Mechanisms of Enterobacter and Bacillus in promoting aerobic composting and immobilization of Cd in livestock and poultry manure

Mechanisms of Enterobacter and Bacillus in promoting aerobic composting and immobilization of Cd in livestock and poultry manure | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Mechanisms of Enterobacter and Bacillus in promoting aerobic composting and immobilization of Cd in livestock and poultry manure Xinyu Mao, Wei Li, Daling Xu, Jianhong Ma, Rui Zhao, Junan Bao, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7361044/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 16 Oct, 2025 Read the published version in International Microbiology → Version 1 posted 9 You are reading this latest preprint version Abstract The "concentration effect" of heavy metals during aerobic composting of livestock and poultry manure and the associated pollution risks upon land application represent significant challenges in the agricultural waste resource utilization. Enhancing composting efficiency and passivating heavy metal Cd through microbial approaches are key to achieving safe disposal and resource recovery of manure. This study aimed to screen composite microbial strains capable of simultaneously promoting compost maturation and Cd passivation, investigating their mechanisms of action on the composting process, microbial community succession, and Cd speciation transformation. Cd-resistant strains were isolated and purified from chicken manure using in situ screening techniques, and a composite microbial inoculum was prepared using Enterobacter hormaechei (LB3), Enterobacter cloacae (LB4), and Bacillus velezensis (J-1-2). Composting experiments were conducted with a control group (CK) and two treatment groups: T1 (LB3+LB4) and T2 (LB3+LB4+J-1-2). Maturity parameters, Cd speciation distribution, and microbial community dynamics were monitored, with high-throughput sequencing and correlation analysis employed to elucidate the underlying mechanisms. The results demonstrated that the composite inoculum significantly optimized the composting process. The T1 group exhibited an extended thermophilic phase and more thorough organic matter degradation (lowest C/N ratio of 14.88), while the T2 group showed optimal nitrogen retention (highest NO3--N content of 1504 mg/kg and lowest NH4+-N content of 153 mg/kg). Microbial community analysis revealed that the Ace and Chao1 indices of T1 and T2 increased by 1.5－1.8 times compared to CK during the heating phase, while the Shannon index at maturity was 10.13% and 22.40% higher than CK, respectively. The Cd passivation efficiency was highest in T2 (66.7%), with the EX-Cd fraction decreasing from 27% to 9%. Notably, key taxa such as Thauera (Proteobacteria) showed a significant positive correlation with RES-Cd (p< 0.01). In conclusion, the composite inoculum accelerated organic matter decomposition and maturation by modulating microbial community structure, while synergistically passivating Cd through adsorption and complexation mechanisms involving key genera (e.g., Thauera). This study provides theoretical and technical support for the safe composting of livestock manure and heavy metal pollution control. Aerobic compost Humification Heavy metal Cd Passivation Composite strain Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Figure 11 Figure 12 Figure 13 Figure 14 Figure 15 Figure 16 Figure 17 Figure 18 1 Introduction With China's rapid economic development and continuous optimization of rural industrial structures, livestock and poultry farming has become a cornerstone of the national economy. However, its rapid expansion also poses significant threats to agro-ecological environments. For instance, in 2017 China generated 2×10 12 kg of livestock manure, with pig manure constituting the largest proportion[ 1 ]. Improper or untimely manure management not only causes environmental pollution but also leads to the wastage of its valuable nutrient resources. Aerobic composting, as an environmentally friendly treatment technology, can achieve harmless, volume-reduced, and resource-recovered utilization of manure[ 2 ]. However, several challenges remain. Suboptimal environmental conditions and process parameters during composting may result in insufficient humification, and the application of immature compost can be detrimental to both soil and plants. Furthermore, inappropriate allocation of livestock manure during field application may induce soil crusting and salinization[ 3 ], diminishing fertilizer efficacy and crop growth. Of particular concern is the long-term accumulation of residual heavy metals and antibiotics in soils and crops, which ultimately threatens agricultural productivity, crop quality, and human health. These issues underscore the critical need for improving composting efficiency in livestock manure treatment systems. Previous studies have demonstrated that microbial agent inoculation can effectively accelerate compost maturation[ 4 ], enhance organic matter conversion efficiency, improve nitrogen fixation capacity[ 5 ], and reduce the overall composting duration. In recent years, extensive research has been conducted domestically and internationally on improving aerobic composting efficiency through microbial agent application. Bemal et al.[ 6 ]demonstrated that microbial agent inoculation enhances the decomposition efficiency of livestock manure. Abebe et al.[ 7 ]further revealed that microbial agents not only accelerate organic matter degradation and reduce composting duration, but also exhibit nitrogen-fixing capacity. Regarding functional strain screening, Zheng et al.[ 8 ]isolated five Bacillus spp. strains from chicken manure that promote compost decomposition, demonstrating their effectiveness in enhancing organic matter degradation efficiency. Meanwhile, Ansari et al.[ 9 ]successfully screened Escherichia coli strains with Cd 2+ passivation capability from polluted irrigated soils. Although numerous functional strains have been obtained through microbial in situ screening in domestic and international research, highly efficient composite strains with synergistic effects remain scarce, particularly those capable of simultaneously promoting compost maturation and passivating heavy metals. In this study, we employed in situ screening coupled with purification techniques to obtain composite strains exhibiting these dual functions. The in situ screening approach preserves microbial original characteristics and maintains ecological balance within microbial communities, thereby ensuring synergistic effects between functional strains and environmental microorganisms[ 10 ]. Concurrently, isolation and purification techniques enable precise identification of microbial functional traits and elucidation of their mechanisms, while eliminating interference from non-target microorganisms. This integrated technical approach provides an innovative strategy for addressing both compost maturation efficiency and heavy metal pollution challenges. Based on the current situation, the present study used chicken manure as a raw material and employed in situ screening and isolation purification techniques to obtain composite bacterial agents capable of promoting compost humification and passivating heavy metal Cd. These agents were then applied in aerobic composting experiments. The study hypothesized that Enterobacteriaceae and Bacillus sp. could enhance the humification process of aerobic composting while improving the passivation efficiency of heavy metal Cd. To test this, the effect of in situ screening and isolation of Cd-resistant strains was first preliminarily verified. Subsequently, the target strains were inoculated into the composting system to systematically monitor dynamic changes in decomposition parameters, the morphology and distribution of heavy metal Cd, and microbial community succession during composting. This allowed for an investigation into how the composite bacterial agents influenced the transformation of compost material, the speciation and distribution of heavy metal Cd, and the structure of the microbial community. By analyzing the interrelationships among heavy metal Cd passivation, microbial community succession, and the decomposition process, the study elucidated the mechanism by which the functional bacterial strains affect the bioefficacy of heavy metal Cd. The results provide an important theoretical and practical basis for improving aerobic composting technology and promoting the resource utilization of livestock and poultry manure. 2 Materials and Methods 2.1 In situ screening and performance characterisation of Cd-passivating bacterial strains 2.1.1 Screening of functional strains (1)Preparation of specific culture media The selective basal media for bacteria, fungi, and actinomycetes were prepared following modified formulations of LB medium, Martin medium, and Gause's No.1 medium, respectively. The specific procedure was as follows(Fig. 1 ): Each medium component was mixed with an appropriate amount of distilled water and poured into a conical flask. The liquid volume did not exceed half of the flask’s total capacity, and the flask mouth was sealed with sealing film. Subsequently, the medium was sterilized in an autoclave at 121°C for 20 minutes. After sterilization, it was transferred to an ultra-clean bench for cooling and aseptic treatment. The UV lamp was turned on to sterilize the workbench for 20 minutes. Once the medium temperature dropped to a suitable range, it was poured into plates (20-25 mL per dish, 9 cm diameter) and labeled. The plates were inverted and left at room temperature for 2།3 hours to solidify completely. Notably, 30 mg/L cadmium sulfate was added during preparation for screening Cd-resistant microorganisms. (2)Primary screening of Cd-resistant microorganisms The gradient dilution method was used to isolate, purify, and screen for cadmium-resistant microorganisms from fresh chicken manure samples. The experimental procedure was as follows: First, 10 g of fresh chicken manure was weighed into a sterile bag, transferred to a sterilized triangular flask, mixed with 90 mL of sterile water, and shaken at 180 rpm for 30 min. The mixture was left to stand for 30 min to prepare the suspension. Next, 100 uL of the supernatant was serially diluted (10-fold increments) with saline to a final concentration of 10 − 6. For each dilution, 100 uL was spread evenly on the corresponding medium plate. All operations were performed near an alcohol lamp in the ultra-clean bench to maintain sterility. The plates were inverted and incubated at 37°C for 1-2 days. Three replicates were prepared per dilution. After colony formation, distinct single colonies were selected based on morphology and streaked repeatedly (3།4 times) to obtain pure cultures. These cultures were then inoculated into medium containing 30 mg/L cadmium sulfate and incubated at 40°C and 50°C for 1།2 days. Strains showing growth under these conditions were preliminarily identified as cadmium-resistant. (3)Secondary screening of Cd-passivating microorganisms The microorganisms screened in the previous step for heavy metal Cd tolerance were inoculated into fresh chicken manure at a 5% (w/w) inoculation rate. Rice husk was added proportionally, and the mixture was placed in 2 L containers for small-scale fermentation at room temperature for 25 days. A control group (with an equal amount of sterile water instead of inoculum) was included, and all treatments were performed in triplicate. Samples were collected on days 0 and 25 of fermentation to determine the weakly acid-extractable Cd content and calculate the passivation rate. The data were compared to identify strains with superior Cd passivation effects. The equation used to calculate the passivation rate is presented in Eq. (1). P=(B-A)/B×100% (1) In Eq. (1), P denotes the passivation rate, B signifies the rate of pre-heap allocation, and A characterizes the rate of post-heap allocation. 2.1.2 Identification of functional strains (1)Morphological identification Microorganisms demonstrating Cd passivation potential were subjected to secondary incubation. When visible colonies formed, they were photographed and documented. (2)Molecular identification The PCR technique was used to amplify the target sequence. The primers for the 16S rDNA gene sequence of the bacteria were provided by Shanghai Meiji Biomedical Technology Co., Ltd., with the forward and reverse primer pairs being 27F (AGAGTTTGATCCTGGCTGGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT), respectively. The reagents and amplification steps are detailed in Table 1 . Table 1 Reagents for PCR amplification Reagent Volume 10*Ex Taq buffer 2.0µL 5u Ex Taq 0.2µL 2.5mM dNTP Mix 1.6µL 5p Primer 1 1µL 5p Primer 2 1µL DNA 0.5µL dd H 2 O 13.7µL Total volume 20µL The amplification protocol consisted of 25 cycles with the following thermal profile: initial denaturation at 95°C for 5 min, followed by cyclic denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 60 s, with a final extension at 72°C for 10 min. PCR products were then analyzed for concentration and purity using agarose gel electrophoresis. The purified amplicons were subjected to DNA sequencing, and the resulting sequences were compared against the GenBank database using the BLAST tool from NCBI (National Center for Biotechnology Information) to identify homologous sequences. Phylogenetic analysis was performed using MEGA 7.0 software to construct and evaluate evolutionary trees. 2.1.3 Selection of functional strains and preparation of composite bacterial agents (1)Studies on the putrefactive capacity of Cd-resistant strains of bacteria The Cd-passivation-promoting strains were selected for small-scale fermentation tests. The E4/E6 ratio of chicken manure was measured before and after fermentation. Strains demonstrating both cadmium tolerance and organic matter decomposition capacity were identified as the dominant microorganisms. (2)Strain antagonism test The Oxford cup method was employed to investigate antagonistic effects among Cd-resistant strains exhibiting enhanced organic matter decomposition capacity. The experimental procedure consisted of the following steps: (1) The test strains were uniformly spread on the culture medium using the spread plate technique and allowed to solidify. (2) Sterilized Oxford cups (four per plate) were placed on the inoculated medium, followed by addition of different bacterial suspensions into individual cups. Each treatment was performed in triplicate, with sterile water serving as the control. (3) After incubation at constant temperature, the plates were examined for inhibition zone formation. The presence of clear zones indicated strain antagonism, while their absence suggested no antagonistic interaction. (3)Plotting of strain growth curves As the bacteria have certain shading to light, the more the bacteria multiply, the stronger their shading, so the optical density value of the liquid can be measured to respond to the quantity status of the bacteria. The specific steps are as follows: (1) activation culture: use a pipette gun to accurately transfer 200 uL of the bacterial liquid value of the conical flasks containing 200 mL of liquid medium, in the constant temperature incubation shaker for 24 h (speed of 180 r/min), every 4 h to take a sample of 60 uL to determine the absorbance value of its OD 600 nm. (2) Determination of absorbance: transfer the aspirated bacterial solution to a cuvette and measure it at a wavelength of 600 nm, and take the average value for three times. (3) Drawing of growth curve: the growth curve of the bacterium was drawn, the Y-axis was the measured value of OD 600 nm, and the X-axis was the length of the incubation time to observe the logarithmic and stable periods of microbial growth. (4)Preparation of composite fungicide Strains that were not antagonistic to each other were combined to form a composite colony, with a 1:1 mixing ratio. 2.1.4. Preservation of strains A 50% (v/v) glycerol solution was prepared by mixing 50 mL of glycerol with 50 mL of distilled water. Following autoclave sterilization, 1 mL of bacterial culture in logarithmic growth phase was aseptically mixed with 1 mL of the sterile 50% glycerol solution. The mixture was then aliquoted into cryovials and stored at -70°C for long-term preservation(Fig. 2 ). 2.2 Aerobic Composting of Livestock Manure and Determination of Related Physicochemical Parameters Experiment 2.2.1 Composting materials The 35-day experiment was conducted in a greenhouse at the Nanjing Animal Husbandry Science Research Institute (geographic coordinates: 118°94′E, 31°90′N). Fresh chicken manure was collected from the institute's poultry farm, while rice husks were obtained from the Agricultural By-Products Storage Facility of the same institute. The physicochemical characteristics of these raw materials are presented in Table 2 . Table 2 Physical and chemical properties of composting materials Material Moisture content(%) Total organic carbon(g/kg) Total nitrogen(g/kg) C/N Nitrate nitrogen (mg/kg) Ammonium nitrogen (mg/kg) pH Fowl dung 75.34 335 16.8 19.94 689 145 6.8 Rice hull 10.11 451 10.1 44.65 - - - 2.2.2 Experimental design A foam box measuring 59×39×35 cm was selected as the aerobic composting device for the experiment. Chicken manure and rice husk were used as composting raw materials in a ratio of 7:3, with an adjusted moisture content of 60%, a carbon-to-nitrogen ratio of 25:1, and a turning frequency of every 5 days. The experimental group was prepared based on the amount of composite bacterial inoculant added, while the control group was treated with an equal amount of sterile water. All treatments were performed in triplicate. Sampling was conducted every 2 days using the five-point sampling method. From each treatment, 100 g of sample was collected using a sterile sampling bag and divided into two portions: one for determining pH, moisture content, nitrate nitrogen, ammonium nitrogen, C/N ratio, and Cd speciation, and the other for 16S rDNA analysis. Samples taken on days 0, 3, 8, and 33 were designated as representative samples of the initial (0), heating (S), thermophilic (G), and maturity (J) phases of composting, respectively. 2.2.3 Determination of physical and chemical parameters of composting The thermometer was inserted one-third from the top of the pile, and the temperature was recorded daily at 10 a.m. and 4 p.m., with the average value used as the measured temperature. For pH determination, 5 g of compost sample was mixed with 50 mL of distilled water, shaken at 25°C and 180 rpm for 30 min, filtered, and allowed to stand for 1 h before measurement using a pH meter. To determine moisture content, 50 g of fresh compost samples were weighed and dried in an oven at 105°C for 4 h. Total organic carbon and total nitrogen were analyzed following national standard methods, and the carbon-to-nitrogen ratio was subsequently calculated. NH 4 + -N was determined using Cui Lanying's method, while NO 3 − -N was analyzed following the national standard NY/T 1116–2014. Absorbance values were measured at wavelengths of 465 nm and 665 nm using a cuvette, and the E4/E6 ratio was calculated. For the germination assay, compost samples were mixed with distilled water at a 1:10 ratio, shaken for 20 min, and allowed to stand for 24 h. After removing debris and precipitates by slow filtration, the filtrate was spread evenly on a 9 cm petri dish, with 5 mL of extract added to each. A control group containing the same volume of distilled water was prepared in parallel. Twenty uniform-sized cabbage seeds were placed in each petri dish, with three replicates per treatment. After 48 h, root length and germination count were recorded, and the germination index (GI) was calculated using Formula (2). 2.2.4 Determination of heavy metal Cd forms The improved three-step extraction method was used to determine the chemical speciation of cadmium (Cd) in compost samples. The specific procedures were as follows:(1) For exchangeable Cd (EX-Cd): Air-dried compost samples were ground and sieved through a 100-mesh sieve. A 1.0 g aliquot was placed in a 100 mL centrifuge tube, mixed with 40 mL of 0.10 mol/L glacial acetic acid, and shaken at 25°C for 16 h. After centrifugation at 3000 r/min for 20 min, the supernatant was diluted to 50 mL for Cd 2+ concentration measurement (denoted as Z1). (2) For reducible Cd (OXI-Cd): The residual precipitate from step (1) was treated with 40 mL of 0.5 mol/L hydroxylamine hydrochloride solution. The mixture was shaken at 25°C for 16 h and centrifuged (3000 r/min, 20 min). The supernatant was adjusted to 50 mL for Cd 2+ analysis (denoted as Z2). (3) For oxidizable Cd (RED-Cd): The precipitate from step (2) was sequentially treated with 10 mL of acidified hydrogen peroxide (standing for 1–2 h), heated to 85°C with additional 10 mL hydrogen peroxide (maintained for 1 h), then mixed with 50 mL of 1 mol/L ammonium acetate. After shaking (25°C, 16 h) and centrifugation (3000 r/min, 20 min), the supernatant was diluted to 50 mL for Cd 2+ measurement (denoted as Z3). (4) For residual Cd (RES-Cd): The final precipitate was digested with 10 mL HNO 3 and 4 mL HF in a sealed ablation tank at 140°C. The digested solution was diluted to 50 mL for Cd2 + determination (denoted as Z4). 2.2.5 Determination of microbial diversity and community structure in the composting process (1)DNA extraction and purification Total genomic DNA was extracted from the samples following the CTAB method. The DNA quality (purity and concentration) was subsequently evaluated through 1% agarose gel electrophoresis. (2)PCR amplification The diluted DNA was amplified by PCR using primer pairs 341 F:CCTACGGGNGGCWGCAG and 806 R:GGACTACHVGGGTWTCTAAT. The detailed PCR reaction syst-em is presented in Table 3 . Table 3 PCR amplification reaction system Reagent Volume High-Fidelity PCR Master Mix 15µL Primers 0.2µL Template DNA 10µL Total volume 30µL The PCR amplification protocol consisted of: initial denaturation at 98°C for 1 min; followed by 30 cycles of denaturation at 98°C for 10 s, annealing at 50°C for 30 s, and extension at 72°C for 30 s; with a final extension at 72°C for 5 min. Subsequently, PCR product purity and concentration were assessed by 1% agarose gel electrophoresis. (3)High-throughput sequencing The concentration and quality of PCR amplification products were assessed, and only samples meeting the following criteria were selected for subsequent analysis: DNA concentration > 10 ng/uL and 260/280 nm absorbance ratio approximately 1.8. Qualified samples were then submitted to Tiangen Biochemical Technology (Beijing) Co., Ltd. for Illumina high-throughput sequencing and bioinformatics analysis. 2.3 Data processing and analysis Microsoft Excel 2020 was employed for data collation and preliminary processing of physicochemical parameters and biological indices. For sequence analysis, Notepad + + and MEGA 7.0 were used to process and align the obtained microbial sequences, followed by phylogenetic tree construction using appropriate methods based on sequence similarity and evolutionary relationships. Data visualization was performed using Origin 2021, including line graphs for physicochemical indices and stacked bar charts for the percentage distribution of cadmium (Cd) speciation. For microbial community analysis, the sequencing data were processed through QIIME2's DADA2 pipeline for OTU clustering. Taxonomic annotation was subsequently performed to determine species composition and relative abundance. Beta diversity matrices were calculated to evaluate sample relationships, while rarefaction curve analysis was conducted based on OTU distributions. Alpha diversity was assessed using Chao1, ACE, Simpson, and Shannon indices. 3 Results 3.1 Results of in situ screening and informative identification of Cd-resistant bacterial strains 3.1.1 Results of in situ screening of Cd-resistant bacterial strains In this study, a total of 20 cadmium-tolerant microbial strains were successfully isolated, comprising eight bacterial, one fungal, and two actinomycete strains at 40°C, along with four bacterial, two fungal, and three actinomycete strains at 50°C. Among these, eleven strains demonstrated significant cadmium passivation capability. During in situ screening, all colonies exhibited robust growth on the culture medium (Fig. 3 ). Detailed information regarding colony morphology and screening culture conditions is provided in the Supplementary Material (Table S1 ). 3.1.2 Informative identification of Cd-resistant strains The PCR amplification results of the cadmium-resistant strains are presented in Fig. 4 . All 12 selected strains exhibited clear and well-defined electrophoretic bands, meeting the quality standards required for high-throughput sequencing. Phylogenetic analysis of the cadmium-passivating microorganisms was performed based on 16S rDNA sequencing. The evolutionary tree constructed using BLAST alignment and MEGA 7.0 (Fig. 5 ) revealed that these isolates primarily clustered into five distinct genera with sequence similarities exceeding 98%. The identified genera included: Escherichia (strains LB1, LB2, F2), Bacillus (strains J-1-1, J-1-2, J-2-1, J-2-4, F1), Enterobacter (strains LB3, LB4), Micrococcus (strain LB5), and Saccharomyces (strain MR1). Due to potential biosafety concerns associated with pathogenic Escherichia coli and Escherichia fergusonii, strains LB1, LB2, and F2 were excluded from further investigation. Additionally, since both J-1-1 and J-1-2 were identified as Bacillus velezensis, only one representative strain was selected for subsequent experiments. Ultimately, eight microbial strains were retained for further study, with detailed taxonomic information provided in Supplementary Table S2. 3.2 Study on the effect of Cd passivation and humification by strains of Rhizobium spp. 3.2.1 Cd passivation-promoting and humification-promoting effects of a single bacterial strain The effects of individual bacterial strains on Cd passivation and humification promotion are shown in Fig. 6 . Among them, LB3, LB4, and J-1-2 exhibited the highest Cd passivation efficiency, with LB4 being the most outstanding, achieving an EX-Cd passivation rate of 67.35%. Based on passivation efficiency, the treatment groups were ranked as follows: LB4 > LB3 > J-1-2 > LB5 > F1 > J-2-1 > J-2-4. Notably, the J-2-4, J-2-1, F1, and MR1 treatment groups all showed EX-Cd passivation rates below 35%, which were significantly lower than those of other strains. Therefore, these strains were excluded from further study. In terms of humification promotion, J-1-2 performed best(10.82%), followed by LB3(10.31%) and LB4(9.80%). The other strains showed unsatisfactory results and were thus not considered for subsequent bacterial agent preparation. 3.2.2 Antagonism experiments between strains Antagonism experiments were conducted on the three selected strains (LB3, LB4, and J-1-2) using the Oxford cup method. These strains exhibited both Cd passivation and humification capabilities. Results demonstrated no mutual antagonism among the three strains (Table 4 and Fig. 7), indicating their suitability for combined use in bacterial agent preparation. Table 4 Antagonism results between different strains Bacteria LB3 LB4 J-1-2 LB3 / - - LB4 - / - J-1-2 - - / Note : "+" indicates presence of antagonistic activity, while "-" denotes absence of antagonistic response. 3.2.3 Growth curve of the strain In order to investigate the growth characteristics of LB3, LB4, and J-1-2, the preserved bacterial fluids were inoculated into the corresponding liquid medium at an inoculation ratio of 1:100 and cultured continuously for 24 h. Samples were taken every 4 h to determine the OD 600 values, and growth curves were plotted (Fig. 8 ). The results showed that LB4 and J-1-2 entered the rapid growth phase within a relatively short period. LB4 reached the stabilization phase around 12 h, while J-1-2 exhibited a significant decrease in growth rate and stabilized after 8 h. In contrast, LB3 displayed a more pronounced lag phase, with slow growth between 0–10 h, followed by rapid proliferation until reaching stabilization after 20 h. The growth rate of LB3 was significantly lower than that of LB4 at around 12 h. Throughout the 24-h culture period, none of the three strains showed an obvious decay phase. 3.2.4 Preparation of composite bacterial agents and their effectiveness in promoting Cd passivation and humification The strains LB3, LB4, and J-1-2 were mixed in equal proportions to prepare compound microbial agents for investigating Cd passivation and compost maturation promotion (Fig. 9 ). The results demonstrated significant differences in Cd passivation efficiency among different strain combinations. Notably, the LB3 + LB4 and LB3 + LB4 + J-1-2 combinations exhibited the highest passivation efficiencies, achieving EX-Cd passivation rates of 69.25% and 71.35%, respectively. These findings confirm that specific strain combinations exert synergistic effects in heavy metal passivation. Similarly, the promotion effects of different compound agents on compost humification varied significantly. The LB3 + LB4 and LB3 + LB4 + J-1-2 combinations also showed the best humification performance, with maturation degrees of 12.78% and 13.10%, respectively, significantly surpassing the capabilities of individual strains. Based on these results, the two strain combinations (Treatment T1: LB3 + LB4; Treatment T2: LB3 + LB4 + J-1-2) were selected as test agents for subsequent composting experiments. 3.3 Changes in decay indicators during composting The pH of all treatment groups exhibited an initial increase followed by a decrease during composting (Fig. 10 A), consistent with the typical pH trend in aerobic composting[ 11 ]. At the onset of composting, the pH values of the T1 and T2 treatment groups were higher than that of the CK group, likely due to the addition of composite microbial agents. Between days 3 and 16, the pH of each treatment group increased significantly, peaking on day 16, with the T2 group reaching the highest value (8.9). By the end of composting, the pH stabilized at a weakly alkaline level across all treatments, which is a key condition for compost maturation[ 12 ]. The pre-composting phase was characterized by a rapid temperature increase in all treatment groups (Fig. 10 B). By day 6, each treatment group had reached its peak composting temperature, with the T1 group recording the highest temperature (58°C), which was then consistently maintained above 50°C. Since maintaining temperatures above 50°C for more than 3 days effectively eliminates pathogenic microorganisms and weeds, achieving the harmless treatment standard[ 13 ], all treatment groups in this study met this requirement. Notably, the T1 group reached the thermophilic phase first, suggesting that the microbial inoculant promoted compost decomposition. During the subsequent cooling phase, temperatures gradually decreased, with minor temporary increases observed after pile turning in all treatments, though none exceeded 50°C. The moisture content of all treatment groups exhibited a decreasing trend (Fig. 10 C), declining from approximately 60% initially to 43.11% (CK), 41.56% (T1), and 41.89% (T2) during the maturation phase, representing an overall reduction of about 20%. The most rapid moisture loss occurred during the thermophilic phase, primarily because thermophilic bacteria dominated the microbial community during this stage. The intensive decomposition of organic matter and consequent heat generation significantly enhanced water evaporation. In this experiment, all treatment groups exhibited a continuous decline in C/N ratio throughout the composting process (Fig. 10 D). The most significant reduction occurred during the thermophilic phase, with C/N ratios decreasing to 19.05 (CK), 19.03 (T1), and 21.01 (T2), respectively. Subsequently, the rate of decrease gradually slowed until reaching the lowest values during the maturation phase: 15.82 (CK), 14.88 (T1), and 15.79 (T2). Figure 10 E illustrates the NO 3 − -N variation pattern during composting. During both the mesophilic and thermophilic phases, NO 3 − -N content remained relatively stable. However, a rapid increase was observed following the thermophilic phase. At composting completion, the NO 3 − -N content increased by 2.00-fold (CK), 2.06-fold (T1), and 2.18-fold (T2), with the T2 treatment group achieving the highest concentration (1504 mg/kg). Figure 10 F presents the NH 4 + -N variation pattern during composting. In contrast to NO 3 − -N, NH 4 + -N content increased rapidly during the mesophilic and thermophilic phases, reaching peak concentrations. Subsequently, NH 4 + -N levels declined sharply during the cooling phase, attaining minimum values by day 16. The T2 treatment group showed the lowest recorded concentration (153 mg/kg). All treatment groups exhibited a characteristic rise and subsequent decline in E4/E6 ratios during composting (Fig. 10 G). During the thermophilic phase, E4/E6 ratios increased concomitantly with temperature elevation, peaking on day 14 at 3.44 (CK), 3.20 (T1), and 3.34 (T2). Following the temperature maximum, the ratios decreased progressively as pile temperatures declined, ultimately reaching their lowest values during the maturation phase: 1.74 (CK), 1.52 (T1), and 1.41 (T2). Seed GI demonstrated a consistent upward trend across all treatments during composting (Fig. 10 H). Initial GI values were relatively low (about 25%) in all groups during the early composting stage. The GI progression exhibited phase-dependent characteristics: slower increases during mesophilic and thermophilic phases, followed by accelerated growth during the cooling phase, particularly in T1 and T2 treatments (significantly higher than CK). This upward trend gradually stabilized toward composting completion, with final GI values reaching 81.72% (CK), 86.22% (T1), and 87.35% (T2). 3.4 Characterisation of bacterial communities and their succession in composting processes 3.4.1 Differential analysis of bacterial species in compost samples Electrophoresis analysis of PCR-amplified sequences from compost samples revealed clear bands meeting high-throughput sequencing standards (see Supplementary Material Fig. S1 for detailed electropherograms). High-throughput sequencing of 12 compost samples representing four composting phases yielded 1,189,665 bacterial sequences, with treatment-specific effective sequence counts presented in Table 5 . Table 5 Number of valid sequences for each treatment group Specimen Number of valid sequences Specimen Number of valid sequences Specimen Number of valid sequences CK0 87526 T10 80386 T20 73281 CKS 139791 T1S 113891 T2S 128669 CKG 82507 T1G 86492 T2G 82190 CKJ 118983 T1J 101684 T2J 94265 Note : Experimental phases are coded as follows: 0 - initial phase; S - mesophilic phase; G - thermophilic phase; J - maturation phase. Using 97% similarity threshold for operational taxonomic unit (OTU) clustering, we analyzed bacterial OTU distribution across treatments and phases (Fig. 11a). Throughout composting, total OTU counts followed the order: 7,785 (T1) > 7,471 (T2) > 6,691 (CK), indicating T1 maintained the highest microbial diversity. All treatments exhibited increasing OTU numbers during composting, reaching peak bacterial community diversity during the maturation phase. The OTU rarefaction curve analysis (Fig. 11b) revealed the steepest slope in T2 treatment, indicating superior species richness. Principal coordinate analysis (Fig. 11c) demonstrated significant differences between initial-phase and subsequent-phase bacterial communities across all treatments, confirming substantial composting-induced microbial restructuring. During mesophilic and maturation phases, bacterial community compositions showed remarkable convergence among treatments, suggesting that dominant microorganisms in these phases were likely indigenous and phylogenetically related, developing similar community structures under comparable environmental conditions. Notably, thermophilic-phase samples exhibited distinct clustering patterns: CK treatment diverged significantly from T1 and T2 groups. This divergence presumably resulted from the active involvement of inoculated microbial consortia in T1/T2 treatments, which modified indigenous community structures and created differentiation from conventional composting (CK) microbiota. 3.4.2 Changes in bacterial community diversity indices in compost samples Bacterial diversity indices across composting phases and treatments are presented in Table 6 . Both Chao1 and Ace indices, which estimate community richness, exhibited parallel trends. Notably, T1 and T2 treatments consistently demonstrated higher values than CK after the initial phase, suggesting microbial inoculants enhanced bacterial community richness. Phase-specific patterns emerged: T1 showed maximum richness during mesophilic (S) and maturation (J) phases, while T2 dominated in other phases. This phase-dependent variation highlights treatment-specific impacts on microbial abundance. The ranked Chao1 indices (T1J > T2J > CKJ > T2G > T1S > T2S > T1G > CKG > CK0 > T20 > T10) further illustrate temporal and treatment-based variations in bacterial community abundance. Both Simpson and Shannon indices peaked during the maturation phase, indicating optimal bacterial community diversity and evenness were achieved at this stage. Comparative analysis revealed significant increases post-composting: CK treatment showed increments of 0.0013 (Simpson) and 2.1739 (Shannon), while T1 and T2 treatments demonstrated greater improvements (T1: +0.0733, + 2.6483; T2: +0.1046, + 2.9616), confirming that microbial inoculants enhanced α-diversity more effectively than conventional composting. All samples exhibited exceptional coverage rates (> 0.999), verifying that the sequencing depth adequately captured the composting microbiome and validating the reliability of our diversity assessments. This high coverage ensures our bacterial diversity indices accurately represent the in situ microbial community dynamics. Table 6 Variation of bacterial abundance and diversity during chicken manure composting Period Specimen Number of valid sequences Ace Chao1 Simpson Shannon Coverage Initial phase CK0 87526 370.78 370.81 0.9696 5.6844 0.9996 T10 80386 294.55 294.16 0.9081 5.4753 0.9998 T20 73281 320.12 323.32 0.8758 4.8835 0.9998 Mesophilic phase CKS 139791 636.27 635.14 0.9736 6.6822 0.9998 T1S 113891 843.17 842.19 0.9828 7.3697 0.9999 T2S 128669 797.42 797.78 0.9753 7.000 0.9997 Thermophilic phase CKG 82507 719.99 716.48 0.9704 6.6566 0.9995 T1G 86492 729.71 727.75 0.9662 6.4959 0.9996 T2G 82190 856.81 850.84 0.9829 7.3549 0.9995 Maturation phase CKJ T1J T2J 118983 101684 94265 1410.20 1681.68 1449.19 1408.42 1681.23 1447.98 0.9862 0.9814 0.9804 7.8583 8.1236 7.8451 0.9996 0.9994 0.9997 Note : Experimental phases are coded as follows: 0 - initial phase; S - mesophilic phase; G - thermophilic phase; J - maturation phase. 3.4.3 Bacterial community succession during the composting process To investigate the dynamics of the bacterial community during different composting stages, this study analyzed the composition of bacterial communities at the phylum level (groups with < 1% abundance were classified as "Others") in compost samples from various treatments over time. The results are presented in Fig. 12 . Overall, the dominant phyla at each composting stage included Bacteroidetes , Actinobacteria , Firmicutes , Proteobacteria , Acidobacteria , and Chloroflexi . Among these, Firmicutes and Actinobacteria exhibited significant fluctuations and higher abundance. In the first three phases, Firmicutes accounted for 38.53–89.51% of the community, while Actinobacteria ranged from 5–38.61%. However, during the maturation phase, the abundance of Firmicutes plummeted to 15.06–20.60%, whereas Actinobacteria increased sharply to 46.01–58.90%. Notably, in the CK, T1, and T2 treatment groups, Firmicutes reached 62.28%, 77.24%, and 89.51%, respectively, suggesting its adaptability to high-temperature environments. Additionally, during maturation, Actinobacteria abundance rose significantly to 46.01%, 58.90%, and 57.26% in the CK, T1, and T2 groups, respectively. In contrast, Chloroflexi , which had previously represented < 1% of the community, increased to 15.36%, 11.82%, and 14.65% during maturation. In this study, bacterial communities with a relative abundance exceeding 1% were further classified statistically at the family level, and the results are presented in Fig. 13 . A total of 27 major bacterial families were identified and analyzed for abundance variations across different compost treatments. The dominant families included Enterobacteriaceae (0.11–37.15%), Ruminococcaceae (0.93–76.79%), Lachnospiraceae (0.25–76.68%), Burkholderia (0.03–90.98%), Lactobacillaceae (0.25–33.13%), Wohlfahrtiimonadaceae (1.79–68.09%), Bacillaceae (0.01–51.55%), and Family XI (0.52–18.93%). The analysis showed that the abundance of both Ruminococcaceae and Lachnospiraceae increased in all treatments during the warming period but declined sharply in the rotting period. Specifically, Ruminococcaceae decreased from 2.79–21.51% in the initial phase to 0.93–1.67% in the rotting phase, while Lachnospiraceae dropped from 3.48–25.44% initially to 0.25–0.81% during rotting. The initial abundance of Lactobacillaceae was higher in the T1 and T2 treatment groups but decreased significantly during the high-temperature phase and reached its lowest level in the rotting phase. In contrast, the CK group exhibited a peak in Lactobacillaceae abundance (29.93%) during the warming phase, followed by a continuous decline to 0.33% by the rotting phase. Unlike these decreasing trends, Burkholderia abundance increased steadily throughout composting, rising from 0.03–0.59% in the initial phase to 22.36–23.56% in the rotting phase. Notably, Wohlfahrtiimonadaceae were detected only during the warming and high-temperature phases. Additionally, Anaerolineaceae and Chromobacteriaceae were absent in the first three composting phases but gradually increased in abundance, peaking during the maturation phase. In this study, 12 samples from different treatments and periods were analyzed for bacterial communities at the genus level, with the top 22 most abundant genera selected and visualized in a bar chart (Fig. 14 ) to demonstrate their distribution patterns across treatments and time. Dominant genera present throughout the composting process included Phascolarctobacterium (0.01%-4.49%), Megamonas (0.01%-6.87%), Bacteroides (0.06%-16.26%), Lactobacillus (0.20%-27.00%), Faecalibacterium (0.04%-3.20%), and Pseudomonas (0.01%-9.29%). The analysis revealed that certain genera like Prevotella and Enterococcus showed minimal abundance during the rotting period, with their populations declining sharply in the late composting stage. This suggests these genera may have been primarily active in the pre-composting phase. Conversely, other genera including Tauerella , Aeromonas , and Comamonas exhibited low initial abundance but progressively increased throughout the composting process, peaking during maturation. This pattern indicates these genera likely adapted well to changing composting conditions and potentially played significant roles in mid-to-late stage transformation and metabolic processes. 3.5 Study on the passivation effect of heavy metal Cd in composting process 3.5.1 Changes in total landfill weight of the heavy metal Cd After composting, the total cadmium (Cd) concentration in all treatment groups exhibited an increasing trend (Fig. 15 ), showing an approximate 71–79% elevation. This phenomenon primarily resulted from the concentration effect associated with organic matter decomposition during the composting process[ 14 ]. However, post-composting Cd concentrations showed no statistically significant differences between the control and treatment groups. 3.5.2 Changes in the morphological distribution of Cd in stacked heavy metals To better understand how different treatments affect the speciation of Cd during chicken manure composting, this study analyzed Cd fractions at various composting stages (Fig. 16 ). Analysis of cadmium (Cd) fractionation patterns revealed distinct trends among treatment groups. For EX-Cd, while the CK group showed an initial increase followed by decrease, both T1 and T2 groups exhibited continuous reductions during the final three composting phases. The T2 group demonstrated optimal performance by reducing EX-Cd to 9% at composting completion, which was slightly but significantly better than the 11% reduction achieved by T1, thus confirming the composite bacterial agent's effectiveness in EX-Cd reduction. Oxidizable Cd (OXI-Cd) emerged as the dominant Cd storage form, consistently comprising > 45% of total Cd and showing progressive accumulation throughout composting. The CK group's OXI-Cd proportion increased from 45–64%, while T1 and T2 reached 57% and 62% respectively, demonstrating composting's dual effect of OXI-Cd promotion and EX-Cd reduction. Reducible Cd (RED-Cd) exhibited minimal overall variation, with only T1 showing a slight 3% post-composting increase. Both CK and T2 groups showed reductions (7% and 5% respectively). RES-Cd reached its lowest allocation during the thermophilic phase, suggesting unfavorable formation conditions. Final RES-Cd percentages decreased by 2% in CK, remained stable in T1, and increased 6% in T2. 3.6 Correlation of Cd bioavailability with humification parameters and bacterial communities 3.6.1 Heatmap analysis of bacterial communities and decay parameters affecting Cd passivation Figure 17 presents a heatmap illustrating the correlations between environmental factors, decomposition parameters, and dominant bacterial communities during the composting process. In the CK treatment group (Fig. 17a), NO 3 − -N and GI were the primary environmental factors and composting parameters showing significant positive correlations (p < 0.05 or p < 0.01) with bacterial communities. The presence of Subdoligranulum , Bifidobacterium , Agathobacter , and Faecalibacterium perfringens was found to inhibit the conversion of other heavy metal fractions to RES-Cd. Other environmental factors showed no significant relationship with heavy metal speciation. These results indicate that while aerobic composting can partially passivate heavy metals, its effectiveness remains limited. In the T1 treatment group (Fig. 17b), NO 3 − -N exhibited the strongest influence on bacterial community structure, showing positive correlations with pH, GI, and RES-Cd, while demonstrating negative correlations with C/N ratio, MC, OXI-Cd, and EX-Cd. Regarding Cd speciation, the genera Tauerella , Acetanaerobacterium , Aeromonas , Comamonas and Vogesella showed negative correlations with EX-Cd, indicating their potential role in facilitating EX-Cd transformation. These same genera simultaneously displayed positive correlations with RES-Cd, suggesting their capacity to promote EX-Cd passivation and RES-Cd accumulation. The T2 treatment group analysis (Fig. 17c) revealed that NO 3 − -N, GI, and RES-Cd were the top three environmental factors influencing bacterial community composition. Seven bacterial genera ( Thauera , Aeromonas , Azoarcus , Acetanaerobacterium , Comamonas , Vogesella , and Pseudomonas ) showed significant positive correlations (p < 0.01) with RES-Cd content, while Phascolarctobacterium exhibited a negative correlation. Comparative analysis with the T1 treatment group indicated that genera such as Thauera likely facilitate the transformation of EX-Cd. The observed positive correlation between these genera and RES-Cd content in the T2 treatment group suggests their potential role as key microbial taxa for effective Cd passivation. 3.6.2. Mantel test test for the influence of bacterial communities and decay parameters on Cd passivation Ten bacterial genera showing high correlations with environmental and composting parameters were selected from each treatment for Mantel tests. Figure 18 presents the correlations between bacterial communities, environmental factors, and composting parameters, along with Mantel test results across treatments. In the CK treatment group (Fig. 18a), the ten genera clustered into three groups: Group P ( Proteobacteria , including Azoarcus and Desulfovibrio ), Group F ( Firmicutes , including Faecalibacterium and Bifidobacterium ), and Group B ( Macrococcus ). The T1 treatment group (Fig. 18b) showed Group P ( Proteobacteria , including Taenia and Azoarcus ), Group F ( Firmicutes , including Oscillospira and Weissella ), and Group B ( Bacteroidetes , including Megamonas ), where Group P significantly correlated with GI and EX-Cd, Group F showed partial factor correlations, and Group B exhibited multiple high correlations. In the T2 treatment group (Fig. 18c), Group P ( Proteobacteria , including Pseudomonas and Vogesella ) and Group F ( Firmicutes , including Lactobacillus and Phascolarctobacterium ) demonstrated significant positive correlations with NO 3 − -N, GI, and RES-Cd. Notably, Group B displayed similar correlation patterns between T1 and T2 treatments regarding environmental factors and composting parameters. 4 Discussion 4.1 Analysis of in situ screening, compounding and putrefactive effect of Cd-resistant bacterial strains This study successfully isolated three high-performing bacterial strains from fresh chicken manure that demonstrated cadmium (Cd) passivation and organic matter decomposition capabilities. Following morphological and molecular characterization, these strains were identified as Enterobacter cloacae (LB3), Enterobacter cloacae (LB4), and Bacillus velezensis (J-1-2). Antagonism tests revealed no inhibitory interactions among these strains. Subsequent formulation of composite bacterial consortia demonstrated superior Cd passivation and decomposition performance compared to individual strains. Notably, the LB3 + LB4 and LB3 + LB4 + J-1-2 consortia exhibited particularly promising results, achieving EX-Cd passivation efficiencies of 69.25% and 71.35% respectively, along with 12.70% and 12.79% increases in decomposition rates compared to the control (CK). Based on these findings, these two consortium formulations were selected for subsequent composting experiments. 4.2 Influence of microbial additives on the humification process of composts During the initial composting phase, both T1 and T2 treatment groups exhibited higher pH values compared to the CK group. This phenomenon can be explained by the metabolic activity of the inoculated microorganisms ( Enterobacter cloacae and Bacillus velezensis ), which accelerated organic matter decomposition and ammonia release. Concurrently, the substantial ammonium ions generated through nitrogen mineralization neutralized organic and inorganic acid production[ 15 ], collectively contributing to pH elevation. The introduced microorganisms also rapidly metabolized readily degradable substrates (for example, sugars, proteins, etc.), generating significant metabolic heat that prompted faster temperature increases in T1 and T2 piles and extended their thermophilic phases. Notably, while Bacillus velezensis in T2 is thermotolerant[ 16 ], its early-stage substrate competition potentially suppressed certain bacterial populations, thereby moderating their organic decomposition efficiency and temperature rise kinetics. In contrast, the CK group amended with sterile water demonstrated slower heating rates due to its limited microbial diversity and reduced metabolic activity. By composting completion, all treatment groups achieved C/N ratios below 20-meeting the established threshold for mature compost (studies indicate decomposition occurs at C/N < 20[ 17 ]). The T1 group exhibited the lowest C/N ratio, attributable to enhanced organic matter degradation by microbial activity[ 18 ]. During the thermophilic phase, T1 and T2 groups demonstrated the most pronounced moisture reduction rates. This resulted from dual mechanisms: (1) water utilization for microbial growth and (2) activated water consumption by the inoculated microbial consortia to boost metabolic activity[ 19 ]. These processes stimulated organic matter mineralization and heat generation, consequently accelerating moisture evaporation and loss. This experiment demonstrated that all three treatment groups eventually achieved the target E4/E6 ratio for compost maturity[ 20 ], with T1 and T2 reaching the standard range by day 26. Notably, the T2 group exhibited the lowest E4/E6 ratio during the maturation phase, reflecting enhanced organic matter decomposition through microbial activity. These results confirm that our composite bacterial consortium effectively promotes more thorough compost degradation. The T2 group's Bacillus sphaericus contributed additional benefits by secreting plant growth hormones like IAA[ 21 ], accelerating seed germination rates. This explains T2's faster GI increase, achieving 80% maturity (indicating phytotoxin-free status[ 22 ]) on day 23 (the earliest attainment among all groups). The microbial inoculation appears to neutralize seed germination inhibitors while accelerating compost maturation. Furthermore, Bacillus sphaericus modulated nitrogen metabolism through multiple mechanisms: (1) suppressing ammonification of nitrogenous compounds, (2) immobilizing ammonium within the compost matrix, (3) enhancing nitrification, and (4) facilitating microbial nitrogen fixation[ 23 ]. Consequently, T2 showed optimal nitrogen speciation with minimal ammonium and maximal nitrate accumulation. 4.3 Influence of microbial additives on microbial community succession in composting As the composting progressed, all treatment groups demonstrated increasing bacterial OTU numbers across all four phases. Notably, both bacteriophage-treated groups exhibited more pronounced increases than the CK group. This enhancement primarily resulted from the added bacteriophages optimizing the composting environment through synergistic effects, directing microbial community dynamics, and accelerating the process-all of which collectively fostered microbial proliferation and diversity. This study revealed a characteristic 'high-low-high' fluctuation pattern in microbial diversity indices across all treatment groups during composting. In the warming phase, inoculated thermophilic bacteria dominated the T1 and T2 groups, extensively decomposing soluble organic matter[ 24 ]. This metabolic activity not only sustained their own proliferation but also stimulated generalized microbial growth, driving rapid diversity index elevation. The subsequent thermophilic phase saw temperature increases suppress mesophilic bacterial activity, allowing thermally-tolerant populations to dominate. As these thermophiles represent a narrower taxonomic range, their predominance reduced overall diversity - a phenomenon attributable to drastic community succession[ 25 ], with parallel observations reported in textile waste composting systems[ 26 ]. During maturation, decreasing pile temperatures reactivated mesophilic communities that utilized thermophilic-phase metabolites, ultimately restoring microbial diversity. This experiment identified four dominant phyla throughout the composting process: Bacteroidetes , Actinobacteria , Firmicutes ,and Proteobacteria , collectively representing > 85% of total microbial abundance; this distribution pattern aligns with prior research[ 27 ]. Firmicutes demonstrated the highest relative abundance in all phases except maturation, aligning with its established role as primary carbohydrate degraders[ 28 ]. Their prevalence peaked during thermophilic phases (89.51%), then sharply declined to 15.06% in maturation, reflecting intensive carbohydrate utilization during early composting and near-complete depletion by maturation. Proteobacteria , the second most abundant phylum, maintained stable distribution across all phases[ 29 ], reaching maximum abundance (46.01%-58.90%) during maturation. Meanwhile, the abundance of Chloroflexi , an important group of bacteria for decomposing difficult-to-degrade macromolecules, also increased significantly (to 11.82%-15.36%) during the humification period. The substantial presence of Proteobacteria and Chloroflexi during this phase confirms maturation as the critical period for lignocellulose decomposition, corroborating Qing's findings[ 30 ]. Bacteroidetes possess similar capabilities for decomposing both sugars and macromolecular organic matter[ 31 ]. The cellulose-rich rice husk and feather amendments in this experiment provided optimal substrates for Bacteroidetes growth. Notably, their abundance decreased significantly during the maturation phase compared to the thermophilic phases, suggesting near-complete decomposition of these macromolecules prior to maturation. The microbial community composition exhibited distinct phase-dependent shifts during composting. In the initial phase, dominant genera included Prevotella , Phascolarctobacterium , Megamonas , and Lactobacillus , while the maturation phase was characterized by Vogesella , Aeromonas , Pseudomonas , and Thauera dominance. Notably, Bacteroides reached peak abundance during the thermophilic phase, consistent with its proteolytic function in degrading readily available substrates. Pseudomonas demonstrated a characteristic progression: lowest abundance during warming, moderate increase in the thermophilic phase, and maximal levels during maturation; this pattern correlated with post-thermophilic nitrate accumulation dynamics. 4.4 Effect of microbial additives on the passivation of heavy gold during composting process Analysis of Cd speciation under different treatments revealed that OXI-Cd consistently constituted the dominant fraction. Throughout composting, OXI-Cd content progressively increased, thereby enhancing Cd immobilization. This observed increase likely stems from microbial metabolites (e.g., oxidative enzymes) generated during composting[ 32 ], which facilitate Cd ion oxidation and subsequent conversion from reduced to oxidized states. RED-Cd represented the second largest fraction but remained relatively stable across all treatments. During the thermophilic phase, T1 and T2 groups exhibited significant EX-Cd reduction concurrent with RES-Cd increase, demonstrating favorable conditions for Cd immobilization. This stabilization likely derived from dual mechanisms: (1) organic matter decomposition-induced heat and moisture loss, and (2) complexation between Cd and humic substance functional groups. Furthermore, the inoculated microbial consortia contributed through surface functional groups (carboxyl, amino, hydroxyl) that adsorbed EX-Cd, converting exchangeable fractions to cell-bound forms[ 33 ]. LSD analysis indicated significantly enhanced OXI-Cd immobilization in all treatment groups versus control (P < 0.05), despite comparable EX-Cd passivation efficiency. These results collectively demonstrate composting's effectiveness for Cd stabilization, with the T2 microbial consortium showing superior performance. 5 Conclusions In this study, chicken manure was used as the raw material for aerobic composting experiments. A composite bacterial agent—capable of promoting compost decomposition and passivating the heavy metal Cd—was screened and added to the process. The effects of this composite bacterial agent were systematically investigated, including its impact on compost decomposition parameters, bacterial community structure, and the morphological distribution of Cd. The results showed that the three strains obtained from fresh chicken manure through in situ screening, isolation, and purification performed better in promoting Cd passivation and organic decomposition when combined into a composite bacterial agent, as no antagonism was observed among them. Among the combinations tested, LB3 + LB4 and LB3 + LB4 + J-1-2 exhibited the most desirable effects, making them suitable for subsequent composting experiments. In terms of promoting compost decay, microbial agent inoculation accelerated the onset of the high-temperature phase. Among the treatments, the T1 group exhibited a prolonged high-temperature duration, complete organic matter degradation, and the lowest final C/N ratio. In contrast, the T2 group (supplemented with the nitrogen-fixing bacterium Bacillus sphaericus) significantly reduced nitrogen loss, as evidenced by the highest NO 3 − -N and lowest NH 4 + -N contents. Both composite bacterial agent treatments accelerated compost maturation. Notably, the T2 group reached 80% maturation by day 23—the earliest among all groups—and showed the lowest E4/E6 ratio, indicating more advanced humification. These results demonstrate that composite bacterial agents enhance compost quality by accelerating organic matter transformation and improving fertilisation efficiency. Regarding bacterial community structure, both T1 and T2 treatment groups showed significantly higher Ace and Chao1 indices than the control group (CK) during the thermophilic phase, while their Shannon indices were superior during the maturation phase. The dominant phyla throughout composting were Firmicutes and Proteobacteria . The composite microbial agents precisely modulated the abundance of these key phyla, altered genus-level composition, and optimized microbial ecological functions. These changes subsequently influenced material-energy metabolism, improved the composting process, and enhanced the system's overall adaptability. Regarding the passivation mechanism of Cd, the T2 treatment group showed a significant reduction in EX-Cd from 27–9%, achieving 66.6% passivation efficiency. Concurrently, the RES-Cd content increased, indicating that the fungal treatment effectively passivated the exchangeable Cd fraction. Correlation analyses revealed that Thauera were negatively correlated with EX-Cd, while synergistic associations between key Proteobacteria genera and multiple factors were identified, establishing their central roles in cadmium passivation and compost maturation. These microbial communities influence the composting process through two primary mechanisms: (1) modifying compost physicochemical properties and heavy metal speciation through metabolic secretions, and (2) reducing Cd bioavailability and mobility via ion exchange, adsorption-complexation, and precipitation. Concurrently, they participate in nutrient cycling and enzymatic regulation to optimize the composting environment, ultimately enhancing both heavy metal stabilization and compost quality. This study provides crucial microbiological evidence and innovative technical approaches for safe livestock manure composting, soil ecological protection, and sustainable agricultural development. Current limitations include the need to: (1) determine optimal inoculation parameters for Enterobacter and Bacillus to maximize cadmium immobilization, and (2) elucidate the specific biochemical mechanisms underlying cadmium immobilization in future studies. Declarations Institutional Review Board Statement Not applicable. Conflicts of Interest: The authors declare no conflicts of interest. Funding: This research received no external funding. Author Contribution Author Contributions: Conceptualization, X.M. and X.S.; methodology, W.L.; software, W.L. and J.B.; validation, W.L. and H.Y. ; formal analysis, W.L.; investigation, W.L.; resources, J.M. and X.M.; data curation, W.L. and D.X.; writing—original draft preparation, W.L.; writing—review and editing, X.M.; visualization, P.T.; supervision, R.Z.; project administration, J.L.; funding acquisition, X.M. All authors have read and agreed to the published version of the manuscript. Acknowledgement Acknowledgments: The author gratefully acknowledges the support from the 2024 Jiangsu Modern Agricultural Machinery Equipment and Technology Promotion Project (Grant No. NJ2024-32). Data Availability Statement: The original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding authors. References Wang, Y.Z.; Zhang, Y.L.; Li, J.X.; Lin, J.G.; Zhang, N.; Cao, W.Z. Biogas energy generated from livestock manure in China: Current situation and future trends. J. Environ. Manage. 2021, 297, 113324. Zhi, C.; Ruizhi, X.; Xinggui, Y. Enhanced in situ Pb(II) passivation by biotransformation into chloropyromorphite during sludge composting. [J]. Journal of hazardous materials. 2020, 408, 124973-124973. Hernández, D.; Polo, A.; Plaza, C. Long-term effects of pig slurry on barley yield and N use efficiency under semiarid Mediterranean conditions [J]. European Journal of Agronomy. 2013, 44, 78-86. Shengnan, L.; Stevy, B.O.; Shih-Hsin, H. Emerging soil contamination of antibiotics resistance bacteria (ARB) carrying genes (ARGs): New challenges for soil remediation and conservation [J]. Environmental Research. 2023, 219, 115132-115132. Asja, K.; Pauline, W.; Lauren, B. Persistence and Decay of Fecal Microbiota in Aquatic Habitats. [J]. Microbiology and molecular biology reviews : MMBR. 2019, 83 (4): Bernal, M.P.; Alburquerque, J.A.; Moral, R. Composting of animal manures and chemical criteria for compost maturity assessment. A review[J]. Bioresource Technology. 2009, 100(22): 5444-5453. Abebe, N.; Bayu, D.; Milkyas, A. Effect of microbial inoculation on nutrient turnover and lignocellulose degradation during composting: A meta-analysis [J]. Waste Management. 2021, 125,220-234. Zheng, J. R.; Luo, L.J.; Le, Z.X. Isolation and Identification of Thermostable Strains from Chicken Manure Compost: A Preliminary Application[J]. Journal of Subtropical Resources and Environment. 2021,16(3):9-16. Ansari, M.I.; Malik, A. Biosorption of nickel and cadmium by metal resistant bacterial isolates from agricultural soil irrigated with industrial wastewater[J]. Bioresource Technology. 2007, 98(16): 3149-3153. Dawoon, J.; Liwei, L.; Shan, H. Application of in situ cultivation in marine microbial resource mining [J]. Marine Life Science & Technology. 2020, 3 (2): 148-161. Mianshen, G.; Yujun, S.; Jingtao, D. New insight into the impact of moisture content and pH on dissolved organic matter and microbial dynamics during cattle manure composting [J]. Bioresource Technology. 2022, 344 (PA): 126236-126236. Taha, M.A.; Junqiu, W.; Yue,Z. Insights into enzyme activity and phosphorus conversion during kitchen waste composting utilizing phosphorus-solubilizing bacterial inoculation. [J]. Bioresource technology. 2022, 362, 127823-127823. Jain, S.M.; Jambhulkar, R.; Kalamdhad, S.A. Biochar amendment for batch composting of nitrogen rich organic waste: Effect on degradation kinetics, composting physics and nutritional properties [J]. Bioresource Technology. 2018, 253, 204-213. Vandecasteele, B.; Willekens, K.; Zwertvaegher, A. Effect of composting on the Cd, Zn and Mn content and fractionation in feedstock mixtures with wood chips from a short-rotation coppice and bark [J]. Waste Management. 2013, 33 (11): 2195-2203. Chi, Y.; Ma, X.; Chu, S. Nitrogen cycle induced by plant growth-promoting rhizobacteria drives "microbial partners" to enhance cadmium phytoremediation. [J]. Microbiome. 2025, 13 (1): 113. Arya, M.; Shahi, N.; Bisht,I. Probiotic potential of Bacillus velezensis STPB10 sourced from the gut microbiota of a hillstream fish Schizothorax richardsonii (Gray, 1832) for aquaculture applications. [J]. Scientific reports. 2025, 15 (1): 17580. Azis, A.F.; Choo, M.; Suhaimi, H. The Effect of Initial Carbon to Nitrogen Ratio on Kitchen Waste Composting Maturity [J]. Sustainability. 2023, 15 (7): Xiaorui, T.; Runyu, G.; Yage, L. Enhancing nitrogen conversion and microbial dynamics in swine manure composting process through inoculation with a microbial consortium [J]. Journal of Cleaner Production. 2023, 423. Cao, R.; Huang, Y.; Li, R. Regulation of nitrogen transformation and microbial community by inoculation during livestock manure composting. [J]. Environmental microbiology reports. 2024, 16 (2): e13256-e13256. Ozdemir, S.; Dede, G.; Dede, H.O. Composting of sewage sludge with mole cricket: stability, maturity and sanitation aspects [J]. International Journal of Environmental Science and Technology. 2019, 16 (10): 5827-5834. Kenfaoui, J.; Dutilloy, E.; Benchlih, S. Bacillus velezensis: a versatile ally in the battle against phytopathogens-insights and prospects. [J]. Applied microbiology and biotechnology. 2024, 108 (1): 439. Kong, Y.; Zhang, J.; Zhang, X. Applicability and limitation of compost maturity evaluation indicators: A review [J]. Chemical Engineering Journal. 2024, 489, 151386-. Kazutaka, K.; Akihiro, T.; Kenich, F. Application of Bacillus sp. TAT105 to reduce ammonia emissions during pilot-scale composting of swine manure. [J]. Bioscience, biotechnology, and biochemistry. 2017, 81 (12): 2400-2406. Ayodeji, B.; Abiola, O.; Sun, Y. Dynamics of fungal species related to nitrogen transformation and their network patterns during cattle manure-corn straw with biochar composting. [J]. Archives of microbiology. 2022, 204 (4): 236-236. Ilaria, F.; Antonio, F.; Ludovica, R. Thermophilic bacteria and their thermozymes in composting processes: a review [J]. Chemical and Biological Technologies in Agriculture. 2023, 10 (1): Saloua, B.; Mohammed, M.; Taisija, D. Microbial community dynamics in the mesophilic and thermophilic phases of textile waste composting identified through next-generation sequencing [J]. Scientific Reports. 2021, 11 (1): 23624-23624. Zhou, H.; Gu, W.J.; Sun, W. A microbial community snapshot of windrows from a commercial composting facility[J]. Applied Microbiology and Biotechnology. 2018, 102: 8069-8077. Awasthi, M.K.; Zhang, Z.; Wang, Q. New insight with the effects of biochar amendment on bacterial diversity as indicators of biomarkers support the thermophilic phase during sewage sludge composting[J]. Bioresource Technology. 2017, 238: 589-601. Takaku, H.; Kodaira, S.; Kimoto, A. Microbial communities in the garbage composting with rice hull as an amendment revealed by culture-dependent and independent approaches[J]. Journal of Bioscience and Bioengineering. 2006, 101(1): 42-50. Qingxin, M.; Wei, Y.; Mengqi, M. Microbial Community Succession and Response to Environmental Variables During Cow Manure and Corn Straw Composting. [J]. Frontiers in microbiology. 2019, 10 529. Pascal, L.; Vincent, L.; Elodie, D. Bacteroidetes use thousands of enzyme combinations to break down glycans. [J]. Nature communications. 2019, 10 (1): 2043. Changning, L.; Haiyun, L.; Tuo, Y. Effects of swine manure composting by microbial inoculation: Heavy metal fractions, humic substances, and bacterial community metabolism [J]. Journal of Hazardous Materials. 2021, 415, 125559-125559. Zhu, G.; Wang, X.; Du, R. Adsorption of Cd2+ by Lactobacillus plantarum Immobilized on Distiller’s Grains Biochar: Mechanism and Action [J]. Microorganisms. 2024, 12 (7): 1406-1406. Additional Declarations No competing interests reported. Supplementary Files Supplementalmaterials.docx Cite Share Download PDF Status: Published Journal Publication published 16 Oct, 2025 Read the published version in International Microbiology → Version 1 posted Editorial decision: Revision requested 09 Sep, 2025 Reviews received at journal 08 Sep, 2025 Reviews received at journal 08 Sep, 2025 Reviewers agreed at journal 30 Aug, 2025 Reviewers agreed at journal 30 Aug, 2025 Reviewers invited by journal 27 Aug, 2025 Editor assigned by journal 27 Aug, 2025 Submission checks completed at journal 14 Aug, 2025 First submitted to journal 13 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7361044","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":507940113,"identity":"13ab4e2f-8e42-4c20-9f3d-3a6c55700a9b","order_by":0,"name":"Xinyu Mao","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1ElEQVRIiWNgGAWjYHACxgcfDP7bsbE3Nj78QKQWZsMZFczJfDyHm40liNTCJs1zhplxnkR6mwAPMep1Z+QYG85sY2Nmk3zYxiDBYCen20BAi9mZM4YPPrbx8LFJJ7Y9KGBINjY7QEjL8R6QLRLMQC3tBhIMBxK3EdRymMdMmrfNgLFN8mCbBA9RWo73mAG9n8DYJsFIrJYzx4qBgXwgmY0nERjIBsT45UbyRmBUHrCTbz/+8OGHCjs5gloYGDgMkDgGOJUhA/YHRCkbBaNgFIyCEQwAArVCmfLRHxIAAAAASUVORK5CYII=","orcid":"","institution":"Hohai University","correspondingAuthor":true,"prefix":"","firstName":"Xinyu","middleName":"","lastName":"Mao","suffix":""},{"id":507940114,"identity":"235b862d-bfc0-4ccc-a377-1f1abfedf65f","order_by":1,"name":"Wei Li","email":"","orcid":"","institution":"Hohai University","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Li","suffix":""},{"id":507940115,"identity":"11b5d2c7-0876-42e4-97a1-59b17dec5170","order_by":2,"name":"Daling Xu","email":"","orcid":"","institution":"Nanjing Agricultural Equipment Extension Center","correspondingAuthor":false,"prefix":"","firstName":"Daling","middleName":"","lastName":"Xu","suffix":""},{"id":507940116,"identity":"e2dbc284-e800-42e3-9526-b0bf50bddf9b","order_by":3,"name":"Jianhong Ma","email":"","orcid":"","institution":"Nanjing Agricultural Equipment Extension Center","correspondingAuthor":false,"prefix":"","firstName":"Jianhong","middleName":"","lastName":"Ma","suffix":""},{"id":507940117,"identity":"2370b9f0-1b68-488d-b207-53fe2affb8bf","order_by":4,"name":"Rui Zhao","email":"","orcid":"","institution":"Hohai University","correspondingAuthor":false,"prefix":"","firstName":"Rui","middleName":"","lastName":"Zhao","suffix":""},{"id":507940118,"identity":"71a0cf6e-c978-404e-a4cf-6dc9b3535324","order_by":5,"name":"Junan Bao","email":"","orcid":"","institution":"Hohai University","correspondingAuthor":false,"prefix":"","firstName":"Junan","middleName":"","lastName":"Bao","suffix":""},{"id":507940119,"identity":"2bf516c3-a411-4a3e-87e9-7933f53851d0","order_by":6,"name":"Pengbin Tang","email":"","orcid":"","institution":"Hohai University","correspondingAuthor":false,"prefix":"","firstName":"Pengbin","middleName":"","lastName":"Tang","suffix":""},{"id":507940120,"identity":"d9ee9809-dfcd-4ea9-adfc-d283d9d067a9","order_by":7,"name":"Jiaqi Liu","email":"","orcid":"","institution":"Hohai University","correspondingAuthor":false,"prefix":"","firstName":"Jiaqi","middleName":"","lastName":"Liu","suffix":""},{"id":507940121,"identity":"031e02f8-c68e-4214-9beb-02fe22edb78d","order_by":8,"name":"Huaizhi Yu","email":"","orcid":"","institution":"Hohai University","correspondingAuthor":false,"prefix":"","firstName":"Huaizhi","middleName":"","lastName":"Yu","suffix":""},{"id":507940122,"identity":"5da454c1-3a63-419c-8e28-f04c281f9aa2","order_by":9,"name":"Xiaohou Shao","email":"","orcid":"","institution":"Hohai University","correspondingAuthor":false,"prefix":"","firstName":"Xiaohou","middleName":"","lastName":"Shao","suffix":""}],"badges":[],"createdAt":"2025-08-13 05:38:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7361044/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7361044/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s10123-025-00730-y","type":"published","date":"2025-10-16T15:56:51+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":90510421,"identity":"22571a80-3f2f-44eb-8a7e-4d93fe1341dd","added_by":"auto","created_at":"2025-09-03 13:24:28","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":203653,"visible":true,"origin":"","legend":"\u003cp\u003ePreparation of specific culture media\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/901c275d8030a96dc4a0bb09.png"},{"id":90510483,"identity":"f2f614bc-4375-4b99-9a4b-a5744530707e","added_by":"auto","created_at":"2025-09-03 13:24:32","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":294446,"visible":true,"origin":"","legend":"\u003cp\u003ePreparation and preservation of microorganisms promoting Cd passivation\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/f7d24790fb17c93653407bc6.png"},{"id":90510440,"identity":"449f4622-a792-4c29-bf35-a1809282270c","added_by":"auto","created_at":"2025-09-03 13:24:30","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1175725,"visible":true,"origin":"","legend":"\u003cp\u003eDisplays colony morphology of the isolated strains on different culture media: (a) Strain 1 (LB1); (b) Strain 2 (LB2); (c) Strain 3 (LB3); (d) Strain 4 (LB4); (e) Strain 5 (LB5); (f) Strain 6 (J-1-1); (g) Strain 7 (J-1-2); (h) Strain 8 (J-2-1); (i) Strain 9 (J-2-4); (j) Strain 10 (MR1); (k) Strain 11 (F1); and (l) Strain 12 (F2).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/2f8f8030199ba2eff760c3b2.png"},{"id":90510425,"identity":"5fd5f793-0c81-4330-b536-09369695cfa1","added_by":"auto","created_at":"2025-09-03 13:24:29","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":210295,"visible":true,"origin":"","legend":"\u003cp\u003ePCR electrophoresis of 12 strains\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/9864ce136022af7383d864ac.png"},{"id":90510495,"identity":"a9c391b7-bb4f-4f19-9a0b-43278827ec46","added_by":"auto","created_at":"2025-09-03 13:24:33","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":248247,"visible":true,"origin":"","legend":"\u003cp\u003eGene phylogenetic tree of 12 strains\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/1badd4c8b079723e91085aea.png"},{"id":90510423,"identity":"3c1cd934-95b7-45aa-8545-4e0acc2c13dc","added_by":"auto","created_at":"2025-09-03 13:24:28","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":84605,"visible":true,"origin":"","legend":"\u003cp\u003eThe effects of individual bacterial strains on Cd passivation and humification promotion\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/29695aa72a030f1712e8cc62.png"},{"id":90510484,"identity":"7a23e887-ed3b-4e09-89fc-fc1eff726f63","added_by":"auto","created_at":"2025-09-03 13:24:32","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":345685,"visible":true,"origin":"","legend":"\u003cp\u003eLB3, LB4 and J-1-2 antagonism experiments\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eNote:\u003c/strong\u003e Each Petri dish contains four Oxford cups - one filled with sterile water (negative control) and the other three containing replicate aliquots of the bacterial suspension.\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/49de0f7d4244e8e2a28c4735.png"},{"id":90510433,"identity":"803a9cdc-54e7-40d6-a753-ab8809f02c17","added_by":"auto","created_at":"2025-09-03 13:24:29","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":55980,"visible":true,"origin":"","legend":"\u003cp\u003eGrowth curves of three functional strains\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/35675a2311fd77deebcada1c.png"},{"id":90510781,"identity":"ab978c69-b5b1-4f99-9d13-e47babdb63ff","added_by":"auto","created_at":"2025-09-03 13:32:30","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":74460,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of compound microbial agents on Cd passivation and humification promotion\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/54c7b92013f897111cc56b49.png"},{"id":90510498,"identity":"84720892-ee6e-4611-96c4-9953edfb0af2","added_by":"auto","created_at":"2025-09-03 13:24:33","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":178333,"visible":true,"origin":"","legend":"\u003cp\u003eChanges in decay indicators during composting\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/539da938b50d9ee007d55e47.png"},{"id":90512106,"identity":"29f01702-c0cc-492a-b607-686dbbb1a1b9","added_by":"auto","created_at":"2025-09-03 13:48:32","extension":"png","order_by":11,"title":"Figure 11","display":"","copyAsset":false,"role":"figure","size":142084,"visible":true,"origin":"","legend":"\u003cp\u003eDifferential changes in bacterial species: (a)Venn diagram of bacterial community in different periods of chicken manure composting; (b)Bacterial dilution profiles during composting of chicken manure; (c)Analysis of structural principal coordinates of bacterial species composition in samples from different time periods\u003c/p\u003e","description":"","filename":"11.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/4cbe1e73ee6c10d248674593.png"},{"id":90510437,"identity":"191433cd-61f1-41c9-a109-719396c2f0c8","added_by":"auto","created_at":"2025-09-03 13:24:29","extension":"png","order_by":12,"title":"Figure 12","display":"","copyAsset":false,"role":"figure","size":89719,"visible":true,"origin":"","legend":"\u003cp\u003eComposition (phylum) of bacterial communities in compost samples at different times\u003c/p\u003e","description":"","filename":"12.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/005f65f6bd577f4585b16885.png"},{"id":90511815,"identity":"163a4656-8482-41b6-9a8d-318bdb685720","added_by":"auto","created_at":"2025-09-03 13:40:32","extension":"png","order_by":13,"title":"Figure 13","display":"","copyAsset":false,"role":"figure","size":177404,"visible":true,"origin":"","legend":"\u003cp\u003eBacterial families with abundance greater than 1% during chicken manure composting\u003c/p\u003e","description":"","filename":"13.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/9c2d8cedc3a08ad034317fc1.png"},{"id":90510462,"identity":"f897a7d0-57ff-424f-bad5-f4e7a8f36500","added_by":"auto","created_at":"2025-09-03 13:24:30","extension":"png","order_by":14,"title":"Figure 14","display":"","copyAsset":false,"role":"figure","size":97401,"visible":true,"origin":"","legend":"\u003cp\u003eComposition of bacterial community at the genus level in different samples at different times\u003c/p\u003e","description":"","filename":"14.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/a290456a1edcaa02a38667ae.png"},{"id":90510452,"identity":"ab967a46-23a1-4dfb-a9f2-b8f5dd330617","added_by":"auto","created_at":"2025-09-03 13:24:30","extension":"png","order_by":15,"title":"Figure 15","display":"","copyAsset":false,"role":"figure","size":96817,"visible":true,"origin":"","legend":"\u003cp\u003eChanges of heavy metal Cd concentration during chicken manure composting\u003c/p\u003e","description":"","filename":"15.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/92dd647f1834d933fee38bee.png"},{"id":90510430,"identity":"2b181ec9-d8c5-4c83-9b51-347d2b00da43","added_by":"auto","created_at":"2025-09-03 13:24:29","extension":"png","order_by":16,"title":"Figure 16","display":"","copyAsset":false,"role":"figure","size":137263,"visible":true,"origin":"","legend":"\u003cp\u003eChanges in the distribution of various forms of heavy metal Cd under different treatments\u003c/p\u003e","description":"","filename":"16.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/7c3103c7e5e34dd7187e605d.png"},{"id":90510778,"identity":"e46657af-bd08-440a-995d-88d7a084425e","added_by":"auto","created_at":"2025-09-03 13:32:29","extension":"png","order_by":17,"title":"Figure 17","display":"","copyAsset":false,"role":"figure","size":170542,"visible":true,"origin":"","legend":"\u003cp\u003eHeat map of the correlation between main bacterial communities and environmental parameters under different treatments (a, b, c)\u003c/p\u003e","description":"","filename":"17.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/6f6c486530c606e2832e6f6a.png"},{"id":90510785,"identity":"6bf45684-c4f1-4927-bd65-f99c4a8b1eba","added_by":"auto","created_at":"2025-09-03 13:32:30","extension":"png","order_by":18,"title":"Figure 18","display":"","copyAsset":false,"role":"figure","size":268296,"visible":true,"origin":"","legend":"\u003cp\u003eCorrelation and Mantel analysis of bacterial community and environmental parameters in different treatments(a, b, c)\u003c/p\u003e","description":"","filename":"18.png","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/68e913acb798c242e13e0e35.png"},{"id":93955813,"identity":"a27368c6-381e-470d-a283-81d129282455","added_by":"auto","created_at":"2025-10-20 16:03:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":6496168,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/26f7a6ba-c3b4-4ecd-936e-6de82d882afd.pdf"},{"id":90510803,"identity":"0a7abfe7-7475-4144-9eee-2d35c00a9ce6","added_by":"auto","created_at":"2025-09-03 13:32:33","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1274600,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementalmaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-7361044/v1/b4b4189cd824706d0f78ea14.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Mechanisms of Enterobacter and Bacillus in promoting aerobic composting and immobilization of Cd in livestock and poultry manure","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eWith China's rapid economic development and continuous optimization of rural industrial structures, livestock and poultry farming has become a cornerstone of the national economy. However, its rapid expansion also poses significant threats to agro-ecological environments. For instance, in 2017 China generated 2\u0026times;10\u003csup\u003e12\u003c/sup\u003e kg of livestock manure, with pig manure constituting the largest proportion[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Improper or untimely manure management not only causes environmental pollution but also leads to the wastage of its valuable nutrient resources. Aerobic composting, as an environmentally friendly treatment technology, can achieve harmless, volume-reduced, and resource-recovered utilization of manure[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. However, several challenges remain. Suboptimal environmental conditions and process parameters during composting may result in insufficient humification, and the application of immature compost can be detrimental to both soil and plants. Furthermore, inappropriate allocation of livestock manure during field application may induce soil crusting and salinization[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], diminishing fertilizer efficacy and crop growth. Of particular concern is the long-term accumulation of residual heavy metals and antibiotics in soils and crops, which ultimately threatens agricultural productivity, crop quality, and human health. These issues underscore the critical need for improving composting efficiency in livestock manure treatment systems. Previous studies have demonstrated that microbial agent inoculation can effectively accelerate compost maturation[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], enhance organic matter conversion efficiency, improve nitrogen fixation capacity[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], and reduce the overall composting duration.\u003c/p\u003e\u003cp\u003eIn recent years, extensive research has been conducted domestically and internationally on improving aerobic composting efficiency through microbial agent application. Bemal et al.[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]demonstrated that microbial agent inoculation enhances the decomposition efficiency of livestock manure. Abebe et al.[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]further revealed that microbial agents not only accelerate organic matter degradation and reduce composting duration, but also exhibit nitrogen-fixing capacity. Regarding functional strain screening, Zheng et al.[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]isolated five Bacillus spp. strains from chicken manure that promote compost decomposition, demonstrating their effectiveness in enhancing organic matter degradation efficiency. Meanwhile, Ansari et al.[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]successfully screened Escherichia coli strains with Cd\u003csup\u003e2+\u003c/sup\u003e passivation capability from polluted irrigated soils. Although numerous functional strains have been obtained through microbial in situ screening in domestic and international research, highly efficient composite strains with synergistic effects remain scarce, particularly those capable of simultaneously promoting compost maturation and passivating heavy metals. In this study, we employed in situ screening coupled with purification techniques to obtain composite strains exhibiting these dual functions. The in situ screening approach preserves microbial original characteristics and maintains ecological balance within microbial communities, thereby ensuring synergistic effects between functional strains and environmental microorganisms[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Concurrently, isolation and purification techniques enable precise identification of microbial functional traits and elucidation of their mechanisms, while eliminating interference from non-target microorganisms. This integrated technical approach provides an innovative strategy for addressing both compost maturation efficiency and heavy metal pollution challenges.\u003c/p\u003e\u003cp\u003eBased on the current situation, the present study used chicken manure as a raw material and employed in situ screening and isolation purification techniques to obtain composite bacterial agents capable of promoting compost humification and passivating heavy metal Cd. These agents were then applied in aerobic composting experiments. The study hypothesized that \u003cem\u003eEnterobacteriaceae\u003c/em\u003e and \u003cem\u003eBacillus\u003c/em\u003e sp. could enhance the humification process of aerobic composting while improving the passivation efficiency of heavy metal Cd. To test this, the effect of in situ screening and isolation of Cd-resistant strains was first preliminarily verified. Subsequently, the target strains were inoculated into the composting system to systematically monitor dynamic changes in decomposition parameters, the morphology and distribution of heavy metal Cd, and microbial community succession during composting. This allowed for an investigation into how the composite bacterial agents influenced the transformation of compost material, the speciation and distribution of heavy metal Cd, and the structure of the microbial community. By analyzing the interrelationships among heavy metal Cd passivation, microbial community succession, and the decomposition process, the study elucidated the mechanism by which the functional bacterial strains affect the bioefficacy of heavy metal Cd. The results provide an important theoretical and practical basis for improving aerobic composting technology and promoting the resource utilization of livestock and poultry manure.\u003c/p\u003e"},{"header":"2 Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003e2.1 In situ screening and performance characterisation of Cd-passivating bacterial strains\u003c/h2\u003e\u003cdiv id=\"Sec4\" class=\"Section3\"\u003e\u003ch2\u003e2.1.1 Screening of functional strains\u003c/h2\u003e\u003cp\u003e\u003cem\u003e(1)Preparation of specific culture media\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe selective basal media for bacteria, fungi, and actinomycetes were prepared following modified formulations of LB medium, Martin medium, and Gause's No.1 medium, respectively. The specific procedure was as follows(Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e): Each medium component was mixed with an appropriate amount of distilled water and poured into a conical flask. The liquid volume did not exceed half of the flask\u0026rsquo;s total capacity, and the flask mouth was sealed with sealing film. Subsequently, the medium was sterilized in an autoclave at 121\u0026deg;C for 20 minutes. After sterilization, it was transferred to an ultra-clean bench for cooling and aseptic treatment. The UV lamp was turned on to sterilize the workbench for 20 minutes. Once the medium temperature dropped to a suitable range, it was poured into plates (20-25 mL per dish, 9 cm diameter) and labeled. The plates were inverted and left at room temperature for 2།3 hours to solidify completely. Notably, 30 mg/L cadmium sulfate was added during preparation for screening Cd-resistant microorganisms.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003e(2)Primary screening of Cd-resistant microorganisms\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe gradient dilution method was used to isolate, purify, and screen for cadmium-resistant microorganisms from fresh chicken manure samples. The experimental procedure was as follows: First, 10 g of fresh chicken manure was weighed into a sterile bag, transferred to a sterilized triangular flask, mixed with 90 mL of sterile water, and shaken at 180 rpm for 30 min. The mixture was left to stand for 30 min to prepare the suspension. Next, 100 uL of the supernatant was serially diluted (10-fold increments) with saline to a final concentration of 10\u0026thinsp;\u0026minus;\u0026thinsp;6. For each dilution, 100 uL was spread evenly on the corresponding medium plate. All operations were performed near an alcohol lamp in the ultra-clean bench to maintain sterility. The plates were inverted and incubated at 37\u0026deg;C for 1-2 days. Three replicates were prepared per dilution. After colony formation, distinct single colonies were selected based on morphology and streaked repeatedly (3།4 times) to obtain pure cultures. These cultures were then inoculated into medium containing 30 mg/L cadmium sulfate and incubated at 40\u0026deg;C and 50\u0026deg;C for 1།2 days. Strains showing growth under these conditions were preliminarily identified as cadmium-resistant.\u003c/p\u003e\u003cp\u003e\u003cem\u003e(3)Secondary screening of Cd-passivating microorganisms\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe microorganisms screened in the previous step for heavy metal Cd tolerance were inoculated into fresh chicken manure at a 5% (w/w) inoculation rate. Rice husk was added proportionally, and the mixture was placed in 2 L containers for small-scale fermentation at room temperature for 25 days. A control group (with an equal amount of sterile water instead of inoculum) was included, and all treatments were performed in triplicate. Samples were collected on days 0 and 25 of fermentation to determine the weakly acid-extractable Cd content and calculate the passivation rate. The data were compared to identify strains with superior Cd passivation effects. The equation used to calculate the passivation rate is presented in Eq.\u0026nbsp;(1).\u003c/p\u003e\u003cp\u003eP=(B-A)/B\u0026times;100% (1)\u003c/p\u003e\u003cp\u003eIn Eq.\u0026nbsp;(1), P denotes the passivation rate, B signifies the rate of pre-heap allocation, and A characterizes the rate of post-heap allocation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec5\" class=\"Section3\"\u003e\u003ch2\u003e2.1.2 Identification of functional strains\u003c/h2\u003e\u003cp\u003e\u003cem\u003e(1)Morphological identification\u003c/em\u003e\u003c/p\u003e\u003cp\u003eMicroorganisms demonstrating Cd passivation potential were subjected to secondary incubation. When visible colonies formed, they were photographed and documented.\u003c/p\u003e\u003cp\u003e\u003cem\u003e(2)Molecular identification\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe PCR technique was used to amplify the target sequence. The primers for the 16S rDNA gene sequence of the bacteria were provided by Shanghai Meiji Biomedical Technology Co., Ltd., with the forward and reverse primer pairs being 27F (AGAGTTTGATCCTGGCTGGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT), respectively. The reagents and amplification steps are detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eReagents for PCR amplification\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eReagent\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eVolume\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e10*Ex Taq buffer\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e2.0\u0026micro;L\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e5u Ex Taq\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.2\u0026micro;L\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e2.5mM dNTP Mix\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1.6\u0026micro;L\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e5p Primer 1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1\u0026micro;L\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003e5p Primer 2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e1\u0026micro;L\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eDNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.5\u0026micro;L\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003edd H\u003csub\u003e2\u003c/sub\u003eO\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e13.7\u0026micro;L\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTotal volume\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e20\u0026micro;L\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eThe amplification protocol consisted of 25 cycles with the following thermal profile: initial denaturation at 95\u0026deg;C for 5 min, followed by cyclic denaturation at 95\u0026deg;C for 30 s, annealing at 56\u0026deg;C for 30 s, and extension at 72\u0026deg;C for 60 s, with a final extension at 72\u0026deg;C for 10 min. PCR products were then analyzed for concentration and purity using agarose gel electrophoresis. The purified amplicons were subjected to DNA sequencing, and the resulting sequences were compared against the GenBank database using the BLAST tool from NCBI (National Center for Biotechnology Information) to identify homologous sequences. Phylogenetic analysis was performed using MEGA 7.0 software to construct and evaluate evolutionary trees.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec6\" class=\"Section3\"\u003e\u003ch2\u003e2.1.3 Selection of functional strains and preparation of composite bacterial agents\u003c/h2\u003e\u003cp\u003e\u003cem\u003e(1)Studies on the putrefactive capacity of Cd-resistant strains of bacteria\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe Cd-passivation-promoting strains were selected for small-scale fermentation tests. The E4/E6 ratio of chicken manure was measured before and after fermentation. Strains demonstrating both cadmium tolerance and organic matter decomposition capacity were identified as the dominant microorganisms.\u003c/p\u003e\u003cp\u003e\u003cem\u003e(2)Strain antagonism test\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe Oxford cup method was employed to investigate antagonistic effects among Cd-resistant strains exhibiting enhanced organic matter decomposition capacity. The experimental procedure consisted of the following steps: (1) The test strains were uniformly spread on the culture medium using the spread plate technique and allowed to solidify. (2) Sterilized Oxford cups (four per plate) were placed on the inoculated medium, followed by addition of different bacterial suspensions into individual cups. Each treatment was performed in triplicate, with sterile water serving as the control. (3) After incubation at constant temperature, the plates were examined for inhibition zone formation. The presence of clear zones indicated strain antagonism, while their absence suggested no antagonistic interaction.\u003c/p\u003e\u003cp\u003e\u003cem\u003e(3)Plotting of strain growth curves\u003c/em\u003e\u003c/p\u003e\u003cp\u003eAs the bacteria have certain shading to light, the more the bacteria multiply, the stronger their shading, so the optical density value of the liquid can be measured to respond to the quantity status of the bacteria. The specific steps are as follows: (1) activation culture: use a pipette gun to accurately transfer 200 uL of the bacterial liquid value of the conical flasks containing 200 mL of liquid medium, in the constant temperature incubation shaker for 24 h (speed of 180 r/min), every 4 h to take a sample of 60 uL to determine the absorbance value of its OD\u003csub\u003e600\u003c/sub\u003e nm. (2) Determination of absorbance: transfer the aspirated bacterial solution to a cuvette and measure it at a wavelength of 600 nm, and take the average value for three times. (3) Drawing of growth curve: the growth curve of the bacterium was drawn, the Y-axis was the measured value of OD\u003csub\u003e600\u003c/sub\u003e nm, and the X-axis was the length of the incubation time to observe the logarithmic and stable periods of microbial growth.\u003c/p\u003e\u003cp\u003e\u003cem\u003e(4)Preparation of composite fungicide\u003c/em\u003e\u003c/p\u003e\u003cp\u003eStrains that were not antagonistic to each other were combined to form a composite colony, with a 1:1 mixing ratio.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec7\" class=\"Section3\"\u003e\u003ch2\u003e2.1.4. Preservation of strains\u003c/h2\u003e\u003cp\u003eA 50% (v/v) glycerol solution was prepared by mixing 50 mL of glycerol with 50 mL of distilled water. Following autoclave sterilization, 1 mL of bacterial culture in logarithmic growth phase was aseptically mixed with 1 mL of the sterile 50% glycerol solution. The mixture was then aliquoted into cryovials and stored at -70\u0026deg;C for long-term preservation(Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003e2.2 Aerobic Composting of Livestock Manure and Determination of Related Physicochemical Parameters Experiment\u003c/h2\u003e\u003cdiv id=\"Sec9\" class=\"Section3\"\u003e\u003ch2\u003e2.2.1 Composting materials\u003c/h2\u003e\u003cp\u003eThe 35-day experiment was conducted in a greenhouse at the Nanjing Animal Husbandry Science Research Institute (geographic coordinates: 118\u0026deg;94\u0026prime;E, 31\u0026deg;90\u0026prime;N). Fresh chicken manure was collected from the institute's poultry farm, while rice husks were obtained from the Agricultural By-Products Storage Facility of the same institute. The physicochemical characteristics of these raw materials are presented in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePhysical and chemical properties of composting materials\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"13\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c9\" colnum=\"9\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c10\" colnum=\"10\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c11\" colnum=\"11\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c12\" colnum=\"12\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c13\" colnum=\"13\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMaterial\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c3\" namest=\"c2\"\u003e\u003cp\u003eMoisture content(%)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eTotal organic carbon(g/kg)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eTotal nitrogen(g/kg)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c7\" namest=\"c6\"\u003e\u003cp\u003eC/N\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"2\" nameend=\"c9\" namest=\"c8\"\u003e\u003cp\u003eNitrate nitrogen (mg/kg)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c10\"\u003e\u003cp\u003eAmmonium nitrogen (mg/kg)\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colspan=\"3\" nameend=\"c13\" namest=\"c11\"\u003e\u003cp\u003epH\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eFowl dung\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e75.34\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e335\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003e16.8\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c8\" namest=\"c7\"\u003e\u003cp\u003e19.94\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u003cp\u003e689\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c11\" namest=\"c10\"\u003e\u003cp\u003e145\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c13\" namest=\"c12\"\u003e\u003cp\u003e6.8\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eRice hull\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e10.11\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c4\" namest=\"c3\"\u003e\u003cp\u003e451\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c6\" namest=\"c5\"\u003e\u003cp\u003e10.1\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"2\" nameend=\"c8\" namest=\"c7\"\u003e\u003cp\u003e44.65\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c9\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colspan=\"3\" nameend=\"c12\" namest=\"c10\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c13\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec10\" class=\"Section3\"\u003e\u003ch2\u003e2.2.2 Experimental design\u003c/h2\u003e\u003cp\u003eA foam box measuring 59\u0026times;39\u0026times;35 cm was selected as the aerobic composting device for the experiment. Chicken manure and rice husk were used as composting raw materials in a ratio of 7:3, with an adjusted moisture content of 60%, a carbon-to-nitrogen ratio of 25:1, and a turning frequency of every 5 days. The experimental group was prepared based on the amount of composite bacterial inoculant added, while the control group was treated with an equal amount of sterile water. All treatments were performed in triplicate. Sampling was conducted every 2 days using the five-point sampling method. From each treatment, 100 g of sample was collected using a sterile sampling bag and divided into two portions: one for determining pH, moisture content, nitrate nitrogen, ammonium nitrogen, C/N ratio, and Cd speciation, and the other for 16S rDNA analysis. Samples taken on days 0, 3, 8, and 33 were designated as representative samples of the initial (0), heating (S), thermophilic (G), and maturity (J) phases of composting, respectively.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section3\"\u003e\u003ch2\u003e2.2.3 Determination of physical and chemical parameters of composting\u003c/h2\u003e\u003cp\u003eThe thermometer was inserted one-third from the top of the pile, and the temperature was recorded daily at 10 a.m. and 4 p.m., with the average value used as the measured temperature. For pH determination, 5 g of compost sample was mixed with 50 mL of distilled water, shaken at 25\u0026deg;C and 180 rpm for 30 min, filtered, and allowed to stand for 1 h before measurement using a pH meter. To determine moisture content, 50 g of fresh compost samples were weighed and dried in an oven at 105\u0026deg;C for 4 h. Total organic carbon and total nitrogen were analyzed following national standard methods, and the carbon-to-nitrogen ratio was subsequently calculated. NH\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e-N was determined using Cui Lanying's method, while NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N was analyzed following the national standard NY/T 1116\u0026ndash;2014. Absorbance values were measured at wavelengths of 465 nm and 665 nm using a cuvette, and the E4/E6 ratio was calculated. For the germination assay, compost samples were mixed with distilled water at a 1:10 ratio, shaken for 20 min, and allowed to stand for 24 h. After removing debris and precipitates by slow filtration, the filtrate was spread evenly on a 9 cm petri dish, with 5 mL of extract added to each. A control group containing the same volume of distilled water was prepared in parallel. Twenty uniform-sized cabbage seeds were placed in each petri dish, with three replicates per treatment. After 48 h, root length and germination count were recorded, and the germination index (GI) was calculated using Formula (2).\u003c/p\u003e\u003cp\u003e\u003cimg src=\"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAqQAAABVCAYAAACfF/Y8AAAAAXNSR0IArs4c6QAAAARnQU1BAACxjwv8YQUAAAAJcEhZcwAAFiUAABYlAUlSJPAAAB6LSURBVHhe7d1BbBNX/gfwr/9npxycQ0N2JbAbUC9dUpRI7VK1i9PdoLC7qCollSpTiU1WkEoFOwWqHhK6h5YShxy6rIq9EiWr2itWqla2S1ciCKVoVyoiDr1hE4vDJs6hPlDP/f0PmzeaeZ7xPCdOnJDvR/IhM2/ee/ObN/bLzHszPiGEABERERFRi/yfuoCIiIiIaCOxQ0pERERELcUOKRERERG1FDukRERERNRS7JASERERUUuxQ0pERERELcUOKRERERG1FDukRERERNRS7JASERERUUuxQ0pERERELcUOKRERERG1FDukRERERNRS7JASERERUUuxQ7oJffPNN+jt7UU8HldXbWrFYhHDw8Po7e1FuVxWV7eEYRiIxWIbWqd8Po/e3l74fD60t7cjnU6rSepqRZ1pa4jFYgiFQigWi+qqddOKMjcTwzBw+fJltLe3I5vNqquJqEnYIVUUi0WzM+Hz+TA8PIxisYgLFy5sSOcgHo9jYGAA9+7dU1dtauVyGf39/UgkEqhUKurqlhkZGcHk5OSG1Smfz2NwcBBffPEFqtUq3njjDSSTSRiGoSZ1tdF1JiJ3IyMjiEajPB+J1hk7pBb5fB4vvfQSXnnlFVSrVQghcPDgQbz00ku4fv26mnxdxGIxzM3NIRAIqKtayqtD3tHRgYWFBUQiEXXVhrPW9csvv9zQOt2+fRs///nP0dXVBb/fj6tXr+LWrVvw+/1qUptW1nmtvNrGemlVua0Uj8exsLCArq4udVVTOMV0vcvc7L788ktMTEyoi4moydghtZiamsKOHTswOjpqdiAGBwdx7do1Nem2ks/nkcvl1MWbUivrahgGbt68qS721Mo6r1Wr6t6qcp9mjCkRtRI7pCsMw8Di4iKePHmC5eVl27rXXnsN4XDYtmy7MAwDH3zwwZa4XbWV6iptxTpLraq7brnJZNJ1zF86nUYymVQXb1u6MSUiWi/skK7w+/04dOgQKpUKXn/9dXzzzTe2dZ2dnbb0UCavyPGm6lhBnTTWcas6E1nkIPu9e/cim80imUyivb0dfX19Zt7FYhGHDh0yy+3t7UU+n1ezqpvOMAwcOXIEMzMzKJVK2LlzJ9rb2x3z8VIvDnJ/ent7USwWEYvFaupiTdfe3u6Yh1ddjZXJQk55e6kXJwDIZrNoa2vDzMwMZmZm0NbWhlAoVPdYNqPO9eLqxW3bfD5vxtjn86Gvrw/FYhGhUMhclk6nHev+3Xff1W2b1v2Rn1gsVlNnp7HccnunctW4YOXuxvT0dM26bDaLjz76CAMDA7bl8GhjVm6xs+bhFIPl5WXXtl4ul235qmU7TRqUZTnl59aO1LjXi6lTmZLXOWGlW08nXtsahoG+vj74fD7znCuXy2Z7tbY9t3y8Ym+tizWOTm13tW1DzYdo2xFkqlarIhwOCwACgOjv7xeFQkFNJoQQIpPJ2NbncjkRCAREOBwW1WpVO83c3JwIBAJiYmJCCCFEoVAQPT09AoC5TBWJRMw6jo6OitnZWTExMSGCwaBYWlqqm2cmkzHz0U0XiUTMvL04pfWKg9yfQCAgJicnRbVaNesWiUTMfCYmJkQgEBBzc3O27QDY8lLLj0QinnnXoxsn2X6sx1fHauvsFdd6vLa1ngtyHzOZjAgEAiKXy5n5qHX3apsyvSx3YmKipq1nMhmxZ88esxy579b9Ust1U61WxVtvvSXm5uaEWMnbWr5Kp415xa5eDPr6+lzb+rFjx8x9TqVStrgsLS2JYDAoADjG2yk/a1vRibsaU7cyRQPnhKRbTyc628r2aq1noVAQwWCw5rg45VMv9sISr6GhoZoYNnJO1msbXm2Z6GnHDqmiWq2KyclJEQgEzC8O65eQTGP9kZMiK50I+WOmkyYcDtd8IWcymZovRJVbGpmn2imRX7zyi083nXD4oapHTasTB7ftrPWTP47WWMm6enWe1WVq3vW4pXWKk1taL2r9nJapeevG1YnutjLmgUBA/P3vfxfHjh2raQNqPUWDbdOtY2Hdtlqtimg0KsLh8Kra5NLSkjh27JhIJBJ1/8nUaWO6sXOLgUxrrXu9ctXt1W2dlqlxVv8WDnF3ysdtuVN+wuWcsNLNx4nOtqtJoxt72flUO9vW496MtkG0nfGWvcLv9+PMmTP4z3/+g6GhIQBAIpFAf3+/ecuqWCxiZmYGL774ou0W2PXr11GpVLC4uKidZn5+Hi+88IKtDp2dndqz7Pfu3Wv7W+bZ2dlpm9nd1dWFffv2mWNkddOtlU4cdLS1tWH37t1YXFysubX18OFD29/NtFFxatRa4qq7bUdHB/7xj38AAE6dOoVz586ho6NDyc2d2jb9fj9u3bqFW7duAQAuX76M119/3TZuUcbbuq3f70c8HsetW7caKl/q6OjAkSNHcOnSJYyMjLjOFtdpY7qxk9QYOKlXbjPoxL0Rm/WcWI21xv7o0aMNfedb6bQNou2EHVIL6yNPurq6cPXqVRQKBfT09KBUKuH8+fNm2kAggLm5OaxcZbZ9Dh8+rJVmcXERlUqlqV9MMk+VHAcrvxh10zWDVxx0+P1+nD59GvPz8+ZEldu3bzc9fqqNjFOj1hJX3W27u7tx/PhxVCoV3L5925bHasgxeLt27QIAfP3117Z/vtzivRb5fB5jY2M4e/YspqenXTseum1MN3abiVfcG+F2jDbDOdFqW7FtEG0W7JBa/PTTTzX/2Xd1deGf//wngsGg7b9onR9onTRo8hU+eXXV7T/+QCCAzs5O7XTNoBsHL4cPH8bx48cxNjYGn8+HTz75BKlUal2/6DcyTo1aS1x1t83n83jmmWcwPj6O0dFR11nrOoyVyTMPHjzA48ePcebMGdsVNljifePGDdvy1cqvvKggnU7jxIkTOH/+PC5cuOB4LKHZxnRjt1noxL0Rm/mcaAXr/m61tkG0mbBDavHjjz9iampKXWze1pG3qOStqdHR0Zoft2w2i2w2q5Vm//79CAaDuHnzpuMX+2rIcmdmZnDnzh1zubHyWKt9+/ahq6tLO91a6cRBVzwex86dO/Hw4UMIIfDjjz9icHBQTdZUGxWnRq0lrrrblstlXLx4EcPDw4jFYgiHw3j33Xc9Z0W7kbd6Dx065NohevbZZ7Fjxw5cv369pm71HuPkJJ/P47333kM8Hkd3dzewcsX31VdfxdjYmJoc0GhjurHbTHTi3ojNek60wo0bN2q+U7dS2yDaVNRBpdtZZGUGpHUSk5xQoU4UkQPT1Y91wLxOGutMTTkBYWhoSARWJlW98cYbjgP+5XZOA+NluUFlVq3bPnilsw7KTyaTjvURlkkEUAb/e8VBbuc0oUZNo+YBy+xn4VDXcrnsmbcX3TjJWb3BYLBmYkM9q62zV1zr8drWaYKGnOxhjYNa92q16to25fbyeMlzCyvtP5fLiUKh4Fq3esfZqU1Go9GaSShSJpOpWafbxtzq53ReqzGo19Z7enpqjq31/Hc6v+rlJ+ujG3enmDqVaa2f1zkh6dTTje62MuapVEpUVyan7tmzxzx+9c4rr9jLmffhcLju/q6lbRBtd+yQWoyPj4ulpSWRy+XMR5igzuOfdNLppEkkEiKw0gENh8NidnZW7Nmzx3w0iUp2nOXH+mMpzc3NeZarm07+oPX09Dj+2AhLGmu9rF+4bnFQOwGBlccKBVceNwPLl7k1TupHlmWt6+zsrHbeXrzi5PRDZJ25W89a6uwWVx31tpVtTP7gOh3fTCZT0za82qb1GEajUVEoFMxOQiqVstVNdibg8KQLtdxm0WljQjN2agx02ro8/611iEQijvEfHx/3zM/p3HGLuxpTpzKtMfA6JySd/XY7DxvZdmlpyazP0NCQ2QGNRqOiWCx65uMWe0k95mqbdEun0zaIaB07pPI/1Jdfftn2JTA5OSnK5bL4+OOPbSei/K/R+uF/kGSVSCQcOx+pVEokEgl1MVHD2MboaZfL5cTQ0JDrPwHCcmdQ/hZHo1HHjrNOuurKXT/ZB1DvTFhlMhkRjUbVxbRNrMsY0nQ6jV27diGVSuHzzz83Zxk+fvwY//3vf9HR0YFHjx7ZxjPFYjFkMhkEAgGEw2FUq1XEYjFbvrR9ZbNZpNNpx7Fp+/fvx/79+9XFRA1hG6OnXTwex5kzZ5BIJNRVNiMjI3jw4AGq1Sqq1SoeP36MkZERNZlnOjmhrlQqoVqt4sMPP3Qdh57P5zE9PY0LFy6oq2i7UHuoa+U1PkbegnFaL28R1fsPirYnOV4rkUjY/gMvFAoimUza0hKtBtsYbRcRl5cgiJWrlAFlbKzTb7NOOvm3OqRK/f1fWnl5hVN9aPto6hXSbDaL0dFRRCIR16ubfr8fg4ODOHjwoLoKt2/fxo4dO3glgmrEYjF8/vnnuHTpEtra2uDz+bB3717cv38fJ06cUJMTNYxtjLaSek+dSKfTSCaT6mIt1icHSPIJAtbHsemkk8+slc/xlU/R+OGHH8xtAGBiYgLvvPPOql58QU+PpnVIy+Uy3n//fQSDQXz66afqaptnnnkGzz77rG2ZYRi4efMmDhw4wEZJjgYHB83H8Qgh8PDhw3V/7BNtL2xjtFUMDg5ienq65vZ3NpvFRx99hIGBAdtyHeVyGXfv3q15C5d86cHdu3dRLpe108ln1spnbS8vL+PJkye2txPKR62t5/OkaWtoWof0q6++QqlU0upQvvXWWzVp5LPyjh49alvu5Pjx47ZXs7l94vG4uikREdGW5/f78de//hWffvqp2SnNZrN4//338e2339b8xupw6jBKL7zwgvlaWN108oqpfNa2fGmAvEOaz+fx/fff449//KOSC21HTeuQykvwTh3KcrmMUChk6yyGQiHzNZ1o8Hb9l19+WfNaNqeP27ABIiKirc7v92NqagoXL15EMpnEn//8Z3z77beOE/Nawe/3Y3p6Gj/99BPa2trwySef4Nq1a+ju7jZfvDE1NQW/349isYje3l74fD709vbWXPmlp19TOqTyDR1ur4zr6OjAwsKCObMvEongwYMH5n9w8nb97t270dbWpmxNRERETjo6OnDkyBFcunQJIyMj69YZ/eGHH7Bjx46a4XYqNV1HRwe+//57iJU3n8lb89Zxo4Zh4OTJk3j++edRrVbx/PPP480337RdtKKnX1M6pLpkAz169Kht3EmzX23nRb21zw8//PDDDz+b/eMkn89jbGwMZ8+exfT0tO2VpY1ym3Sk0k3nRh03eufOHczMzJh9g6NHj6JUKuH+/fvqpvQUa0qHVA5krlQq5hgRJzdu3EAwGKy5La+OK/Gy1jGk6q19fvjhhx9++NnsH1U+n8fg4CDS6TROnDiB8+fP48KFC6vulLa1tWH37t1YXFy05SHvgso5IrrpnOTzeSwtLdUdUqdOhqLtoSkdUgA4ffo0AoEArly54niZXc7KUxuqvF2vPj6iHo4hJSKi7Syfz+O9995DPB5Hd3c3AKC7uxuvvvoqxsbG1ORa/H4/Tp8+jfn5eRSLRXO5OulYN51KjhsdHR1VV9moj4ui7aFpHdLu7m5cu3YNT548we9///uaAcn3799HqVSqmZX3xRdfYGZmZsNu1xMREW11f/vb3/Dhhx/WPC7p8OHD+NWvfuX6jFLDMMyrmsvLy+pqvPbaa9i3bx+mpqZgGAaKxSI++OADDAwM2MrSTScZhoHTp0/j3LlzNVdPX3vtNYTDYdy4cQOGYbjeTaWnnPqk/LUqFApiaGhIBAIB23vpX375ZTE5OWm+ASWTydS8u97tzRFERES0Nk6/u5FIRE1me0d9IBCw/XavJp1YeROa+oYmq0KhIHp6egQA0dPTY3sDFG0PPuE0MIWIiIiIaIM07Zb9dhSLxRAKhWxjaFbLKa9isYjh4WH09vbaxuW6LV+tb775Br29va6TwGhttmJ8m93GmsEwDMRisU1Vp83A6btjvbWizM3CMAxcvnwZ7e3trrfFiahx27ZDahgG+vr6ambmy097ezt++ctf4vLly6uesbgW5XIZ/f39SCQSqFQqnstXKx6PY2BgAPfu3VNXURNsxfg2u401y8jICCYnJzdVnWj7GRkZQTQaZTskajb1Hv52Mzc3J4LBoIhEIraxL3Nzc2JoaMgcG5PJZGzbrcX4+Lj2WNlIJOI4ttZt+WrMzc2JQCBQd3zPemskJlvNZoivSifezWxjq6XWczPUabtRjwH9bzwkgKb+LhBtd9v2CqlkfeuEdZZ/d3c3rl69ilQqhUqlgnfffbfmyQGrkc/nkcvl1MXbGmOysbZKvLdKPZ9mPAZEtFG2fYfUy+DgICKRCCqVCqamptTVDTEMAx988AFv9VgwJhtrq8R7PeqZTCZdx/yl02kkk0l18ba2HseAiMgNO6Qa5EP/7969a06mcJv0US6X0dvbC5/Ph+HhYeTzefPNGUeOHMHMzAxKpRJ27tyJ9vZ25PN517xWI5/Pm+XLOqhjYIvFopmmXpnqONtQKIRyuYx8Po/29nZz+fHjx2vS9/X1wVh53l0sFrONz43FYuY6t5jAY1+MlYkFe/fuRTabRTKZRHt7u1muyu24WNUrr5E0uvGVdPalWCzi0KFDZrm9vb2OV+zrpfOKt656MZD70tvbi2KxaB57tb4ynWxHah5e9bS2KzVvN4ODg5ienq5Jm81m8dFHH2FgYMC2XKpXVyuduDgd4+XlZdeYyfPN2natZTt9dzRyDFZzbjqVKdVrf1a6dXTita1h+R6S31nlchmhUAg+5bvJLR+vuFvrYo2hjJ/VatuFmg/RU0+9h7/dLC0tmWNI3cg0csyQ9W91PFskEhGJREKIlWe0RSIRW97qGLh6eTmlr7c8k8mI/v5+USgUhBBC5HI5EQgERDgcNsfHquMZrc9+cxvjODExUTOOVu6bWodqtSo+/vhjszyZRtZJjr2yluWUj9e+RCIR8zl6o6OjYnZ2VkxMTNTkI3kdF6/ydNOsJr5e+1IvT+sx0U3nFG8nTum8YiD3xfpMQlkva7xlm5qbm6s5nta81PIjkYhn3vVUq1Xx1ltvmc84zGQytvbpRKeuunFxOsZ9fX2uMTt27JjI5XJCCCFSqZStHbl9d+geAxnfRs5NtzJFA+1PNFBHJzrbVqtVEQ6HbXUsFAoiGAzWHBOnfOrFXVhiNTQ0VBM/a/3X0i68zk+ipw07pKvokEpuX9bWNEtLS2J8fNx1m2YtV39oremsP6bhcLhmXzMrD0t26zC5xUhuZ93fTCZj6/iFw2HHDps1r9Xsi9Cot+R1XHTK002zmviKOmmcYigscZRx000nHOLtRk2nEwO37ax1c2pPsp71zi+nZWreOpaWlsSxY8dEIpGwdRac6NRVNy5ux1imte5XvXLV7dVtnZapcVL/Fprnpttyp/yES/uTdPNworPtatLoxl12Pp062o18ZwiPdkG0nfCWfQMCgQA6OzvVxaa2tjbs3r0bv/3tbzE8PIxisYiOjo5Vv1e4EcViETMzM3jxxRdtt+CuX7+OSqWCxcVFFFfeM6y+vrWzsxOBQMC2zKqjowMHDhywDVkwDMMcUytfHYeVV8TK1735/X7cunULt27dAgBcvnwZr7/+uueYNJ19sfJ637HXcdEpTzfNauJrpe6LzLOzs9M26a6rqwv79u3DkydPsLy8rJ1uLXRioEMej8XFxZrbkg8fPrT9vR46Ojpw5MgRXLp0CSMjI+jq6lKTmHTq2mhc1GPspF65zbDac9PNRrS/jbDWuB89erSh7wwrnXZB1AqlUgnPPfecbdlzzz1na9fpdNq2/tSpUzXLvLBDqmF5eRlPnjzBjh07bLPyVX6/H3/5y1/Q09ODRCKBPXv2aI2JapZAIIC5uTmsXPm2fQ4fPozFxUVUKpVVffGdPn0aT548wVdffQUAuHPnDn7xi19gfHwc8/PzKBaLKJfLMAzD9gMvx1jt2rULAPD1119rdc689qUROsdFpzyvNGuJrxuZp8rv96Ozs9P8YdNNt1ZeMdDh9/tx+vRpzM/Pm5OMbt++3fTYucnn8xgbG8PZs2cxPT1dt+OhW9dmxGWjrfbcdLJR7W+r2YrtgkgVCoXw6NEj82+fz4eFhQVbmrfffhufffaZ+feVK1dw7dq1hjql7JBqmJqaQqVSwYEDB9DR0aGutunq6sL333+PQqGAoaEh3Lt3D2+++WbN4P/1UKlUcPv2bXVxjdVchZJXOm7evInl5WVMT0/jnXfewe9+9ztg5Uf6/v372Lt3r3mFxFiZGPHgwQM8fvwYZ86csV09qUd3X3R5HRed8nTSYJXxdSOvrrpdsZFX7XXTrZVuDLwcPnwYx48fx9jYGHw+Hz755BOkUql1/5HO5/MYHBxEOp3GiRMncP78eXPSoRudujYrLhtlLeemk41qf1uBdV+3WrsgUvX39yOVSpl/f/bZZwiFQrZ/ri5evAgAOHfunGXL/3VK3377bduyetgh9RCPx3H9+nUEg0F8+umn6mobwzDwpz/9ybxKePXqVWQyGZRKJdy/f19N3lSywzg6OlrzA5vNZpHNZrF//34Eg0HcvHnT8UejHr/fj0OHDmF+fh6JRAI/+9nP0N3dje7ubgwMDODKlSvIZDLm7XpYbuMdOnSooR87nX1phNdx0SlPJ81a4utGljszM4M7d+6Yyw3DwOLiIvbt24euri7tdGuhEwNd8XgcO3fuxMOHDyGEwI8//ojBwUE1WVPl83m89957iMfj6O7uBlaeN/zqq6/WHVbjVddmxmWjrPbcdLMR7W8ruHHjRs05uZXaBZFVOp3Go0ePbN93jx8/xvDwsC3d2bNncfLkSQDA3bt3zeXBYBAnT57EqVOnLKnrUAeVbjdzLm9qKhQK5puaenp6agamywHy1oHtclk0GjXzSqVStkHz1gHtyWTSNsFAHSTf6HI5OF79WMu3zgSVZQ8NDYlAICAAiDfeeMN1QoEc3G8dkC8s5aqTEWR6ubxarYpoNGqWn8vlRKFQcIxJI/viNRlA57jolKeTZrXxrbcvstygMiPa7Th4pXOKt2q1bUxuZy1TThRR06h5QGlDaj3L5bJn3vVEo9GaSShSJpNxXKdbV6+4iDrHuF7Menp6atqftQ05Had6+cn6rOXcdCrTWj+v9ic06+hGd1sZ71QqJarVqpicnBR79uwxj1299uQVdznzPhwO193XtbQLolYLhULi4sWL6mJHFy9eFADEwsKCbfl3333nuNzJtu2Q1vuhkZ/+/n6Ry+XMLyFJfplb005MTIhqtSqSyaSYnZ01H3eidmbltnK5W16NLpdyuZxZttwHdRZxIpEw8wiHw2J2dlbs2bPHfPRJPRHlcUnC8iXu9IVqLSsajYpCoWD+CKRSKSEcYiLV25eI5XEpcj/c6q5zXIRHeY2kaTS+OvsyNzfnWa5uOrd4q+utddJpY+o5FQgERC6XE8GVJ1TA8kNsjZH6kWVZ6zk7O6udd7Pp1FXUiYuoc4x1YibbkLUOkUjE8TiNj4975ud0DHTPTacyrTHQaX86++x2LBvZdmlpyazL0NCQ2QGNRqOiWCx65uMWd0k93tZHQFmp6XTaBVGryY7kd999p65yJDukTnQ7tj4hhFCvmhIRradkMon9+/ebt86ldDoNwzDwhz/8wba8lbZSXYmImuGzzz7DuXPnoNtFfO655zA8PIyzZ8+qq9Df349Hjx7ZJkY54RhSItpQ2WwW6XTacUzh/v37beOQW20r1ZWIqFkeP36MUCikLnYkZ9c7dUaxMpZUnZXvhB1SItpQDx8+xPz8vHmFUSoWi5idna25EtlKW6muRETNUiqV1EWO7t69i3PnztW9+ikfLeeVJzukRLShYrEYPv/8c1y6dAltbW3w+XzYu3cv7t+/jxMnTqjJW2or1ZWIqFnqdTClUqmEV155Rfu2vheOISUiIiIik9e4z1KpZD6P1Iscj7qwsIBgMKiuNvEKKRERERGZ6nUcG+mMYmU8KjzyBDukRERERGS1a9cux4lIsjOKlVeIOn1UpVIJv/nNb9TFNdghJSIiIiLTyy+/DChvXrJ2Rhvxr3/9CwcPHlQX12CHlIiIiIhMBw4cQCgUwr///W9zWTAYtL3D3u1jJTu0b775pm25E05qIiIiIiKbdDqNt99+u6aT2Qj5HvsrV66oq2qwQ0pERERENfr7+3Hw4EHXh97XI2/xe82ul9ghJSIiIiJHPp9Pu1Np1d/fj3fffReDg4PqKkccQ0pEREREjhYWFvDrX/9aXVzXqVOncPDgQe3OKHiFlIiIiIhajVdIiYiIiKil2CElIiIiopZih5SIiIiIWoodUiIiIiJqKXZIiYiIiKil2CElIiIiopZih5SIiIiIWoodUiIiIiJqKXZIiYiIiKil2CElIiIiopZih5SIiIiIWoodUiIiIiJqKXZIiYiIiKil2CElIiIiopZih5SIiIiIWur/AdXVOyuKUfEkAAAAAElFTkSuQmCC\" style=\"width: 590px; height: 77.9938px;\" width=\"590\" height=\"77.9938\"\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section3\"\u003e\u003ch2\u003e2.2.4 Determination of heavy metal Cd forms\u003c/h2\u003e\u003cp\u003eThe improved three-step extraction method was used to determine the chemical speciation of cadmium (Cd) in compost samples. The specific procedures were as follows:(1) For exchangeable Cd (EX-Cd): Air-dried compost samples were ground and sieved through a 100-mesh sieve. A 1.0 g aliquot was placed in a 100 mL centrifuge tube, mixed with 40 mL of 0.10 mol/L glacial acetic acid, and shaken at 25\u0026deg;C for 16 h. After centrifugation at 3000 r/min for 20 min, the supernatant was diluted to 50 mL for Cd\u003csup\u003e2+\u003c/sup\u003e concentration measurement (denoted as Z1). (2) For reducible Cd (OXI-Cd): The residual precipitate from step (1) was treated with 40 mL of 0.5 mol/L hydroxylamine hydrochloride solution. The mixture was shaken at 25\u0026deg;C for 16 h and centrifuged (3000 r/min, 20 min). The supernatant was adjusted to 50 mL for Cd\u003csup\u003e2+\u003c/sup\u003e analysis (denoted as Z2). (3) For oxidizable Cd (RED-Cd): The precipitate from step (2) was sequentially treated with 10 mL of acidified hydrogen peroxide (standing for 1\u0026ndash;2 h), heated to 85\u0026deg;C with additional 10 mL hydrogen peroxide (maintained for 1 h), then mixed with 50 mL of 1 mol/L ammonium acetate. After shaking (25\u0026deg;C, 16 h) and centrifugation (3000 r/min, 20 min), the supernatant was diluted to 50 mL for Cd\u003csup\u003e2+\u003c/sup\u003e measurement (denoted as Z3). (4) For residual Cd (RES-Cd): The final precipitate was digested with 10 mL HNO\u003csub\u003e3\u003c/sub\u003e and 4 mL HF in a sealed ablation tank at 140\u0026deg;C. The digested solution was diluted to 50 mL for Cd2\u0026thinsp;+\u0026thinsp;determination (denoted as Z4).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section3\"\u003e\u003ch2\u003e2.2.5 Determination of microbial diversity and community structure in the composting process\u003c/h2\u003e\u003cp\u003e\u003cem\u003e(1)DNA extraction and purification\u003c/em\u003e\u003c/p\u003e\u003cp\u003eTotal genomic DNA was extracted from the samples following the CTAB method. The DNA quality (purity and concentration) was subsequently evaluated through 1% agarose gel electrophoresis.\u003c/p\u003e\u003cp\u003e\u003cem\u003e(2)PCR amplification\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe diluted DNA was amplified by PCR using primer pairs 341 F:CCTACGGGNGGCWGCAG and 806 R:GGACTACHVGGGTWTCTAAT. The detailed PCR reaction syst-em is presented in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePCR amplification reaction system\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eReagent\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eVolume\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eHigh-Fidelity PCR Master Mix\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e15\u0026micro;L\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimers\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e0.2\u0026micro;L\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTemplate DNA\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e10\u0026micro;L\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTotal volume\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e30\u0026micro;L\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eThe PCR amplification protocol consisted of: initial denaturation at 98\u0026deg;C for 1 min; followed by 30 cycles of denaturation at 98\u0026deg;C for 10 s, annealing at 50\u0026deg;C for 30 s, and extension at 72\u0026deg;C for 30 s; with a final extension at 72\u0026deg;C for 5 min. Subsequently, PCR product purity and concentration were assessed by 1% agarose gel electrophoresis.\u003c/p\u003e\u003cp\u003e\u003cem\u003e(3)High-throughput sequencing\u003c/em\u003e\u003c/p\u003e\u003cp\u003eThe concentration and quality of PCR amplification products were assessed, and only samples meeting the following criteria were selected for subsequent analysis: DNA concentration\u0026thinsp;\u0026gt;\u0026thinsp;10 ng/uL and 260/280 nm absorbance ratio approximately 1.8. Qualified samples were then submitted to Tiangen Biochemical Technology (Beijing) Co., Ltd. for Illumina high-throughput sequencing and bioinformatics analysis.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec14\" class=\"Section2\"\u003e\u003ch2\u003e2.3 Data processing and analysis\u003c/h2\u003e\u003cp\u003eMicrosoft Excel 2020 was employed for data collation and preliminary processing of physicochemical parameters and biological indices. For sequence analysis, Notepad\u0026thinsp;+\u0026thinsp;+\u0026thinsp;and MEGA 7.0 were used to process and align the obtained microbial sequences, followed by phylogenetic tree construction using appropriate methods based on sequence similarity and evolutionary relationships. Data visualization was performed using Origin 2021, including line graphs for physicochemical indices and stacked bar charts for the percentage distribution of cadmium (Cd) speciation. For microbial community analysis, the sequencing data were processed through QIIME2's DADA2 pipeline for OTU clustering. Taxonomic annotation was subsequently performed to determine species composition and relative abundance. Beta diversity matrices were calculated to evaluate sample relationships, while rarefaction curve analysis was conducted based on OTU distributions. Alpha diversity was assessed using Chao1, ACE, Simpson, and Shannon indices.\u003c/p\u003e\u003c/div\u003e"},{"header":"3 Results","content":"\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003e3.1 Results of in situ screening and informative identification of Cd-resistant bacterial strains\u003c/h2\u003e\u003cdiv id=\"Sec17\" class=\"Section3\"\u003e\u003ch2\u003e3.1.1 Results of in situ screening of Cd-resistant bacterial strains\u003c/h2\u003e\u003cp\u003eIn this study, a total of 20 cadmium-tolerant microbial strains were successfully isolated, comprising eight bacterial, one fungal, and two actinomycete strains at 40\u0026deg;C, along with four bacterial, two fungal, and three actinomycete strains at 50\u0026deg;C. Among these, eleven strains demonstrated significant cadmium passivation capability. During in situ screening, all colonies exhibited robust growth on the culture medium (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). Detailed information regarding colony morphology and screening culture conditions is provided in the Supplementary Material (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section3\"\u003e\u003ch2\u003e3.1.2 Informative identification of Cd-resistant strains\u003c/h2\u003e\u003cp\u003eThe PCR amplification results of the cadmium-resistant strains are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e. All 12 selected strains exhibited clear and well-defined electrophoretic bands, meeting the quality standards required for high-throughput sequencing.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003ePhylogenetic analysis of the cadmium-passivating microorganisms was performed based on 16S rDNA sequencing. The evolutionary tree constructed using BLAST alignment and MEGA 7.0 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) revealed that these isolates primarily clustered into five distinct genera with sequence similarities exceeding 98%. The identified genera included: \u003cem\u003eEscherichia\u003c/em\u003e (strains LB1, LB2, F2), \u003cem\u003eBacillus\u003c/em\u003e (strains J-1-1, J-1-2, J-2-1, J-2-4, F1), \u003cem\u003eEnterobacter\u003c/em\u003e (strains LB3, LB4), \u003cem\u003eMicrococcus\u003c/em\u003e (strain LB5), and \u003cem\u003eSaccharomyces\u003c/em\u003e (strain MR1). Due to potential biosafety concerns associated with pathogenic Escherichia coli and Escherichia fergusonii, strains LB1, LB2, and F2 were excluded from further investigation. Additionally, since both J-1-1 and J-1-2 were identified as Bacillus velezensis, only one representative strain was selected for subsequent experiments. Ultimately, eight microbial strains were retained for further study, with detailed taxonomic information provided in Supplementary Table S2.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003e3.2 Study on the effect of Cd passivation and humification by strains of Rhizobium spp.\u003c/h2\u003e\u003cdiv id=\"Sec20\" class=\"Section3\"\u003e\u003ch2\u003e3.2.1 Cd passivation-promoting and humification-promoting effects of a single bacterial strain\u003c/h2\u003e\u003cp\u003eThe effects of individual bacterial strains on Cd passivation and humification promotion are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. Among them, LB3, LB4, and J-1-2 exhibited the highest Cd passivation efficiency, with LB4 being the most outstanding, achieving an EX-Cd passivation rate of 67.35%. Based on passivation efficiency, the treatment groups were ranked as follows: LB4\u0026thinsp;\u0026gt;\u0026thinsp;LB3\u0026thinsp;\u0026gt;\u0026thinsp;J-1-2\u0026thinsp;\u0026gt;\u0026thinsp;LB5\u0026thinsp;\u0026gt;\u0026thinsp;F1\u0026thinsp;\u0026gt;\u0026thinsp;J-2-1\u0026thinsp;\u0026gt;\u0026thinsp;J-2-4. Notably, the J-2-4, J-2-1, F1, and MR1 treatment groups all showed EX-Cd passivation rates below 35%, which were significantly lower than those of other strains. Therefore, these strains were excluded from further study. In terms of humification promotion, J-1-2 performed best(10.82%), followed by LB3(10.31%) and LB4(9.80%). The other strains showed unsatisfactory results and were thus not considered for subsequent bacterial agent preparation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section3\"\u003e\u003ch2\u003e3.2.2 Antagonism experiments between strains\u003c/h2\u003e\u003cp\u003eAntagonism experiments were conducted on the three selected strains (LB3, LB4, and J-1-2) using the Oxford cup method. These strains exhibited both Cd passivation and humification capabilities. Results demonstrated no mutual antagonism among the three strains (Table\u0026nbsp;\u003cspan refid=\"Tab4\" class=\"InternalRef\"\u003e4\u003c/span\u003e and Fig.\u0026nbsp;7), indicating their suitability for combined use in bacterial agent preparation.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab4\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 4\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eAntagonism results between different strains\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"4\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBacteria\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eLB3\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eLB4\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eJ-1-2\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLB3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eLB4\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eJ-1-2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e-\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e/\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"4\"\u003e\u003cb\u003eNote\u003c/b\u003e: \"+\" indicates presence of antagonistic activity, while \"-\" denotes absence of antagonistic response.\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec22\" class=\"Section3\"\u003e\u003ch2\u003e3.2.3 Growth curve of the strain\u003c/h2\u003e\u003cp\u003eIn order to investigate the growth characteristics of LB3, LB4, and J-1-2, the preserved bacterial fluids were inoculated into the corresponding liquid medium at an inoculation ratio of 1:100 and cultured continuously for 24 h. Samples were taken every 4 h to determine the OD\u003csub\u003e600\u003c/sub\u003e values, and growth curves were plotted (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e8\u003c/span\u003e). The results showed that LB4 and J-1-2 entered the rapid growth phase within a relatively short period. LB4 reached the stabilization phase around 12 h, while J-1-2 exhibited a significant decrease in growth rate and stabilized after 8 h. In contrast, LB3 displayed a more pronounced lag phase, with slow growth between 0\u0026ndash;10 h, followed by rapid proliferation until reaching stabilization after 20 h. The growth rate of LB3 was significantly lower than that of LB4 at around 12 h. Throughout the 24-h culture period, none of the three strains showed an obvious decay phase.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\u003ch2\u003e3.2.4 Preparation of composite bacterial agents and their effectiveness in promoting Cd passivation and humification\u003c/h2\u003e\u003cp\u003eThe strains LB3, LB4, and J-1-2 were mixed in equal proportions to prepare compound microbial agents for investigating Cd passivation and compost maturation promotion (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e9\u003c/span\u003e). The results demonstrated significant differences in Cd passivation efficiency among different strain combinations. Notably, the LB3\u0026thinsp;+\u0026thinsp;LB4 and LB3\u0026thinsp;+\u0026thinsp;LB4\u0026thinsp;+\u0026thinsp;J-1-2 combinations exhibited the highest passivation efficiencies, achieving EX-Cd passivation rates of 69.25% and 71.35%, respectively. These findings confirm that specific strain combinations exert synergistic effects in heavy metal passivation. Similarly, the promotion effects of different compound agents on compost humification varied significantly. The LB3\u0026thinsp;+\u0026thinsp;LB4 and LB3\u0026thinsp;+\u0026thinsp;LB4\u0026thinsp;+\u0026thinsp;J-1-2 combinations also showed the best humification performance, with maturation degrees of 12.78% and 13.10%, respectively, significantly surpassing the capabilities of individual strains. Based on these results, the two strain combinations (Treatment T1: LB3\u0026thinsp;+\u0026thinsp;LB4; Treatment T2: LB3\u0026thinsp;+\u0026thinsp;LB4\u0026thinsp;+\u0026thinsp;J-1-2) were selected as test agents for subsequent composting experiments.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec24\" class=\"Section2\"\u003e\u003ch2\u003e3.3 Changes in decay indicators during composting\u003c/h2\u003e\u003cp\u003eThe pH of all treatment groups exhibited an initial increase followed by a decrease during composting (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e10\u003c/span\u003eA), consistent with the typical pH trend in aerobic composting[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. At the onset of composting, the pH values of the T1 and T2 treatment groups were higher than that of the CK group, likely due to the addition of composite microbial agents. Between days 3 and 16, the pH of each treatment group increased significantly, peaking on day 16, with the T2 group reaching the highest value (8.9). By the end of composting, the pH stabilized at a weakly alkaline level across all treatments, which is a key condition for compost maturation[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eThe pre-composting phase was characterized by a rapid temperature increase in all treatment groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e10\u003c/span\u003eB). By day 6, each treatment group had reached its peak composting temperature, with the T1 group recording the highest temperature (58\u0026deg;C), which was then consistently maintained above 50\u0026deg;C. Since maintaining temperatures above 50\u0026deg;C for more than 3 days effectively eliminates pathogenic microorganisms and weeds, achieving the harmless treatment standard[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], all treatment groups in this study met this requirement. Notably, the T1 group reached the thermophilic phase first, suggesting that the microbial inoculant promoted compost decomposition. During the subsequent cooling phase, temperatures gradually decreased, with minor temporary increases observed after pile turning in all treatments, though none exceeded 50\u0026deg;C.\u003c/p\u003e\u003cp\u003eThe moisture content of all treatment groups exhibited a decreasing trend (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e10\u003c/span\u003eC), declining from approximately 60% initially to 43.11% (CK), 41.56% (T1), and 41.89% (T2) during the maturation phase, representing an overall reduction of about 20%. The most rapid moisture loss occurred during the thermophilic phase, primarily because thermophilic bacteria dominated the microbial community during this stage. The intensive decomposition of organic matter and consequent heat generation significantly enhanced water evaporation.\u003c/p\u003e\u003cp\u003eIn this experiment, all treatment groups exhibited a continuous decline in C/N ratio throughout the composting process (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e10\u003c/span\u003eD). The most significant reduction occurred during the thermophilic phase, with C/N ratios decreasing to 19.05 (CK), 19.03 (T1), and 21.01 (T2), respectively. Subsequently, the rate of decrease gradually slowed until reaching the lowest values during the maturation phase: 15.82 (CK), 14.88 (T1), and 15.79 (T2).\u003c/p\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e10\u003c/span\u003eE illustrates the NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N variation pattern during composting. During both the mesophilic and thermophilic phases, NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N content remained relatively stable. However, a rapid increase was observed following the thermophilic phase. At composting completion, the NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N content increased by 2.00-fold (CK), 2.06-fold (T1), and 2.18-fold (T2), with the T2 treatment group achieving the highest concentration (1504 mg/kg).\u003c/p\u003e\u003cp\u003eFigure\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e10\u003c/span\u003eF presents the NH\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e-N variation pattern during composting. In contrast to NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N, NH\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e-N content increased rapidly during the mesophilic and thermophilic phases, reaching peak concentrations. Subsequently, NH\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e-N levels declined sharply during the cooling phase, attaining minimum values by day 16. The T2 treatment group showed the lowest recorded concentration (153 mg/kg).\u003c/p\u003e\u003cp\u003eAll treatment groups exhibited a characteristic rise and subsequent decline in E4/E6 ratios during composting (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e10\u003c/span\u003eG). During the thermophilic phase, E4/E6 ratios increased concomitantly with temperature elevation, peaking on day 14 at 3.44 (CK), 3.20 (T1), and 3.34 (T2). Following the temperature maximum, the ratios decreased progressively as pile temperatures declined, ultimately reaching their lowest values during the maturation phase: 1.74 (CK), 1.52 (T1), and 1.41 (T2).\u003c/p\u003e\u003cp\u003eSeed GI demonstrated a consistent upward trend across all treatments during composting (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e10\u003c/span\u003eH). Initial GI values were relatively low (about 25%) in all groups during the early composting stage. The GI progression exhibited phase-dependent characteristics: slower increases during mesophilic and thermophilic phases, followed by accelerated growth during the cooling phase, particularly in T1 and T2 treatments (significantly higher than CK). This upward trend gradually stabilized toward composting completion, with final GI values reaching 81.72% (CK), 86.22% (T1), and 87.35% (T2).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec25\" class=\"Section2\"\u003e\u003ch2\u003e3.4 Characterisation of bacterial communities and their succession in composting processes\u003c/h2\u003e\u003cdiv id=\"Sec26\" class=\"Section3\"\u003e\u003ch2\u003e3.4.1 Differential analysis of bacterial species in compost samples\u003c/h2\u003e\u003cp\u003eElectrophoresis analysis of PCR-amplified sequences from compost samples revealed clear bands meeting high-throughput sequencing standards (see Supplementary Material Fig.\u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e for detailed electropherograms). High-throughput sequencing of 12 compost samples representing four composting phases yielded 1,189,665 bacterial sequences, with treatment-specific effective sequence counts presented in Table\u0026nbsp;\u003cspan refid=\"Tab5\" class=\"InternalRef\"\u003e5\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab5\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 5\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eNumber of valid sequences for each treatment group\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"6\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eSpecimen\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNumber of valid sequences\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eSpecimen\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eNumber of valid sequences\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eSpecimen\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eNumber of valid sequences\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCK0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e87526\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eT10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e80386\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eT20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e73281\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCKS\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e139791\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eT1S\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e113891\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eT2S\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e128669\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCKG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e82507\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eT1G\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e86492\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eT2G\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e82190\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eCKJ\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003e118983\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003eT1J\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e101684\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003eT2J\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e94265\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"6\"\u003e\u003cb\u003eNote\u003c/b\u003e: Experimental phases are coded as follows: 0 - initial phase; S - mesophilic phase; G - thermophilic phase; J - maturation phase.\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cp\u003eUsing 97% similarity threshold for operational taxonomic unit (OTU) clustering, we analyzed bacterial OTU distribution across treatments and phases (Fig.\u0026nbsp;11a). Throughout composting, total OTU counts followed the order: 7,785 (T1)\u0026thinsp;\u0026gt;\u0026thinsp;7,471 (T2)\u0026thinsp;\u0026gt;\u0026thinsp;6,691 (CK), indicating T1 maintained the highest microbial diversity. All treatments exhibited increasing OTU numbers during composting, reaching peak bacterial community diversity during the maturation phase.\u003c/p\u003e\u003cp\u003eThe OTU rarefaction curve analysis (Fig.\u0026nbsp;11b) revealed the steepest slope in T2 treatment, indicating superior species richness. Principal coordinate analysis (Fig.\u0026nbsp;11c) demonstrated significant differences between initial-phase and subsequent-phase bacterial communities across all treatments, confirming substantial composting-induced microbial restructuring. During mesophilic and maturation phases, bacterial community compositions showed remarkable convergence among treatments, suggesting that dominant microorganisms in these phases were likely indigenous and phylogenetically related, developing similar community structures under comparable environmental conditions.\u003c/p\u003e\u003cp\u003eNotably, thermophilic-phase samples exhibited distinct clustering patterns: CK treatment diverged significantly from T1 and T2 groups. This divergence presumably resulted from the active involvement of inoculated microbial consortia in T1/T2 treatments, which modified indigenous community structures and created differentiation from conventional composting (CK) microbiota.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec27\" class=\"Section3\"\u003e\u003ch2\u003e3.4.2 Changes in bacterial community diversity indices in compost samples\u003c/h2\u003e\u003cp\u003eBacterial diversity indices across composting phases and treatments are presented in Table\u0026nbsp;\u003cspan refid=\"Tab6\" class=\"InternalRef\"\u003e6\u003c/span\u003e. Both Chao1 and Ace indices, which estimate community richness, exhibited parallel trends. Notably, T1 and T2 treatments consistently demonstrated higher values than CK after the initial phase, suggesting microbial inoculants enhanced bacterial community richness. Phase-specific patterns emerged: T1 showed maximum richness during mesophilic (S) and maturation (J) phases, while T2 dominated in other phases. This phase-dependent variation highlights treatment-specific impacts on microbial abundance. The ranked Chao1 indices (T1J\u0026thinsp;\u0026gt;\u0026thinsp;T2J\u0026thinsp;\u0026gt;\u0026thinsp;CKJ\u0026thinsp;\u0026gt;\u0026thinsp;T2G\u0026thinsp;\u0026gt;\u0026thinsp;T1S\u0026thinsp;\u0026gt;\u0026thinsp;T2S\u0026thinsp;\u0026gt;\u0026thinsp;T1G\u0026thinsp;\u0026gt;\u0026thinsp;CKG\u0026thinsp;\u0026gt;\u0026thinsp;CK0\u0026thinsp;\u0026gt;\u0026thinsp;T20\u0026thinsp;\u0026gt;\u0026thinsp;T10) further illustrate temporal and treatment-based variations in bacterial community abundance.\u003c/p\u003e\u003cp\u003eBoth Simpson and Shannon indices peaked during the maturation phase, indicating optimal bacterial community diversity and evenness were achieved at this stage. Comparative analysis revealed significant increases post-composting: CK treatment showed increments of 0.0013 (Simpson) and 2.1739 (Shannon), while T1 and T2 treatments demonstrated greater improvements (T1: +0.0733, +\u0026thinsp;2.6483; T2: +0.1046, +\u0026thinsp;2.9616), confirming that microbial inoculants enhanced α-diversity more effectively than conventional composting. All samples exhibited exceptional coverage rates (\u0026gt;\u0026thinsp;0.999), verifying that the sequencing depth adequately captured the composting microbiome and validating the reliability of our diversity assessments. This high coverage ensures our bacterial diversity indices accurately represent the in situ microbial community dynamics.\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab6\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 6\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003eVariation of bacterial abundance and diversity during chicken manure composting\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"8\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c7\" colnum=\"7\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c8\" colnum=\"8\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePeriod\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSpecimen\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c3\"\u003e\u003cp\u003eNumber of valid sequences\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c4\"\u003e\u003cp\u003eAce\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c5\"\u003e\u003cp\u003eChao1\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c6\"\u003e\u003cp\u003eSimpson\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c7\"\u003e\u003cp\u003eShannon\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c8\"\u003e\u003cp\u003eCoverage\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eInitial phase\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCK0\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e87526\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e370.78\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e370.81\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.9696\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e5.6844\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.9996\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eT10\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e80386\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e294.55\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e294.16\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.9081\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e5.4753\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.9998\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eT20\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e73281\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e320.12\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e323.32\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.8758\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e4.8835\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.9998\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eMesophilic phase\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCKS\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e139791\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e636.27\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e635.14\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.9736\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e6.6822\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.9998\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eT1S\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e113891\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e843.17\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e842.19\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.9828\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e7.3697\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.9999\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eT2S\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e128669\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e797.42\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e797.78\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.9753\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e7.000\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.9997\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\" morerows=\"2\" rowspan=\"3\"\u003e\u003cp\u003eThermophilic phase\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCKG\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e82507\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e719.99\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e716.48\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.9704\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e6.6566\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.9995\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eT1G\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e86492\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e729.71\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e727.75\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.9662\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e6.4959\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.9996\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eT2G\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e82190\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e856.81\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e850.84\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.9829\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e7.3549\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.9995\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eMaturation phase\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eCKJ\u003c/p\u003e\u003cp\u003eT1J\u003c/p\u003e\u003cp\u003eT2J\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c3\"\u003e\u003cp\u003e118983\u003c/p\u003e\u003cp\u003e101684\u003c/p\u003e\u003cp\u003e94265\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c4\"\u003e\u003cp\u003e1410.20\u003c/p\u003e\u003cp\u003e1681.68\u003c/p\u003e\u003cp\u003e1449.19\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c5\"\u003e\u003cp\u003e1408.42\u003c/p\u003e\u003cp\u003e1681.23\u003c/p\u003e\u003cp\u003e1447.98\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c6\"\u003e\u003cp\u003e0.9862\u003c/p\u003e\u003cp\u003e0.9814\u003c/p\u003e\u003cp\u003e0.9804\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c7\"\u003e\u003cp\u003e7.8583\u003c/p\u003e\u003cp\u003e8.1236\u003c/p\u003e\u003cp\u003e7.8451\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c8\"\u003e\u003cp\u003e0.9996\u003c/p\u003e\u003cp\u003e0.9994\u003c/p\u003e\u003cp\u003e0.9997\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003ctfoot\u003e\u003ctr\u003e\u003ctd colspan=\"8\"\u003e\u003cb\u003eNote\u003c/b\u003e: Experimental phases are coded as follows: 0 - initial phase; S - mesophilic phase; G - thermophilic phase; J - maturation phase.\u003c/td\u003e\u003c/tr\u003e\u003c/tfoot\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec28\" class=\"Section3\"\u003e\u003ch2\u003e3.4.3 Bacterial community succession during the composting process\u003c/h2\u003e\u003cp\u003eTo investigate the dynamics of the bacterial community during different composting stages, this study analyzed the composition of bacterial communities at the phylum level (groups with \u0026lt;\u0026thinsp;1% abundance were classified as \"Others\") in compost samples from various treatments over time. The results are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e12\u003c/span\u003e.\u003c/p\u003e\u003cp\u003eOverall, the dominant phyla at each composting stage included \u003cem\u003eBacteroidetes\u003c/em\u003e, \u003cem\u003eActinobacteria\u003c/em\u003e, \u003cem\u003eFirmicutes\u003c/em\u003e, \u003cem\u003eProteobacteria\u003c/em\u003e, \u003cem\u003eAcidobacteria\u003c/em\u003e, and \u003cem\u003eChloroflexi\u003c/em\u003e. Among these, \u003cem\u003eFirmicutes\u003c/em\u003e and \u003cem\u003eActinobacteria\u003c/em\u003e exhibited significant fluctuations and higher abundance.\u003c/p\u003e\u003cp\u003eIn the first three phases, \u003cem\u003eFirmicutes\u003c/em\u003e accounted for 38.53\u0026ndash;89.51% of the community, while \u003cem\u003eActinobacteria\u003c/em\u003e ranged from 5\u0026ndash;38.61%. However, during the maturation phase, the abundance of \u003cem\u003eFirmicutes\u003c/em\u003e plummeted to 15.06\u0026ndash;20.60%, whereas \u003cem\u003eActinobacteria\u003c/em\u003e increased sharply to 46.01\u0026ndash;58.90%. Notably, in the CK, T1, and T2 treatment groups, \u003cem\u003eFirmicutes\u003c/em\u003e reached 62.28%, 77.24%, and 89.51%, respectively, suggesting its adaptability to high-temperature environments.\u003c/p\u003e\u003cp\u003eAdditionally, during maturation, \u003cem\u003eActinobacteria\u003c/em\u003e abundance rose significantly to 46.01%, 58.90%, and 57.26% in the CK, T1, and T2 groups, respectively. In contrast, \u003cem\u003eChloroflexi\u003c/em\u003e, which had previously represented\u0026thinsp;\u0026lt;\u0026thinsp;1% of the community, increased to 15.36%, 11.82%, and 14.65% during maturation.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn this study, bacterial communities with a relative abundance exceeding 1% were further classified statistically at the family level, and the results are presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig11\" class=\"InternalRef\"\u003e13\u003c/span\u003e. A total of 27 major bacterial families were identified and analyzed for abundance variations across different compost treatments. The dominant families included \u003cem\u003eEnterobacteriaceae\u003c/em\u003e (0.11\u0026ndash;37.15%), \u003cem\u003eRuminococcaceae\u003c/em\u003e (0.93\u0026ndash;76.79%), \u003cem\u003eLachnospiraceae\u003c/em\u003e (0.25\u0026ndash;76.68%), \u003cem\u003eBurkholderia\u003c/em\u003e (0.03\u0026ndash;90.98%), \u003cem\u003eLactobacillaceae\u003c/em\u003e (0.25\u0026ndash;33.13%), \u003cem\u003eWohlfahrtiimonadaceae\u003c/em\u003e (1.79\u0026ndash;68.09%), \u003cem\u003eBacillaceae\u003c/em\u003e (0.01\u0026ndash;51.55%), and \u003cem\u003eFamily XI\u003c/em\u003e (0.52\u0026ndash;18.93%). The analysis showed that the abundance of both \u003cem\u003eRuminococcaceae\u003c/em\u003e and \u003cem\u003eLachnospiraceae\u003c/em\u003e increased in all treatments during the warming period but declined sharply in the rotting period. Specifically, \u003cem\u003eRuminococcaceae\u003c/em\u003e decreased from 2.79\u0026ndash;21.51% in the initial phase to 0.93\u0026ndash;1.67% in the rotting phase, while \u003cem\u003eLachnospiraceae\u003c/em\u003e dropped from 3.48\u0026ndash;25.44% initially to 0.25\u0026ndash;0.81% during rotting.\u003c/p\u003e\u003cp\u003eThe initial abundance of \u003cem\u003eLactobacillaceae\u003c/em\u003e was higher in the T1 and T2 treatment groups but decreased significantly during the high-temperature phase and reached its lowest level in the rotting phase. In contrast, the CK group exhibited a peak in \u003cem\u003eLactobacillaceae\u003c/em\u003e abundance (29.93%) during the warming phase, followed by a continuous decline to 0.33% by the rotting phase. Unlike these decreasing trends, \u003cem\u003eBurkholderia\u003c/em\u003e abundance increased steadily throughout composting, rising from 0.03\u0026ndash;0.59% in the initial phase to 22.36\u0026ndash;23.56% in the rotting phase. Notably, \u003cem\u003eWohlfahrtiimonadaceae\u003c/em\u003e were detected only during the warming and high-temperature phases. Additionally, \u003cem\u003eAnaerolineaceae\u003c/em\u003e and \u003cem\u003eChromobacteriaceae\u003c/em\u003e were absent in the first three composting phases but gradually increased in abundance, peaking during the maturation phase.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eIn this study, 12 samples from different treatments and periods were analyzed for bacterial communities at the genus level, with the top 22 most abundant genera selected and visualized in a bar chart (Fig.\u0026nbsp;\u003cspan refid=\"Fig12\" class=\"InternalRef\"\u003e14\u003c/span\u003e) to demonstrate their distribution patterns across treatments and time. Dominant genera present throughout the composting process included \u003cem\u003ePhascolarctobacterium\u003c/em\u003e (0.01%-4.49%), \u003cem\u003eMegamonas\u003c/em\u003e (0.01%-6.87%), \u003cem\u003eBacteroides\u003c/em\u003e (0.06%-16.26%), \u003cem\u003eLactobacillus\u003c/em\u003e (0.20%-27.00%), \u003cem\u003eFaecalibacterium\u003c/em\u003e (0.04%-3.20%), and \u003cem\u003ePseudomonas\u003c/em\u003e (0.01%-9.29%).\u003c/p\u003e\u003cp\u003eThe analysis revealed that certain genera like \u003cem\u003ePrevotella\u003c/em\u003e and \u003cem\u003eEnterococcus\u003c/em\u003e showed minimal abundance during the rotting period, with their populations declining sharply in the late composting stage. This suggests these genera may have been primarily active in the pre-composting phase. Conversely, other genera including \u003cem\u003eTauerella\u003c/em\u003e, \u003cem\u003eAeromonas\u003c/em\u003e, and \u003cem\u003eComamonas\u003c/em\u003e exhibited low initial abundance but progressively increased throughout the composting process, peaking during maturation. This pattern indicates these genera likely adapted well to changing composting conditions and potentially played significant roles in mid-to-late stage transformation and metabolic processes.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec29\" class=\"Section2\"\u003e\u003ch2\u003e3.5 Study on the passivation effect of heavy metal Cd in composting process\u003c/h2\u003e\u003cdiv id=\"Sec30\" class=\"Section3\"\u003e\u003ch2\u003e3.5.1 Changes in total landfill weight of the heavy metal Cd\u003c/h2\u003e\u003cp\u003eAfter composting, the total cadmium (Cd) concentration in all treatment groups exhibited an increasing trend (Fig.\u0026nbsp;\u003cspan refid=\"Fig13\" class=\"InternalRef\"\u003e15\u003c/span\u003e), showing an approximate 71\u0026ndash;79% elevation. This phenomenon primarily resulted from the concentration effect associated with organic matter decomposition during the composting process[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, post-composting Cd concentrations showed no statistically significant differences between the control and treatment groups.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec31\" class=\"Section3\"\u003e\u003ch2\u003e3.5.2 Changes in the morphological distribution of Cd in stacked heavy metals\u003c/h2\u003e\u003cp\u003eTo better understand how different treatments affect the speciation of Cd during chicken manure composting, this study analyzed Cd fractions at various composting stages (Fig.\u0026nbsp;\u003cspan refid=\"Fig14\" class=\"InternalRef\"\u003e16\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eAnalysis of cadmium (Cd) fractionation patterns revealed distinct trends among treatment groups. For EX-Cd, while the CK group showed an initial increase followed by decrease, both T1 and T2 groups exhibited continuous reductions during the final three composting phases. The T2 group demonstrated optimal performance by reducing EX-Cd to 9% at composting completion, which was slightly but significantly better than the 11% reduction achieved by T1, thus confirming the composite bacterial agent's effectiveness in EX-Cd reduction.\u003c/p\u003e\u003cp\u003eOxidizable Cd (OXI-Cd) emerged as the dominant Cd storage form, consistently comprising\u0026thinsp;\u0026gt;\u0026thinsp;45% of total Cd and showing progressive accumulation throughout composting. The CK group's OXI-Cd proportion increased from 45\u0026ndash;64%, while T1 and T2 reached 57% and 62% respectively, demonstrating composting's dual effect of OXI-Cd promotion and EX-Cd reduction.\u003c/p\u003e\u003cp\u003eReducible Cd (RED-Cd) exhibited minimal overall variation, with only T1 showing a slight 3% post-composting increase. Both CK and T2 groups showed reductions (7% and 5% respectively). RES-Cd reached its lowest allocation during the thermophilic phase, suggesting unfavorable formation conditions. Final RES-Cd percentages decreased by 2% in CK, remained stable in T1, and increased 6% in T2.\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv id=\"Sec32\" class=\"Section2\"\u003e\u003ch2\u003e3.6 Correlation of Cd bioavailability with humification parameters and bacterial communities\u003c/h2\u003e\u003cdiv id=\"Sec33\" class=\"Section3\"\u003e\u003ch2\u003e3.6.1 Heatmap analysis of bacterial communities and decay parameters affecting Cd passivation\u003c/h2\u003e\u003cp\u003eFigure\u0026nbsp;17 presents a heatmap illustrating the correlations between environmental factors, decomposition parameters, and dominant bacterial communities during the composting process. In the CK treatment group (Fig.\u0026nbsp;17a), NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N and GI were the primary environmental factors and composting parameters showing significant positive correlations (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05 or p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) with bacterial communities. The presence of \u003cem\u003eSubdoligranulum\u003c/em\u003e, \u003cem\u003eBifidobacterium\u003c/em\u003e, \u003cem\u003eAgathobacter\u003c/em\u003e, and \u003cem\u003eFaecalibacterium\u003c/em\u003e perfringens was found to inhibit the conversion of other heavy metal fractions to RES-Cd. Other environmental factors showed no significant relationship with heavy metal speciation. These results indicate that while aerobic composting can partially passivate heavy metals, its effectiveness remains limited.\u003c/p\u003e\u003cp\u003eIn the T1 treatment group (Fig.\u0026nbsp;17b), NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N exhibited the strongest influence on bacterial community structure, showing positive correlations with pH, GI, and RES-Cd, while demonstrating negative correlations with C/N ratio, MC, OXI-Cd, and EX-Cd. Regarding Cd speciation, the genera \u003cem\u003eTauerella\u003c/em\u003e, \u003cem\u003eAcetanaerobacterium\u003c/em\u003e, \u003cem\u003eAeromonas\u003c/em\u003e, \u003cem\u003eComamonas\u003c/em\u003e and \u003cem\u003eVogesella\u003c/em\u003e showed negative correlations with EX-Cd, indicating their potential role in facilitating EX-Cd transformation. These same genera simultaneously displayed positive correlations with RES-Cd, suggesting their capacity to promote EX-Cd passivation and RES-Cd accumulation.\u003c/p\u003e\u003cp\u003eThe T2 treatment group analysis (Fig.\u0026nbsp;17c) revealed that NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N, GI, and RES-Cd were the top three environmental factors influencing bacterial community composition. Seven bacterial genera (\u003cem\u003eThauera\u003c/em\u003e, \u003cem\u003eAeromonas\u003c/em\u003e, \u003cem\u003eAzoarcus\u003c/em\u003e, \u003cem\u003eAcetanaerobacterium\u003c/em\u003e, \u003cem\u003eComamonas\u003c/em\u003e, \u003cem\u003eVogesella\u003c/em\u003e, and \u003cem\u003ePseudomonas\u003c/em\u003e) showed significant positive correlations (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) with RES-Cd content, while \u003cem\u003ePhascolarctobacterium\u003c/em\u003e exhibited a negative correlation. Comparative analysis with the T1 treatment group indicated that genera such as \u003cem\u003eThauera\u003c/em\u003e likely facilitate the transformation of EX-Cd. The observed positive correlation between these genera and RES-Cd content in the T2 treatment group suggests their potential role as key microbial taxa for effective Cd passivation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec34\" class=\"Section3\"\u003e\u003ch2\u003e3.6.2. Mantel test test for the influence of bacterial communities and decay parameters on Cd passivation\u003c/h2\u003e\u003cp\u003eTen bacterial genera showing high correlations with environmental and composting parameters were selected from each treatment for Mantel tests. Figure\u0026nbsp;18 presents the correlations between bacterial communities, environmental factors, and composting parameters, along with Mantel test results across treatments. In the CK treatment group (Fig.\u0026nbsp;18a), the ten genera clustered into three groups: Group P (\u003cem\u003eProteobacteria\u003c/em\u003e, including \u003cem\u003eAzoarcus\u003c/em\u003e and \u003cem\u003eDesulfovibrio\u003c/em\u003e), Group F (\u003cem\u003eFirmicutes\u003c/em\u003e, including \u003cem\u003eFaecalibacterium\u003c/em\u003e and \u003cem\u003eBifidobacterium\u003c/em\u003e), and Group B (\u003cem\u003eMacrococcus\u003c/em\u003e). The T1 treatment group (Fig.\u0026nbsp;18b) showed Group P (\u003cem\u003eProteobacteria\u003c/em\u003e, including \u003cem\u003eTaenia\u003c/em\u003e and \u003cem\u003eAzoarcus\u003c/em\u003e), Group F (\u003cem\u003eFirmicutes\u003c/em\u003e, including \u003cem\u003eOscillospira\u003c/em\u003e and \u003cem\u003eWeissella\u003c/em\u003e), and Group B (\u003cem\u003eBacteroidetes\u003c/em\u003e, including \u003cem\u003eMegamonas\u003c/em\u003e), where Group P significantly correlated with GI and EX-Cd, Group F showed partial factor correlations, and Group B exhibited multiple high correlations. In the T2 treatment group (Fig.\u0026nbsp;18c), Group P (\u003cem\u003eProteobacteria\u003c/em\u003e, including \u003cem\u003ePseudomonas\u003c/em\u003e and \u003cem\u003eVogesella\u003c/em\u003e) and Group F (\u003cem\u003eFirmicutes\u003c/em\u003e, including \u003cem\u003eLactobacillus\u003c/em\u003e and \u003cem\u003ePhascolarctobacterium\u003c/em\u003e) demonstrated significant positive correlations with NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N, GI, and RES-Cd. Notably, Group B displayed similar correlation patterns between T1 and T2 treatments regarding environmental factors and composting parameters.\u003c/p\u003e"},{"header":"4 Discussion","content":"\u003cdiv id=\"Sec36\" class=\"Section2\"\u003e\u003ch2\u003e4.1 Analysis of in situ screening, compounding and putrefactive effect of Cd-resistant bacterial strains\u003c/h2\u003e\u003cp\u003eThis study successfully isolated three high-performing bacterial strains from fresh chicken manure that demonstrated cadmium (Cd) passivation and organic matter decomposition capabilities. Following morphological and molecular characterization, these strains were identified as \u003cem\u003eEnterobacter cloacae\u003c/em\u003e (LB3), \u003cem\u003eEnterobacter cloacae\u003c/em\u003e (LB4), and \u003cem\u003eBacillus velezensis\u003c/em\u003e (J-1-2). Antagonism tests revealed no inhibitory interactions among these strains. Subsequent formulation of composite bacterial consortia demonstrated superior Cd passivation and decomposition performance compared to individual strains. Notably, the LB3\u0026thinsp;+\u0026thinsp;LB4 and LB3\u0026thinsp;+\u0026thinsp;LB4\u0026thinsp;+\u0026thinsp;J-1-2 consortia exhibited particularly promising results, achieving EX-Cd passivation efficiencies of 69.25% and 71.35% respectively, along with 12.70% and 12.79% increases in decomposition rates compared to the control (CK). Based on these findings, these two consortium formulations were selected for subsequent composting experiments.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec37\" class=\"Section2\"\u003e\u003ch2\u003e4.2 Influence of microbial additives on the humification process of composts\u003c/h2\u003e\u003cp\u003eDuring the initial composting phase, both T1 and T2 treatment groups exhibited higher pH values compared to the CK group. This phenomenon can be explained by the metabolic activity of the inoculated microorganisms (\u003cem\u003eEnterobacter cloacae\u003c/em\u003e and \u003cem\u003eBacillus velezensis\u003c/em\u003e), which accelerated organic matter decomposition and ammonia release. Concurrently, the substantial ammonium ions generated through nitrogen mineralization neutralized organic and inorganic acid production[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], collectively contributing to pH elevation. The introduced microorganisms also rapidly metabolized readily degradable substrates (for example, sugars, proteins, etc.), generating significant metabolic heat that prompted faster temperature increases in T1 and T2 piles and extended their thermophilic phases. Notably, while Bacillus velezensis in T2 is thermotolerant[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], its early-stage substrate competition potentially suppressed certain bacterial populations, thereby moderating their organic decomposition efficiency and temperature rise kinetics. In contrast, the CK group amended with sterile water demonstrated slower heating rates due to its limited microbial diversity and reduced metabolic activity.\u003c/p\u003e\u003cp\u003eBy composting completion, all treatment groups achieved C/N ratios below 20-meeting the established threshold for mature compost (studies indicate decomposition occurs at C/N\u0026thinsp;\u0026lt;\u0026thinsp;20[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]). The T1 group exhibited the lowest C/N ratio, attributable to enhanced organic matter degradation by microbial activity[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. During the thermophilic phase, T1 and T2 groups demonstrated the most pronounced moisture reduction rates. This resulted from dual mechanisms: (1) water utilization for microbial growth and (2) activated water consumption by the inoculated microbial consortia to boost metabolic activity[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. These processes stimulated organic matter mineralization and heat generation, consequently accelerating moisture evaporation and loss.\u003c/p\u003e\u003cp\u003eThis experiment demonstrated that all three treatment groups eventually achieved the target E4/E6 ratio for compost maturity[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], with T1 and T2 reaching the standard range by day 26. Notably, the T2 group exhibited the lowest E4/E6 ratio during the maturation phase, reflecting enhanced organic matter decomposition through microbial activity. These results confirm that our composite bacterial consortium effectively promotes more thorough compost degradation. The T2 group's Bacillus sphaericus contributed additional benefits by secreting plant growth hormones like IAA[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], accelerating seed germination rates. This explains T2's faster GI increase, achieving 80% maturity (indicating phytotoxin-free status[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]) on day 23 (the earliest attainment among all groups). The microbial inoculation appears to neutralize seed germination inhibitors while accelerating compost maturation. Furthermore, Bacillus sphaericus modulated nitrogen metabolism through multiple mechanisms: (1) suppressing ammonification of nitrogenous compounds, (2) immobilizing ammonium within the compost matrix, (3) enhancing nitrification, and (4) facilitating microbial nitrogen fixation[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Consequently, T2 showed optimal nitrogen speciation with minimal ammonium and maximal nitrate accumulation.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec38\" class=\"Section2\"\u003e\u003ch2\u003e4.3 Influence of microbial additives on microbial community succession in composting\u003c/h2\u003e\u003cp\u003eAs the composting progressed, all treatment groups demonstrated increasing bacterial OTU numbers across all four phases. Notably, both bacteriophage-treated groups exhibited more pronounced increases than the CK group. This enhancement primarily resulted from the added bacteriophages optimizing the composting environment through synergistic effects, directing microbial community dynamics, and accelerating the process-all of which collectively fostered microbial proliferation and diversity.\u003c/p\u003e\u003cp\u003eThis study revealed a characteristic 'high-low-high' fluctuation pattern in microbial diversity indices across all treatment groups during composting. In the warming phase, inoculated thermophilic bacteria dominated the T1 and T2 groups, extensively decomposing soluble organic matter[\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. This metabolic activity not only sustained their own proliferation but also stimulated generalized microbial growth, driving rapid diversity index elevation. The subsequent thermophilic phase saw temperature increases suppress mesophilic bacterial activity, allowing thermally-tolerant populations to dominate. As these thermophiles represent a narrower taxonomic range, their predominance reduced overall diversity - a phenomenon attributable to drastic community succession[\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e], with parallel observations reported in textile waste composting systems[\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. During maturation, decreasing pile temperatures reactivated mesophilic communities that utilized thermophilic-phase metabolites, ultimately restoring microbial diversity.\u003c/p\u003e\u003cp\u003eThis experiment identified four dominant phyla throughout the composting process: \u003cem\u003eBacteroidetes\u003c/em\u003e, \u003cem\u003eActinobacteria\u003c/em\u003e, \u003cem\u003eFirmicutes\u003c/em\u003e ,and \u003cem\u003eProteobacteria\u003c/em\u003e, collectively representing\u0026thinsp;\u0026gt;\u0026thinsp;85% of total microbial abundance; this distribution pattern aligns with prior research[\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. \u003cem\u003eFirmicutes\u003c/em\u003e demonstrated the highest relative abundance in all phases except maturation, aligning with its established role as primary carbohydrate degraders[\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Their prevalence peaked during thermophilic phases (89.51%), then sharply declined to 15.06% in maturation, reflecting intensive carbohydrate utilization during early composting and near-complete depletion by maturation.\u003c/p\u003e\u003cp\u003e\u003cem\u003eProteobacteria\u003c/em\u003e, the second most abundant phylum, maintained stable distribution across all phases[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e], reaching maximum abundance (46.01%-58.90%) during maturation. Meanwhile, the abundance of \u003cem\u003eChloroflexi\u003c/em\u003e, an important group of bacteria for decomposing difficult-to-degrade macromolecules, also increased significantly (to 11.82%-15.36%) during the humification period. The substantial presence of \u003cem\u003eProteobacteria\u003c/em\u003e and \u003cem\u003eChloroflexi\u003c/em\u003e during this phase confirms maturation as the critical period for lignocellulose decomposition, corroborating Qing's findings[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Bacteroidetes possess similar capabilities for decomposing both sugars and macromolecular organic matter[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. The cellulose-rich rice husk and feather amendments in this experiment provided optimal substrates for Bacteroidetes growth. Notably, their abundance decreased significantly during the maturation phase compared to the thermophilic phases, suggesting near-complete decomposition of these macromolecules prior to maturation.\u003c/p\u003e\u003cp\u003eThe microbial community composition exhibited distinct phase-dependent shifts during composting. In the initial phase, dominant genera included \u003cem\u003ePrevotella\u003c/em\u003e, \u003cem\u003ePhascolarctobacterium\u003c/em\u003e, \u003cem\u003eMegamonas\u003c/em\u003e, and \u003cem\u003eLactobacillus\u003c/em\u003e, while the maturation phase was characterized by \u003cem\u003eVogesella\u003c/em\u003e, \u003cem\u003eAeromonas\u003c/em\u003e, \u003cem\u003ePseudomonas\u003c/em\u003e, and \u003cem\u003eThauera\u003c/em\u003e dominance. Notably, Bacteroides reached peak abundance during the thermophilic phase, consistent with its proteolytic function in degrading readily available substrates. Pseudomonas demonstrated a characteristic progression: lowest abundance during warming, moderate increase in the thermophilic phase, and maximal levels during maturation; this pattern correlated with post-thermophilic nitrate accumulation dynamics.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec39\" class=\"Section2\"\u003e\u003ch2\u003e4.4 Effect of microbial additives on the passivation of heavy gold during composting process\u003c/h2\u003e\u003cp\u003eAnalysis of Cd speciation under different treatments revealed that OXI-Cd consistently constituted the dominant fraction. Throughout composting, OXI-Cd content progressively increased, thereby enhancing Cd immobilization. This observed increase likely stems from microbial metabolites (e.g., oxidative enzymes) generated during composting[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e], which facilitate Cd ion oxidation and subsequent conversion from reduced to oxidized states. RED-Cd represented the second largest fraction but remained relatively stable across all treatments. During the thermophilic phase, T1 and T2 groups exhibited significant EX-Cd reduction concurrent with RES-Cd increase, demonstrating favorable conditions for Cd immobilization. This stabilization likely derived from dual mechanisms: (1) organic matter decomposition-induced heat and moisture loss, and (2) complexation between Cd and humic substance functional groups. Furthermore, the inoculated microbial consortia contributed through surface functional groups (carboxyl, amino, hydroxyl) that adsorbed EX-Cd, converting exchangeable fractions to cell-bound forms[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eLSD analysis indicated significantly enhanced OXI-Cd immobilization in all treatment groups versus control (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), despite comparable EX-Cd passivation efficiency. These results collectively demonstrate composting's effectiveness for Cd stabilization, with the T2 microbial consortium showing superior performance.\u003c/p\u003e\u003c/div\u003e"},{"header":"5 Conclusions","content":"\u003cp\u003eIn this study, chicken manure was used as the raw material for aerobic composting experiments. A composite bacterial agent\u0026mdash;capable of promoting compost decomposition and passivating the heavy metal Cd\u0026mdash;was screened and added to the process. The effects of this composite bacterial agent were systematically investigated, including its impact on compost decomposition parameters, bacterial community structure, and the morphological distribution of Cd. The results showed that the three strains obtained from fresh chicken manure through in situ screening, isolation, and purification performed better in promoting Cd passivation and organic decomposition when combined into a composite bacterial agent, as no antagonism was observed among them. Among the combinations tested, LB3\u0026thinsp;+\u0026thinsp;LB4 and LB3\u0026thinsp;+\u0026thinsp;LB4\u0026thinsp;+\u0026thinsp;J-1-2 exhibited the most desirable effects, making them suitable for subsequent composting experiments.\u003c/p\u003e\u003cp\u003eIn terms of promoting compost decay, microbial agent inoculation accelerated the onset of the high-temperature phase. Among the treatments, the T1 group exhibited a prolonged high-temperature duration, complete organic matter degradation, and the lowest final C/N ratio. In contrast, the T2 group (supplemented with the nitrogen-fixing bacterium Bacillus sphaericus) significantly reduced nitrogen loss, as evidenced by the highest NO\u003csub\u003e3\u003c/sub\u003e\u003csup\u003e\u0026minus;\u003c/sup\u003e-N and lowest NH\u003csub\u003e4\u003c/sub\u003e\u003csup\u003e+\u003c/sup\u003e-N contents. Both composite bacterial agent treatments accelerated compost maturation. Notably, the T2 group reached 80% maturation by day 23\u0026mdash;the earliest among all groups\u0026mdash;and showed the lowest E4/E6 ratio, indicating more advanced humification. These results demonstrate that composite bacterial agents enhance compost quality by accelerating organic matter transformation and improving fertilisation efficiency.\u003c/p\u003e\u003cp\u003eRegarding bacterial community structure, both T1 and T2 treatment groups showed significantly higher Ace and Chao1 indices than the control group (CK) during the thermophilic phase, while their Shannon indices were superior during the maturation phase. The dominant phyla throughout composting were \u003cem\u003eFirmicutes\u003c/em\u003e and \u003cem\u003eProteobacteria\u003c/em\u003e. The composite microbial agents precisely modulated the abundance of these key phyla, altered genus-level composition, and optimized microbial ecological functions. These changes subsequently influenced material-energy metabolism, improved the composting process, and enhanced the system's overall adaptability.\u003c/p\u003e\u003cp\u003eRegarding the passivation mechanism of Cd, the T2 treatment group showed a significant reduction in EX-Cd from 27\u0026ndash;9%, achieving 66.6% passivation efficiency. Concurrently, the RES-Cd content increased, indicating that the fungal treatment effectively passivated the exchangeable Cd fraction. Correlation analyses revealed that \u003cem\u003eThauera\u003c/em\u003e were negatively correlated with EX-Cd, while synergistic associations between key \u003cem\u003eProteobacteria\u003c/em\u003e genera and multiple factors were identified, establishing their central roles in cadmium passivation and compost maturation. These microbial communities influence the composting process through two primary mechanisms: (1) modifying compost physicochemical properties and heavy metal speciation through metabolic secretions, and (2) reducing Cd bioavailability and mobility via ion exchange, adsorption-complexation, and precipitation. Concurrently, they participate in nutrient cycling and enzymatic regulation to optimize the composting environment, ultimately enhancing both heavy metal stabilization and compost quality.\u003c/p\u003e\u003cp\u003eThis study provides crucial microbiological evidence and innovative technical approaches for safe livestock manure composting, soil ecological protection, and sustainable agricultural development. Current limitations include the need to: (1) determine optimal inoculation parameters for Enterobacter and Bacillus to maximize cadmium immobilization, and (2) elucidate the specific biochemical mechanisms underlying cadmium immobilization in future studies.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eInstitutional Review Board Statement\u003c/h2\u003e\u003cp\u003eNot applicable.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eConflicts of Interest:\u003c/h2\u003e\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding:\u003c/h2\u003e\u003cp\u003eThis research received no external funding.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eAuthor Contributions: Conceptualization, X.M. and X.S.; methodology, W.L.; software, W.L. and J.B.; validation, W.L. and H.Y. ; formal analysis, W.L.; investigation, W.L.; resources, J.M. and X.M.; data curation, W.L. and D.X.; writing\u0026mdash;original draft preparation, W.L.; writing\u0026mdash;review and editing, X.M.; visualization, P.T.; supervision, R.Z.; project administration, J.L.; funding acquisition, X.M. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgement\u003c/h2\u003e\u003cp\u003eAcknowledgments: The author gratefully acknowledges the support from the 2024 Jiangsu Modern Agricultural Machinery Equipment and Technology Promotion Project (Grant No. NJ2024-32).\u003c/p\u003e\u003ch2\u003eData Availability Statement:\u003c/h2\u003e\u003cp\u003eThe original contributions presented in the study are included in the article/supplementary material, further inquiries can be directed to the corresponding authors.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWang, Y.Z.; Zhang, Y.L.; Li, J.X.; Lin, J.G.; Zhang, N.; Cao, W.Z. Biogas energy generated from livestock manure in China: Current situation and future trends. J. Environ. Manage. 2021, 297, 113324.\u003c/li\u003e\n\u003cli\u003eZhi, C.; Ruizhi, X.; Xinggui, Y. Enhanced in situ Pb(II) passivation by biotransformation into chloropyromorphite during sludge composting. [J]. Journal of hazardous materials. 2020, 408, 124973-124973.\u003c/li\u003e\n\u003cli\u003eHern\u0026aacute;ndez, D.; Polo, A.; Plaza, C. Long-term effects of pig slurry on barley yield and N use efficiency under semiarid Mediterranean conditions [J]. European Journal of Agronomy. 2013, 44, 78-86.\u003c/li\u003e\n\u003cli\u003eShengnan, L.; Stevy, B.O.; Shih-Hsin, H. Emerging soil contamination of antibiotics resistance bacteria (ARB) carrying genes (ARGs): New challenges for soil remediation and conservation [J]. Environmental Research. 2023, 219, 115132-115132.\u003c/li\u003e\n\u003cli\u003eAsja, K.; Pauline, W.; Lauren, B. Persistence and Decay of Fecal Microbiota in Aquatic Habitats. [J]. Microbiology and molecular biology reviews : MMBR. 2019, 83 (4):\u003c/li\u003e\n\u003cli\u003eBernal, M.P.; Alburquerque, J.A.; Moral, R. Composting of animal manures and chemical criteria for compost maturity assessment. A review[J]. Bioresource Technology. 2009, 100(22): 5444-5453.\u003c/li\u003e\n\u003cli\u003eAbebe, N.; Bayu, D.; Milkyas, A. Effect of microbial inoculation on nutrient turnover and lignocellulose degradation during composting: A meta-analysis [J]. Waste Management. 2021, 125,220-234.\u003c/li\u003e\n\u003cli\u003eZheng, J. R.; Luo, L.J.; Le, Z.X. Isolation and Identification of Thermostable Strains from Chicken Manure Compost: A Preliminary Application[J]. Journal of Subtropical Resources and Environment. 2021,16(3):9-16.\u003c/li\u003e\n\u003cli\u003eAnsari, M.I.; Malik, A. Biosorption of nickel and cadmium by metal resistant bacterial isolates from agricultural soil irrigated with industrial wastewater[J]. Bioresource Technology. 2007, 98(16): 3149-3153.\u003c/li\u003e\n\u003cli\u003eDawoon, J.; Liwei, L.; Shan, H. Application of in situ cultivation in marine microbial resource mining [J]. Marine Life Science \u0026amp; Technology. 2020, 3 (2): 148-161.\u003c/li\u003e\n\u003cli\u003eMianshen, G.; Yujun, S.; Jingtao, D. New insight into the impact of moisture content and pH on dissolved organic matter and microbial dynamics during cattle manure composting [J]. Bioresource Technology. 2022, 344 (PA): 126236-126236.\u003c/li\u003e\n\u003cli\u003eTaha, M.A.; Junqiu, W.; Yue,Z. Insights into enzyme activity and phosphorus conversion during kitchen waste composting utilizing phosphorus-solubilizing bacterial inoculation. [J]. Bioresource technology. 2022, 362, 127823-127823.\u003c/li\u003e\n\u003cli\u003eJain, S.M.; Jambhulkar, R.; Kalamdhad, S.A. Biochar amendment for batch composting of nitrogen rich organic waste: Effect on degradation kinetics, composting physics and nutritional properties [J]. Bioresource Technology. 2018, 253, 204-213.\u003c/li\u003e\n\u003cli\u003eVandecasteele, B.; Willekens, K.; Zwertvaegher, A. Effect of composting on the Cd, Zn and Mn content and fractionation in feedstock mixtures with wood chips from a short-rotation coppice and bark [J]. Waste Management. 2013, 33 (11): 2195-2203.\u003c/li\u003e\n\u003cli\u003eChi, Y.; Ma, X.; Chu, S. Nitrogen cycle induced by plant growth-promoting rhizobacteria drives \u0026quot;microbial partners\u0026quot; to enhance cadmium phytoremediation. [J]. Microbiome. 2025, 13 (1): 113.\u003c/li\u003e\n\u003cli\u003eArya, M.; Shahi, N.; Bisht,I. Probiotic potential of Bacillus velezensis STPB10 sourced from the gut microbiota of a hillstream fish Schizothorax richardsonii (Gray, 1832) for aquaculture applications. [J]. Scientific reports. 2025, 15 (1): 17580.\u003c/li\u003e\n\u003cli\u003eAzis, A.F.; Choo, M.; Suhaimi, H. The Effect of Initial Carbon to Nitrogen Ratio on Kitchen Waste Composting Maturity [J]. Sustainability. 2023, 15 (7):\u003c/li\u003e\n\u003cli\u003eXiaorui, T.; Runyu, G.; Yage, L. Enhancing nitrogen conversion and microbial dynamics in swine manure composting process through inoculation with a microbial consortium [J]. Journal of Cleaner Production. 2023, 423.\u003c/li\u003e\n\u003cli\u003eCao, R.; Huang, Y.; Li, R. Regulation of nitrogen transformation and microbial community by inoculation during livestock manure composting. [J]. Environmental microbiology reports. 2024, 16 (2): e13256-e13256.\u003c/li\u003e\n\u003cli\u003eOzdemir, S.; Dede, G.; Dede, H.O. Composting of sewage sludge with mole cricket: stability, maturity and sanitation aspects [J]. International Journal of Environmental Science and Technology. 2019, 16 (10): 5827-5834.\u003c/li\u003e\n\u003cli\u003eKenfaoui, J.; Dutilloy, E.; Benchlih, S. Bacillus velezensis: a versatile ally in the battle against phytopathogens-insights and prospects. [J]. Applied microbiology and biotechnology. 2024, 108 (1): 439.\u003c/li\u003e\n\u003cli\u003eKong, Y.; Zhang, J.; Zhang, X. Applicability and limitation of compost maturity evaluation indicators: A review [J]. Chemical Engineering Journal. 2024, 489, 151386-.\u003c/li\u003e\n\u003cli\u003eKazutaka, K.; Akihiro, T.; Kenich, F. Application of Bacillus sp. TAT105 to reduce ammonia emissions during pilot-scale composting of swine manure. [J]. Bioscience, biotechnology, and biochemistry. 2017, 81 (12): 2400-2406.\u003c/li\u003e\n\u003cli\u003eAyodeji, B.; Abiola, O.; Sun, Y. Dynamics of fungal species related to nitrogen transformation and their network patterns during cattle manure-corn straw with biochar composting. [J]. Archives of microbiology. 2022, 204 (4): 236-236.\u003c/li\u003e\n\u003cli\u003eIlaria, F.; Antonio, F.; Ludovica, R. Thermophilic bacteria and their thermozymes in composting processes: a review [J]. Chemical and Biological Technologies in Agriculture. 2023, 10 (1):\u003c/li\u003e\n\u003cli\u003eSaloua, B.; Mohammed, M.; Taisija, D. Microbial community dynamics in the mesophilic and thermophilic phases of textile waste composting identified through next-generation sequencing [J]. Scientific Reports. 2021, 11 (1): 23624-23624.\u003c/li\u003e\n\u003cli\u003eZhou, H.; Gu, W.J.; Sun, W. A microbial community snapshot of windrows from a commercial composting facility[J]. Applied Microbiology and Biotechnology. 2018, 102: 8069-8077.\u003c/li\u003e\n\u003cli\u003eAwasthi, M.K.; Zhang, Z.; Wang, Q. New insight with the effects of biochar amendment on bacterial diversity as indicators of biomarkers support the thermophilic phase during sewage sludge composting[J]. Bioresource Technology. 2017, 238: 589-601.\u003c/li\u003e\n\u003cli\u003eTakaku, H.; Kodaira, S.; Kimoto, A. Microbial communities in the garbage composting with rice hull as an amendment revealed by culture-dependent and independent approaches[J]. Journal of Bioscience and Bioengineering. 2006, 101(1): 42-50.\u003c/li\u003e\n\u003cli\u003eQingxin, M.; Wei, Y.; Mengqi, M. Microbial Community Succession and Response to Environmental Variables During Cow Manure and Corn Straw Composting. [J]. Frontiers in microbiology. 2019, 10 529.\u003c/li\u003e\n\u003cli\u003ePascal, L.; Vincent, L.; Elodie, D. Bacteroidetes use thousands of enzyme combinations to break down glycans. [J]. Nature communications. 2019, 10 (1): 2043.\u003c/li\u003e\n\u003cli\u003eChangning, L.; Haiyun, L.; Tuo, Y. Effects of swine manure composting by microbial inoculation: Heavy metal fractions, humic substances, and bacterial community metabolism [J]. Journal of Hazardous Materials. 2021, 415, 125559-125559.\u003c/li\u003e\n\u003cli\u003eZhu, G.; Wang, X.; Du, R. Adsorption of Cd2+ by Lactobacillus plantarum Immobilized on Distiller\u0026rsquo;s Grains Biochar: Mechanism and Action [J]. Microorganisms. 2024, 12 (7): 1406-1406.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"international-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"intm","sideBox":"Learn more about [International Microbiology](https://www.springer.com/journal/10123)","snPcode":"10123","submissionUrl":"https://submission.nature.com/new-submission/10123/3","title":"International Microbiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Aerobic compost, Humification, Heavy metal Cd, Passivation, Composite strain","lastPublishedDoi":"10.21203/rs.3.rs-7361044/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7361044/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"The \"concentration effect\" of heavy metals during aerobic composting of livestock and poultry manure and the associated pollution risks upon land application represent significant challenges in the agricultural waste resource utilization. Enhancing composting efficiency and passivating heavy metal Cd through microbial approaches are key to achieving safe disposal and resource recovery of manure. This study aimed to screen composite microbial strains capable of simultaneously promoting compost maturation and Cd passivation, investigating their mechanisms of action on the composting process, microbial community succession, and Cd speciation transformation. Cd-resistant strains were isolated and purified from chicken manure using in situ screening techniques, and a composite microbial inoculum was prepared using Enterobacter hormaechei (LB3), Enterobacter cloacae (LB4), and Bacillus velezensis (J-1-2). Composting experiments were conducted with a control group (CK) and two treatment groups: T1 (LB3+LB4) and T2 (LB3+LB4+J-1-2). Maturity parameters, Cd speciation distribution, and microbial community dynamics were monitored, with high-throughput sequencing and correlation analysis employed to elucidate the underlying mechanisms. The results demonstrated that the composite inoculum significantly optimized the composting process. The T1 group exhibited an extended thermophilic phase and more thorough organic matter degradation (lowest C/N ratio of 14.88), while the T2 group showed optimal nitrogen retention (highest NO3--N content of 1504 mg/kg and lowest NH4+-N content of 153 mg/kg). Microbial community analysis revealed that the Ace and Chao1 indices of T1 and T2 increased by 1.5－1.8 times compared to CK during the heating phase, while the Shannon index at maturity was 10.13% and 22.40% higher than CK, respectively. The Cd passivation efficiency was highest in T2 (66.7%), with the EX-Cd fraction decreasing from 27% to 9%. Notably, key taxa such as Thauera (Proteobacteria) showed a significant positive correlation with RES-Cd (p\u003c 0.01). In conclusion, the composite inoculum accelerated organic matter decomposition and maturation by modulating microbial community structure, while synergistically passivating Cd through adsorption and complexation mechanisms involving key genera (e.g., Thauera). This study provides theoretical and technical support for the safe composting of livestock manure and heavy metal pollution control.","manuscriptTitle":"Mechanisms of Enterobacter and Bacillus in promoting aerobic composting and immobilization of Cd in livestock and poultry manure","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-09-03 13:24:22","doi":"10.21203/rs.3.rs-7361044/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-09T12:24:44+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-09T01:38:46+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-08T07:45:19+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"159942114485223321514279026931702249433","date":"2025-08-31T02:21:36+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"210085581848342529146815813757286689209","date":"2025-08-30T10:29:08+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-27T10:01:54+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-27T10:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-14T22:20:58+00:00","index":"","fulltext":""},{"type":"submitted","content":"International Microbiology","date":"2025-08-13T05:23:16+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"international-microbiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"intm","sideBox":"Learn more about [International Microbiology](https://www.springer.com/journal/10123)","snPcode":"10123","submissionUrl":"https://submission.nature.com/new-submission/10123/3","title":"International Microbiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"9564e4ae-cc8f-4e63-a9ea-8f706862d582","owner":[],"postedDate":"September 3rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-10-20T15:59:13+00:00","versionOfRecord":{"articleIdentity":"rs-7361044","link":"https://doi.org/10.1007/s10123-025-00730-y","journal":{"identity":"international-microbiology","isVorOnly":false,"title":"International Microbiology"},"publishedOn":"2025-10-16 15:56:51","publishedOnDateReadable":"October 16th, 2025"},"versionCreatedAt":"2025-09-03 13:24:22","video":"","vorDoi":"10.1007/s10123-025-00730-y","vorDoiUrl":"https://doi.org/10.1007/s10123-025-00730-y","workflowStages":[]},"version":"v1","identity":"rs-7361044","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7361044","identity":"rs-7361044","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}