Microglial clearance function in health and disease. Neuroscience. United States; 2009;158:1030–8. Neumann H, Kotter MR, Franklin RJM. Debris clearance by microglia: an essential link between degeneration and regeneration. Brain: a journal of neurology. 2009;132:288–95. Liu P-S, Ho P-C. Determining Macrophage Polarization upon Metabolic Perturbation. Methods in molecular biology (Clifton, NJ). United States; 2019;1862:173–86. Valente AJ, Maddalena LA, Robb EL, Moradi F, Stuart JA. A simple ImageJ macro tool for analyzing mitochondrial network morphology in mammalian cell culture. Acta histochemica. Germany; 2017;119:315–26. Cheng S-C, Quintin J, Cramer RA, Shepardson KM, Saeed S, Kumar V, et al. mTOR- and HIF-1α-mediated aerobic glycolysis as metabolic basis for trained immunity. Science (New York, NY). 2014;345:1250684. Otxoa-de-Amezaga A, Miró-Mur F, Pedragosa J, Gallizioli M, Justicia C, Gaja-Capdevila N, et al. Microglial cell loss after ischemic stroke favors brain neutrophil accumulation. Acta neuropathologica. 2019;137:321–41. Bakina O, Kettenmann H, Nolte C. Microglia form satellites with different neuronal subtypes in the adult murine central nervous system. Journal of neuroscience research. United States; 2022;100:1105–22. Gibson CL, Coughlan TC, Murphy SP. Glial nitric oxide and ischemia. Glia. United States; 2005;50:417–26. Chen A-Q, Fang Z, Chen X-L, Yang S, Zhou Y-F, Mao L, et al. Microglia-derived TNF-α mediates endothelial necroptosis aggravating blood brain-barrier disruption after ischemic stroke. Cell death & disease. 2019;10:487. Jin R, Yang G, Li G. Inflammatory mechanisms in ischemic stroke: role of inflammatory cells. Journal of leukocyte biology. 2010;87:779–89. Bilbo SD. Early-life infection is a vulnerability factor for aging-related glial alterations and cognitive decline. Neurobiology of learning and memory. 2010;94:57–64. Mattei D, Ivanov A, Ferrai C, Jordan P, Guneykaya D, Buonfiglioli A, et al. Maternal immune activation results in complex microglial transcriptome signature in the adult offspring that is reversed by minocycline treatment. Translational psychiatry. 2017;7:e1120. Endres M, Moro MA, Nolte CH, Dames C, Buckwalter MS, Meisel A. Immune Pathways in Etiology, Acute Phase, and Chronic Sequelae of Ischemic Stroke. Circulation research. United States; 2022;130:1167–86. Baik SH, Kang S, Lee W, Choi H, Chung S, Kim J-I, et al. A Breakdown in Metabolic Reprogramming Causes Microglia Dysfunction in Alzheimer’s Disease. Cell metabolism. United States; 2019;30:493–507.e6. O’Neill LAJ, Kishton RJ, Rathmell J. A guide to immunometabolism for immunologists. Nature reviews Immunology. 2016;16:553–65. Palsson-McDermott EM, Curtis AM, Goel G, Lauterbach MAR, Sheedy FJ, Gleeson LE, et al. Pyruvate kinase M2 regulates Hif-1α activity and IL-1β induction and is a critical determinant of the warburg effect in LPS-activated macrophages. Cell metabolism. 2015;21:65–80. Chang C-H, Curtis JD, Maggi LBJ, Faubert B, Villarino A V, O’Sullivan D, et al. Posttranscriptional control of T cell effector function by aerobic glycolysis. Cell. 2013;153:1239–51. Panatier A, Robitaille R. The soothing touch: microglial contact influences neuronal excitability. Developmental cell. United States; 2012;23:1125–6. Yang T, Li S, Xu H, Walsh DM, Selkoe DJ. Large Soluble Oligomers of Amyloid β-Protein from Alzheimer Brain Are Far Less Neuroactive Than the Smaller Oligomers to Which They Dissociate. The Journal of neuroscience: the official journal of the Society for Neuroscience. 2017;37:152–63. Huang H, Long L, Zhou P, Chapman NM, Chi H. mTOR signaling at the crossroads of environmental signals and T-cell fate decisions. Immunological reviews. 2020;295:15–38. Herzig S, Shaw RJ. AMPK: guardian of metabolism and mitochondrial homeostasis. Nature reviews Molecular cell biology. 2018;19:121–35. Gwinn DM, Shackelford DB, Egan DF, Mihaylova MM, Mery A, Vasquez DS, et al. AMPK phosphorylation of raptor mediates a metabolic checkpoint. Molecular cell. 2008;30:214–26. Cserép C, Pósfai B, Lénárt N, Fekete R, László ZI, Lele Z, et al. Microglia monitor and protect neuronal function through specialized somatic purinergic junctions. Science (New York, NY). United States; 2020;367:528–37. Lourbopoulos A, Ertürk A, Hellal F. Microglia in action: how aging and injury can change the brain’s guardians. Frontiers in cellular neuroscience. 2015;9:54. Chen C, Chu S-F, Ai Q-D, Zhang Z, Guan F-F, Wang S-S, et al. CKLF1 Aggravates Focal Cerebral Ischemia Injury at Early Stage Partly by Modulating Microglia/Macrophage Toward M1 Polarization Through CCR4. Cellular and molecular neurobiology. United States; 2019;39:651–69. Kong L-L, Wang Z-Y, Hu J-F, Yuan Y-H, Li H, Chen N-H. Inhibition of chemokine-like factor 1 improves blood-brain barrier dysfunction in rats following focal cerebral ischemia. Neuroscience letters. Ireland; 2016;627:192–8. Kong LL, Wang ZY, Han N, Zhuang XM, Wang ZZ, Li H, et al. Neutralization of chemokine-like factor 1, a novel C-C chemokine, protects against focal cerebral ischemia by inhibiting neutrophil infiltration via MAPK pathways in rats. Journal of neuroinflammation. 2014;11:112. Additional Declarations No competing interests reported. Supplementary Files SupportingInformation.docx Graphicalabstract.docx OriginalWesternBlots.docx Cite Share Download PDF Status: Published Journal Publication published 25 Apr, 2023 Read the published version in Journal of Neuroinflammation → Version 1 posted Editorial decision: Major revision 25 Jan, 2023 Reviews received at journal 10 Jan, 2023 Reviewers agreed at journal 15 Dec, 2022 Reviewers invited by journal 15 Dec, 2022 Editor assigned by journal 07 Dec, 2022 Submission checks completed at journal 07 Dec, 2022 First submitted to journal 05 Dec, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-2344526","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":158063581,"identity":"9a084448-6d6f-459a-b066-e93804ace38d","order_by":0,"name":"Wenyu Ma","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Wenyu","middleName":"","lastName":"Ma","suffix":""},{"id":158063583,"identity":"14664e86-0a79-4c05-a546-66f4f2793bdc","order_by":1,"name":"Qinglin Wu","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Qinglin","middleName":"","lastName":"Wu","suffix":""},{"id":158063585,"identity":"b7faa984-f9b6-4535-a557-3010af234124","order_by":2,"name":"Shasha Wang","email":"","orcid":"","institution":"Guangzhou University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Shasha","middleName":"","lastName":"Wang","suffix":""},{"id":158063587,"identity":"d8f7fad1-128b-4a47-bce9-cbf29485ec49","order_by":3,"name":"Hongyun Wang","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences and Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"Hongyun","middleName":"","lastName":"Wang","suffix":""},{"id":158063588,"identity":"6e42c721-106e-4d43-b268-3faa27a8198e","order_by":4,"name":"Junrui Ye","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences and Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"Junrui","middleName":"","lastName":"Ye","suffix":""},{"id":158063590,"identity":"c9054b8f-694b-4b9b-9ea6-3973747aa50a","order_by":5,"name":"Hongsuo Sun","email":"","orcid":"","institution":"University of Toronto","correspondingAuthor":false,"prefix":"","firstName":"Hongsuo","middleName":"","lastName":"Sun","suffix":""},{"id":158063592,"identity":"a361abdd-583d-40ab-bf08-8de290ec8dcb","order_by":6,"name":"Zhongping Feng","email":"","orcid":"","institution":"University of Toronto","correspondingAuthor":false,"prefix":"","firstName":"Zhongping","middleName":"","lastName":"Feng","suffix":""},{"id":158063594,"identity":"536be2fe-233a-43bb-a71f-7689fc0994ec","order_by":7,"name":"Wenbin He","email":"","orcid":"","institution":"Shanxi University of Chinese Medicine","correspondingAuthor":false,"prefix":"","firstName":"Wenbin","middleName":"","lastName":"He","suffix":""},{"id":158063596,"identity":"0c52f6df-9721-4413-ab30-c735dece3d8f","order_by":8,"name":"Shifeng Chu","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences and Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"Shifeng","middleName":"","lastName":"Chu","suffix":""},{"id":158063597,"identity":"069c98e5-83ca-481b-b4fc-953c3bc04d89","order_by":9,"name":"Zhao Zhang","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences and Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"Zhao","middleName":"","lastName":"Zhang","suffix":""},{"id":158063599,"identity":"164d3caa-a767-4d1b-ae87-5bf5cf9a8946","order_by":10,"name":"Naihong Chen","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAApklEQVRIiWNgGAWjYDACCSBmbLDhIVlLGulaDpOgg39287HHhTvOy+hOO8D44QeDXR5hS+4cSzeeeeY2j9ntBGbJHobkYoJaDCRyzKR528BaGKQZGA4kNhDWkv8NqOUc2JbfRGrJYQNqOQDSwkacLRI30kAOSwZqSWyz7DFIJqyFf0byM6AWO3uz28mHb/yosCOsBQkwAhUbkKB+FIyCUTAKRgFuAAA66TZ2ymkYRQAAAABJRU5ErkJggg==","orcid":"","institution":"Chinese Academy of Medical Sciences and Peking Union Medical College","correspondingAuthor":true,"prefix":"","firstName":"Naihong","middleName":"","lastName":"Chen","suffix":""}],"badges":[],"createdAt":"2022-12-05 05:59:21","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-2344526/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-2344526/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12974-023-02779-w","type":"published","date":"2023-04-25T20:35:38+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":30229165,"identity":"210a38bf-1d73-4b11-8456-2526a39b3be7","added_by":"auto","created_at":"2022-12-12 21:31:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":182555,"visible":true,"origin":"","legend":"\u003cp\u003eCKLF1 induces activation of microglia accompanied by metabolic reprogramming of aerobic glycolysis. (A) is time course of IL-6 protein expression stimulated by C27 (\u003cem\u003en\u003c/em\u003e = 3 per group). (B) indicates that microglial phagocytosis was activated by C27 exposure. Microglial phagocytosis was tested using imaging flow cytometryto detect the control group, the positive control group (LPS+IFN-γ) and low dose C27-L (500 nM), medium dose C27-M (1000 nM), high dose C27-H (2000 nM) administration group (C27-L, C27-M, C27-H). The amount of zymosan phagocytosed by microglia was revealed by the fluorescence imaging in a single cell. Scale bar: 7 μm. And the proportion of zymosan phagocytosed by a single cell in each group (\u003cem\u003en\u003c/em\u003e = 3 per group). (C) and (D) show microglia glycolysis was enhanced by C27. The cell energy metabolism analyzer detects the real-time change process of extracellular acidification and quantitatively counts the basic glycolytic capacity, maximum glycolytic capacity and reserve glycolytic capacity in the measurement of ECAR (\u003cem\u003en\u003c/em\u003e = 4 per group). (E) and (F) are the levels of pyruvate kinase and lactate in microglia after C27 treatment (\u003cem\u003en\u003c/em\u003e = 6 per group). (G) is the relative mRNA expression of glycolytic genes stimulated by C27 (\u003cem\u003en\u003c/em\u003e = 6 per group). (H) is the schematic diagram of the metabolic reprogramming process induced by C27. Data are presented as mean ± SEM. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001 \u003cem\u003evs.\u003c/em\u003e control group.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-2344526/v1/d4e3b6ff9b553e6804df5d05.png"},{"id":30228768,"identity":"c7278d7c-8196-4170-8c5c-df6ef986e1ee","added_by":"auto","created_at":"2022-12-12 21:23:42","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":171648,"visible":true,"origin":"","legend":"\u003cp\u003eInhibition of glycolytic pathway abolished the activation of microglia caused by CKLF1. (A) is the schematic illustration of \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e administration of the glycolytic inhibitor 2-DG. (B) is the relative mRNA levels of inflammatory cytokines in microglial challenged by C27 with or without of 2-DG (\u003cem\u003en\u003c/em\u003e = 6 per group). (C) indicates that inhibition of glycolysis blocked the phagocytosis stimulated by C27 \u003cem\u003ein vitro\u003c/em\u003e. The amount of zymosan phagocytosed by microglia in each group was detected by imaging flow cytometry and quantification of positive ratio of phagocytosis for each group (\u003cem\u003en\u003c/em\u003e= 3 per group). (D) shows the inhibition of glycolysis blocked the phagocytosis stimulated by C27 \u003cem\u003ein vivo\u003c/em\u003e. After injected 2-DG into mice, the fluorescence expression of neutrophil Ly6G (red) phagocytized by microglia Iba-1 (green) (\u003cem\u003en\u003c/em\u003e = 3 per group). Scale bar = 75 μm. Data are presented as mean ± SEM. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.001 \u003cem\u003evs.\u003c/em\u003e control group.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-2344526/v1/73de95d785b89cd8f3441ba5.png"},{"id":30228766,"identity":"8554b469-e7b4-46e9-95c1-953c966f04c3","added_by":"auto","created_at":"2022-12-12 21:23:42","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":155675,"visible":true,"origin":"","legend":"\u003cp\u003eCKLF1-induced glycolysis and inflammation are dependent on the activation AMPK-mTOR-HIF-1α pathway. (A) is the representative molecular image of AMPK-mTOR-HIF-1α pathway. Microglia were treated with LPS+IFN-γ and various doses of C27 for 24 h, and the immunoblot analysis of mTOR, p-mTOR, HIF-1α, AMPK, p-AMPK, TREM2, IL-6 and β-Actin (\u003cem\u003en\u003c/em\u003e = 3 per group). (B)\u003cstrong\u003e \u003c/strong\u003eare the\u003cstrong\u003e \u003c/strong\u003equantification of gray values of figure 3A (\u003cem\u003en\u003c/em\u003e = 3 per group). (C) is fluorescent signals of TREM2 simulated by C27 (\u003cem\u003en\u003c/em\u003e = 3 per group). Scale bar = 100 μm. (D) are the relative mRNA expression of IL-1β, IL-6 and TNF-α in microglia treated with C27 and rapamycin or metformin for 24 h (\u003cem\u003en\u003c/em\u003e = 6 per group). (E) is the schematic diagram of the effect of rapamycin or metformin on AMPK-mTOR-HIF-1α pathway. Data are presented as mean ± SEM. *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 \u003cem\u003evs.\u003c/em\u003e control group.\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-2344526/v1/80d0b4836a0f1425254ddc82.png"},{"id":30229161,"identity":"91f88d58-e4d2-404f-92f6-185e4e21d1dc","added_by":"auto","created_at":"2022-12-12 21:31:42","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":133861,"visible":true,"origin":"","legend":"\u003cp\u003eRepeated exposure of CKLF1-induced metabolic abnormalities and immune tolerance in microglia. (A) is the timeline of repeated exposure of CKLF1 to microglia. Microglia was stimulated by CKLF1 or vehicle-stimulated microglia for 24 h. After washing off the drug, cells were further cultured with medium without C27 for the following three days and then restimulated with CKLF1 or vehicle for the next 24 h, resulting in these three experimental groups: Veh, acute, and chronic stimulation. (B) is the level of IL-6 in microglia determined by western blot (\u003cem\u003en\u003c/em\u003e = 3 per group). (C) is the relative mRNA levels of inflammatory cytokines in microglial (\u003cem\u003en\u003c/em\u003e = 6 per group). (D) indicates that repeated exposure of C27 fail to induce phagocytosis in microglia. After the microglia were induced with CKLF1, the amount of zymosan phagocytosed by cells in each group was detected by imaging flow cytometry (\u003cem\u003en\u003c/em\u003e = 3 per group). (E) and (F)shows repeated exposure of C27 led to metabolic abnormalities in microglia. The cell energy metabolism analyzer detects the real-time change process of extracellular acidification, and quantitatively counts the basic glycolytic capacity, maximum glycolytic capacity and glycolytic reserve capacity in the measurement of ECAR (\u003cem\u003en\u003c/em\u003e = 6-7 per group). (G) is the statistics of relative mRNA expression of glycolytic genes(\u003cem\u003en\u003c/em\u003e = 6 per group). Data are presented as mean ± SEM. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 \u003cem\u003evs.\u003c/em\u003e vehicle group or acute group.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-2344526/v1/d10b8c9fbc407386c4b8db90.png"},{"id":30228771,"identity":"da202d81-c077-4b8f-a222-84f7450c597c","added_by":"auto","created_at":"2022-12-12 21:23:42","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":188252,"visible":true,"origin":"","legend":"\u003cp\u003eGene expression in freshly isolated microglia from adult mice after acute or chronic stereotactic injection of C27. (A) are the volcano plot of gene expression changes and up-regulated genes in microglia of C27 acute stimulated mice were significantly (\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05) enriched for 20 BPs compared to PBS-treated mice. The importance of BP is indicated by the intensity of red (\u003cem\u003en\u003c/em\u003e= 3 per group). (B) are the volcano plots of gene expression changes and down-regulated genes enriched in a significant (\u003cem\u003ep \u003c/em\u003e\u0026lt; 0.05) 20 BPs in the microglia of C27 chronically stimulated mice compared to acutely stimulated mice. The importance of BP is represented by the intensity of blue (\u003cem\u003en\u003c/em\u003e = 3 per group). (C) is volcano plot of gene expression changes in microglia of C27 chronically stimulated mice compared to PBS-treated mice (\u003cem\u003en\u003c/em\u003e = 3 per group). (D) Comparison of the significance of the top 20 BPs shared between\u0026nbsp;groups of mice after acute and chronic treatment with C27 (\u003cem\u003en\u003c/em\u003e= 3 per group). (E) are the heatmap which depicting the transcriptional profile of selected BPs among the top 20 BPs (\u003cem\u003en\u003c/em\u003e= 3 per group). (F) Normalized expression of selected genes (\u003cem\u003en\u003c/em\u003e = 3 per group). Data are presented as mean ± SEM. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 \u003cem\u003evs.\u003c/em\u003e vehicle group or acute group.\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-2344526/v1/3960ca706608c4a04330ff75.png"},{"id":30228776,"identity":"e34708c6-1a39-40b1-bdad-73ab3e2a9e5f","added_by":"auto","created_at":"2022-12-12 21:23:42","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":120078,"visible":true,"origin":"","legend":"\u003cp\u003eChronic administration of C27 to M1 cortex produced immune tolerance \u003cem\u003ein vivo\u003c/em\u003e. (A) C27 was delivered into brain at the dose of 10 μg through stereotactic injection for once or four times, and the tissues was collected at 24 hours post of last injection. (B) The structure of microglia was revealed by Iba-1 staining, which was further analyzed by skeleton analyzed in Image J. Scale bar = 10 μm. (C) Analysis of the process length induced by C27 (\u003cem\u003en\u003c/em\u003e = 25 per group). (D) Analysis of the endpoints per microglia induced by C27 (\u003cem\u003en\u003c/em\u003e= 25 per group). (E) Microglia loss its phagocytosis to neutrophil after chronic administration of C27. Microglia and neutrophil were staining with green and red respectively, the merged images showed the engulfed neutrophil by microglia (\u003cem\u003en\u003c/em\u003e = 3 per group). Scale bar = 15 μm. (F) Lamp1 was decreased challenged by chronic administration of C27 (\u003cem\u003en\u003c/em\u003e = 3 per group). Data are presented as mean ± SEM. ** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, *** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 \u003cem\u003evs.\u003c/em\u003e vehicle group.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-2344526/v1/1328c81b74ce8d123b6670e6.png"},{"id":30229166,"identity":"c794f130-e9a5-48ce-b586-8a8fa9ebf4ee","added_by":"auto","created_at":"2022-12-12 21:31:42","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":190944,"visible":true,"origin":"","legend":"\u003cp\u003eKnockout CKLF1 improves behavioral performance and restores microglia phagocytosis after stroke. (A) Schematic diagram of the loss of CKLF1 restored the microglia phagocytosis and improved the long-term outcomes of stroke established by photothrombotic. (B)-(D) Mice were assessed function recovery by testing with cylinder test (B), grid walking task (C) and pole climbing test (D) at baseline and 3, 7 and 14 days after stroke. (\u003cem\u003en\u003c/em\u003e = 6 per group), ** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, *** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.001 \u003cem\u003evs.\u003c/em\u003e WT-PT group at corresponding time point. (E) CKLF-KO maintains phagocytosis to neutrophils. Microglia were stained with an antibody against Iba-1 (green), nuclei were stained with hoechst (blue), and neutrophils were stained with Ly6G (red). Typical images of morphology of phagocytosis of neutrophils by microglia in wild type and CKLF1 KO mice (\u003cem\u003en\u003c/em\u003e = 3 per group). Scale bar = 15 μm.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-2344526/v1/ff57d78e960fe460fe740aec.png"},{"id":30229628,"identity":"5f99e6ee-904e-42d1-a3f9-c3c477087ed9","added_by":"auto","created_at":"2022-12-12 21:47:42","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":197999,"visible":true,"origin":"","legend":"\u003cp\u003eShort term neutralize to CKLF1 produced long term improvement on behavioral performance and restores microglia phagocytosis after stroke. (A) Schematic diagram of neutralize to CKLF1 restored the microglia phagocytosis and improved the long-term outcomes of stroke established by photothrombotic. (B)-(D) Mice were assessed function recovery by testing with cylinder test (B), grid walking task (C) and pole climbing test (D) at baseline and 3, 7 and 14 days after stroke (\u003cem\u003en\u003c/em\u003e = 6 per group), *\u003cem\u003ep\u003c/em\u003e\u0026lt;0.05, ** \u003cem\u003ep\u003c/em\u003e\u0026lt;0.01, ***\u003cem\u003e p\u003c/em\u003e\u0026lt;0.001 \u003cem\u003evs.\u003c/em\u003e IgG treated group at corresponding time point. (E) Neutralize to CKLF1 maintains phagocytosis to neutrophils at DPI 1 and 4. Microglia were stained with an antibody against Iba-1 (green), nuclei were stained with hoechst (blue), and neutrophils were stained with Ly6G (red). Typical images of morphology of phagocytosis of neutrophils by microglia in IgG and CKLF1 antibody mice. Scale bar: 15 μm.\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-2344526/v1/de743efa7fb24ffc6e1c20ea.png"},{"id":44727412,"identity":"451ce35e-63a0-4b25-9e91-a09fe1269e9d","added_by":"auto","created_at":"2023-10-16 20:52:55","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1856200,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-2344526/v1/61c13a42-0814-40f5-8852-69b9e6269106.pdf"},{"id":30229163,"identity":"7d7d4add-f15e-40d0-b133-7e385ca4d7ae","added_by":"auto","created_at":"2022-12-12 21:31:42","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1662691,"visible":true,"origin":"","legend":"","description":"","filename":"SupportingInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-2344526/v1/6161a9876eba296a97ee7f87.docx"},{"id":30229307,"identity":"491b6d94-8219-468c-a4c2-a33c5758dbb9","added_by":"auto","created_at":"2022-12-12 21:39:42","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":548938,"visible":true,"origin":"","legend":"","description":"","filename":"Graphicalabstract.docx","url":"https://assets-eu.researchsquare.com/files/rs-2344526/v1/fd182080e186251e86653955.docx"},{"id":30228773,"identity":"ad794217-6931-4393-84f5-8efca83368e6","added_by":"auto","created_at":"2022-12-12 21:23:42","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":2356612,"visible":true,"origin":"","legend":"","description":"","filename":"OriginalWesternBlots.docx","url":"https://assets-eu.researchsquare.com/files/rs-2344526/v1/a9a99c8c75c3998f0d0aa660.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"A breakdown of metabolic reprogramming in microglia caused by CKLF1 exacerbates immune tolerance in the ischemic stroke","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eIschemic stroke is the most common type of stroke, and neurological injury has been associated with a variety of pathological indicators, including inflammation, oxidative stress, and blood-brain barrier breakdown. The innate immune response is a highly complex physiological process during the acute stage of ischemic stroke. Microglia, the brain's resident immune cells, were activated initially and have the most intricate effects during the post-stroke stage [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. It has been revealed that overactivation of microglia was the primary drive of neuroinflammation, while loss of microglia also exacerbated neuronal damage, and that repopulating microglia following a stroke promoted the neurorepair alleviated it significantly [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e][\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], suggested that the immune status of microglia is important for stroke outcome. However, its regulatory mechanism remains unclear.\u003c/p\u003e \u003cp\u003eMicroglia are polysynaptic and flexible immunological effector cells found in the central nervous system, which may develop an inflammatory phenotype in response to \"danger signals\" such as pathogens and tissue damage, as evidenced by increased production of pro-inflammatory cytokines such as interleukin-1β (IL-1β), interleukin-6 (IL-6) and tumor necrosis factor-a (TNF-α), as well as enhanced immune responses, including cellular recruitment (e.g., chemotaxis, and phagocytosis) [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Consequently, activated immune cells are attracted to the inflammatory region and facilitate in the elimination of pathogens. However, once began, the process must be tightly monitored, as uncontrolled or severe inflammation can cause host tissue damage [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e][\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Many pathways regulating these characteristics have been elucidated [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Nonetheless, the distinction between homeostatic and disease-related signaling is not absolute [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], and this simplistic view does not adequately describe the complex physiology of microglia [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAs a result of immune cells becoming polarized during inflammation, \"innate immunological tolerance\" occurs, a host-protective mechanism in which these cells become unresponsive to recurrent stimulation. Immune tolerance may protect host tissue from the detrimental effects of excessive inflammatory responses, However, it has been paradoxically associated with immune cell malfunction in a variety of disorders, including cancer, sepsis, autoimmune diseases, and metabolic diseases [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e][\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e], both in vitro and in vivo. Therefore, central to our understanding of microglia function in disease and our ability to target microglia is the need for more biomarkers and underlying mechanisms that reflect the functioning of microglia at different stages of travel [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eRecently, research on cellular metabolic reprogramming has provided new clues for the activation of immune cells. Because immune cells perform a variety of functions with different energy demands, the metabolic pathways utilized to fabricate energy change by cellular phenotype. Relevant research results show that the transformation of cell metabolic state to aerobic glycolysis state will be beneficial for the immune cells to play a pro-inflammatory role. The inflammatory response of immune cells is dependent on aerobic glycolysis, through understanding this mechanism, we can provide cells with a rapid supply of adenosine triphosphate (ATP), thus regulating the enzyme, and regulating the production of pro-inflammatory cytokines by releasing some substances [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], although glycolysis is less efficient than mitochondrial in terms of ATP production, glycolysis' rate of glucose metabolism is 10\u0026ndash;100 times faster than oxidative phosphorylation (OXPHOS), allowing it to perform energy-intensive activities like proliferation, migration, cytokine release, and phagocytosis. On the other hand, owing of its high efficiency, na\u0026iuml;ve and resting cells, which require a continuous energy source, rely mostly on mitochondrial respiration. As a result, microglia might adopt a phenotype known as \"trained-immunity,\" in which immunological responses are reinforced by an increase in glycolysis [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e][\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e][\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. As a unique metabolic organ, brain will provide a unique environment for immune metabolism control of microglia [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e][\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Metabolic reprogramming will produce a large number of pro-inflammatory factors to increase immune memory. The change of cell metabolic state is also closely related to the formation of immune memory by macrophages [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. However, it is still uncertain whether metabolic reprogramming will affect the immune function of microglia.\u003c/p\u003e \u003cp\u003eCKLF1 is a CC chemokine that was cloned in 2001 and has multiple biological activities [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. As a secreted protein [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e][\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], CKLF1 plays a key role in a variety of tissues and has potential effects, which has attracted extensive attention by researchers [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Studies have shown that CKLF1 is highly expressed after cerebral ischemia. In the acute phase following stroke, knocking out (KO) CKLF1 or inhibiting its activity might cause severe nerve injury and decrease the amount of activated microglia. A single dose of CKLF1 administered 1 h prior to ischemia can exacerbate nerve damage and the inflammatory response, implying that CKLF1 can be immunologically trained for microglia and then rapidly activate microglia in the presence of subsequent ischemic injury [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e][\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. However, it is unknown whether CKLF1 might induce immunological tolerance or mitigate nerve damage following stroke, the regulation of CKLF1 expression and its molecular mechanism on microglia phenotypic changes have not yet been elucidated, which seriously hinders its research as a new anti-stroke therapeutic target.\u003c/p\u003e \u003cp\u003eIn this study, it was found that CKLF1 causes acute microglial inflammation and metabolic reprogramming from oxidative phosphorylation to glycolysis, which was reliant on the AMPK-mTOR-HIF-1α signaling pathway. Microglia, once activated, entered a chronic tolerant phase as a result of widespread energy metabolism abnormalities and therefore reduced immunological responses, including cytokine release and phagocytosis. It was also found metabolically dysfunctional microglia in the mice using genome-wide RNA sequencing by chronic administration of CKLF1 directly, as well as the decrease of inflammation response. Finally, we showed that loss of CKLF1 reversed the defective immune response of microglia, as manifested by kept its phagocytosis to neutrophils, thereby mitigating long term outcomes of ischemic stroke. Overall, CKLF1 plays a crucial role in the relationship between microglial metabolic status and immune function in stroke, which provides a potential therapeutic strategy for the treatment of ischemic stroke.\u003c/p\u003e"},{"header":"2. Materials And Methods","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003ch2\u003e2.1. \u003cem\u003eAnimals\u003c/em\u003e\u003c/h2\u003e\n \u003cp\u003eAll animal procedures were performed according to protocols approved by the Animal Care and Use Committee of the Peking Union Medical College and the Chinese Academy of Medical Sciences. Adult male (7\u0026ndash;8 weeks old) C57BL/6N mice (Charles river, China) housed under constant temperature and a 12:12 h light/dark cycle were used. Feed and water sources were consumed ad libitum by the mice. CKLF1\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice were generous provided by Professor Zhang (Institute of Laboratory Animal Science, Peking Union Medicine College, Chinese Academy of Medical Sciences)[\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e]. Generation of CKLF1\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice were using CRISPR/Cas9 system. Investigators designed sgRNA-target sequences (gene ID: 75458, target site 1: cctggagcagcgtttgctcgg, target site 2: gatattatacttgtaatctgg) based on the first coding exon of the CKLF1 gene and transcribed sgRNA and Cas9 mRNA in vitro. After injection into fertilized eggs, investigators got 23 pups of F0 generation, two of which were KO mice with the test of PCR and sequencing. After mating for 10 generations, investigators got the homozygote CKLF1\u003csup\u003e\u0026minus;/\u0026minus;\u003c/sup\u003e mice with genetic stability. In this line, 957 bp nucleic acid in CKLF1 was deleted, and frameshift mutation occurred in the subsequent protein coding region.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec4\"\u003e\n \u003ch2\u003e2.2. Stereotaxic injection and photothrombotic stroke\u003c/h2\u003e\n \u003cp\u003eThe surgery was performed under isoflurane anesthesia, and the mice were fixed using a stereotactic frame (RWD Life Science, China). The injection site is the right M1 area according to the second edition of the mouse brain in Stereotaxic Coordinates from the bregma point as follows: AP, +\u0026thinsp;1.5 mm; ML, -2.0 mm; DV, -1.7 mm. After the injection, the needle was remained in the M1 area for the next 10 min to prevent drug leakage. For the administration cannula, surgical operation needs to be performed with brain stereotaxic apparatus. After the animals were anesthetized, the scalp was opened to expose the skull, and the site was drilled. The cannula is clamped by a holder and implanted to a suitable depth. The dental cement was fixed and the catheter cap was inserted to complete the surgery. For acute stimulation of CKLF1, 24 h after stereotactic injection of C27 at the dose of 10 \u0026micro;g, who is the CKLF1 active peptide sequenced by ALIYRKLLFNPSGPYQKKPVHEKKEVL with 99% of purity provided by Guoping Pharmaceutical (Anhui, China), brains were taken after heart perfusion. For tolerated stimulation, 10 \u0026micro;g C27 was administered once a day for four times by same manner. After 24 hours of last injection, the brains were taken followed heart perfusion. For anti-CKLF1 antibody treatment, 10 \u0026micro;g anti-CKLF1 or control IgG were administered by the stereotactic injection prior to the photothrombotic stroke. After that, 200 \u0026micro;L of 10 mg/mL Rose Bengal sodium salt (Solarbio, China) solution was administered via tail vein. After 5 min, green laser with spot diameter of 2 mm (wavelength 532 nm) was turned on and irradiated for 7 min to form an ischemia model of specific brain regions.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec5\"\u003e\n \u003ch2\u003e2.3. Primary Microglia Culture\u003c/h2\u003e\n \u003cp\u003ePrimary Microglia (PMG) was obtained in the cerebral of C57BL/6 neonatal mouses at 24 h of birth. The mouse decapitations were placed in pre-cooled DMEM/F12 medium. Brain tissue was cut to pieces to digest the cells, and then sieved and a single cell suspension from the brain was placed in culture flasks coated with poly-lysine (PLL). After 3 days of incubation at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e, the medium (DMEM/F12 containing 10% fetal bovine serum and 1% Penicillin-Streptomycin) was changed. Microglia were isolated from the mixed glial cultures on Day 10 by oscillating, and the shaking was repeated 3\u0026ndash;5 days later. Isolated PMG was seeded at 1.5-2.0\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells /mL on a PLL-coated cell culture plate and incubated until stable (37\u0026deg;C, 5% CO\u003csub\u003e2\u003c/sub\u003e) prior to use.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec6\"\u003e\n \u003ch2\u003e2.4. Stimulation of PMG\u003c/h2\u003e\n \u003cp\u003ePMG was stimulated by LPS (100 ng/mL) and IFN-\u0026gamma; (20 ng/mL) or C27 (500 nM, 1000 nM, 2000 nM) for 24 h. In some conditions of experiments, PMG was preincubated with 2-DG (4 mM, Topscience, China) to inhibit glycolysis, or was incubated with rapamycin (50 nM, Topscience, China) or metformin (2 mM, Topscience, China) to block the mTOR pathway. Experiments for the tolerance model mimicked chronic conditions by incubating cells with vehicle or C27 (1000 nM) for 24 h, washing with preheated phosphate buffered saline (PBS), followed by further incubation with PMG for 3 days. After that, the cells were re-stimulated with C27 (1000 nM) for 24 h.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec7\"\u003e\n \u003ch2\u003e2.5. Measurement of Lactate and Pyruvate kinase\u003c/h2\u003e\n \u003cp\u003ePMG (2.0\u0026times;10\u003csup\u003e5\u003c/sup\u003e cells/mL) was spread on a 6-well plate, and was administered as described above. Thereafter, the lactic acid and pyruvate kinase in the cells were quantified by utilizing the lactic acid content assay kit (Solarbio, China) and pyruvate kinase activity detection kit (Solarbio, China) according to the manufacturer\u0026apos;s instructions.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec8\"\u003e\n \u003ch2\u003e2.6. Live Cell Mitochondrial Imaging\u003c/h2\u003e\n \u003cp\u003ePMG was cultured on fluorodish cell culture dish (World precision instruments, China) for imaging of live mitochondria and treated with MitoTracker Green (300 nM, Thermo Fisher Scientific, USA) solution protected from light for 30 min (37℃, 5% CO\u003csub\u003e2\u003c/sub\u003e) to label mitochondria. Fresh complete medium was added after rinsing by preheated PBS. Real-time mitochondrial imaging was performed using confocal laser scanning microscopy (Leica, Germany) and mitochondrial morphology was analyzed by using ImageJ software [\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec9\"\u003e\n \u003ch2\u003e2.7. Western Blotting\u003c/h2\u003e\n \u003cp\u003eThe cultured cells were collected and then lysed with RIPA lysis buffer (Beyotime, China) containing a mixture of protease and phosphate inhibitor. Protein was separated by electrophoresis on a 10% SDS-PAGE gel containing an equal amount of protein (25\u0026ndash;60 \u0026micro;g) of the lysates and transferred to a PVDF (Merck Millipore, USA) membrane. After 2 h of blocking with 5% BSA formulated with Tris-buffered saline containing 0.1% Tween-20 (TBS-T) at room temperature (RT), the membranes were incubated overnight with primary antibody at 4℃: anti-IL-6 (1: 1000, abcam, UK), Anti-mTOR antibody [Y391] (1:1000, abcam, UK), Anti-mTOR (phospho S2481) antibody (1:1000, abcam, UK), Anti-AMPK alpha 1\u0026thinsp;+\u0026thinsp;AMPK alpha 2(1:1000, abcam, UK), Anti-AMPK alpha 1 (phospho T183)\u0026thinsp;+\u0026thinsp;AMPK alpha 2 (phospho T172) (1:1000, abcam, UK), Anti-TREM2 antibody (1:500, abcam, UK), Anti-HIF-1 alpha antibody (1:1000, abcam, UK). After 3 washes, the specific blot was incubated with a secondary antibody of the appropriate species at RT for 2 h. The expression of each protein was examined with enhanced chemiluminescence plus detection system (Molecular Device, Lmax). Analysis was performed by FIJI software.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec10\"\u003e\n \u003ch2\u003e2.8. Isolation of RNA and quantitative real-time polymerase chain reaction (RT-PCR)\u003c/h2\u003e\n \u003cp\u003eTotal RNA was extracted from isolated microglia by using Trizol (Invitrogen, Carlsbad, CA, USA), and dissolved in 20 \u0026micro;L DEPC (Beyotime, China) to obtain total RNA. RNA was quantified by measuring OD at 260 and 280 nm using a NanoDrop 2000 spectrophotometer and stored at -80℃. The synthesis of cDNA was referred to instruction of the reverse transcription of cDNA synthesis kit (Transgen, China). In brief, 2 \u0026micro;g total RNA was incubated for 15 min at 42℃ and for 5 seconds at 85℃ to obtain cDNA, which could be diluted with DEPC water and stored at -20℃. qPCR System (Foster City, CA, USA) using TransStart Tip Green qPCR Supermix kit (TransGen, China). The PCR amplifcation conditions were as follows: 94\u0026deg;C for 30 s for pre-denaturation, 94\u0026deg;C for 5 s and 60\u0026deg;C for 30 s to denaturation for 40 cycles to extension. The primer is following:\u003c/p\u003e\n \u003cp\u003eMouse-iNOS, forward primer: 5\u0026rsquo;-CAAGCACCTTGGAAGAGGAG-3\u0026rsquo; and reverse primer: 5\u0026rsquo;-AAGGCCAAACACAGCATACC-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eMouse-CD16, forward primer: 5\u0026rsquo;-TTTGGACACCCAGATGTTTCAG-3\u0026rsquo; and reverse primer: 5\u0026rsquo;-GTCTTCCTTGAGCACCTGGATC-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eMouse-CD32, forward primer:5\u0026rsquo;-AATCCTGCCGTTCCTACTGATC-3\u0026rsquo; and reverse primer: 5\u0026rsquo;-GTGTCACCGTGTCTTCCTTGAG-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eMouse-IL-6, forward primer:5\u0026rsquo;-GGAGCCCACCAAGAACGATA-3\u0026rsquo; and reverse primer: 5\u0026rsquo;-TCACCAGCATCAGTCCCAAG-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eMouse-IL-1\u0026beta;, forward primer: 5\u0026rsquo;-GCCCATCCTCTGTGACTCAT-3\u0026rsquo; and reverse primer: 5\u0026rsquo;-AGCTCATATGGGTCCGACAG-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eMouse-TNF-\u0026alpha;, forward primer: 5\u0026rsquo;-AGAAGTTCCCAAATGGCCTC-3\u0026rsquo; and reverse primer: 5\u0026rsquo;-CCACTTGGTGGTTTGCTACG-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eMouse-Arg-1, forward primer: 5\u0026rsquo;-CTCCAAGCCAAAGTCCTTAGAG-3\u0026rsquo; and reverse primer: 5\u0026rsquo;-AGGAGCTGTCATTAGGGACATC-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eMouse-CCL-22, forward primer: 5\u0026rsquo;-CTGATGCAGGTCCCTATGGT-3\u0026rsquo; and reverse primer: 5\u0026rsquo;-GCAGGATTTTGAGGTCCAGA-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eMouse-TGF-\u0026beta;, forward primer: 5\u0026rsquo;-TGCGCTTGCAGAGATTAAAA-3\u0026rsquo; and reverse primer: 5\u0026rsquo;-CGTCAAAAGACAGCCACTCA-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eMouse-PKM2, forward primer: 5\u0026rsquo;-AGTACGCCCGAGGACTTC-3\u0026rsquo; and reverse primer: 5\u0026rsquo;-AAATGATGCCAGTGTTGCGG-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eMouse-G6P, forward primer: GCTGGAGTCTTGTCAGGCATT-3\u0026rsquo; and reverse primer: 5\u0026rsquo;-AATCCAAGCGCGAAACCAAA-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eMouse-PFKFB3, forward primer: CGGGAGAGGTCAGAGAACATGAA-3\u0026rsquo; and reverse primer: 5\u0026rsquo;-CTTCAACATGCCGACCTCCA-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eMouse-GLUT1, forward primer: AGCAGAGGCTTGCTTGTAGAG-3\u0026rsquo; and reverse primer: 5\u0026rsquo;-GCCCGTCACCTTCTTGCT-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eMouse-\u0026beta;-actin, forward primer: 5\u0026rsquo;-CATCCGTAAAGACCTCTATGCCAAC-3\u0026rsquo; and reverse primer: 5\u0026rsquo;-ATGGAGCCACCGATCCACA-3\u0026rsquo;.\u003c/p\u003e\n \u003cp\u003eFor result interpretation, Ct value data during the reaction were collected using the corrected threshold setting. \u0026beta;-actin was used as an endogenous control by real-time quantitative PCR, and all fold changes are expressed normalized to the control group. The 2-\u0026Delta;\u0026Delta;Ct method was used for relative quantification.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec11\"\u003e\n \u003ch2\u003e2.9. Measurement of Real-Time ECAR and OCR\u003c/h2\u003e\n \u003cp\u003eReal-time extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) were estimated using a Seahorse XF24 analyzer (Agilent, USA). 4\u0026times;10\u003csup\u003e4\u003c/sup\u003e cells were plated in XF24 cell culture microplates and cultured as instructed and stimulated by drug administration. The plates were hydrated and incubated overnight (37\u0026deg;C, no carbon dioxide) with XF calibration buffer; Assay medium (XF minimal medium containing 1 mM pyruvic acid, 4 mM glutamine and 25 mM glucose) was confected prior to assay. For ECAR measurement, after the cell plate and the probe plate were loaded with and stabilized by an XF analyzer, glucose, oligomycin, and 2-DG were successively injected into the cells, and then the change level of ECAR was monitored in real time. After the ECAR experiment, the key parameters of glycolysis flux were calculated, including basic glycolysis, maximum glycolysis capacity, and glycolysis reserve and non-glycolysis acidification. For OCR measurement, the mixture of Oligomycin, FCCP and Rotenone \u0026amp; antimycin A was sequentially injected to monitor the change level of OCR in real time [\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e], and each well sample on the cell culture plate was quantified, followed by normalization of the data. Basal respiration, ATP production, maximal respiration, spare capacity, and proton leak were calculated.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv class=\"Section2\" id=\"Sec12\"\u003e\n \u003ch2\u003e2.10. Microparticle-Uptake assay\u003c/h2\u003e\n \u003cp\u003eThe density of 5\u0026times;10\u003csup\u003e5\u003c/sup\u003e/mL was seeded in a 6 cm dish and cultured for 24 h until cells adhered. Negative control, medication control and each medication administration group were set, and the medication stimulated the cells for 24 h. 0.75 mg (1.0\u0026times;10\u003csup\u003e7\u003c/sup\u003e Zymosan A particles) of microsphere particles (Zymosan A (S. Cerevisiae) Bioparticles, Alexa Fluor\u0026trade; 488 conjugate) were coated by incubating with 1.5 mL DMEM containing 50% FBS for 15 min in shaking at 37\u0026deg;C (1000 rpm) and diluting 10-fold in preheated DMEM containing 10% FBS. 1 \u0026times;10\u003csup\u003e6\u003c/sup\u003e /mL of the prepared microspheres were added and co-incubated with cells at 37\u0026deg;C for 120 min (Negative control without particles). The cells were washed by PBS, blown off with complete medium, transferred to EP tube for centrifugation at 1000 rpm for 4 min and discarded the supernatant. The cells were re-suspended for a second time with PBS containing 2% FBS, blown evenly, passed through a 70 \u0026micro;m sieve, and centrifuged at 1000 rpm for 4 min. 50 \u0026micro;L cell suspension was discarded and retained in 1.5 mL EP tube. The phagocytic rate of the cells was then detected by ImageStream system flow cytometry (Merck, France). Results were analyzed by using IDEAS 6.2 software.\u003c/p\u003e\n \u003ch2\u003e\u003cem\u003e2.11. LDH Assay and TUNEL Assay\u003c/em\u003e\u003c/h2\u003e\n \u003cp\u003eTo quantify cytotoxicity in the different stimulations, lactate dehydrogenase (LDH) was determined using the LDH cytotoxicity assay kit (Zhongshengbeikong Biotechnology, China) following the manufacturer\u0026apos;s instructions. Microglia (4\u0026times;10\u003csup\u003e4\u003c/sup\u003e/ well) were inoculated on 96-well plates and treated as described herein. The medium containing the released lactate dehydrogenase was transferred into EP tubes and the LDH activity was detected using a biochemistry analyzer.\u003c/p\u003e\n \u003cp\u003eTo quantify apoptosis under experimental conditions, microglia (4\u0026times;10\u003csup\u003e4\u003c/sup\u003e/ well) were seeded on 96-well plates and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) (Beyotime, China) was performed according to the manufacturer\u0026apos;s instructions with DNaseI (100 U/mL) treated cells as the positive control. The images were observed through fluorescence microscope and analyzed using Image J software.\u003c/p\u003e\n \u003ch2\u003e\u003cem\u003e2.12. Microglia Isolation from Adult Mouse Brain\u003c/em\u003e\u003c/h2\u003e\n \u003cp\u003eFor the sorting experiment, the in vivo acute stimulation model was constructed by brain-targeted injection of C27 for 24 h, and the in vivo immune tolerance model was constructed by brain-targeted injection of PBS or C27 for four consecutive days, and microglia were isolated from the mouse brain. In short, the cells were incubated with pre-cooling Dulbecco\u0026apos;s PBS (dPBS; Sigma-Aldrich, USA) to transfer the brain (excluding the olfactory bulb and cerebellum) to a solution containing Enzyme mix (Miltenyi Biotec, Germany). The tissue was cut as pieces and enzymolysized using the gentleMACS Dissociator Homogenizer (Miltenyi Biotec, Germany) running program brain-01-03. The cell solutions were passed through a 70 \u0026micro;m cell filter (Falcon) to obtain a single cell suspension and debris was depleted using a fragment removal solution (Miltenyi Biotec, Germany). CD11b (microglia) microbeads (Miltenyi Biotec, Germany) and magnetically activated cell sorting (MACS; Miltenyi Biotec, Germany) system were used. The isolated microglia were lysed with pre-cooling Trizol and stored at -80\u0026deg;C.\u003c/p\u003e\n \u003ch2\u003e\u003cem\u003e2.13. RNA Sequencing of Microglia\u003c/em\u003e\u003c/h2\u003e\n \u003cp\u003eTotal RNA was extracted from the isolated microglia and subjected to RNA quality testing, and messenger RNA in the total RNA was purified by mRNA-specific polyA structure using Truseq Stranded mRNA Lt Sample Prepkit. The first strand cDNA was synthesized by the action of random primers and reverse transcriptase, and the second strand cDNA was synthesized using the first strand cDNA as a template. After purifying the double-stranded cDNA and performing terminal repair, adding an A at the 3 end, adding a sequencing linker under the action of the ligase, and performing fragment selection on the product with the linker added by a magnetic bead mode. The pooled libraries were uniformly diluted to 2 nM and denatured with base to form a single-stranded library. Sequencing was performed on the Novaseq 6000 PE150 platform. Filtering to obtain high-quality clean data, comparing the clean data with a designated reference genome, calculating the comparison efficiency of the sequencing data with the reference genome, and evaluating the saturation of the sequencing data and the gene coverage. Differential genes were screened in different sample groups, and visualized displays such as clustering analysis and volcanic diagram were conducted for the differential genes. GO/KEGG functional annotation and functional enrichment analysis were conducted for the differential genes to explore the functions and regulatory relationships for differential expression of the differential genes.\u003c/p\u003e\n \u003ch2\u003e\u003cem\u003e2.14. Immunohistochemistry and immunofluorescence\u003c/em\u003e\u003c/h2\u003e\n \u003cp\u003eFor immunofluorescence, the mice were anesthetized with cold PBS perfusion and the brains were incubated for 24 h in 4% PFA and then in 30% sucrose paraformaldehyde for fully dehydration. Serial coronal sections (30 \u0026micro;m thick) of the brain were prepared using a cryomicrotome (Leica, Germany). The sections were immersed sequentially in antigen fix for 15 min, in 1% Triton X-100 for 10 min and in 5% bovine serum albumin (BSA) for 30 min and then incubated overnight at 4℃ with the following primary antibodies: Iba-1 (1: 1000, Wako Pure Chemical Industries, Japan). For cell immunofluorescence, cells were inoculated at 1.5\u0026times;10\u003csup\u003e5\u003c/sup\u003e/mL. The cells were cultured at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e until they reached 70% growth, and then stimulated with C27 and positive control LPS\u0026thinsp;+\u0026thinsp;IFN-\u0026gamma;. After 24 h, immunofluorescence detection was performed. After the cells were washed, 4% paraformaldehyde was overlaid on the cells and fixed for 20 min. The sections were washed with PBS, and the membrane was broken using 0.3% Triton X-100 for 10 min. The surface of the sections was covered with 3% BSA and blocked at RT for 1 h. The primary antibodies were incubated overnight at 4\u0026deg;C. Next day, the corresponding species of Alexa 488 or 546-coupled IgG secondary antibody (Thermo fisher scientific, USA) was added and incubated in the dark at RT for 1 h. Then placed in PBS for washing for 5 min. Hoechst was added and covered with a cover glass, protected from light. After the slices were sealed, they were observed under a a confocal laser scanning microscope (Citation 10, Bioteck, USA) and the acquired images were analyzed by Image J software.\u003c/p\u003e\u003cspan\u003e\n \u003ch2\u003e\u003cem\u003e2.15. Behavioral Assessment\u003c/em\u003e\u003c/h2\u003e\n \u003c/span\u003e\u003cspan\u003e\n \u003ch3\u003e\u003cem\u003e2.15.1. Cylinder test\u003c/em\u003e\u003c/h3\u003e\n \u003c/span\u003e\n \u003cp\u003eThe mice were placed in a cylindric transparent plexiglass (D\u0026times;H: 15 cm\u0026times;20 cm) and moved freely. The whole process was recorded, with a mirror mounted behind the cylinder to capture the mice as they turned their back to the camera. Each upper limb contact with the cylinder wall in an upright position until the end (marked by the return of both upper limbs to the ground) is counted as a set of movements, and the first 20 groups were recorded. Their performance was evaluated by the number of impaired forelimb contacts are calculated as a percentage of total contacts.\u003c/p\u003e\n \u003ch3\u003e\u003cem\u003e2.15.2. Grid-walk test\u003c/em\u003e\u003c/h3\u003e\n \u003cp\u003eForelimb motor function was evaluated by the number of foot errors by grid-walk test. Mice were placed on a square grid with a 3 cm \u0026times; 3 cm mesh at a vertical height of 60 cm and were subjected to noise or stimulation to traverse the mesh surface for 1 min. It was counted as a misstep when the mice inaccurately placed the limb and fell from the grid. The number of misstep on the left forelimb and the total number of use of both forelimbs were calculated. The test was performed three times with an interval of 1 min. Injury analysis: number of misstep on left forelimb (injured side) / total number of use of both forelimbs.\u003c/p\u003e\n \u003ch3\u003e\u003cem\u003e2.15.3. Pole climbing test\u003c/em\u003e\u003c/h3\u003e\n \u003cp\u003eThe limb coordination ability and adhesion ability of the mice in the pole test were evaluated by rod climbing time. The device consists of a piece of wood with a long 50 cm diameter of 1 cm, wrapped around gauze to prevent animals from slipping, and the bottom is placed in a feeding cage and covered with padding to prevent mice from being injured. A wooden ball is attached to the top of the stick to help the mouse stay on top of the stick. Record the time that the mouse crawls from the top of the stick to the bottom. There were three consecutive measurements, and the interval between each measurement was at least 30 minutes to ensure the recovery of the physical strength of the mice. The average value of the three measurements was selected for data analysis.\u003c/p\u003e\n \u003ch3\u003e\u003cem\u003e2.16. Quantification and statistical analysis\u003c/em\u003e\u003c/h3\u003e\n \u003cp\u003eStatistical analyses were implemented using GraphPad prism 7.0 (GraphPad Software La Jolla, CA, USA). All values are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SEM. Statistical significance between multiple groups was calculated with one-way ANOVA, Dunnett\u0026apos;s multiple comparisons test; two-way ANOVA, Tukey\u0026apos;s multiple comparisons test, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Acute microglial inflammation induced by CKLF1 accompanied by metabolic reprogramming of glycolysis\u003c/h2\u003e \u003cp\u003ePrimary microglia (PMG) from fetal mouse brain were cultured to examine their response to CKLF1. After 14 days of culture, higher purity PMG is obtained (Fig. S1A). PMG were treated with varying concentrations of CKLF1 peptide (C27) for different time. The levels of inflammatory cytokine IL-6 were determined by western blot. It was found that the expression of inflammatory cytokine IL-6 was up-regulated after CKLF1 treatment and gradually increased at 12 h, and peaked at 20\u0026ndash;24 h (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Next, we incubated microglia with different concentrations of CKLF1 for 24 h, using lipopolysaccharide and interferon γ (LPS\u0026thinsp;+\u0026thinsp;IFN-γ) as positive controls, it was found that the mRNA level of IL-6 could be significantly up-regulated by CKLF1 exposure (Fig. S1B), and there is a concentration-dependent effect relationship from 500 nM to 2000 nM. The increase of IL-6 caused by CKLF1 showed no significantly different from that of the positive control.\u003c/p\u003e \u003cp\u003eElevated cytokines indicated that CKLF1 led to the activation of microglia. qPCR analysis showed that exposure of CKLF1 significantly increased the levels of fcgamma receptor type III (CD16), fcgamma receptor type II (CD32), and inducible nitric oxide synthase (iNOS), the marker genes of M1-type polarization. In the detection of M2 type marker genes, CKLF1 inhibited the expression of chemokine (CC motif) ligand-22 (CCL-22), but had no effect on transforming growth factor β (TGF-β) and arginase-1 (Arg-1) (Fig. S1D and S1E). The above results suggest that CKLF1 induces an acute inflammatory response in microglia, reflecting recognition of CKLF1 as a danger signal by microglia.\u003c/p\u003e \u003cp\u003ePhagocytosis is the first step of immune cells in driving defense. The normal phagocytosis of microglia plays an important role in maintaining the normal homeostasis of the brain, brain development, pathological process and regeneration of the brain [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e][\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Therefore, we used imaging flow cytometry to detect the phagocytic ability of microglia microspheres to assess the effect of CKLF1 on microglia physiological function. Our study showed that CKLF1 significantly enhanced phagocytosis (Fig. S1C). According to the analysis of single-cell imaging, it was found that CKLF1 not only increased the proportion of microglia with phagocytic function, but also significantly increase the proportion of cells phagocytosing 1, 2, 3, and 4 globules, which suggested that phagocytic ability of microglia was improved by CKLF1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Apoptosis was detected by TdT-mediated dUTP nick end labeling (TUNEL) staining (Fig. S1F), and necrosis was detected by lactate dehydrogenase (Fig. S1G). The results showed that the enhancement of CKLF1 on microglial activation and inflammatory response was not related to apoptosis or necrosis.\u003c/p\u003e \u003cp\u003eBased on the close relationship between microglia state and energy metabolism, we monitored the metabolic dynamics of microglia by detecting extracellular acidification rates (ECAR) in real time with Seahorse xFe24. The results showed that CKLF1 could significantly enhance the basal and maximal glycolytic capacity of microglia, manifested as a rapid increase in ECAR value after adding a saturated concentration of glucose or inhibiting ATP synthase activity by application of oligomycin. 2-Deoxy-D-glucose (2-DG) was the last drug added, which inhibited glycolysis by competitively binding to glycolytic pathway's hexokinase, causing a decrease in ECAR, thus confirming that the ECAR in the experiment was derived from glycolytic pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC and D) [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Elevated glycolysis is further evidenced by the enhancement of lactate production and pyruvate kinase activity (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE and F). Furthermore, it was also found that CKLF1 at a concentration of 1000nM significantly increased the levels of key molecules in the glycolytic pathway, including the levels of glucose-6-phosphate (G6P), glucose transporter type 1 (GLUT1), 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3 (PFKFB3) and pyruvate kinase M2 (PKM2) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG), The above results indicated that CKLF1 enhanced the glycolytic capacity of microglia (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH).\u003c/p\u003e \u003cp\u003eIn addition to glycolysis, we also found that CKLF1 significantly reduced basal oxidative phosphorylation levels and maximal oxidative phosphorylation capacity in microglia by detecting changes in the oxygen consumption rate (OCR) of microglia in real time (Fig. S2A and S2B), suggesting that CKLF1 disrupted microglia\u0026rsquo;s mitochondrial function. Further, we used MitoTracker Green to counted the form factor and aspect ratio of mitochondrial morphology in living cells (Fig. S2C and S2D). The results showed that exposure of CKLF1-induced mitochondrial fission, which may be related to the disruption of the electron transport chain related [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. These data further confirmed that microglia metabolism switched from OXPHOS to aerobic glycolysis during CKLF1-induced microglia activation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Inhibition of glycolytic pathway blocks CKLF1-induced microglia activation\u003c/h2\u003e \u003cp\u003eIn order to observe the role of glycolysis in CKLF1-induced microglial activation and acute inflammatory response, this study used 2-DG to block the glycolysis process, which could competitively bind to Hexokinase to inhibit the glycolytic pathway. As mentioned above, in the ECAR assay, 2-DG could offset the difference in ECAR elevation induced by different concentrations of CKLF1, suggesting that the functional status of microglia may also undergo corresponding changes. To test our speculation, this study observed the effects of glycolysis on microglial function both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). \u003cem\u003eIn vitro\u003c/em\u003e studies, qPCR analysis showed that the increased cytokine induced by CKLF1 could be blocked by 2-DG (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), and microparticle-uptake assay found that CKLF1-induced enhancement of phagocytosis was also significantly counteracted by 2-DG (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eFurthermore, we injected 2-DG into mice by intravenous injection, and then the stereotaxically injected CKLF1 into the cortex area. The results found that compared with the Vehicle group, the morphology of microglia in the injected C27 group showed a significantly activated state, showing a decrease in branches and an increase in the cell body. After 2-DG injection, there was no obvious activation of microglia (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD), which illustrated inhibition of glycolytic pathway could significantly abolishacute activation of microglia caused by CKLF1.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.3. CKLF1-Induced glycolysis and inflammation are dependent on the AMPK-mTOR-HIF-1α Pathway\u003c/h2\u003e \u003cp\u003eAs core of the cell's energy sensing mechanism, the mTOR pathway drives glucose metabolism pathway. In this cascade, AMP-activated protein kinase (AMPK) functions as a sensor for AMP and ADP, which indicate metabolic exhaustion, to inhibit mTOR phosphorylation. Hypoxia inducible factor 1α (HIF-1α), the glycolysis master transcription factor, is induced by phosphorylated mTOR [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. To investigate whether the mTOR pathway is involved in the metabolic reprogramming caused by CKLF1, we determined the AMPK-mTOR-HIF-1α pathways in PMG after CKLF1 treatment. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, CKLF1 exposure inhibited the phosphorylation of AMPK, which was followed by increased of phosphorylation of mTOR. Importantly, CKLF1 dramatically increased HIF-1α level comparable to LPS/IFNγ (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and B). These results show that when microglia are exposed to CKLF1, the AMPK-mTOR-HIF-1α pathway is activated to promote glycolysis. Triggering receptor expressed on myeloid cells-2 (TREM2), one of metabolic switch for microglia, was decreased when mTOR pathway was activated. Loss of TREM2 has been well documented that lead to metabolic deficits including a reduced mitochondrial respiratory capacity and an inability to perform a glycolytic immunometabolic switch (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). It was also confirmed that CKLF1 exposure improved the level of IL-6 in this study (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and B), suggested that the activation of mTOR pathway accompanied with inflammation response. Furthermore, blocking the mTOR pathway with rapamycin (an allosteric mTOR inhibitor) or metformin (an AMPK activator and mTOR inhibitor) reduced CKLF1-induced production of the pro-inflammatory cytokines IL-1β, IL-6 and TNF-αat mRNA and protein levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD). Our findings suggest that CKLF1-induced microglial inflammation is dependent on the AMPK-mTOR-HIF-1α pathway.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Repeated exposure to CKLF1 resulted in metabolic abnormalities in microglia and immune tolerance.\u003c/h2\u003e \u003cp\u003eGiven the prolonged expression of CKLF1 following stroke, we studied the chronic influence of CKLF1 on microglia metabolism. Within a day of exposure to danger signals, innate immune cells can be triggered and then persistently adopt either tolerance for the next 3 days, depending on the kind of stimulus. It may be simulated by cultivated cells being exposed to stimuli for 24 h and then being cultured in the absence of further stimulation for 3 days. As a result, we stimulated PMG for 24 h using C27 or vehicle. PBS washed away the drug, and after normal culture for 3 days, then stimulated with CKLF1 or vehicle for 24 h for the second time, producing three experimental groups: Veh, Acute, and Chronic (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA), the mRNA levels of IL-1β, IL-6 and TNF-α and protein levels of the pro-inflammatory cytokines IL-6 was lower after chronic treatment with CKLF1 than acute CKLF1 treatment and were even comparable to those in non-stimulated microglia (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB and C). Furthermore, chronic CKLF1 treatment dramatically decreased the phagocytic function of microglia as compared to that in acute group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD, Fig. S4B), indicating that CKLF1 ultimately induced innate immune tolerance in microglia.\u003c/p\u003e \u003cp\u003eTo determine if cellular metabolism plays a role in the immune tolerant caused by chronic CKLF1 exposure, we examined the AMPK-mTOR pathway, in addition to glycolytic and OXPHOS metabolism in microglia. In seahorse test, it was found that ECAR triggered by glucose was significantly improved, suggested that the basal glycolysis was enhanced in acute group, but it was down-regulated after tolerance. Moreover, oligomycin was used to inhibit the production of mitochondrial ATP to reveal the maximum glycolysis, it was also found that the maximum glycolysis ability of microglia in the chronic group was still significantly inhibited when compared to that in acute group. Application of 2-DG to inhibit the glycolysis showed that there is no significant difference among vehicle, acute and chronic group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE and F), suggested that the variation of ECAR in this study was rely on the glycolysis. qPCR analysis showed that the increased expression of glycolysis related genes by acute CKLF1 exposure was diminished in the chronic treated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG), which provided another evidence for their metabolic reprogramming.\u003c/p\u003e \u003cp\u003eThe AMPK-mTOR-HIF-1α pathway, which induces acute inflammation in microglia, was downregulated in CKLF1-tolerant microglia (Fig. S3), ultimately leading to a decrease in the production of lactate to levels (Fig. S4A). The above results indicated that there were defects in glycolysis metabolism of the tolerant cells. Mitochondrial dysfunction as was the case in acutely activated microglia was still observed in CKLF1-tolerant microglia (Fig. S4C and S4D). Additionally, sustained exposure to enhanced necrotic microglia but not apoptotic microglia (Fig. S4E and S4F). These observations imply that broad defects in cellular metabolism including glycolysis and OXPHOS are present in CKLF1-tolerant microglia and lead to functional impairment of microglia.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Microglia isolated from adult mouse brain genome-wide RNA Sequencing identifies CKLF1-Induced acute inflammation and tolerance\u003c/h2\u003e \u003cp\u003eTo evaluate whether chronic exposure of CKLF1 led to the immune tolerance of microglia \u003cem\u003ein vivo\u003c/em\u003e, C27 was delivered into M1 cortex directly through stereotaxic injection for four consecutive days. As shown in fig.s\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e. the first injection of C27 led to a pronounce increase of IL-1β, TNF-α and IL-10 (Fig. S5). Upon the second injection, the level of IL-10 was diminished compared to the vehicle injection, while IL-1β and TNF-α release occurred at similar levels. The increase of IL-1β and TNF-α maintains to the third injection, and after the fourth injection of C27, the increased release of IL-1β and TNF-α was lost as compared to that with PBS group, indicated the brain was in immune tolerance status.\u003c/p\u003e \u003cp\u003eMoreover, we performed genome-wide RNA sequencing (RNA-seq) on freshly isolated microglia from mice 24 h after stereotactic injection injection of PBS or CKLF1, or with acute inflammation and tolerance induced in 4 consecutive days. Compared to PBS-treated animals, there were 356 up-regulated genes and 236 down-regulated genes in acute CKLF1-treated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). In the up-regulated genes, significantly (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05) enriched biological processes (BP) were identified as heat map. The term \"inflammation response\" includes genes involved in immune response or response to cytokine, are the most significantly enriched BP produced by acute CKLF1 injection. These findings suggest that acute exposure to CKLF1 in vivo leads to microglia inflammation and enhanced immune response.\u003c/p\u003e \u003cp\u003eSubsequently, we analyzed changes in microglia gene expression between mice that were treated by chronic and acute CKLF1 injection. Compared with the acute stimulation group, we found 263 significantly up-regulated genes and 347 significantly down-regulated genes in the differential genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). In the downregulated genes, inflammation response, immune response and regulation of IL-6 production are the most enriched BP induced by chronic CKLF1. In addition, the differential genes of the tolerance group and the Vehicle group included 128 up-regulated genes and 248 down-regulated genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). Compared with the acute stimulation group, the overlap was reduced in the Vehicle group. Compare the differences between the first 20 acute stimuli and the Vehicle groups and the common differences between the Chronic and Acute groups BP. \"Inflammatory Response\", \"Innate Immune Response\", \"Cytokine Response\", \"Neutrophic Chemotaxis\" and \u0026ldquo;Immune system function regulation\u0026rdquo; were found to have significantly reduced correlations (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD).We also observed different alterations in microglia genes in acute and tolerant animals (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). Together, they enrich the BP genome-wide transcriptional spectrum (\"inflammatory response\", \"innate immune response\", \"response to cytokines\", \"phagocytosis\", and \"metabolic process\" systemic processes) and associated selected genes (IL-6, TNF-α, GLUT1, PFKFB3, TREM2 CKLF1; Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF) shows that microglia in the brain of the tolerant mice are almost not activated and are less reactive compared to microglia from CKLF1 stimulated acute inflammation mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.6. The immune-tolerated microglia trained by CKLF1 loss its phagocytosis to neutrophil\u003c/h2\u003e \u003cp\u003eTo examine how microglia respond to CKLF1 \u003cem\u003ein vivo\u003c/em\u003e, we injected PBS or C27 into the cerebral cortex. For acute stimulation, the drug was given only once, and for chronic stimulation, it was administered for 4 consecutive days (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). Microglia underwent marked morphological changes upon acute stimulation of C27 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB), and resting microglia were highly branched and uniformly distributed throughout the brain parenchyma. When brain homeostasis is disrupted, such as when the central nervous system is injured or infected, the injured tissue and surrounding astrocytes release ATP to the outside of the cell, and the ATP receptors on the microglia sense ATP and then process the process toward the injury. The center extends while the remaining protrusions retract [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The structure of microglia was revealed by Iba-1 staining, which was further analyzed by skeleton analyzed in Image J (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC and D). The results demonstrated that acute CKLF1 caused substantial changes in microglia morphology, including the reduced process length and endpoints, indicating that microglia were activated. Chronic CKLF1 treatment also resulted in larger cell bodies in microglia, as manifested by the decreased endnotes and process length, which showed no obviously difference between acute and chronic stimulation of CKLF1.\u003c/p\u003e \u003cp\u003eCKLF1 has been shown to have the biological function of inducing chemotactic movement of neutrophils. We also previously showed that CKLF1 can aggravate neutrophil infiltration after stroke, and the infiltrated neutrophils can be phagocytosed and cleared by microglia. In this study, we used green fluorescence to label microglia and red fluorescence to represent Ly6G, which is a marker protein of neutrophils. The results show that acute CKLF1 administration significantly increased the co-localization between neutrophil and microglia, indicating that microglia phagocytose neutrophils. The number of neutrophils in the chronic CKLF1 group was significantly higher than that in the acute CKLF1 group, and the yellow fluorescence was significantly reduced, indicating that the function of microglia to phagocytose neutrophils was reduced (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). The above results demonstrate from the cellular function level that long-term administration of CKLF1 induced microglia into a state of immune tolerance. Furthermore, the levels of Lamp1, which is a biomarker of lysosomes, was also decreased in the chronic group as compared to acute administration of CKLF1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF), suggested that the degradation capacity of microglia is also diminished except for the phagocytic dysfunction.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.7. Loss of CKLF1 restored the microglia phagocytosis and improved the long-term outcomes of stroke\u003c/h2\u003e \u003cp\u003eTo confirm the biological role of CKLF1-trained immunological tolerance in microglial following stroke, we employed gene knockdown and antibody neutralization, to inhibit CKLF1's biological activity in photothrombotic stroke mice. In CKLF1-knockout mice, we observed a dramatic improvement in motor dysfunction, as seen by considerably reduced mistake rates in the cylinder test in CKLF1-KO animals compared to wild type (WT) mice from DPI 7 to 14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB). The grid walk test showed a dramatically reduces the amounts of mistakes in CKLF1-KO mice than wild type mice from DPI 3 to 14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eC). Furthermore, the improvement of motor function by loss of CKLF1 was also found in pole test, manifested by decreased pole climbing time from DPI 7 to 14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eD). All of results indicated that loss of CKLF1 improved the outcome of photothrombotic stroke. In addition, Loss of CKLF1 greatly increased the phagocytosis of infiltrating neutrophils by microglia, as evidenced by an increase in the co-localization of microglia and neutrophils in the ischemia marginal zone (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eE), suggested that immune tolerance after stroke could be prevent by the loss of CKLF1.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003e3.8. Short term neutralize to CKLF1 produced long term improvement on the behavioral performance in photothrombotic stroke\u003c/em\u003e \u003c/p\u003e \u003cp\u003eTo exclude the likelihood that CKLF1 deficiency may result in aberrant brain function, we blocked CKLF1 activity by injecting CKLF1-neutralizing antibody into the lateral ventricle of the brain. The expression of CKLF1 in ischemic stroke began 8 hours after stroke and peaked 2 to 3 days after stroke, accordingly, the treatment window for CKLF1-neutralizing antibody was defined at four days following stroke, covered the peak period of CKLF1 production and neutrophil infiltration. Compared to the IgG control group, mice in the CKLF1 neutralizing antibody group exhibited considerably better behavior, and the phagocytic activity of microglia was significantly higher than in the IgG control group. In the cylinder test, neutralized to CKLF1 improved the percent of impaired forelimb use significantly as compared to IgG group at DPI 3 and 7 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). Grid test showed that there is a remarkable reduction of foot fault in the CKLF1 antibody treated animals at DPI 3 and 14 (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). Pole test revealed that blockade of CKLF1 activity reduced the pole climbing time significantly (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD). More importantly, this improvement persisted for two weeks, indicating that short-term blockade of CKLF1 might produce a long-lasting effect after stroke. In addition, Neutralization of CKLF1 greatly increased the phagocytosis of infiltrating neutrophils by microglia, as evidenced by an increase in the co-localization of microglia and neutrophils in the ischemia marginal zone (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE), which provides a piece of evidence for the principal role of CKLF1 in the immune tolerance of microglia following stroke.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eMicroglia are the first line of defense for immune defense in the central nervous system. Early morphological studies have shown that microglia are in a balance between resting and activated states, and their phenotypic manifestations are highly plastic. Microglia maintain a high degree of basal activity involved in the interaction of neurons and glial cells [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. Microglia also cause programmed cell death of immature or defective neurons and clear cell debris by phagocytosis. Therefore, resting microglia are mainly involved in neuronal development and the maintenance of normal function, playing a vital role in the central nervous system. When brain damage occurs, microglia will be activated to continuously detect the essence of the central nervous system through branched synapses, to detect changes in the central nervous system triggered by pathology-related substances. Our results reveal that the stroke target CKLF1 causes significant morphological alterations in microglia after stimulation. In this process of microglia detection, microglia undergo multi-stage activation under the stimulation of different pathogens and show corresponding different phenotypes, thus microglia playing a neuroprotective role in this process. Focal stimulation triggers microglia activation, when microglia pool at the injury site to produce an early response. Stroke induces microglia activation, which is the first step of the post-stroke inflammatory response. In the early stage of injury, activated microglia present with an amoebic phenotype, accompanied by changes in the expression of the corresponding receptors and the release of a large number of pro-inflammatory factors [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e][\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Amebic microglia have rapid motility and proliferation, and they are more susceptible to aggregation at and around the lesion. This was followed by infiltration of various immune cells including macrophages/monocytes, neutrophils, natural killer cells [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. The end of microglia activation is represented when they show an irreversible phagocytic phenotype, i.e., different numbers of phagocytes are formed in their cytoplasm. Different microglia phenotypes and functions reveal microglia plasticity, therefore, it is crucial to observe the phenotypic changes of microglia after injury, but the identification of different phenotypes of microglia are challenging due to constantly dynamic microglia changes and susceptibility to stimulation. Our results confirm that CKLF1, a potential target of stroke, can cause phenotypic polarization of microglia inflammation and that acute induction of microglia inflammation is accompanied by metabolic reprogramming.\u003c/p\u003e \u003cp\u003eMicroglia response and function largely changed when exposed to a second inflammatory stimulus in adulthood [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e][\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Although microglia activation and inflammatory response are necessary for microglia to exert neuroprotective function, microglia continuous activation and its mediated neuroinflammation are the core pathological manifestations of neurodegenerative diseases. At present, this result is mainly explained from two aspects. On the one hand, microglia development is damaged, thus affecting brain development and function. On the other hand, these results also suggest that microglia may have long-term memories of previous inflammatory events. Mechanisms of both the innate and adaptive immune systems influence the brain injury cascade following ischemic stroke. Neutrophils and microglia, as well as other immune cells, each play complex interdependent roles that work synergistically to remove dead tissue but may also cause bystander damage to intact brain cells and create tolerance adaptations adverse chronic inflammation. Chronic systemic inflammation may adversely affect post-stroke outcomes and the risk of recurrence of further strokes [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. In our experiments, after continuous stimulation of CKLF1 on the microglia of the innate immune system, the microglia were induced to develop immune tolerance, and changes in the physiological state of the tolerant microglia were observed. Changes in cytoplasmic metabolic function, tolerance to reduced ability of microglia to phagocytose neutrophils, and the process also needs reprogramming balance between glycolysis and OXPHOS. These results provide new insights for the future treatment of ischemic stroke in an inflammatory state, as well as for the study of the effects of glycolysis and oxidative phosphorylation on the immune function of microglia. Therefore, it is important to understand the effects on neurological diseases after the induction of immune tolerance by microglia in the central nervous system.\u003c/p\u003e \u003cp\u003eOver the past few years, an increasing number of studies have shown that the interaction between metabolism and immune function has an important effect on cell function [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The central nervous system tightly regulates the main energy substrates (sugars, fats, and amino acids), so the brain microenvironment has unique metabolic characteristics. The field of immunometabolism is concerned with how reprogramming of intracellular metabolic pathways alter the immune response [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Metabolic reprogramming refers to the reuse of enzymes and metabolites to control various physiological and biochemical functions of cells through cell signal transduction pathways. At present, extensive research on the peripheral immune system has confirmed that metabolic reprogramming is an important role in inflammation and the polarization of immune cells [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Relevant research results show that the transformation of cell metabolic state to aerobic glycolysis state will be beneficial for the immune cells to play a pro-inflammatory role [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Although glycolysis is not as thorough as mitochondrial oxidative phosphorylation in the production of ATP, aerobic glycolysis can meet the multifunctional transformation of immune cells under the condition of adequate energy, so that they can play a role in proliferation, migration, cytokine expression and phagocytosis [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Our results showed that microglia could be directly activated by transforming their metabolism from oxidative phosphorylation to aerobic glycolysis after CKLF1 stimulation [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Microglia metabolism reprogramming is essential for microglia function in stroke. We demonstrated that the metabolic function of microglia is the key regulatory system to control immune function, and metabolic reprogramming mediates CKLF1-induced microglia polarization and directly affects cell physiological activities. Since changes in neurometabolism and microglia activity are the basis of a variety of neurological diseases or neurodevelopmental disorders, it is undoubtedly important to understand the effects of microglia metabolism reprogramming on neurons in both healthy and pathological states.\u003c/p\u003e \u003cp\u003emTOR not only regulate intracellular metabolism, but also works on immune cell activation. Studies have shown that multi-protein complexes of mTOR facilitate metabolic reprogramming, promoting glycolysis, glutamine decomposition, and protein and lipid synthesis, as well as GLUT1 surface expression and aerobic glycolysis. Cell growth, proliferation, and aerobic glycolysis are regulated by regulating downstream effectors in response to growth factor, nutrient, and receptor signals [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. While AMPK promotes cellular catabolism by promoting mitochondrial adaptation and inhibiting anabolic processes [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e], in addition, AMPK drives mitochondrial biogenesis and division, in addition to the removal of damaged mitochondria through mitochondrial phagocytosis/autophagy. In contrast, AMPK is crucial for lipid and cholesterol synthesis, respectively, and inhibits mTOR complex activity, because it inhibits acetyl-CoA carboxylase and HMG-CoA reductase [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Therefore, AMPK negatively regulates the mTOR complex to inhibit inflammation, accompanied by inhibition of protein and lipid synthesis required to produce an appropriate inflammatory response. This inhibition of anabolism and mTOR allows AMPK to inhibit metabolic rewiring and limit the activation of immune cells. We evaluated the status of the AMPK-mTOR-HIF-1α pathway in CKLF1-treated PMG to determine whether the mTOR pathway was involved in CKLF1-induced metabolic reprogramming. Overall, our results suggest that CKLF1-induced microglia inflammation is dependent on the mTOR pathway.\u003c/p\u003e \u003cp\u003eMicroglia are the earliest and longest activated immune cells after stroke. Under physiological conditions, microglia can monitor the energy metabolism and information transmission of neurons by forming connections with the neuron cell body and synapse, respectively [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. When the ischemic necrosis area was gradually enlarged, the nucleosides released by the necrotic neurons could activate the purinergic receptors on the microglia, promote the microglia at the margin to change from M2-type polarization to M1-type polarization, and aggravate the inflammatory reaction [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. With the increase of intracerebral CKLF1 content, the levels of microglia M1 polarization state markers iNOS and CD32 genes increased significantly in a dose-dependent manner, indicating that CKLF1 aggravated microglia M1 polarization after stroke [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. In our experiment, after localization injection of neutralizing antibody against CKLF1 through the brain, in the mouse model of stroke established by light bolt method, the activation proportion of microglia in the brain of the mouse that inhibited the activity of CKLF1 was significantly increased, indicating that the deletion of CKLF1 could increase the activation of microglia and driving phagocytosis. In addition, the proportion of microglia in the CKLF1 gene knockout mice that swallowed the infiltrated neutrophils after stroke was significantly higher than that in the wild-type stroke mice. This indicates that the absence of CKLF1 can enhance the phagocytosis of neutrophils by microglia after stroke. The above studies have fully illustrated that CKLF1 is closely related to the functional state of microglia.\u003c/p\u003e \u003cp\u003eOur previous work found that CKLF1 might aggravate the polarization of damaged microglia in the early stage of cerebral ischemia/reperfusion injury by regulating apoptosis. Inhibition of CKLF1 can protect the blood-brain barrier and reduce damage [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], and inhibit neutrophil infiltration [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. As a target showing time-specific and encephalic region-specific expression after stroke, CKLF1 is not related to other neuropathological changes. Whether interfering or knocking out from the gene level or blocking the activity at the pharmacological level, they can exert the pharmacological effect against stroke, fully proving that CKLF1 is the advantage of potential therapeutic target for stroke.\u003c/p\u003e \u003cp\u003eThe current work demonstrates that CKLF1 directly activates microglia by reprogramming their metabolism to aerobic glycolysis. Microglia that have been activated release pro-inflammatory cytokines and showed a phagocytic capability. This activation requires targets for glycolysis and the AMPK-mTOR-HIF-1α pathway. However, microglia stimulated in vitro entered an innate immune tolerant state within 4 days, demonstrating abnormalities in both glycolysis and OXPHOS metabolism, as well as decreased inflammatory responses. Finally, we discovered that loss of CKLF1 or blockade of its activity restored the phagocytic activity of tolerant microglia from stroke animals, the motor function was reversed. With the deepening of research on microglia immune metabolism, neuroinflammation and related nervous system diseases, people are increasingly aware of the role of the immune response in the central nervous system diseases. Immune cells in the brain have unique and complex problems, so understanding the regulation of microglia metabolism will help to better develop targeted immune metabolism therapy.\u003c/p\u003e"},{"header":"5. Conclusions","content":"\u003cp\u003eIn summary, our findings suggested that metabolic reprogramming is the basis of CKLF1-induced microglia inflammation, and inhibition of mTOR pathway and glycolysis significantly reduces CKLF1-induced microglia inflammatory response. In addition, CKLF1-tolerant microglia show metabolic dysfunction and phagocytic dysfunction. Knocking out or blocking the activity of CKLF1 restores the microglia activation and increases the phagocytosis of neutrophils after photothrombotic stroke. Our results revealed a close correlation between cellular metabolic pathways and microglia function and phenotype. Finally, further studies are needed to better understand the metabolic dysfunction of microglia during stroke. Regulation of microglia bioenergy pathways may become a promising therapeutic strategy for stroke.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cdiv class=\"Section2\" id=\"Sec3\"\u003e\n \u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eAll experiments were performed in accordance with the China Public Health Service Guide for the Care and Use of Laboratory Animals. Experiments involving mice and protocols were were performed according to protocols approved by the Animal Care and Use Committee of the Peking Union Medical College and the Chinese Academy of Medical Sciences.\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eNot applicable.\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eThe datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.\u0026nbsp;\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eThe authors have no conflicts of interest to declare.\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eThis work was supported by the\u0026nbsp;National Key R\u0026amp;D Program of China\u0026nbsp;(2022YFC3500301),\u0026nbsp;National Natural Science Foundation of China (U2202214,\u0026nbsp;82074044, U21A20410, 82130109, 81730096, 81973499), the CAMS Innovation Fund for Medical Sciences (CIFMS) (2021-I2M-1-020),\u0026nbsp;Key R\u0026amp;D Program of Shanxi Province (201803D421006, 201903D421018), High-End Foreign Experts introduction program（G20200001485）\u003cstrong\u003e\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003e\u003cstrong\u003eAuthors\u0026apos; contributions\u003c/strong\u003e\u003c/p\u003e\n \u003cp\u003eConception or design of the study: Naihong Chen, Shifeng Chu, Zhao Zhang, and Wenyu Ma; data collection: Wenyu Ma, Qinglin Wu, Shasha Wang, Hongyun Wang, and Junrui Ye; data analysis and interpretation: Hongsuo Sun, Zhongping Feng, and Wenbin He, drafting the article: Naihong Chen, Shifeng Chu, Zhao Zhang, and Wenyu Ma; critical revision of the article: Naihong Chen, Shifeng Chu, Zhao Zhang, Wenyu Ma, Hongsuo Sun, Zhongping Feng, and Wenbin He; All authors approved the final version of the manuscript.\u003c/p\u003e\n\u003c/div\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eElAli A, Rivest S. Microglia in Alzheimer\u0026rsquo;s disease: A multifaceted relationship. Brain, Behavior, and Immunity. 2016;55:138\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRansohoff RM, Cardona AE. The myeloid cells of the central nervous system parenchyma. Nature. 2010;468:253\u0026ndash;62.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHelmut K, Hanisch UK, Noda M, Verkhratsky A. Physiology of microglia. Physiological Reviews. 2011;91:461\u0026ndash;553.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLener MS. Microglia, Lifestyle Stress, and Neurodegeneration. Physiology \u0026amp; behavior. 2016;176:139\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanisch UK, Kettenmann H. Microglia: Active sensor and versatile effector cells in the normal and pathologic brain. Nature Neuroscience. 2007;10:1387\u0026ndash;94.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHanisch UK. Functional diversity of microglia - How heterogeneous are they to begin with? Frontiers in Cellular Neuroscience. 2013;7:1\u0026ndash;18.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMartinez FO, Gordon S. The M1 and M2 paradigm of macrophage activation: Time for reassessment. F1000Prime Reports. 2014;6:1\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCherry JD, Olschowka JA, O\u0026rsquo;Banion MK. Neuroinflammation and M2 microglia: The good, the bad, and the inflamed. Journal of Neuroinflammation. 2014;11:1\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRansohoff RM. A polarizing question: Do M1 and M2 microglia exist. Nature Neuroscience. 2016;19:987\u0026ndash;91.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBiswas SK, Lopez-Collazo E. Endotoxin tolerance: new mechanisms, molecules and clinical significance. Trends in immunology. England; 2009;30:475\u0026ndash;87.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaeed S, Quintin J, Kerstens HHD, Rao NA, Aghajanirefah A, Matarese F, et al. Epigenetic programming of monocyte-to-macrophage differentiation and trained innate immunity. Science (New York, NY). 2014;345:1251086.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eButovsky O, Howard L. Weiner. Microglial signatures and their role in health and disease. Nat Rev Neurosci. 2018;176:139\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang C, Curtis JD, Jr LBM, Faubert B, Villarino A V, Sullivan DO, et al. Posttranscriptional Control of T Cell Effector Function by Aerobic Glycolysis. Cell. 2013;153:1239\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLampropoulou V, Sergushichev A, Bambouskova M, Nair S, Vincent EE, Loginicheva E, et al. Itaconate Links Inhibition of Succinate Dehydrogenase with Macrophage Metabolic Remodeling and Regulation of Inflammation. Cell metabolism. 2016;24:158\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNetea MG, Joosten LAB, Latz E, Mills KHG, Natoli G, Stunnenberg HG, et al. Trained immunity: A program of innate immune memory in health and disease. Science (New York, NY). 2016;352:aaf1098.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTannahill GM, Curtis AM, Adamik J, Palsson-McDermott EM, McGettrick AF, Goel G, et al. Succinate is an inflammatory signal that induces IL-1β through HIF-1α. Nature. 2013;496:238\u0026ndash;42.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFodelianaki G, Lansing F, Bhattarai P, Troullinaki M, Zeballos MA, Charalampopoulos I, et al. Nerve Growth Factor modulates LPS - induced microglial glycolysis and inflammatory responses. Experimental cell research. United States; 2019;377:10\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMills EL, Kelly B, Logan A, Costa ASH, Varma M, Bryant CE, et al. Succinate Dehydrogenase Supports Metabolic Repurposing of Mitochondria to Drive Inflammatory Macrophages. Cell. 2016;167:457\u0026ndash;470.e13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGaraschuk O, Verkhratsky A. Physiology of Microglia. Methods in molecular biology (Clifton, NJ). United States; 2019;2034:27\u0026ndash;40.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan W, Lou Y, Tang J, Zhang Y, Chen Y, Li Y, et al. Molecular cloning and characterization of chemokine-like factor 1 (CKLF1), a novel human cytokine with unique structure and potential chemotactic activity. The Biochemical journal. 2001;135:127\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu DD, Song XY, Yang PF, Ai Q Di, Wang YY, Feng XY, et al. Progress in pharmacological research of chemokine like factor 1 (CKLF1). Cytokine. 2018;102:41\u0026ndash;50.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai X, Deng J, Ming Q, Cai H, Chen Z. Chemokine-like factor 1: A promising therapeutic target in human diseases. Experimental Biology and Medicine. 2020;245:1518\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan W, Lou Y, Tang J, Zhang Y, Chen Y, Li Y, et al. Molecular Cloning and Characterization of Chemokine-Like Factor 1 (Cklf1), a Novel Human Cytokine with Unique Structure and Potential Chemotactic Activity. The Biochemical journal. 2001;135:127\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen C, Chu SF, Ai Q Di, Zhang Z, Guan FF, Wang SS, et al. CKLF1 Aggravates Focal Cerebral Ischemia Injury at Early Stage Partly by Modulating Microglia/Macrophage Toward M1 Polarization Through CCR4. Cellular and Molecular Neurobiology. 2019;39:651\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou X, Zhang Y-N, Li F-F, Zhang Z, Cui L-Y, He H-Y, et al. Neuronal chemokine-like-factor 1 (CKLF1) up-regulation promotes M1 polarization of microglia in rat brain after stroke. Acta Pharmacol Sin [Internet]. 2022; Available from: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://dx.doi.org/10.1038/s41401-021-00746-w\u003c/span\u003e\u003cspan address=\"10.1038/s41401-021-00746-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChaudhry A, Shi R, Luciani DS. A pipeline for multidimensional confocal analysis of mitochondrial morphology, function, and dynamics in pancreatic β-cells. American journal of physiology Endocrinology and metabolism. 2020;318:E87\u0026ndash;101.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHu Y, Mai W, Chen L, Cao K, Zhang B, Zhang Z, et al. mTOR-mediated metabolic reprogramming shapes distinct microglia functions in response to lipopolysaccharide and ATP. Glia. United States; 2020;68:1031\u0026ndash;45.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNapoli I, Neumann H. Microglial clearance function in health and disease. Neuroscience. United States; 2009;158:1030\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNeumann H, Kotter MR, Franklin RJM. Debris clearance by microglia: an essential link between degeneration and regeneration. Brain: a journal of neurology. 2009;132:288\u0026ndash;95.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu P-S, Ho P-C. Determining Macrophage Polarization upon Metabolic Perturbation. Methods in molecular biology (Clifton, NJ). United States; 2019;1862:173\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eValente AJ, Maddalena LA, Robb EL, Moradi F, Stuart JA. A simple ImageJ macro tool for analyzing mitochondrial network morphology in mammalian cell culture. Acta histochemica. Germany; 2017;119:315\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheng S-C, Quintin J, Cramer RA, Shepardson KM, Saeed S, Kumar V, et al. mTOR- and HIF-1α-mediated aerobic glycolysis as metabolic basis for trained immunity. Science (New York, NY). 2014;345:1250684.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOtxoa-de-Amezaga A, Mir\u0026oacute;-Mur F, Pedragosa J, Gallizioli M, Justicia C, Gaja-Capdevila N, et al. Microglial cell loss after ischemic stroke favors brain neutrophil accumulation. Acta neuropathologica. 2019;137:321\u0026ndash;41.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBakina O, Kettenmann H, Nolte C. Microglia form satellites with different neuronal subtypes in the adult murine central nervous system. Journal of neuroscience research. United States; 2022;100:1105\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGibson CL, Coughlan TC, Murphy SP. Glial nitric oxide and ischemia. Glia. United States; 2005;50:417\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen A-Q, Fang Z, Chen X-L, Yang S, Zhou Y-F, Mao L, et al. Microglia-derived TNF-α mediates endothelial necroptosis aggravating blood brain-barrier disruption after ischemic stroke. Cell death \u0026amp; disease. 2019;10:487.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin R, Yang G, Li G. Inflammatory mechanisms in ischemic stroke: role of inflammatory cells. Journal of leukocyte biology. 2010;87:779\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBilbo SD. Early-life infection is a vulnerability factor for aging-related glial alterations and cognitive decline. Neurobiology of learning and memory. 2010;94:57\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMattei D, Ivanov A, Ferrai C, Jordan P, Guneykaya D, Buonfiglioli A, et al. Maternal immune activation results in complex microglial transcriptome signature in the adult offspring that is reversed by minocycline treatment. Translational psychiatry. 2017;7:e1120.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEndres M, Moro MA, Nolte CH, Dames C, Buckwalter MS, Meisel A. Immune Pathways in Etiology, Acute Phase, and Chronic Sequelae of Ischemic Stroke. Circulation research. United States; 2022;130:1167\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaik SH, Kang S, Lee W, Choi H, Chung S, Kim J-I, et al. A Breakdown in Metabolic Reprogramming Causes Microglia Dysfunction in Alzheimer\u0026rsquo;s Disease. Cell metabolism. United States; 2019;30:493\u0026ndash;507.e6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eO\u0026rsquo;Neill LAJ, Kishton RJ, Rathmell J. A guide to immunometabolism for immunologists. Nature reviews Immunology. 2016;16:553\u0026ndash;65.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePalsson-McDermott EM, Curtis AM, Goel G, Lauterbach MAR, Sheedy FJ, Gleeson LE, et al. Pyruvate kinase M2 regulates Hif-1α activity and IL-1β induction and is a critical determinant of the warburg effect in LPS-activated macrophages. Cell metabolism. 2015;21:65\u0026ndash;80.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang C-H, Curtis JD, Maggi LBJ, Faubert B, Villarino A V, O\u0026rsquo;Sullivan D, et al. Posttranscriptional control of T cell effector function by aerobic glycolysis. Cell. 2013;153:1239\u0026ndash;51.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePanatier A, Robitaille R. The soothing touch: microglial contact influences neuronal excitability. Developmental cell. United States; 2012;23:1125\u0026ndash;6.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang T, Li S, Xu H, Walsh DM, Selkoe DJ. Large Soluble Oligomers of Amyloid β-Protein from Alzheimer Brain Are Far Less Neuroactive Than the Smaller Oligomers to Which They Dissociate. The Journal of neuroscience: the official journal of the Society for Neuroscience. 2017;37:152\u0026ndash;63.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang H, Long L, Zhou P, Chapman NM, Chi H. mTOR signaling at the crossroads of environmental signals and T-cell fate decisions. Immunological reviews. 2020;295:15\u0026ndash;38.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHerzig S, Shaw RJ. AMPK: guardian of metabolism and mitochondrial homeostasis. Nature reviews Molecular cell biology. 2018;19:121\u0026ndash;35.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGwinn DM, Shackelford DB, Egan DF, Mihaylova MM, Mery A, Vasquez DS, et al. AMPK phosphorylation of raptor mediates a metabolic checkpoint. Molecular cell. 2008;30:214\u0026ndash;26.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCser\u0026eacute;p C, P\u0026oacute;sfai B, L\u0026eacute;n\u0026aacute;rt N, Fekete R, L\u0026aacute;szl\u0026oacute; ZI, Lele Z, et al. Microglia monitor and protect neuronal function through specialized somatic purinergic junctions. Science (New York, NY). United States; 2020;367:528\u0026ndash;37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLourbopoulos A, Ert\u0026uuml;rk A, Hellal F. Microglia in action: how aging and injury can change the brain\u0026rsquo;s guardians. Frontiers in cellular neuroscience. 2015;9:54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen C, Chu S-F, Ai Q-D, Zhang Z, Guan F-F, Wang S-S, et al. CKLF1 Aggravates Focal Cerebral Ischemia Injury at Early Stage Partly by Modulating Microglia/Macrophage Toward M1 Polarization Through CCR4. Cellular and molecular neurobiology. United States; 2019;39:651\u0026ndash;69.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKong L-L, Wang Z-Y, Hu J-F, Yuan Y-H, Li H, Chen N-H. Inhibition of chemokine-like factor 1 improves blood-brain barrier dysfunction in rats following focal cerebral ischemia. Neuroscience letters. Ireland; 2016;627:192\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKong LL, Wang ZY, Han N, Zhuang XM, Wang ZZ, Li H, et al. Neutralization of chemokine-like factor 1, a novel C-C chemokine, protects against focal cerebral ischemia by inhibiting neutrophil infiltration via MAPK pathways in rats. Journal of neuroinflammation. 2014;11:112.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-neuroinflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jneu","sideBox":"Learn more about [Journal of Neuroinflammation](http://jneuroinflammation.biomedcentral.com)","snPcode":"12974","submissionUrl":"https://submission.nature.com/new-submission/12974/3","title":"Journal of Neuroinflammation","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"CKLF1, microglia, metabolic reprogramming, immune tolerance, ischemic stroke, phagocytosis","lastPublishedDoi":"10.21203/rs.3.rs-2344526/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-2344526/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIschemic stroke has a prominent pathogenic hallmark called reactive microglia, which is a predictor of prognosis. The precise involvement of microglia in stroke etiology, however, is still unknown. We found that chemokine like factor 1 (CKLF1) causes acute microglial inflammation and metabolic reprogramming from oxidative phosphorylation to glycolysis utilizing metabolic profiling, which was reliant on the AMPK-mTOR-HIF-1α signaling pathway. Microglia, once activated, entered a chronic tolerant state as a result of widespread energy metabolism abnormalities and therefore reduced immunological responses, including cytokine release and phagocytosis. It was also found metabolically dysfunctional microglia in the mice using genome-wide RNA sequencing by chronic administration of CKLF1 directly, as well as the decrease of inflammation response. Finally, we showed that loss of CKLF1 reversed the defective immune response of microglia, as manifested by kept its phagocytosis to neutrophils, thereby mitigating long term outcomes of ischemic stroke. Overall, CKLF1 plays a crucial part in the relationship between microglial metabolic status and immune function in stroke, which prepares a potential therapeutic strategy for ischemic stroke.\u003c/p\u003e","manuscriptTitle":"A breakdown of metabolic reprogramming in microglia caused by CKLF1 exacerbates immune tolerance in the ischemic stroke","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-12-12 21:23:37","doi":"10.21203/rs.3.rs-2344526/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2023-01-25T09:13:14+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2023-01-10T18:39:50+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"20afd0dd-5e46-40e9-8fc8-396678481dbb","date":"2022-12-15T13:00:12+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-12-15T11:58:32+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-12-07T06:50:43+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2022-12-07T05:00:40+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Neuroinflammation","date":"2022-12-05T05:54:33+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-neuroinflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jneu","sideBox":"Learn more about [Journal of Neuroinflammation](http://jneuroinflammation.biomedcentral.com)","snPcode":"12974","submissionUrl":"https://submission.nature.com/new-submission/12974/3","title":"Journal of Neuroinflammation","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"97b0f995-c8d9-41c2-94ad-d790721d06f5","owner":[],"postedDate":"December 12th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2023-10-16T20:45:05+00:00","versionOfRecord":{"articleIdentity":"rs-2344526","link":"https://doi.org/10.1186/s12974-023-02779-w","journal":{"identity":"journal-of-neuroinflammation","isVorOnly":false,"title":"Journal of Neuroinflammation"},"publishedOn":"2023-04-25 20:35:38","publishedOnDateReadable":"April 25th, 2023"},"versionCreatedAt":"2022-12-12 21:23:37","video":"","vorDoi":"10.1186/s12974-023-02779-w","vorDoiUrl":"https://doi.org/10.1186/s12974-023-02779-w","workflowStages":[]},"version":"v1","identity":"rs-2344526","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-2344526","identity":"rs-2344526","version":["v1"]},"buildId":"_2-kVJe1T_tPrBINL-cwx","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}