Glucocorticoid-induced Leucine Zipper (GILZ) is a novel secreted protein by intestinal L-cells and is dysregulated during active ulcerative colitis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Glucocorticoid-induced Leucine Zipper (GILZ) is a novel secreted protein by intestinal L-cells and is dysregulated during active ulcerative colitis Lucrezia Rosati, Giuseppe Leoncini, Luigi Cari, Maria Rosaria Sette, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7590228/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 7 You are reading this latest preprint version Abstract The Glucocorticoid-Induced Leucine Zipper (GILZ) is a key mediator of the anti-inflammatory effects of glucocorticoids, primarily within the immune system. Recent evidence has implicated GILZ as a secretive protein in goblet cells, with reduced expression linked to active Inflammatory Bowel Disease (IBD), suggesting a role in intestinal cell homeostasis. In this context, GILZ has been found also in enteroendocrine cells (EEC), but its role remained undefined. This study aimed at identifying GILZ-expressing EEC subtypes, dissecting how the secretive function is affected by inflammation in human ulcerative colitis (UC) and exploring its role in these cells. GILZ was predominantly expressed in glucagon-like-peptide-1 (GLP-1)-secreting L-cells, across all stages of EEC differentiation. GILZ was also expressed in serotonin (5HT)-producing enterochromaffin cells (EC), even though at low levels. Such an expression profile was supported by analysis of publicly available single-cell RNA sequencing datasets, identifying both EEC progenitors and mature subsets. Interestingly, confocal immunofluorescence localized GILZ to cytoplasmic granules partially co-staining with GLP-1-containing vesicles. Histological analysis of mucosal colonic biopsies revealed a global reduction in EEC during active UC as compared to healthy individuals and quiescent UC. Specifically, GILZ-expressing L-cells were significantly reduced in active UC and only partially restored in quiescent disease. In contrast, 5HT-producing EC cells were still reduced during active UC but fully recovered in quiescent disease. In vitro , NCI-H716 L-cell line-secreted products reduced IL-8 secretion in Caco2 epithelial cells, indicating an anti-inflammatory effect. This activity was attenuated following GILZ silencing. Interestingly, treatment with a recombinant TAT-GILZ protein directly diminished IL-8 in Caco2 cells. Collectively, our findings identify GILZ as a novel secretory product of L-cells with potential anti-inflammatory properties. Restoring GILZ secretion may represent a promising therapeutic strategy to mitigate chronic intestinal inflammation in UC. Health sciences/Diseases/Gastrointestinal diseases/Inflammatory bowel disease/Ulcerative colitis Biological sciences/Immunology/Inflammation Health sciences/Anatomy/Gastrointestinal system/Large intestine/Colon Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction GILZ is a glucocorticoid-induced gene that mimics several anti-inflammatory effects of glucocorticoids in immune cells, as reported by studies in pre-clinical models of chronic/inflammatory diseases, including colitis [ 1 – 10 ]. The recent identification of GILZ as a secretive protein in human goblet cells has broaden the array of its functional implications, opening considerations on its secretive role into GI tract and beyond. While reduced expression of GILZ in goblet cells has been correlated with neutrophil mucosal infiltration and disease activity in IBD patients, the observation of GILZ expression in EEC remained unexplored [ 11 ]. EEC are epithelial cells interspersed throughout the GI mucosa, which are triggered to release neuroendocrine peptides and hormones into the lamina propria after stimulation by bacterial metabolites and food-derived molecules [ 12 , 13 ]. In addition, EEC display neuronal axon-like properties, producing vesicles for synaptic transmission [ 14 , 15 ]. Once delivered into the lamina propria , hormones can act on both local cells and neurons ( paracrine mode), as well as on distant cellular targets, exploiting either the blood stream ( endocrine mode) or the synaptic transmission ( synaptic mode) [ 16 ]. Although the density of EEC is typically low throughout the GI mucosa, accounting for about 1% of the epithelial cells, they constitute the largest endocrine organ capable to link the gut to extra-intestinal organs, including the brain [ 17 , 18 ]. Currently, the use of organoid-based platform of human EECs have contributed to bridge the gap in the study of EEC secretome, leading to the release of an atlas of human EEC subtypes [ 19 ]. New peptides that are secreted by EEC cells have been identified, but the list is still incomplete [ 20 ]. Furthermore, recent single cell studies revealed that human EEC secreted peptides not always overlapped with their murine counterpart [ 21 ]. Colonic EEC differentiate from pluripotent LRG5 + stem cells, which are located deep into the crypt. Lineage differentiation proceeds via activation of Math1, Neurogenin 3 (NGN3), and Neurogenic differentiation factors [ 22 , 23 ]. A recent classification subdivided colonic EEC into enterochromaffin (EC) cells, which are responsible for serotonin (5-HT) secretion, and L-cells, identified as pro-glucagon and peptide YY (PYY) source [ 24 ]. Pro-glucagon is further processed into glucagon-like peptide 1 (GLP-1) and GLP-2. GLP-1 is involved in glucose metabolism, inhibition of gastric emptying, negative regulation of food intake and body weight, whereas GLP-2 promotes crypt cell proliferation, intestinal stem cell expansion, and intestinal growth [ 17 , 25 , 26 ]. IBD is a clinical term including ulcerative colitis (UC) and Crohn’s disease (CD), which are chronic relapsing diseases affecting the patients’ quality of life, also representing an economic burden worldwide. The propensity to relapse and disease-related complications are the major challenges to face in the clinical management and treatment planning of IBD patients [ 27 ]. Pharmacological treatments include glucocorticoids, non-steroidal anti-inflammatory drugs (NSAID), azathioprine and biologic agents. Nonetheless, achieving deep clinical remission still remains elusive [ 28 , 29 ]. The impact of inflammatory processes on EEC is currently a matter of debate. While some Authors have been referring to IBD as a potential risk factor for neuroendocrine cell proliferations, ranging from neuroendocrine hyperplasia and micronests to neuroendocrine tumors (NET), others have seen no significant association between IBD and neuroendocrine proliferation [ 30 – 33 ]. On the other hand, the influence of EEC on immune homeostasis has been proposed and the loss of EEC in diseases leading to gut dysfunctions corroborated that hypothesis. Such a critical role of EEC is further supported by the finding of abnormal permeability and inflammatory signature in experimental studies with EEC-deficient human organoids, underscoring their function as key regulators of intestinal inflammation [ 24 , 34 – 40 ]. The present study aimed at characterizing the expression and distribution of GILZ in distinct EEC subtypes, in both healthy individuals and UC patients. GILZ was found to be predominantly expressed in L-cells, including both precursors and mature cell populations. GILZ was also localized to intracellular vesicles partially co-expressing GLP-1 and Synaptophysin. These findings were confirmed by interrogating transcriptomic datasets. Immunofluorescence analysis revealed a reduction in the number of EEC, both L-cells and enterochromaffin cells (EC), in active UC. To investigate the functional role of GILZ in L-cells, in vitro experiments with the human L-cell line NCI-H716 and epithelial Caco2 cells demonstrated GILZ to be a new protein secreted by L-cells acting as a potential anti-inflammatory mediator. Results GILZ is expressed in distinct subtypes of EEC in the human colon GILZ expression has been previously established in human goblet cells by our group [ 11 ]. We also observed that GILZ was expressed in the cytoplasm of other cells, which exhibited apico-basal polarity by immunofluorescence staining (Supplementary Fig. 1). In a co-staining with GILZ, EEC were identified as immunoreactive both for synaptophysin (SYP) and Chromogranin A (ChgA). The results demonstrated the presence of GILZ in almost all EEC (Fig. 1 , white arrowheads), even though isolated EEC resulted GILZ negative (GILZ − ) (yellow arrowheads). A recent t -distributed stochastic neighbor embedding ( t -SNE) analysis visualized two distinct clusters of EEC in the colon, the EC and L-cells [ 19 , 41 ]. The confocal images of Fig. 2 A (magnification) and Supplementary Fig. 2 (wide field) show that 5HT-positive (5HT + ) cells expressed very low or negligible levels of GILZ (light blue arrows, from now on identified as GILZ low /5-HT + ), while 5HT − cells expressed high levels of GILZ (white arrows, from now on identified as GILZ high /5-HT − ). The amount of GILZ protein in GILZ high /5-HT − and GILZ low /5-HT + single cells was quantitated by densitometric analysis resulting by mean 14-fold higher in the former (mean: 409.5 ± 37.1 vs 29.2 ± 4.6) ( Fig. 2 B). Both 5HT + and 5HT − cells are GILZ + , but they express very different amount of GILZ protein. To further characterize the phenotype of GILZ high /5-HT − EEC, which according to recent work might be referred to as L-cells [ 24 , 41 ], we co-stained colon sections with anti-GLP-1 and anti-GILZ antibodies (Abs). The images in Fig. 3 A show that indeed GILZ high cells were positive for GLP-1, therefore they were identified as GILZ + /GLP-1 + L-cells (white arrows). Furthermore, a triple staining using anti-GILZ, anti-GLP-1 and anti-SYP Abs showed that GILZ exhibited a granular expression pattern, suggesting GILZ as a secreted protein by L-cells, similarly to GLP-1 (Fig. 3 B, arrowhead). Overlay images showed GILZ-GLP-1 partial co-localization. The extent of co-localization was calculated by ImageJ software with JACoP ImageJ plugin , as described in [ 42 ]. The Manders' coefficient of 0.335 means partial co-localization of GILZ with GLP-1 (about 30%), suggesting that the majority of GILZ- and GLP-1-containing cytoplasmic granules were distinct, thus implying independent vesicular secretion (Fig. 3 B, inset). Similarly, the overlay images of GILZ and SYP were analysed. The Manders' coefficient of 0.498 means partial co-localization of GILZ with SYP, but more extended than with GLP-1 (about 50%). An in depth analysis of this triple staining revealed that the majority of L-cells was GILZ + /GLP-1 + (white arrows), whereas a small subset was GILZ − /GLP-1 + (yellow arrows); conversely, another small proportion of EEC resulted GILZ − /GLP-1 − (light blue arrows), only exhibiting SYP expression, indicating that not all SYP + cells are L-cells and not all L-cells express GILZ (Supplementary Fig. 3). In a triple co-staining of GILZ, GLP-1 and 5-HT, all these findings were further confirmed (Supplementary Fig. 4). We next assessed the frequency of GILZ + /GLP-1 + L-cells over the total GLP-1 + cell population in ileal and colorectal biopsies from healthy individuals. Supplementary Fig. 5 shows an increasing gradient of cell density across the small and large bowel in healthy colonic mucosa. GILZ is expressed in progenitors and mature EEC Expression of preproglucagon (GCG), precursor of GLP-1 and GLP-2, is known to increase upward into the crypt, according to the stage of EEC differentiation [ 25 ]. The observation that GILZ + /GLP-1 + cells were scattered along the crypts (Supplementary Fig. 6) suggested that GILZ might be expressed at different stages of EEC development. To this end, we provided an assessment of GILZ expression in subsequent stages of EEC maturation, by co-staining colonic samples with anti-GILZ and anti-Neurogenin 3 (NGN3) Abs. NGN3 is a transcription factor that drives EEC commitment and is considered a marker of EEC progenitors [ 43 , 44 ]. The majority of NGN3 + cells co-stained with GILZ (NGN3 + GILZ + ), whereas only a few cells were NGN3 − GILZ + (Fig. 4 A-C), indicating that GILZ is expressed from EEC precursors to mature cells into the crypt. In addition, GILZ/NGN3 co-staining in the majority of cells suggested that GILZ expression can be referred to as an early event in EEC maturation. To further analyse GILZ expression in human specimens, with a particular focus on EEC, avoiding the limitation of a protein-threshold level in the immunofluorescence technique, we used the single cell (sc)RNAseq analysis of publicly available dataset [ 45 ]. We identified the stages of EEC maturation by the expression of temporally activated transcription factors as reported in Guo et al [ 43 ]. Hence, EEC were sub-classified into four populations, including stem cells, secretory progenitors, EEC progenitors, and mature L-cells, which were identified by expressing Lgr5, Atoh1, NGN3, and GCG, respectively. The percentage of cells expressing GILZ gene (TSC22D3) was evaluated in healthy subjects ( n = 7) (Fig. 5 A). An increase in GILZ expression was found from EEC progenitors to mature L-cells (Fig. 5 B). In mature EEC, identified by SYP, ChgA and ChgB expression, GILZ + cells were less than 20%, regardless the marker of neuroendocrine differentiation (Fig. 5 C). GILZ is dysregulated in EEC of UC patients We next analysed the distribution of GILZ + L-cells in mucosal samples from UC patients ( n = 84). Diagnostic criteria for active UC were met in 42 biopsies. The remaining 42 biopsies showed hyperplastic changes without neutrophil mucosal infiltration, and were referred to as quiescent UC. SYP + cells were found to be significantly decreased in active UC (5.1 ± 0.9/ mm 2 ), as compared to quiescent UC (33.8 ± 4.3/ mm 2 ). Likewise, ChgA + EEC were decreased in active UC (9.4 ± 0.8/ mm 2 ) as compared to quiescent UC (34.3 ± 3.5/ mm 2 ) (Supplementary Fig. 7). Figure 6 A shows immunofluorescence images of biopsies from both active and quiescent UC, with scanty both GILZ + /GLP-1 + L-cells (white arrows) and total GLP-1 + L-cells (white and yellow arrows), compared to samples from healthy individuals (Supplementary Fig. 8A and Fig. 3 A). We assessed the number of L-cells per mm 2 , including the analysis of sections from healthy individuals (Ctrl, Supplementary Fig. 3 and Supplementary Fig. 8A). GILZ + /GLP-1 + (2.0 ± 0.6 cells / mm 2 ) and total GLP-1 + cells (5.4 ± 0.9 cells / mm 2 ) were significantly reduced as compared to controls (17.4 ± 1.3 cells / mm 2 and 18.4 ± 1.4 cells / mm 2 , respectively) in active UC (Fig. 6 B). Interestingly, a significant increase of GILZ + /GLP-1 + was observed in quiescent UC (6.8 ± 1.3 cells / mm 2 ), but below the level of controls; conversely, total GLP-1 + cells did not increase significantly in quiescent UC (8.9 ± 1.4 cells / mm 2 ). We next analysed the distribution of GILZ low /5-HT + EC in UC. Immunofluorescence images in Fig. 7 A showed a significant reduction in GILZ low /5HT + cells (9.0 ± 1.3 cells / mm 2 ) in active UC as compared to control (22.1 ± 2.2 cells / mm 2 , Supplementary Fig. 8B and Supplementary Fig. 2), which was completely restored in quiescent UC (21.5 ± 2.8 cells / mm 2 ) (Fig. 7 B). GILZ in L-cells exerts an anti-inflammatory role on inflamed epithelial cells The function of GILZ in L-cells was investigated in vitro , using the human L-cell line NCI-H716. We first assessed GILZ expression in these cells by immunofluorescence co-staining with GLP-1. The image in Fig. 8 A shows GILZ expressed with a cytoplasmic granular/vesicular pattern, suggesting secretory functions via granules or vesicles delivery, as previously described for GLP-1 [ 46 ]. To investigate whether vesicle delivery could exert an anti-inflammatory effect, we set up an in vitro co-culture of NCI-H716 cells and gut epithelial cell line Caco2 in transwell plates, to hinder any cell-to-cell contact between the two cell lines. Caco2 cells were exposed to TNFα as an inflammatory stimulus, for 24h. After TNFα withdrawal, NCI-H716 cells were added to inserts in Caco2 culture wells. IL-8 induction in Caco2 was measured as an index of cell inflammatory response, since IL-8 is a chemokine capable to attract neutrophils in the mucosa, starting trigger of inflammation in UC. Figure 8 B shows that NCI-H716-secreted content was able to reduce IL-8 mRNA expression after 24h, independently of the amount of added NCI-H716 cell number. ELISA measurement of the released IL-8 confirmed the reduction after 48h (Fig. 8 B). These results suggest that vesicles released by NCI-H716 can reduce inflammation, and GILZ in these granules could contribute to this anti-inflammatory effect. To directly test this hypothesis in another set of experiments, we treated Caco2 cells with TAT-GILZ recombinant protein, which can directly enter the cells. After exposure of Caco2 cells to TNFα for 24h, the addition of TAT-GILZ protein significantly reduced the expression of IL-8, as measured by RT-qPCR. Accordingly, IL-8 released in the culture medium was reduced 48h later (Fig. 8 C). To further substantiate the contribution of GILZ to the anti-inflammatory effect of L-cell-derived products, GILZ expression was silenced in NCI-H716 cells. The cell cycle distribution of untreated and Hyperfect-treated NCI-H716 cells (controls) was first evaluated at 24 and 48h post-silencing. No significant differences were observed in the proportion of cells in G0/G1, S or G2/M phases between untreated and Hyperfect-treated cells (Supplementary Fig. 9A). Accordingly, subsequent analyses compared silenced groups to Hyperfect-treated cells. Twenty-four hours after silencing, NCI-H716 cells were seeded into apical inserts of transwell-plates and co-cultured with TNFα pre-activated Caco2 cells under the same experimental conditions described above. After additional 24h, cell cycle distribution was assessed in Hyperfect, siRNA CTRL and siRNA GILZ groups to confirm the expected reduction of cell proliferation in the positive control (siRNA CTRL). As shown in Supplementary Fig. 9A, siRNA CTRL significantly reduced cell cycle progression compared to Hyperfect- and siRNA GILZ-treated cells, indicating effective silencing of pro-survival genes (detailed in Materials and Methods). Total RNA was isolated from apical inserts from Hyperfect, siRNA CTRL and siRNA GILZ groups (48h post-silencing) and GILZ expression was quantified. A schematic representation of the experimental workflow is provided in Supplementary Fig. 9C. As shown in Fig. 8 D, GILZ expression was significantly reduced in siRNA GILZ cells compared with controls. To determine the effect of GILZ silencing on IL-8 production, IL-8 expression was measured in Caco2 cells 24h after co-culture with silenced NCI-H716 cells. Consistent with the results shown in Fig. 8 B, IL-8 expression was significantly suppressed in Caco2 cells co-cultured with Hyperfect- and siRNA CTRL-treated cells. In contrast, IL-8 levels were significantly increased in Caco2 cells co-cultured with siRNA GILZ-treated cells (Fig. 8 E). However, IL-8 expression in this group was not completely restored to the levels of TNFα-pre-treated control cells, suggesting that GILZ contributes to the anti-inflammatory effect of L-cell-secreted products, although it is not the sole mediator of this activity. IL-8 protein concentration in the culture supernatants was quantified 48h later by ELISA. As shown in Fig. 8 F, a significant reduction in IL-8 release was observed in control groups (Hyperfect and siRNA Ctrl), whereas IL-8 levels resulted in a marked increase in the siRNA GILZ, reaching values comparable to those detected in TNFα-pre-treated Ctrl, suggesting an accumulation of secreted IL-8 in the culture medium. Discussion Previous studies in both animal models and humans have demonstrated the role of GILZ as an anti-inflammatory protein implicated in IBD, affecting immune responses as well as goblet cell functions [ 2 , 4 – 7 , 11 , 47 – 49 ]. In the present study, we identified high GILZ expression levels in L-cells, a specific subtype of EEC. In these cells, GILZ was partially co-expressed with both GLP-1, the major incretin released by colonic L-cells, and synaptophysin, a membrane glycoprotein expressed in the synaptic-like microvesicles of EEC [ 50 , 51 ]. Importantly, GILZ expression was detected as an early event during EEC differentiation, being detected in both precursors and mature cells. This observation supports a potential functional role of GILZ throughout the entire EEC lifecycle. Consistently, GILZ + /GLP-1 + cells were distributed along the length of the colonic crypts, indicating that GILZ expression occurs across subsequent developmental stages of L-cells. Transcriptomic scRNAseq analysis further confirmed our findings, showing elevated GILZ expression in mature secretory cells, particularly within the EEC population. A deep examination of GILZ expression in human gut samples by immunofluorescence analysis revealed a progressive increase in GILZ-expressing L-cells along the gut, displaying an upward trend from the ileum to the rectum. This spatial distribution closely paralleled the pattern observed for GLP-1 expression, suggesting a potential coordinated secretion of GILZ and GLP-1 in L-cells. This observation is consistent with previous evidence demonstrating that L-cell density increases distally along the human intestine toward the rectum [ 25 ]. In active UC, we observed a significant reduction of GLP-1 + /GILZ + cells and total GLP-1 + cells compared to controls. Notably, GLP-1 + GILZ + cells were restored in quiescent UC, even though at a lesser degree as compared to controls, whereas no differences were observed in total GLP-1 + cell number, suggesting GILZ is important for the restoration of L-cells. The intestinal environment, which is highly sensitive to inflammation, number, distribution and function of cells may be affected by active disease, pro-inflammatory cytokines and epithelial barrier dysfunction. Hence, varying degrees of epithelial cell restoration can be observed in quiescent UC, including number and function of cells, mostly depending on the duration of the regenerative process and on the magnitude of the acute inflammation [ 52 ]. Intriguingly, GLP-1 is synthesized intracellularly and released through secretory vesicles in response to dietary nutrients and it is known to participate in the autocrine/paracrine signaling, which may be disrupted in IBD [ 53 , 54 ]. In particular, GLP1 can influence the vesicular release of other molecules, as it contributes to exosome biogenesis [ 55 ]. Therefore, the reduced GLP-1 expression may drive the reduction of GILZ levels, which might negatively affect the epithelial repair, as observed in preclinical studies [ 49 ]. The loss of GILZ + L-cells in active UC correlates with the inflammatory environment, potentially promoting the impairment of gut homeostasis. This finding aligns with our previous observation of GILZ reduction in goblet cells from IBD patients [ 11 ]. Supporting this role, the administration of recombinant TAT-GILZ protein has been shown to ameliorate symptoms of spontaneously induced colitis in IL-10-KO mice and other experimental models by modulating either T or B infiltrating lymphocytes (revised in [ 48 ]), and by strengthening the mucosal barrier in DSS-induced colitis [ 49 ]. Together, these findings from both animal and human studies support the concept that GILZ contributes to maintain intestinal homeostasis. Intriguingly, colonic L-cells showed a distinct cytoplasmic localization of GILZ, resembling vesicle-like structures. This observation suggests GILZ may be implicated in vesicular trafficking, similar to other L-cell products [ 56 ]. Although these GILZ-containing vesicles have not yet been fully characterized, their nature warrants further investigation. Our in vitro experiments aimed at identifying GILZ function in L-cells. Vesicles secreted by NCI-H716 L-cells were found to downregulate IL-8 expression in co-cultured Caco2 epithelial cells, suggesting that GILZ, together with GLP-1, contributes to the suppression of this key pro-inflammatory chemokine. IL-8, produced by epithelial cells after mucosal barrier damage, plays a central role in recruiting neutrophils to the mucosa. While neutrophil infiltration is essential for pathogen clearance, excessive accumulation can lead to transepithelial migration, crypt architectural disruption, and exacerbation of inflammation in IBD [ 57 , 58 ]. By reducing IL-8 levels, GILZ release from L-cells may contribute to reduce neutrophil-driven mucosal injury and inflammation. This function is further supported by our demonstration that the recombinant TAT-GILZ protein directly suppresses IL-8 production in epithelial cells and GILZ silencing reduces the ability of secreted L-cell proteins to suppress IL-8 produced by inflamed epithelial cells. Interestingly, GLP-1 also exerts anti-inflammatory effects, since previous studies demonstrated that GLP-1 alleviates DSS-induced colitis in murine models by reducing inflammation [ 59 , 60 ]. This function may explain the fact that GILZ contributes to prevention of the release of IL-8, but is not the sole protein to exert this effects. Interestingly, accumulated IL-8 protein in the culture supernatant of GILZ-silenced cells reached the control levels after 48h. Our results add data to the known extracellular vesicle-mediated immune responses in the gut [ 61 ]. A limit of this study is the unknown mechanism of GILZ-mediated IL-8 suppression, which does not relies on NF-κB inhibition (data not shown) but on other factors, which deserve future studies. Furthermore, GLP-1 is secreted in response to glucose intake, sustaining a gluco-regulatory system that acts by increasing insulin and suppressing glucagon secretion [ 24 , 62 ]. Impaired GLP-1 secretion can lead to clinical susceptibility to abnormal glucose metabolism, supporting the clinical association between IBD and diabetes [ 63 – 65 ]. Our findings open future perspectives toward the combined restoration of GLP-1 and GILZ as a promising therapeutic strategy to dampen inflammation and promote mucosal healing. Particularly, the role of goblet cells as cellular target of the anti-inflammatory effects of L-cells secretion suggests that even the barrier functions can be improved in UC patients A distinct scenario was observed for EC 5HT + cells. In these cells, GILZ expression was consistently low, resulting unaffected by disease activity. Interestingly, 5HT + EC cell count decreased significantly during active UC, but was completely restored in quiescent UC. However, previous studies investigating mucosal 5-HT levels and EC cell dynamics in IBD have yielded conflicting results: some studies described an increase in EC cell numbers in UC patients and experimental models of colitis [ 66 ], whereas others reported a decrease [ 67 – 69 ]. Despite these discrepancies, it is evident that EC cell abundance and 5-HT levels are altered in active UC, and our data support the observations about the decrease in EC numbers. 5HT + GILZ + cells were found to be completely restored in the quiescence, but this effect may not depend on GILZ function, due to its very low expression levels. The specific contribution of GILZ to EC biology still remains unclear and warrants further investigation. Conclusions Our study identifies GILZ as a novel EEC product, expressed in L-cells. GILZ can potentially facilitate the crosstalk between epithelial cells and immune system, contributing to colon homeostasis. Altered GILZ expression in L-cells may be associated with either the onset or relapse in UC. Specifically, the loss of GILZ + L-cells during active UC, together with impaired secretion of both GILZ and GLP-1, could further impair the barrier dysfunction of the gut mucosa, compromise responsiveness to conventional therapies, and contribute to extra-intestinal IBD-related manifestations, including diabetes. Restoring GILZ expression in L-cells, particularly in combination with approaches that trigger GLP-1 secretion or mimic its actions, may represent a promising pharmacological approach in UC patients. Materials and Methods Immunohistochemistry and Immunofluorescence Biopsy samples from healthy colonic mucosa and UC patients were retrospectively analysed, according to the Ethics Committee Spedali Civili, Brescia, ID no NP 4811. Four µm-thick slides were cut from formalin-fixed paraffin-embedded (FFPE) specimens, and stained with Hematoxylin-Eosin dye. Specimens from UC patients were evaluated for architectural distortion, mucin depletion, occurrence of basal plasma cells, and disease activity by experienced GI pathologists. Neutrophil infiltration, cryptitis and crypt abscesses, erosion and ulcerations were referred to active UC, and were evaluated in all the samples. Overall, 120 mucosal pinch biopsies were examined, including 84 samples from UC patients and 36 samples from healthy donors. For immunofluorescence assays, FFPE specimens were cut and deparaffinized. After rehydration, antigen retrival was performed according to the specific Ab. Immunostaining was performed with the following Abs: anti-GILZ (ab197987, Abcam, Cambridge, UK), anti-5-HT (ab6336, Abcam), anti-GLP-1 (ab26278, Abcam) anti-ChrgA (sc-271738, Santa Cruz, Dallas, Texas, USA), anti-Neurog3 (sc-376607, Santa Cruz) and anti-Syp (OSS00058W-100UL, Thermo Fisher Scientific, Waltham, MA, USA). The anti-GILZ antibody has been granted as highly specific by the manufacturer. All the Abs were incubated overnight at 4°C as previously described [ 11 ]. Secondary Abs (Alexafluor 488, Alexafluor 555, Alexafluor 640, Thermo Fisher Scientific, Waltham, MA, USA) were added the following day and incubated for 1h at room temperature (anti-rabbit Ab for the detection of GILZ, anti-mouse Ab for the detection of GLP-1 Ab and ChrgA, anti-rat Ab for the detection of 5-HT and anti-sheep Ab for the detection of Syp). An example of secondary Ab staining is shown in Supplementary Fig. 10. The slides were then washed with PBS 0.1% TWEEN 3 times for 5 minutes and then stained with DAPI (D9542, Sigma-Aldrich, Milan, Italy) to detect the nuclei. All slides were analysed using Eclipse Ti microscope equipped with Confocal Spinning Disk. In healthy specimens and UC biopsies, the fields (high power field –HPF-, 20x magnification, area = 0.4 µm 2 ) were randomly chosen; stained cells were counted by two independent researchers in a blinded manner. To statistically determine the number of stained cells in UC patients, 27 HPF from 10 healthy samples, 30 HPF from 10 active UC patients, and 28 HPF from 7 quiescent UC patients were assessed for GLP-1 total and GILZ-GLP-1 co-expression; 18 HPF from 7 healthy samples, 32 HPF from 6 active UC patients, and 24 HPF from 5 quiescent UC patients were assessed for 5HT − GILZ co-expression. Densitometric analysis of fluorescence in single cells was carried out with the software ImageJ. After isolating, thresholding, and subtracting background, fluorescence intensity mean ± SE in the selected area was calculated by the software. Cells were analysed within the same field, in separate stained samples. Values below 100 arbitrarily identified low GILZ-expressing cells, values above 100 arbitrarily identified high GILZ-expressing cells. A schematic description of the identification of GILZ low and GILZ high expressing cells distinguishing 5HT (EC cells) and GLP-1 cells (L-cells) is reported in Supplementary Fig. 11. Co-localization analyses of GILZ and GLP-1, or GILZ and SYP were performed using the JacoP plug in for ImageJ, as previously described [ 42 , 70 ]. NCI-H716 cells were cytospun onto glass slides and fixed with 10% formalin. After washing in PBS, cells were blocked with buffer containing 0.1% Triton-X and 1% bovine serum albumin. Cells were then incubated o.n. with goat anti-GILZ (sc-26520, discontinued, Santa Cruz) and anti-GLP-1 (ab26278, Abcam,) Abs. After washing with PBS Tween 0,1%, cells were incubated for 1 h with secondary anti-goat-Alexa 488 and anti-mouse Alexa 555 (Alexafluor, Thermo Fisher Scientific) Abs. After adding DAPI, slides were mounted with cover glass and analyzed using a Zeiss Axioplan fluorescence microscope (Zeiss, Oberkochen, Germany) equipped with a Spot-2 cooled camera (SPOT Imaging Solution, Sterling Heights, MI, USA). Cell cultures Caco2 cells were a kind gift of Prof. Domenico Delfino. Caco2 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) containing 10% of fetal bovine serum (FBS), 1% of non-essential amino acids (MEM NEAA), 1% of sodium pyruvate and 50 IU/mL penicillin and 50 µg/mL streptomycin at 37°C and 5% CO 2 . NCI-H716 cell line was purchased from CLS Cell Lines Service GmbH (Eppelheim, Germany). NCI-H716 were cultured in RPMI 1640 containing 10% of FBS and 50 IU/mL penicillin and 50 µg/mL streptomycin at 37°C and 5% CO 2 . Treatments and co-cultures On day − 2 of the experiment, Caco2 cells were seeded in 12-wells plates (3x10 5 cell/ml) and incubated for 24h at 37°C. On day − 1, cells were stimulated with 10 ng/ml Tumor Necrosis Factor α (TNFα) (recombinant human- Cell guidance system, Cambridge, UK). After further 24 hours, TNFα was withdrawn by replacing with fresh medium. Corning® Transwell® 12 well plates (pores 0.4 µM diameter) (Merck, cat# CLS3401-48EA, Darmstadt, Germany) were inserted in each well containing Caco2 cells previously exposed to TNFα for 24h. NCI-H716 were seeded in the apical side of the transwell (inserts) at concentration ratios of 1:10, 1:20, 1:50 (NCI-H716: Caco2). At day 1 and 2 of co-culture, mRNA extraction from Caco2 cells was carried out to evaluate IL-8 expression. For Caco2-NCI-H716 co-culture experiments, NCI-H716 cells were grown in complete DMEM medium for 2 weeks, and GLP-1 and GILZ expression levels were analysed by RT-qPCR (not shown). No significant changes in either proliferation or mRNA expression levels were noticed. TAT-GILZ (5 µg/mL) recombinant protein, a cell-permeable fusion protein, and control TAT peptide (2.5 µg/mL) were used for in vitro experiments [ 71 , 72 ]. IL-8 release in the culture supernatants was quantified with Human IL-8 Uncoated ELISA kit (Invitrogen, Thermo Fisher Scientific), according to the manufacturer’s instructions. RNA interference assay NCI-H716 cells were seeded in cell culture flasks at 2x10^5 c/w in 24 well-plate, following the manufacturer’s instructions. Positive control HS cell death (siRNA CTRL) and Hyperfect transfection reagent were added to two separate groups as controls (Qiagen, Hilden, Germany). GILZ was transiently knocked down in NCI-H716 cells by siRNA GILZ (TSC22D3) for 24h and then added to the inserts on transwell plates, in which Caco2 cells had been previously seeded and treated with TNFα for 24h (see MM for co-culture experiments in transwell). Twenty-four hours later, mRNA from apical (NCI-H716 silenced) and bottom (Caco2) cells was extracted to measure GILZ and IL-8 expression, respectively. Cell cycle analysis was performed in all groups both 24h and 48h after silencing, by propidiun iodide staining. Briefly, cells were collected, centrifuged and suspended in propidium iodide-hypotonic solution, and kept 1h at 4°C. The analysis was conducted on a Becton Dickinson FACScan running LYSIS II software. For a more detailed description of the entire procedure, see the schematic in Supplementary Fig. 9C. Quantitative RT-PCR mRNA was extracted from Caco2 cells using RNeasy Plus Mini Kit (Qiagen, Hilden, Germany). The extracted mRNA was retro-transcribed by QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany). Quantitative Real-time PCR (RT-qPCR) was performed in triplicate on QuantStudio 1 Real-Time PCR System (Applied Biosystem, Waltham, MA, USA), following the TaqMan® Gene Expression Assays Protocol to detect GILZ by a FAM™ probe (cat# Hs00929365_m1, Thermo Fisher Scientific, Waltham, MA USA), and the eukaryotic 18S rRNA endogenous control (VIC™/MGB probe, primer limited) (Cat# 4319413E Thermo Fisher Scientific, Waltham, MA, USA), using TaqMan™ Gene Expression Master Mix (Applied Biosystems, Waltham, MA, USA). SYBR™ Green Assay Protocol (Applied Biosystems, Waltham, MA, USA) was used to measure IL-8 (Forward primer 5’ACTCCAAACCTTTCCACCCC3’- Reverse primer 5’TTCTCAGCCCTCTTCAAAAACTTC3’), using human GAPDH (5’GCTCCTCCTGTTCGACAGTCA3’- Reverse primer 5’GCAACAATATCCACTTTACCAG3’) as housekeeping gene. Samples were run in triplicate and two-three distinct experiments were performed in each experimental setting. The method 2 −∆CT was used to calculate the relative expression levels. Bioinformatics analysis Publicly available scRNA-seq data from the study by Elmentaite et al [ 45 ] were retrieved from the Human Cell Atlas (HCA) Data Portal ( https://data.humancellatlas.org/ ). Only data corresponding to normal colonic tissue from adult donors were included in the analysis. Data exploration and visualization were performed using the CZ CELLxGENE platform ( https://cellxgene.cziscience.com/ ). This tool was also used to generate Uniform Manifold Approximation and Projection (UMAP) plots and to quantify the number of positive cells for selected markers in each individual donor. Statistical analysis Statistical analyses were performed using Prism 10.4.2 software (GraphPad Software, Boston, MA, USA). Normality was assessed with Kolmogorov–Smirnov test. Pairwise or multiple comparisons of values with normal distribution were carried out using Student’s t test (unpaired), one-sample t test (theoretical mean = 1) and one-way ANOVA. Post hoc tests were conducted where appropriate. Results were considered significant at p < 0.05, and data are reported as mean ± standard error (SEM). Declarations Acknowledgements The author(s) received no specific funding for this work. Ethics approval The study was approved by the ethics committee Spedali Civili, Brescia, ID no NP 4811. Author contributions LR, GL, SR contributed to the conception and design of the experiments. LR, GL, MRS, and MP performed the experiments. LC performed statistical and bioinformatics analysis. LR, LC, GL, and SR analyzed the data. GN, VV, CR, and GM provided material support and contributed revision of the manuscript. SR, GL, LC wrote the manuscript. All authors read and approved the final paper Funding Statement The authors received no specific funding for this work. Competing interests The authors declare no competing interests References Paglialunga M, Flamini S, Contini R, Febo M, Ricci E, Ronchetti S, et al. Anti-Inflammatory Effects of Synthetic Peptides Based on Glucocorticoid-Induced Leucine Zipper (GILZ) Protein for the Treatment of Inflammatory Bowel Diseases (IBDs). Cells 2023, 12(18). Cari L, Rosati L, Leoncini G, Lusenti E, Gentili M, Nocentini G, et al. Association of GILZ with MUC2, TLR2, and TLR4 in Inflammatory Bowel Disease. Int J Mol Sci 2023, 24(3). Nataraja C, Flynn J, Dankers W, Northcott M, Zhu W, Sherlock R, et al. GILZ regulates type I interferon release and sequesters STAT1. J Autoimmun 2022, 131: 102858. Buoso E, Masi M, Limosani RV, Fagiani F, Oliviero C, Colombo G, et al. Disruption of Epithelial Barrier Integrity via Altered GILZ/c-Rel/RACK1 Signaling in Inflammatory Bowel Disease. J Crohns Colitis 2025, 19(1). Bereshchenko O, Coppo M, Bruscoli S, Biagioli M, Cimino M, Frammartino T, et al. GILZ promotes production of peripherally induced Treg cells and mediates the crosstalk between glucocorticoids and TGF-beta signaling. Cell Rep 2014, 7(2): 464–475. Cannarile L, Cuzzocrea S, Santucci L, Agostini M, Mazzon E, Esposito E, et al. Glucocorticoid-induced leucine zipper is protective in Th1-mediated models of colitis. Gastroenterology 2009, 136(2): 530–541. Bruscoli S, Sorcini D, Flamini S, Gagliardi A, Adamo F, Ronchetti S, et al. Glucocorticoid-Induced Leucine Zipper Inhibits Interferon-Gamma Production in B Cells and Suppresses Colitis in Mice. Front Immunol 2018, 9: 1720. Bruscoli S, Riccardi C, Ronchetti S. GILZ as a Regulator of Cell Fate and Inflammation. Cells 2021, 11(1). Goodman WA, Bedoyan SM, Havran HL, Richardson B, Cameron MJ, Pizarro TT. Impaired estrogen signaling underlies regulatory T cell loss-of-function in the chronically inflamed intestine. Proc Natl Acad Sci U S A 2020, 117(29): 17166–17176. Baban B, Marchetti C, Khodadadi H, Malik A, Emami G, Lin PC, et al. Glucocorticoid-Induced Leucine Zipper Promotes Neutrophil and T-Cell Polarization with Protective Effects in Acute Kidney Injury. J Pharmacol Exp Ther 2018, 367(3): 483–493. Leoncini G, Gentili M, Lusenti E, Caruso L, Calafa C, Migliorati G, et al. The novel role of glucocorticoid-induced leucine zipper as a marker of mucosal healing in inflammatory bowel diseases. Pharmacol Res 2022, 182: 106353. Furness JB, Kunze WA, Clerc N. Nutrient tasting and signaling mechanisms in the gut. II. The intestine as a sensory organ: neural, endocrine, and immune responses. Am J Physiol 1999, 277(5): G922–928. Lee J, Cummings BP, Martin E, Sharp JW, Graham JL, Stanhope KL, et al. Glucose sensing by gut endocrine cells and activation of the vagal afferent pathway is impaired in a rodent model of type 2 diabetes mellitus. Am J Physiol Regul Integr Comp Physiol 2012, 302(6): R657–666. Bohorquez DV, Samsa LA, Roholt A, Medicetty S, Chandra R, Liddle RA. An enteroendocrine cell-enteric glia connection revealed by 3D electron microscopy. PLoS One 2014, 9(2): e89881. Bohorquez DV, Liddle RA. The gut connectome: making sense of what you eat. J Clin Invest 2015, 125(3): 888–890. Bertrand PP. The cornucopia of intestinal chemosensory transduction. Front Neurosci 2009, 3: 48. Abdalqadir N, Adeli K. GLP-1 and GLP-2 Orchestrate Intestine Integrity, Gut Microbiota, and Immune System Crosstalk. Microorganisms 2022, 10(10). Ahlman H, Nilsson. The gut as the largest endocrine organ in the body. Ann Oncol 2001, 12 Suppl 2: S63–68. Beumer J, Puschhof J, Bauza-Martinez J, Martinez-Silgado A, Elmentaite R, James KR, et al. High-Resolution mRNA and Secretome Atlas of Human Enteroendocrine Cells. Cell 2020, 181(6): 1291–1306 e1219. Smith CA, O'Flaherty EAA, Guccio N, Punnoose A, Darwish T, Lewis JE, et al. Single-cell transcriptomic atlas of enteroendocrine cells along the murine gastrointestinal tract. PLoS One 2024, 19(10): e0308942. Roberts GP, Larraufie P, Richards P, Kay RG, Galvin SG, Miedzybrodzka EL, et al. Comparison of Human and Murine Enteroendocrine Cells by Transcriptomic and Peptidomic Profiling. Diabetes 2019, 68(5): 1062–1072. Beumer J, Clevers H. Cell fate specification and differentiation in the adult mammalian intestine. Nat Rev Mol Cell Biol 2021, 22(1): 39–53. Kolev HM, Kaestner KH. Mammalian Intestinal Development and Differentiation-The State of the Art. Cell Mol Gastroenterol Hepatol 2023, 16(5): 809–821. Atanga R, Singh V, In JG. Intestinal Enteroendocrine Cells: Present and Future Druggable Targets. Int J Mol Sci 2023, 24(10). Kuhre RE, Deacon CF, Holst JJ, Petersen N. What Is an L-Cell and How Do We Study the Secretory Mechanisms of the L-Cell? Front Endocrinol (Lausanne) 2021, 12: 694284. Kumar V. GLP-1/GLP-1R axis: from metabolism (obesity and T2DM) to immunity. Open Biol 2025, 15(7): 240303. Leoncini G, Ronchetti S, Villanacci V. Mucosal barrier dysfunction and relapse in ulcerative colitis: Is there more that meets the eye? Dig Liver Dis 2024, 56(8): 1420. D'Amico F, Fasulo E, Jairath V, Paridaens K, Peyrin-Biroulet L, Danese S. Management and treatment optimization of patients with mild to moderate ulcerative colitis. Expert Rev Clin Immunol 2024, 20(3): 277–290. Wetwittayakhlang P, Bessissow T, Lakatos PL. Novel and emerging drugs for the treatment of Crohn's disease: a review of phase II and III trials. Expert Opin Emerg Drugs 2024, 29(1): 19–34. Wong M, Larson BK, Dhall D. Neuroendocrine proliferations in inflammatory bowel disease: differentiating neuroendocrine tumours from neuroendocrine cell micronests. Histopathology 2019, 74(3): 415–423. Kanada S, Sugita A, Mikami T, Ohashi K, Hayashi H. Microcarcinoid arising in patients with long-standing ulcerative colitis: histological analysis. Hum Pathol 2017, 64: 28–36. Aoki S, Watanabe M, Hasegawa H, Nishibori H, Mukai M, Kitajima M. Rectal carcinoid arising in ulcerative colitis associated with rectal adenocarcinoma. J Gastroenterol 2004, 39(7): 697–698. Fu K, Igarashi S, Jindo O, Ishikawa T, Hirabayashi K, Kotake K, et al. Synchronous colitic cancers and microcarcinoids in a patient with long-standing and extensive ulcerative colitis: a case report and review of the literature. Surg Laparosc Endosc Percutan Tech 2008, 18(3): 304–307. El-Salhy M, Mazzawi T, Umezawa K, Gilja OH. Enteroendocrine cells, stem cells and differentiation progenitors in rats with TNBS-induced colitis. Int J Mol Med 2016, 38(6): 1743–1751. El-Salhy M, Hatlebakk JG. Changes in enteroendocrine and immune cells following colitis induction by TNBS in rats. Mol Med Rep 2016, 14(6): 4967–4974. Worthington JJ. The intestinal immunoendocrine axis: novel cross-talk between enteroendocrine cells and the immune system during infection and inflammatory disease. Biochem Soc Trans 2015, 43(4): 727–733. Yu Y, Yang W, Li Y, Cong Y. Enteroendocrine Cells: Sensing Gut Microbiota and Regulating Inflammatory Bowel Diseases. Inflamm Bowel Dis 2020, 26(1): 11–20. Furness JB, Rivera LR, Cho HJ, Bravo DM, Callaghan B. The gut as a sensory organ. Nat Rev Gastroenterol Hepatol 2013, 10(12): 729–740. Lebrun LJ, Lenaerts K, Kiers D, Pais de Barros JP, Le Guern N, Plesnik J, et al. Enteroendocrine L Cells Sense LPS after Gut Barrier Injury to Enhance GLP-1 Secretion. Cell Rep 2017, 21(5): 1160–1168. Nwako JG, Patel SD, Roach TJ, Gupte SR, Williams SG, Riedman AM, et al. Enteroendocrine cells regulate intestinal barrier permeability. Am J Physiol Cell Physiol 2025, 328(5): C1501–C1508. Parikh K, Antanaviciute A, Fawkner-Corbett D, Jagielowicz M, Aulicino A, Lagerholm C, et al. Colonic epithelial cell diversity in health and inflammatory bowel disease. Nature 2019, 567(7746): 49–55. Bolte S, Cordelieres FP. A guided tour into subcellular colocalization analysis in light microscopy. J Microsc 2006, 224(Pt 3): 213–232. Guo X, Lv J, Xi R. The specification and function of enteroendocrine cells in Drosophila and mammals: a comparative review. FEBS J 2022, 289(16): 4773–4796. Jenny M, Uhl C, Roche C, Duluc I, Guillermin V, Guillemot F, et al. Neurogenin3 is differentially required for endocrine cell fate specification in the intestinal and gastric epithelium. EMBO J 2002, 21(23): 6338–6347. Elmentaite R, Kumasaka N, Roberts K, Fleming A, Dann E, King HW, et al. Cells of the human intestinal tract mapped across space and time. Nature 2021, 597(7875): 250–255. Reimer RA, Darimont C, Gremlich S, Nicolas-Metral V, Ruegg UT, Mace K. A human cellular model for studying the regulation of glucagon-like peptide-1 secretion. Endocrinology 2001, 142(10): 4522–4528. Gentili M, Sabbatini S, Nunzi E, Lusenti E, Cari L, Mencacci A, et al. Glucocorticoid-Induced Leucine Zipper Protein and Yeast-Extracted Compound Alleviate Colitis and Reduce Fungal Dysbiosis. Biomolecules 2024, 14(10). Ronchetti S, Gentili M, Ricci E, Migliorati G, Riccardi C. Glucocorticoid-Induced Leucine Zipper as a Druggable Target in Inflammatory Bowel Diseases. Inflamm Bowel Dis 2020, 26(7): 1017–1025. Gentili M, Hidalgo-Garcia L, Vezza T, Ricci E, Migliorati G, Rodriguez-Nogales A, et al. A recombinant glucocorticoid-induced leucine zipper protein ameliorates symptoms of dextran sulfate sodium-induced colitis by improving intestinal permeability. FASEB J 2021, 35(11): e21950. Gould VE, Lee I, Wiedenmann B, Moll R, Chejfec G, Franke WW. Synaptophysin: a novel marker for neurons, certain neuroendocrine cells, and their neoplasms. Hum Pathol 1986, 17(10): 979–983. Harada Y, Hiasa M. Immunological identification of vesicular nucleotide transporter in intestinal L cells. Biol Pharm Bull 2014, 37(7): 1090–1095. Urbauer E, Aguanno D, Kuellmer K, Metwaly A, Waldschmitt N, Ahmed M, et al. Reduced Intestinal GLP-1(+) Cell Numbers Are Associated With an Inflammation-related Epithelial Metabolic Signature. Cell Mol Gastroenterol Hepatol 2026, 20(2): 101656. Ohara-Imaizumi M, Aoyagi K, Akimoto Y, Nakamichi Y, Nishiwaki C, Kawakami H, et al. Imaging exocytosis of single glucagon-like peptide-1 containing granules in a murine enteroendocrine cell line with total internal reflection fluorescent microscopy. Biochem Biophys Res Commun 2009, 390(1): 16–20. Kappe C, Zhang Q, Holst JJ, Nystrom T, Sjoholm A. Evidence for paracrine/autocrine regulation of GLP-1-producing cells. Am J Physiol Cell Physiol 2013, 305(10): C1041–1049. Yu H, Davoudi M, Sadegh-Nejadi S, Miao X, Bagherieh M, Afrisham R. Impact of monotherapy and combination therapy with glucagon-like peptide-1 receptor agonists on exosomal and non-exosomal MicroRNA signatures in type 2 diabetes mellitus: a systematic review. J Transl Med 2025, 23(1): 477. Beumer J, Gehart H, Clevers H. Enteroendocrine Dynamics - New Tools Reveal Hormonal Plasticity in the Gut. Endocr Rev 2020, 41(5). Kang L, Fang X, Song YH, He ZX, Wang ZJ, Wang SL, et al. Neutrophil-Epithelial Crosstalk During Intestinal Inflammation. Cell Mol Gastroenterol Hepatol 2022, 14(6): 1257–1267. Zhou GX, Liu ZJ. Potential roles of neutrophils in regulating intestinal mucosal inflammation of inflammatory bowel disease. J Dig Dis 2017, 18(9): 495–503. Bendotti G, Montefusco L, Lunati ME, Usuelli V, Pastore I, Lazzaroni E, et al. The anti-inflammatory and immunological properties of GLP-1 Receptor Agonists. Pharmacol Res 2022, 182: 106320. Lee YS, Jun HS. Anti-Inflammatory Effects of GLP-1-Based Therapies beyond Glucose Control. Mediators Inflamm 2016, 2016: 3094642. Shen Q, Huang Z, Yao J, Jin Y. Extracellular vesicles-mediated interaction within intestinal microenvironment in inflammatory bowel disease. J Adv Res 2022, 37: 221–233. Ahren B. Gut peptides and type 2 diabetes mellitus treatment. Curr Diab Rep 2003, 3(5): 365–372. Muhammad A, Abdulkareem TMK, Alharbi AEB, Alessa NA, Bin Qaed S, Ebrahim EK, et al. The Interplay of Inflammatory Bowel Disease (IBD) and Diabetes in Pediatrics: A Systematic Review. Cureus 2024, 16(9): e70425. Villumsen M, Schelde AB, Jimenez-Solem E, Jess T, Allin KH. GLP-1 based therapies and disease course of inflammatory bowel disease. eClinicalMedicine 2021, 37. Migliorisi G, Gabbiadini R, Dal Buono A, Ferraris M, Privitera G, Petronio L, et al. GLP-1 receptor agonists in IBD: exploring the crossroads of metabolism and inflammation. Front Immunol 2025, 16: 1610368. Khan WI, Motomura Y, Wang H, El-Sharkawy RT, Verdu EF, Verma-Gandhu M, et al. Critical role of MCP-1 in the pathogenesis of experimental colitis in the context of immune and enterochromaffin cells. Am J Physiol Gastrointest Liver Physiol 2006, 291(5): G803–811. Magro F, Vieira-Coelho MA, Fraga S, Serrao MP, Veloso FT, Ribeiro T, et al. Impaired synthesis or cellular storage of norepinephrine, dopamine, and 5-hydroxytryptamine in human inflammatory bowel disease. Dig Dis Sci 2002, 47(1): 216–224. Shajib MS, Chauhan U, Adeeb S, Chetty Y, Armstrong D, Halder SLS, et al. Characterization of Serotonin Signaling Components in Patients with Inflammatory Bowel Disease. J Can Assoc Gastroenterol 2019, 2(3): 132–140. Coates MD, Mahoney CR, Linden DR, Sampson JE, Chen J, Blaszyk H, et al. Molecular defects in mucosal serotonin content and decreased serotonin reuptake transporter in ulcerative colitis and irritable bowel syndrome. Gastroenterology 2004, 126(7): 1657–1664. Pandya P, Jethva M, Rubin E, Birnbaum RY, Braiman A, Isakov N. PICOT binding to chromatin-associated EED negatively regulates cyclin D2 expression by increasing H3K27me3 at the CCND2 gene promoter. Cell Death Dis 2019, 10(10): 685. Vago JP, Galvao I, Negreiros-Lima GL, Teixeira LCR, Lima KM, Sugimoto MA, et al. Glucocorticoid-induced leucine zipper modulates macrophage polarization and apoptotic cell clearance. Pharmacol Res 2020, 158: 104842. Ronchetti S, Migliorati G, Riccardi C. GILZ as a Mediator of the Anti-Inflammatory Effects of Glucocorticoids. Front Endocrinol (Lausanne) 2015, 6: 170. Additional Declarations There is no conflict of interest Supplementary Files FigureS5R.pdf Supplementary figure S5 FigureS6R.pdf Supplementary figure S6 FigureS9R.pdf Supplementary figure S9 FigureS3R.pdf Supplementary figure S3 FigureS7R.pdf Supplementary figure S7 FigureS2R.pdf Supplementary figure S2 FigureS10R.pdf Supplementary figure S10 FigureS11R.pdf Supplementary figure S11 FigureS8R.pdf Supplementary figure S8 FigureS1R.pdf Supplementary figure S1 FigureS4R.pdf Supplementary figure S4 Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: revise 05 May, 2026 Review # 1 received at journal 03 May, 2026 Reviewer # 1 agreed at journal 03 May, 2026 Reviewers invited by journal 03 May, 2026 Submission checks completed at journal 14 Apr, 2026 Editor assigned by journal 14 Apr, 2026 First submitted to journal 14 Apr, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7590228","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":623108006,"identity":"c3504fca-a5a9-400d-990e-900301987869","order_by":0,"name":"Lucrezia Rosati","email":"","orcid":"","institution":"University of Perugia","correspondingAuthor":false,"prefix":"","firstName":"Lucrezia","middleName":"","lastName":"Rosati","suffix":""},{"id":623108007,"identity":"e3df5e0a-30e2-4d18-aef6-5493630eea82","order_by":1,"name":"Giuseppe Leoncini","email":"","orcid":"","institution":"Fondazione IRCCS Istituto Nazionale dei Tumori","correspondingAuthor":false,"prefix":"","firstName":"Giuseppe","middleName":"","lastName":"Leoncini","suffix":""},{"id":623108005,"identity":"b3a4513e-a502-4448-bc00-79571b962d6d","order_by":2,"name":"Luigi Cari","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA00lEQVRIie3PPQrCMBiA4a8E0iWaVejgFSIOCmJ6lZQMrh0dC4V6hQyewznSY9ihRSiOuoiDgwkU6tR0FMw7fYE8+QHw+X6wKQQZCDshpAGYHRwE9wSLjjgM7kfCusFFZjK/1cDnqwN5Rmla8Syk2kGSYi1ALo7l5BQp1srM+TBDmAAdKGQIYaV0/6UjsUKkHU3y2pDEEGwJdxPSFCCYlArh5YawVmCE2CCh4e76eO35VtGyuZB3FVN6roevsW+D/lidFK79JnT/Wuh4hPD5fL4/6wNDMjgdtu+dngAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0003-0698-3872","institution":"University of Perugia","correspondingAuthor":true,"prefix":"","firstName":"Luigi","middleName":"","lastName":"Cari","suffix":""},{"id":623108008,"identity":"55adf5b4-2763-400b-8a55-2dae90b808b7","order_by":3,"name":"Maria Rosaria Sette","email":"","orcid":"","institution":"University of Perugia","correspondingAuthor":false,"prefix":"","firstName":"Maria","middleName":"Rosaria","lastName":"Sette","suffix":""},{"id":623108009,"identity":"39e48489-862c-4085-8825-1ed3938a07b6","order_by":4,"name":"Martina Procaccini","email":"","orcid":"","institution":"University of Perugia","correspondingAuthor":false,"prefix":"","firstName":"Martina","middleName":"","lastName":"Procaccini","suffix":""},{"id":623108010,"identity":"613f0485-1483-4831-b3fe-1da2bd5077a7","order_by":5,"name":"Giuseppe Nocentini","email":"","orcid":"https://orcid.org/0000-0002-5209-0488","institution":"University of Perugia","correspondingAuthor":false,"prefix":"","firstName":"Giuseppe","middleName":"","lastName":"Nocentini","suffix":""},{"id":623108011,"identity":"f2a4102b-6614-48d2-b195-186d9c9c601d","order_by":6,"name":"Vincenzo Villanacci","email":"","orcid":"","institution":"ASST Spedali Civili","correspondingAuthor":false,"prefix":"","firstName":"Vincenzo","middleName":"","lastName":"Villanacci","suffix":""},{"id":623108012,"identity":"13879bad-295f-4a0f-97f9-b0059f3d592d","order_by":7,"name":"Carlo Riccardi","email":"","orcid":"","institution":"University of Perugia","correspondingAuthor":false,"prefix":"","firstName":"Carlo","middleName":"","lastName":"Riccardi","suffix":""},{"id":623108013,"identity":"093d20c0-f7af-4aab-9598-22016a7187c1","order_by":8,"name":"Graziella Migliorati","email":"","orcid":"https://orcid.org/0000-0002-9475-6399","institution":"University of Perugia","correspondingAuthor":false,"prefix":"","firstName":"Graziella","middleName":"","lastName":"Migliorati","suffix":""},{"id":623108014,"identity":"ce6b8f9a-0958-4b32-8382-f4404fc1baf2","order_by":9,"name":"Simona Ronchetti","email":"","orcid":"","institution":"University of Perugia","correspondingAuthor":false,"prefix":"","firstName":"Simona","middleName":"","lastName":"Ronchetti","suffix":""}],"badges":[],"createdAt":"2025-09-11 09:36:49","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7590228/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7590228/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":106944914,"identity":"4756efeb-d778-4f1a-9398-a7429f1c8dfc","added_by":"auto","created_at":"2026-04-15 06:27:01","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":1019352,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative confocal microscopy images of either anti-SYP plus anti-GILZ Ab (left panels) or anti-ChrgA plus anti-GILZ Ab (right panels) staining in human colon sections. EEC were identified with either SYP or ChrgA immunoreactivity (both white and yellow arrows). Yellow arrows indicate EEC not expressing GILZ (GILZ\u003csup\u003e-\u003c/sup\u003e). DAPI staining identifies nuclei. Scale bar: 100µm.\u003c/p\u003e","description":"","filename":"Figure1R.png","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/ccf5910d16197dab8ab95b31.png"},{"id":106944961,"identity":"a15ce96d-1f24-4df9-8b43-fbba2421bcb9","added_by":"auto","created_at":"2026-04-15 06:27:19","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":401073,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative confocal microscopy image of a human colon section with two close EEC. A. The light blue arrow points to a 5HT\u003csup\u003e+\u003c/sup\u003e cell expressing low levels of GILZ, while the white arrow indicates a 5HT\u003csup\u003e-\u003c/sup\u003e cell expressing high levels of GILZ. DAPI staining identifies nuclei. Scale bar: 10µm. B. ImageJ quantitative analysis of GILZ expression evaluated in \u003cem\u003en\u003c/em\u003e=15 single cells GILZ\u003csup\u003ehigh\u003c/sup\u003e/5HT\u003csup\u003e-\u003c/sup\u003e and \u003cem\u003en\u003c/em\u003e=11 GILZ\u003csup\u003elow\u003c/sup\u003e/5HT\u003csup\u003e+\u003c/sup\u003e. Data are represented as mean ± SEM. **** p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Figure2R.png","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/ea1ed7081448f59094b5953c.png"},{"id":106944964,"identity":"b6370870-9dcf-40a7-bbf2-f8e69a3142b9","added_by":"auto","created_at":"2026-04-15 06:27:19","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":659281,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative confocal microscopy images of human colon sections with L-cells. A. GILZ\u003csup\u003e+\u003c/sup\u003e/GLP-1\u003csup\u003e+\u003c/sup\u003e cells are indicated by arrows. Scale bar: 100µm. B. Triple staining with anti-GILZ, anti-GLP-1 and anti-SYP Abs (DAPI identifies nuclei) demonstrate co-localization of the three proteins. Insets show a magnified selected cell with comparative quantification of GILZ-GLP-1 colocalisation (upper box) and GILZ-SYP colocalization (lower box), analysed with \u003cem\u003eJACop\u003c/em\u003e ImageJ plugin. Pearson’s coefficient value and Manders coefficients values are indicated for GILZ-GLP-1 colocalization (top panel) and GILZ-SYP colocalization (bottom panel) in dashed boxes. Scale bar: 50µm.\u003c/p\u003e","description":"","filename":"Figure3R.png","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/08c0a343e09c2dfba7582735.png"},{"id":106944903,"identity":"7024e07b-f67b-4d3d-a926-8ed16bac6312","added_by":"auto","created_at":"2026-04-15 06:26:56","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":665466,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative confocal microscopy images of human colon sections. A. Double staining with anti-GILZ and anti-Neurogenin 3 Abs: white arrowheads indicate double positive (GILZ\u003csup\u003e+\u003c/sup\u003e/NGN3\u003csup\u003e+\u003c/sup\u003e\u003csub\u003e)\u003c/sub\u003e EEC progenitors. Scale bar: 50µm. B. Yellow arrowheads indicate GILZ\u003csup\u003e+ \u003c/sup\u003ecells with a typical secretion pattern, not expressing NGN3. Nuclei were counterstained with DAPI. Scale bar: 50µm. C. The graph shows the number of specific cells per mm\u003csup\u003e2\u003c/sup\u003e, as mean ± SEM. *** p\u0026lt;0.001.\u003c/p\u003e","description":"","filename":"Figure4R.png","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/351326f6e98a639e5ec8a320.png"},{"id":106944925,"identity":"9b9bbd8f-a36c-44c0-b3f4-05d8fcbd4193","added_by":"auto","created_at":"2026-04-15 06:27:06","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":455891,"visible":true,"origin":"","legend":"\u003cp\u003eAnalysis of single-cell RNA sequencing (scRNA-seq) data from human colon samples retrieved from the Human Cell Atlas (HCA) Data Portal. A. UMAP projections of colonic single cells showing the expression levels of markers for the stages of EEC development (left column; color scale from light blue to red). The central column shows GILZ (\u003cem\u003eTSC22D3\u003c/em\u003e) expression (GILZ\u0026gt;0) in cells positive for each corresponding marker, while the pie charts (right column) summarize the proportion of cells expressing high levels of GILZ (cut-off value 1, GILZ\u0026gt;1 red) and low levels of GILZ (GILZ\u0026lt;1, light blue) within each population. B. The histogram shows the percentage of GILZ\u0026gt;1 cells across seven individual donors during different stages of EEC cell maturation. C. The histogram shows the percentage of GILZ\u0026gt;1 cells across different mature EEC subpopulations. Data are presented as mean ± SEM; individual donors are represented by circles. * p\u0026lt;0.05; ** p\u0026lt;0.01.\u003c/p\u003e","description":"","filename":"Figure5R.png","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/cdde8e86c3ecf61f5ba2811a.png"},{"id":106961591,"identity":"5fb59e6e-180d-44e3-854d-3994c84f503f","added_by":"auto","created_at":"2026-04-15 09:26:08","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":855752,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative confocal microscopy images of biopsies from UC patients. A. GILZ and GLP-1 co-staining in both active and quiescent UC. GLP-1\u003csup\u003e+\u003c/sup\u003e/GILZ\u003csup\u003e+\u003c/sup\u003e L-cells and GLP-1\u003csup\u003e+\u003c/sup\u003e cells are indicated by white and yellow arrows, respectively. An enlarged image of one selected cell is provided in the inset. B. Graphs show the number of GLP-1\u003csup\u003e+\u003c/sup\u003e/GILZ\u003csup\u003e+\u003c/sup\u003e cells (left graph) and total GLP-1\u003csup\u003e+\u003c/sup\u003e cells (right graph) in healthy controls, active UC and quiescent UC. Scale bar: 100µm. Data are presented as mean ± SEM. ** p\u0026lt;0.01, **** p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Figure6R.png","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/6899f616c844ee3f556c5ffc.png"},{"id":106960971,"identity":"3f75e130-04d6-467b-819c-69d7e0a811de","added_by":"auto","created_at":"2026-04-15 09:23:50","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":828722,"visible":true,"origin":"","legend":"\u003cp\u003eRepresentative confocal microscopy images of biopsies from UC patients. A. GILZ and SYP staining in both active and quiescent UC. Individual cells are indicated by arrows. B. The graph shows the number of 5HT\u003csup\u003e+\u003c/sup\u003e/GILZ\u003csup\u003e+\u003c/sup\u003e cells in healthy colons, active UC and quiescent UC. Scale bar: 100µm. Data are presented as mean ± SEM **** p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Figure7R.png","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/c3906726f657098c355de5f3.png"},{"id":106944905,"identity":"623c14b3-1829-4c48-b9d7-c37f72728415","added_by":"auto","created_at":"2026-04-15 06:26:56","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":461413,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eIn vitro\u003c/em\u003e activity of NCI-H716-derived vesicles and TAT-GILZ on epithelial Caco2 cells. A. Immunofluorescence images showing co-staining of GILZ (green) and GLP-1 (red) in NCI-H716. Nuclei were counterstained with DAPI. Scale bar: 10µm. B. \u003cem\u003eIn vitro\u003c/em\u003e co-culture of NCI-H716 and Caco2 cells in transwell plates. Caco 2 cells were exposed to TNFα for 24h before apical addition of NCI-H716 at the indicated ratios. After 24h of co-culture, mRNA was extracted from Caco2 and IL-8 expression was measured by RT-qPCR. The results are the mean±SE of two independent experiments, each run in triplicate. # \u003cem\u003evs\u003c/em\u003e control (black column); ° \u003cem\u003evs\u003c/em\u003e basal. #: p\u0026lt;0.0001; °: p\u0026lt;0.05. ELISA quantitative evaluation of IL-8 released in the medium in the 48h-co-cultures. C. Caco2 cells were treated with recombinant TAT-GILZ or related-control (TAT) after 24h exposure to TNFα. IL-8 expression was measured both by RT-qPCR after 24h and ELISA after 48h. The results are presented as the mean±SE of two independent experiments, each run in triplicate. D. \u003cem\u003eIn vitro\u003c/em\u003e co-culture of NCI-H716 and Caco2 cells in transwell plates. Caco 2 cells were exposed to TNFα for 24h before apical addition of silenced NCI-H716 at the 1:10 ratio (NCI-H716 : Caco2). NCI-H716 were silenced 24h earlier with either siRNA CTRL (HS positive control) or siRNA GILZ (siRNA TSC22D3). A further vehicle control with only the transfection reagent was added (Hyperfect). After 24h of co-culture, mRNA was extracted from both silenced NCI-H716 and Caco2 cells to measure GILZ and IL-8 expression (E), respectively, by RT-qPCR. F. ELISA assay to quantify the IL-8 release in the culture medium after 48h co-culture. The results are the mean±SE of two independent experiments, each run in duplicate. *p\u0026lt;0.05, **p\u0026lt;0.01, *** p\u0026lt;0.001, **** p\u0026lt;0.0001.\u003c/p\u003e","description":"","filename":"Figure8R.png","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/80e1791de6e41d740b59a003.png"},{"id":107487145,"identity":"bcb073c0-e6d9-4857-a013-a24bca9c0542","added_by":"auto","created_at":"2026-04-22 02:39:53","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5044722,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/3299f615-a2c5-40b1-b377-d29b4344f44b.pdf"},{"id":106944995,"identity":"959832b9-aba8-435b-9bc8-fc23ab64f8d9","added_by":"auto","created_at":"2026-04-15 06:27:25","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":609012,"visible":true,"origin":"","legend":"Supplementary figure S5","description":"","filename":"FigureS5R.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/15a809de02bf3e3808d13998.pdf"},{"id":106944957,"identity":"7aa63daa-63f1-4cc7-bada-0e6ace40e473","added_by":"auto","created_at":"2026-04-15 06:27:18","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":506464,"visible":true,"origin":"","legend":"Supplementary figure S6","description":"","filename":"FigureS6R.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/9c4cd2b95cedc7daa1a1cf97.pdf"},{"id":106944902,"identity":"b3d583cd-fd17-4a29-aa01-ea65d8d41f70","added_by":"auto","created_at":"2026-04-15 06:26:56","extension":"pdf","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":615121,"visible":true,"origin":"","legend":"Supplementary figure S9","description":"","filename":"FigureS9R.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/57b304373673368fa948a41a.pdf"},{"id":106944994,"identity":"343b99dd-0b37-45ae-8c75-9640b22fa871","added_by":"auto","created_at":"2026-04-15 06:27:24","extension":"pdf","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":395667,"visible":true,"origin":"","legend":"Supplementary figure S3","description":"","filename":"FigureS3R.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/3a278ce9c0f0e285abc12539.pdf"},{"id":106961601,"identity":"5bcb9815-a1f7-4cc3-a892-6b4954f94116","added_by":"auto","created_at":"2026-04-15 09:26:12","extension":"pdf","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":468458,"visible":true,"origin":"","legend":"Supplementary figure S7","description":"","filename":"FigureS7R.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/4153e005a789eb17a432c375.pdf"},{"id":106944963,"identity":"d0157256-88e3-4136-8e99-5b1853b03f8f","added_by":"auto","created_at":"2026-04-15 06:27:19","extension":"pdf","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":911034,"visible":true,"origin":"","legend":"Supplementary figure S2","description":"","filename":"FigureS2R.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/d521327d8c42d1a7914f9f01.pdf"},{"id":106944912,"identity":"80bf718c-b730-4d73-bdfe-6bb0c6559411","added_by":"auto","created_at":"2026-04-15 06:27:00","extension":"pdf","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":2913961,"visible":true,"origin":"","legend":"Supplementary figure S10","description":"","filename":"FigureS10R.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/e32f9416d1063bfcabe94c03.pdf"},{"id":106961586,"identity":"cc6555a4-8d1e-4708-8a3e-0a28ed3fd717","added_by":"auto","created_at":"2026-04-15 09:26:07","extension":"pdf","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":25141,"visible":true,"origin":"","legend":"Supplementary figure S11","description":"","filename":"FigureS11R.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/b81c0ecf5d7bea4e7d184083.pdf"},{"id":106944942,"identity":"255d28ed-eb4e-45aa-a1ba-4037ebe45a0c","added_by":"auto","created_at":"2026-04-15 06:27:17","extension":"pdf","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":369738,"visible":true,"origin":"","legend":"Supplementary figure S8","description":"","filename":"FigureS8R.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/013111a314a6a824c4406745.pdf"},{"id":106944906,"identity":"b9fae0e5-e59a-4b7b-9235-ae8b27255278","added_by":"auto","created_at":"2026-04-15 06:26:56","extension":"pdf","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":310368,"visible":true,"origin":"","legend":"Supplementary figure S1","description":"","filename":"FigureS1R.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/340b30f665dc08e6d9de7d1a.pdf"},{"id":106961417,"identity":"4901e438-2af6-482f-9e13-d41ddfc357b8","added_by":"auto","created_at":"2026-04-15 09:25:29","extension":"pdf","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":506486,"visible":true,"origin":"","legend":"Supplementary figure S4","description":"","filename":"FigureS4R.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7590228/v1/ce0c302e308d9f78ed6d4774.pdf"}],"financialInterests":"There is no conflict of interest","formattedTitle":"Glucocorticoid-induced Leucine Zipper (GILZ) is a novel secreted protein by intestinal L-cells and is dysregulated during active ulcerative colitis","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGILZ is a glucocorticoid-induced gene that mimics several anti-inflammatory effects of glucocorticoids in immune cells, as reported by studies in pre-clinical models of chronic/inflammatory diseases, including colitis [\u003cspan additionalcitationids=\"CR2 CR3 CR4 CR5 CR6 CR7 CR8 CR9\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. The recent identification of GILZ as a secretive protein in human goblet cells has broaden the array of its functional implications, opening considerations on its secretive role into GI tract and beyond. While reduced expression of GILZ in goblet cells has been correlated with neutrophil mucosal infiltration and disease activity in IBD patients, the observation of GILZ expression in EEC remained unexplored [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eEEC are epithelial cells interspersed throughout the GI mucosa, which are triggered to release neuroendocrine peptides and hormones into the \u003cem\u003elamina propria\u003c/em\u003e after stimulation by bacterial metabolites and food-derived molecules [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In addition, EEC display neuronal axon-like properties, producing vesicles for synaptic transmission [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Once delivered into the \u003cem\u003elamina propria\u003c/em\u003e, hormones can act on both local cells and neurons (\u003cem\u003eparacrine\u003c/em\u003e mode), as well as on distant cellular targets, exploiting either the blood stream (\u003cem\u003eendocrine\u003c/em\u003e mode) or the synaptic transmission (\u003cem\u003esynaptic\u003c/em\u003e mode) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Although the density of EEC is typically low throughout the GI mucosa, accounting for about 1% of the epithelial cells, they constitute the largest endocrine organ capable to link the gut to extra-intestinal organs, including the brain [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Currently, the use of organoid-based platform of human EECs have contributed to bridge the gap in the study of EEC secretome, leading to the release of an atlas of human EEC subtypes [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. New peptides that are secreted by EEC cells have been identified, but the list is still incomplete [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Furthermore, recent single cell studies revealed that human EEC secreted peptides not always overlapped with their murine counterpart [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eColonic EEC differentiate from pluripotent LRG5\u003csup\u003e+\u003c/sup\u003e stem cells, which are located deep into the crypt. Lineage differentiation proceeds via activation of Math1, Neurogenin 3 (NGN3), and Neurogenic differentiation factors [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. A recent classification subdivided colonic EEC into enterochromaffin (EC) cells, which are responsible for serotonin (5-HT) secretion, and L-cells, identified as pro-glucagon and peptide YY (PYY) source [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Pro-glucagon is further processed into glucagon-like peptide 1 (GLP-1) and GLP-2. GLP-1 is involved in glucose metabolism, inhibition of gastric emptying, negative regulation of food intake and body weight, whereas GLP-2 promotes crypt cell proliferation, intestinal stem cell expansion, and intestinal growth [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIBD is a clinical term including ulcerative colitis (UC) and Crohn\u0026rsquo;s disease (CD), which are chronic relapsing diseases affecting the patients\u0026rsquo; quality of life, also representing an economic burden worldwide. The propensity to relapse and disease-related complications are the major challenges to face in the clinical management and treatment planning of IBD patients [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Pharmacological treatments include glucocorticoids, non-steroidal anti-inflammatory drugs (NSAID), azathioprine and biologic agents. Nonetheless, achieving deep clinical remission still remains elusive [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. The impact of inflammatory processes on EEC is currently a matter of debate. While some Authors have been referring to IBD as a potential risk factor for neuroendocrine cell proliferations, ranging from neuroendocrine hyperplasia and micronests to neuroendocrine tumors (NET), others have seen no significant association between IBD and neuroendocrine proliferation [\u003cspan additionalcitationids=\"CR31 CR32\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. On the other hand, the influence of EEC on immune homeostasis has been proposed and the loss of EEC in diseases leading to gut dysfunctions corroborated that hypothesis. Such a critical role of EEC is further supported by the finding of abnormal permeability and inflammatory signature in experimental studies with EEC-deficient human organoids, underscoring their function as key regulators of intestinal inflammation [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan additionalcitationids=\"CR35 CR36 CR37 CR38 CR39\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe present study aimed at characterizing the expression and distribution of GILZ in distinct EEC subtypes, in both healthy individuals and UC patients. GILZ was found to be predominantly expressed in L-cells, including both precursors and mature cell populations. GILZ was also localized to intracellular vesicles partially co-expressing GLP-1 and Synaptophysin. These findings were confirmed by interrogating transcriptomic datasets. Immunofluorescence analysis revealed a reduction in the number of EEC, both L-cells and enterochromaffin cells (EC), in active UC. To investigate the functional role of GILZ in L-cells, \u003cem\u003ein vitro\u003c/em\u003e experiments with the human L-cell line NCI-H716 and epithelial Caco2 cells demonstrated GILZ to be a new protein secreted by L-cells acting as a potential anti-inflammatory mediator.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eGILZ is expressed in distinct subtypes of EEC in the human colon\u003c/h2\u003e \u003cp\u003eGILZ expression has been previously established in human goblet cells by our group [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. We also observed that GILZ was expressed in the cytoplasm of other cells, which exhibited apico-basal polarity by immunofluorescence staining (Supplementary Fig.\u0026nbsp;1). In a co-staining with GILZ, EEC were identified as immunoreactive both for synaptophysin (SYP) and Chromogranin A (ChgA). The results demonstrated the presence of GILZ in almost all EEC (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, white arrowheads), even though isolated EEC resulted GILZ negative (GILZ\u003csup\u003e\u0026minus;\u003c/sup\u003e) (yellow arrowheads).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eA recent \u003cem\u003et\u003c/em\u003e-distributed stochastic neighbor embedding (\u003cem\u003et\u003c/em\u003e-SNE) analysis visualized two distinct clusters of EEC in the colon, the EC and L-cells [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. The confocal images of Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA (magnification) and Supplementary Fig.\u0026nbsp;2 (wide field) show that 5HT-positive (5HT\u003csup\u003e+\u003c/sup\u003e) cells expressed very low or negligible levels of GILZ (light blue arrows, from now on identified as GILZ\u003csup\u003elow\u003c/sup\u003e/5-HT\u003csup\u003e+\u003c/sup\u003e), while 5HT\u003csup\u003e\u0026minus;\u003c/sup\u003e cells expressed high levels of GILZ (white arrows, from now on identified as GILZ\u003csup\u003ehigh\u003c/sup\u003e/5-HT\u003csup\u003e\u0026minus;\u003c/sup\u003e). The amount of GILZ protein in GILZ\u003csup\u003ehigh\u003c/sup\u003e/5-HT\u003csup\u003e\u0026minus;\u003c/sup\u003e and GILZ\u003csup\u003elow\u003c/sup\u003e/5-HT\u003csup\u003e+\u003c/sup\u003e single cells was quantitated by densitometric analysis resulting by mean 14-fold higher in the former (mean: 409.5\u0026thinsp;\u0026plusmn;\u0026thinsp;37.1 \u003cem\u003evs\u003c/em\u003e 29.2\u0026thinsp;\u0026plusmn;\u0026thinsp;4.6) \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Both 5HT\u003csup\u003e+\u003c/sup\u003e and 5HT\u003csup\u003e\u0026minus;\u003c/sup\u003e cells are GILZ\u003csup\u003e+\u003c/sup\u003e, but they express very different amount of GILZ protein.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further characterize the phenotype of GILZ\u003csup\u003ehigh\u003c/sup\u003e/5-HT\u003csup\u003e\u0026minus;\u003c/sup\u003e EEC, which according to recent work might be referred to as L-cells [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], we co-stained colon sections with anti-GLP-1 and anti-GILZ antibodies (Abs). The images in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA show that indeed GILZ\u003csup\u003ehigh\u003c/sup\u003e cells were positive for GLP-1, therefore they were identified as GILZ\u003csup\u003e+\u003c/sup\u003e/GLP-1\u003csup\u003e+\u003c/sup\u003e L-cells (white arrows). Furthermore, a triple staining using anti-GILZ, anti-GLP-1 and anti-SYP Abs showed that GILZ exhibited a granular expression pattern, suggesting GILZ as a secreted protein by L-cells, similarly to GLP-1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, arrowhead). Overlay images showed GILZ-GLP-1 partial co-localization. The extent of co-localization was calculated by ImageJ software with \u003cem\u003eJACoP ImageJ plugin\u003c/em\u003e, as described in [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. The Manders' coefficient of 0.335 means partial co-localization of GILZ with GLP-1 (about 30%), suggesting that the majority of GILZ- and GLP-1-containing cytoplasmic granules were distinct, thus implying independent vesicular secretion (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB, inset). Similarly, the overlay images of GILZ and SYP were analysed. The Manders' coefficient of 0.498 means partial co-localization of GILZ with SYP, but more extended than with GLP-1 (about 50%). An in depth analysis of this triple staining revealed that the majority of L-cells was GILZ\u003csup\u003e+\u003c/sup\u003e/GLP-1\u003csup\u003e+\u003c/sup\u003e (white arrows), whereas a small subset was GILZ\u003csup\u003e\u0026minus;\u003c/sup\u003e/GLP-1\u003csup\u003e+\u003c/sup\u003e (yellow arrows); conversely, another small proportion of EEC resulted GILZ\u003csup\u003e\u0026minus;\u003c/sup\u003e/GLP-1\u003csup\u003e\u0026minus;\u003c/sup\u003e (light blue arrows), only exhibiting SYP expression, indicating that not all SYP\u003csup\u003e+\u003c/sup\u003e cells are L-cells and not all L-cells express GILZ (Supplementary Fig.\u0026nbsp;3). In a triple co-staining of GILZ, GLP-1 and 5-HT, all these findings were further confirmed (Supplementary Fig.\u0026nbsp;4).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe next assessed the frequency of GILZ\u003csup\u003e+\u003c/sup\u003e/GLP-1\u003csup\u003e+\u003c/sup\u003e L-cells over the total GLP-1\u003csup\u003e+\u003c/sup\u003e cell population in ileal and colorectal biopsies from healthy individuals. Supplementary Fig.\u0026nbsp;5 shows an increasing gradient of cell density across the small and large bowel in healthy colonic mucosa.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eGILZ is expressed in progenitors and mature EEC\u003c/h3\u003e\n\u003cp\u003eExpression of preproglucagon (GCG), precursor of GLP-1 and GLP-2, is known to increase upward into the crypt, according to the stage of EEC differentiation [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. The observation that GILZ\u003csup\u003e+\u003c/sup\u003e/GLP-1\u003csup\u003e+\u003c/sup\u003e cells were scattered along the crypts (Supplementary Fig.\u0026nbsp;6) suggested that GILZ might be expressed at different stages of EEC development. To this end, we provided an assessment of GILZ expression in subsequent stages of EEC maturation, by co-staining colonic samples with anti-GILZ and anti-Neurogenin 3 (NGN3) Abs. NGN3 is a transcription factor that drives EEC commitment and is considered a marker of EEC progenitors [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. The majority of NGN3\u003csup\u003e+\u003c/sup\u003e cells co-stained with GILZ (NGN3\u003csup\u003e+\u003c/sup\u003eGILZ\u003csup\u003e+\u003c/sup\u003e), whereas only a few cells were NGN3\u003csup\u003e\u0026minus;\u003c/sup\u003eGILZ\u003csup\u003e+\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-C), indicating that GILZ is expressed from EEC precursors to mature cells into the crypt. In addition, GILZ/NGN3 co-staining in the majority of cells suggested that GILZ expression can be referred to as an early event in EEC maturation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo further analyse GILZ expression in human specimens, with a particular focus on EEC, avoiding the limitation of a protein-threshold level in the immunofluorescence technique, we used the single cell (sc)RNAseq analysis of publicly available dataset [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. We identified the stages of EEC maturation by the expression of temporally activated transcription factors as reported in \u003cem\u003eGuo et al\u003c/em\u003e [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Hence, EEC were sub-classified into four populations, including stem cells, secretory progenitors, EEC progenitors, and mature L-cells, which were identified by expressing Lgr5, Atoh1, NGN3, and GCG, respectively. The percentage of cells expressing GILZ gene (TSC22D3) was evaluated in healthy subjects (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;7) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). An increase in GILZ expression was found from EEC progenitors to mature L-cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). In mature EEC, identified by SYP, ChgA and ChgB expression, GILZ\u003csup\u003e+\u003c/sup\u003e cells were less than 20%, regardless the marker of neuroendocrine differentiation (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eGILZ is dysregulated in EEC of UC patients\u003c/h3\u003e\n\u003cp\u003eWe next analysed the distribution of GILZ\u003csup\u003e+\u003c/sup\u003e L-cells in mucosal samples from UC patients (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;84). Diagnostic criteria for active UC were met in 42 biopsies. The remaining 42 biopsies showed hyperplastic changes without neutrophil mucosal infiltration, and were referred to as quiescent UC. SYP\u003csup\u003e+\u003c/sup\u003e cells were found to be significantly decreased in active UC (5.1\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9/ mm\u003csup\u003e2\u003c/sup\u003e), as compared to quiescent UC (33.8\u0026thinsp;\u0026plusmn;\u0026thinsp;4.3/ mm\u003csup\u003e2\u003c/sup\u003e). Likewise, ChgA\u003csup\u003e+\u003c/sup\u003e EEC were decreased in active UC (9.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.8/ mm\u003csup\u003e2\u003c/sup\u003e) as compared to quiescent UC (34.3\u0026thinsp;\u0026plusmn;\u0026thinsp;3.5/ mm\u003csup\u003e2\u003c/sup\u003e) (Supplementary Fig.\u0026nbsp;7). Figure\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA shows immunofluorescence images of biopsies from both active and quiescent UC, with scanty both GILZ\u003csup\u003e+\u003c/sup\u003e/GLP-1\u003csup\u003e+\u003c/sup\u003e L-cells (white arrows) and total GLP-1\u003csup\u003e+\u003c/sup\u003e L-cells (white and yellow arrows), compared to samples from healthy individuals (Supplementary Fig.\u0026nbsp;8A and Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). We assessed the number of L-cells per mm\u003csup\u003e2\u003c/sup\u003e, including the analysis of sections from healthy individuals (Ctrl, Supplementary Fig.\u0026nbsp;3 and Supplementary Fig.\u0026nbsp;8A). GILZ\u003csup\u003e+\u003c/sup\u003e/GLP-1\u003csup\u003e+\u003c/sup\u003e (2.0\u0026thinsp;\u0026plusmn;\u0026thinsp;0.6 cells / mm\u003csup\u003e2\u003c/sup\u003e) and total GLP-1\u003csup\u003e+\u003c/sup\u003e cells (5.4\u0026thinsp;\u0026plusmn;\u0026thinsp;0.9 cells / mm\u003csup\u003e2\u003c/sup\u003e) were significantly reduced as compared to controls (17.4\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3 cells / mm\u003csup\u003e2\u003c/sup\u003e and 18.4\u0026thinsp;\u0026plusmn;\u0026thinsp;1.4 cells / mm\u003csup\u003e2\u003c/sup\u003e, respectively) in active UC (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Interestingly, a significant increase of GILZ\u003csup\u003e+\u003c/sup\u003e/GLP-1\u003csup\u003e+\u003c/sup\u003e was observed in quiescent UC (6.8\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3 cells / mm\u003csup\u003e2\u003c/sup\u003e), but below the level of controls; conversely, total GLP-1\u003csup\u003e+\u003c/sup\u003e cells did not increase significantly in quiescent UC (8.9\u0026thinsp;\u0026plusmn;\u0026thinsp;1.4 cells / mm\u003csup\u003e2\u003c/sup\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe next analysed the distribution of GILZ\u003csup\u003elow\u003c/sup\u003e/5-HT\u003csup\u003e+\u003c/sup\u003e EC in UC. Immunofluorescence images in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA showed a significant reduction in GILZ\u003csup\u003elow\u003c/sup\u003e/5HT\u003csup\u003e+\u003c/sup\u003e cells (9.0\u0026thinsp;\u0026plusmn;\u0026thinsp;1.3 cells / mm\u003csup\u003e2\u003c/sup\u003e) in active UC as compared to control (22.1\u0026thinsp;\u0026plusmn;\u0026thinsp;2.2 cells / mm\u003csup\u003e2\u003c/sup\u003e, Supplementary Fig.\u0026nbsp;8B and Supplementary Fig.\u0026nbsp;2), which was completely restored in quiescent UC (21.5\u0026thinsp;\u0026plusmn;\u0026thinsp;2.8 cells / mm\u003csup\u003e2\u003c/sup\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003eGILZ in L-cells exerts an anti-inflammatory role on inflamed epithelial cells\u003c/h3\u003e\n\u003cp\u003eThe function of GILZ in L-cells was investigated \u003cem\u003ein vitro\u003c/em\u003e, using the human L-cell line NCI-H716. We first assessed GILZ expression in these cells by immunofluorescence co-staining with GLP-1. The image in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA shows GILZ expressed with a cytoplasmic granular/vesicular pattern, suggesting secretory functions via granules or vesicles delivery, as previously described for GLP-1 [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. To investigate whether vesicle delivery could exert an anti-inflammatory effect, we set up an \u003cem\u003ein vitro\u003c/em\u003e co-culture of NCI-H716 cells and gut epithelial cell line Caco2 in transwell plates, to hinder any cell-to-cell contact between the two cell lines. Caco2 cells were exposed to TNFα as an inflammatory stimulus, for 24h. After TNFα withdrawal, NCI-H716 cells were added to inserts in Caco2 culture wells. IL-8 induction in Caco2 was measured as an index of cell inflammatory response, since IL-8 is a chemokine capable to attract neutrophils in the mucosa, starting trigger of inflammation in UC. Figure\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB shows that NCI-H716-secreted content was able to reduce IL-8 mRNA expression after 24h, independently of the amount of added NCI-H716 cell number. ELISA measurement of the released IL-8 confirmed the reduction after 48h (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). These results suggest that vesicles released by NCI-H716 can reduce inflammation, and GILZ in these granules could contribute to this anti-inflammatory effect. To directly test this hypothesis in another set of experiments, we treated Caco2 cells with TAT-GILZ recombinant protein, which can directly enter the cells. After exposure of Caco2 cells to TNFα for 24h, the addition of TAT-GILZ protein significantly reduced the expression of IL-8, as measured by RT-qPCR. Accordingly, IL-8 released in the culture medium was reduced 48h later (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). To further substantiate the contribution of GILZ to the anti-inflammatory effect of L-cell-derived products, GILZ expression was silenced in NCI-H716 cells. The cell cycle distribution of untreated and Hyperfect-treated NCI-H716 cells (controls) was first evaluated at 24 and 48h post-silencing. No significant differences were observed in the proportion of cells in G0/G1, S or G2/M phases between untreated and Hyperfect-treated cells (Supplementary Fig.\u0026nbsp;9A). Accordingly, subsequent analyses compared silenced groups to Hyperfect-treated cells. Twenty-four hours after silencing, NCI-H716 cells were seeded into apical inserts of transwell-plates and co-cultured with TNFα pre-activated Caco2 cells under the same experimental conditions described above. After additional 24h, cell cycle distribution was assessed in Hyperfect, siRNA CTRL and siRNA GILZ groups to confirm the expected reduction of cell proliferation in the positive control (siRNA CTRL). As shown in Supplementary Fig.\u0026nbsp;9A, siRNA CTRL significantly reduced cell cycle progression compared to Hyperfect- and siRNA GILZ-treated cells, indicating effective silencing of pro-survival genes (detailed in Materials and Methods). Total RNA was isolated from apical inserts from Hyperfect, siRNA CTRL and siRNA GILZ groups (48h post-silencing) and GILZ expression was quantified. A schematic representation of the experimental workflow is provided in Supplementary Fig.\u0026nbsp;9C. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eD, GILZ expression was significantly reduced in siRNA GILZ cells compared with controls. To determine the effect of GILZ silencing on IL-8 production, IL-8 expression was measured in Caco2 cells 24h after co-culture with silenced NCI-H716 cells. Consistent with the results shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB, IL-8 expression was significantly suppressed in Caco2 cells co-cultured with Hyperfect- and siRNA CTRL-treated cells. In contrast, IL-8 levels were significantly increased in Caco2 cells co-cultured with siRNA GILZ-treated cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eE). However, IL-8 expression in this group was not completely restored to the levels of TNFα-pre-treated control cells, suggesting that GILZ contributes to the anti-inflammatory effect of L-cell-secreted products, although it is not the sole mediator of this activity. IL-8 protein concentration in the culture supernatants was quantified 48h later by ELISA. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eF, a significant reduction in IL-8 release was observed in control groups (Hyperfect and siRNA Ctrl), whereas IL-8 levels resulted in a marked increase in the siRNA GILZ, reaching values comparable to those detected in TNFα-pre-treated Ctrl, suggesting an accumulation of secreted IL-8 in the culture medium.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003ePrevious studies in both animal models and humans have demonstrated the role of GILZ as an anti-inflammatory protein implicated in IBD, affecting immune responses as well as goblet cell functions [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan additionalcitationids=\"CR5 CR6\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan additionalcitationids=\"CR48\" citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. In the present study, we identified high GILZ expression levels in L-cells, a specific subtype of EEC. In these cells, GILZ was partially co-expressed with both GLP-1, the major incretin released by colonic L-cells, and synaptophysin, a membrane glycoprotein expressed in the synaptic-like microvesicles of EEC [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e]. Importantly, GILZ expression was detected as an early event during EEC differentiation, being detected in both precursors and mature cells. This observation supports a potential functional role of GILZ throughout the entire EEC lifecycle. Consistently, GILZ\u003csup\u003e+\u003c/sup\u003e/GLP-1\u003csup\u003e+\u003c/sup\u003e cells were distributed along the length of the colonic crypts, indicating that GILZ expression occurs across subsequent developmental stages of L-cells. Transcriptomic scRNAseq analysis further confirmed our findings, showing elevated GILZ expression in mature secretory cells, particularly within the EEC population.\u003c/p\u003e \u003cp\u003eA deep examination of GILZ expression in human gut samples by immunofluorescence analysis revealed a progressive increase in GILZ-expressing L-cells along the gut, displaying an upward trend from the ileum to the rectum. This spatial distribution closely paralleled the pattern observed for GLP-1 expression, suggesting a potential coordinated secretion of GILZ and GLP-1 in L-cells. This observation is consistent with previous evidence demonstrating that L-cell density increases distally along the human intestine toward the rectum [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In active UC, we observed a significant reduction of GLP-1\u003csup\u003e+\u003c/sup\u003e/GILZ\u003csup\u003e+\u003c/sup\u003e cells and total GLP-1\u003csup\u003e+\u003c/sup\u003e cells compared to controls. Notably, GLP-1\u003csup\u003e+\u003c/sup\u003eGILZ\u003csup\u003e+\u003c/sup\u003e cells were restored in quiescent UC, even though at a lesser degree as compared to controls, whereas no differences were observed in total GLP-1\u003csup\u003e+\u003c/sup\u003e cell number, suggesting GILZ is important for the restoration of L-cells. The intestinal environment, which is highly sensitive to inflammation, number, distribution and function of cells may be affected by active disease, pro-inflammatory cytokines and epithelial barrier dysfunction. Hence, varying degrees of epithelial cell restoration can be observed in quiescent UC, including number and function of cells, mostly depending on the duration of the regenerative process and on the magnitude of the acute inflammation [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Intriguingly, GLP-1 is synthesized intracellularly and released through secretory vesicles in response to dietary nutrients and it is known to participate in the autocrine/paracrine signaling, which may be disrupted in IBD [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e, \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. In particular, GLP1 can influence the vesicular release of other molecules, as it contributes to exosome biogenesis [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Therefore, the reduced GLP-1 expression may drive the reduction of GILZ levels, which might negatively affect the epithelial repair, as observed in preclinical studies [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. The loss of GILZ\u003csup\u003e+\u003c/sup\u003e L-cells in active UC correlates with the inflammatory environment, potentially promoting the impairment of gut homeostasis. This finding aligns with our previous observation of GILZ reduction in goblet cells from IBD patients [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Supporting this role, the administration of recombinant TAT-GILZ protein has been shown to ameliorate symptoms of spontaneously induced colitis in IL-10-KO mice and other experimental models by modulating either T or B infiltrating lymphocytes (revised in [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]), and by strengthening the mucosal barrier in DSS-induced colitis [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]. Together, these findings from both animal and human studies support the concept that GILZ contributes to maintain intestinal homeostasis.\u003c/p\u003e \u003cp\u003e Intriguingly, colonic L-cells showed a distinct cytoplasmic localization of GILZ, resembling vesicle-like structures. This observation suggests GILZ may be implicated in vesicular trafficking, similar to other L-cell products [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. Although these GILZ-containing vesicles have not yet been fully characterized, their nature warrants further investigation.\u003c/p\u003e \u003cp\u003eOur \u003cem\u003ein vitro\u003c/em\u003e experiments aimed at identifying GILZ function in L-cells. Vesicles secreted by NCI-H716 L-cells were found to downregulate IL-8 expression in co-cultured Caco2 epithelial cells, suggesting that GILZ, together with GLP-1, contributes to the suppression of this key pro-inflammatory chemokine. IL-8, produced by epithelial cells after mucosal barrier damage, plays a central role in recruiting neutrophils to the mucosa. While neutrophil infiltration is essential for pathogen clearance, excessive accumulation can lead to transepithelial migration, crypt architectural disruption, and exacerbation of inflammation in IBD [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. By reducing IL-8 levels, GILZ release from L-cells may contribute to reduce neutrophil-driven mucosal injury and inflammation. This function is further supported by our demonstration that the recombinant TAT-GILZ protein directly suppresses IL-8 production in epithelial cells and GILZ silencing reduces the ability of secreted L-cell proteins to suppress IL-8 produced by inflamed epithelial cells. Interestingly, GLP-1 also exerts anti-inflammatory effects, since previous studies demonstrated that GLP-1 alleviates DSS-induced colitis in murine models by reducing inflammation [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e]. This function may explain the fact that GILZ contributes to prevention of the release of IL-8, but is not the sole protein to exert this effects. Interestingly, accumulated IL-8 protein in the culture supernatant of GILZ-silenced cells reached the control levels after 48h. Our results add data to the known extracellular vesicle-mediated immune responses in the gut [\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. A limit of this study is the unknown mechanism of GILZ-mediated IL-8 suppression, which does not relies on NF-κB inhibition (data not shown) but on other factors, which deserve future studies. Furthermore, GLP-1 is secreted in response to glucose intake, sustaining a gluco-regulatory system that acts by increasing insulin and suppressing glucagon secretion [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e62\u003c/span\u003e]. Impaired GLP-1 secretion can lead to clinical susceptibility to abnormal glucose metabolism, supporting the clinical association between IBD and diabetes [\u003cspan additionalcitationids=\"CR64\" citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e]. Our findings open future perspectives toward the combined restoration of GLP-1 and GILZ as a promising therapeutic strategy to dampen inflammation and promote mucosal healing. Particularly, the role of goblet cells as cellular target of the anti-inflammatory effects of L-cells secretion suggests that even the barrier functions can be improved in UC patients\u003c/p\u003e \u003cp\u003eA distinct scenario was observed for EC 5HT\u003csup\u003e+\u003c/sup\u003e cells. In these cells, GILZ expression was consistently low, resulting unaffected by disease activity. Interestingly, 5HT\u003csup\u003e+\u003c/sup\u003e EC cell count decreased significantly during active UC, but was completely restored in quiescent UC. However, previous studies investigating mucosal 5-HT levels and EC cell dynamics in IBD have yielded conflicting results: some studies described an increase in EC cell numbers in UC patients and experimental models of colitis [\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e], whereas others reported a decrease [\u003cspan additionalcitationids=\"CR68\" citationid=\"CR67\" class=\"CitationRef\"\u003e67\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. Despite these discrepancies, it is evident that EC cell abundance and 5-HT levels are altered in active UC, and our data support the observations about the decrease in EC numbers. 5HT\u003csup\u003e+\u003c/sup\u003eGILZ\u003csup\u003e+\u003c/sup\u003e cells were found to be completely restored in the quiescence, but this effect may not depend on GILZ function, due to its very low expression levels. The specific contribution of GILZ to EC biology still remains unclear and warrants further investigation.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eOur study identifies GILZ as a novel EEC product, expressed in L-cells. GILZ can potentially facilitate the crosstalk between epithelial cells and immune system, contributing to colon homeostasis. Altered GILZ expression in L-cells may be associated with either the onset or relapse in UC. Specifically, the loss of GILZ\u003csup\u003e+\u003c/sup\u003e L-cells during active UC, together with impaired secretion of both GILZ and GLP-1, could further impair the barrier dysfunction of the gut mucosa, compromise responsiveness to conventional therapies, and contribute to extra-intestinal IBD-related manifestations, including diabetes. Restoring GILZ expression in L-cells, particularly in combination with approaches that trigger GLP-1 secretion or mimic its actions, may represent a promising pharmacological approach in UC patients.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry and Immunofluorescence\u003c/h2\u003e \u003cp\u003e Biopsy samples from healthy colonic mucosa and UC patients were retrospectively analysed, according to the Ethics Committee Spedali Civili, Brescia, ID no NP 4811. Four \u0026micro;m-thick slides were cut from formalin-fixed paraffin-embedded (FFPE) specimens, and stained with Hematoxylin-Eosin dye. Specimens from UC patients were evaluated for architectural distortion, mucin depletion, occurrence of basal plasma cells, and disease activity by experienced GI pathologists. Neutrophil infiltration, cryptitis and crypt abscesses, erosion and ulcerations were referred to active UC, and were evaluated in all the samples. Overall, 120 mucosal pinch biopsies were examined, including 84 samples from UC patients and 36 samples from healthy donors.\u003c/p\u003e \u003cp\u003eFor immunofluorescence assays, FFPE specimens were cut and deparaffinized. After rehydration, antigen retrival was performed according to the specific Ab. Immunostaining was performed with the following Abs: anti-GILZ (ab197987, Abcam, Cambridge, UK), anti-5-HT (ab6336, Abcam), anti-GLP-1 (ab26278, Abcam) anti-ChrgA (sc-271738, Santa Cruz, Dallas, Texas, USA), anti-Neurog3 (sc-376607, Santa Cruz) and anti-Syp (OSS00058W-100UL, Thermo Fisher Scientific, Waltham, MA, USA). The anti-GILZ antibody has been granted as highly specific by the manufacturer. All the Abs were incubated overnight at 4\u0026deg;C as previously described [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Secondary Abs (Alexafluor 488, Alexafluor 555, Alexafluor 640, Thermo Fisher Scientific, Waltham, MA, USA) were added the following day and incubated for 1h at room temperature (anti-rabbit Ab for the detection of GILZ, anti-mouse Ab for the detection of GLP-1 Ab and ChrgA, anti-rat Ab for the detection of 5-HT and anti-sheep Ab for the detection of Syp). An example of secondary Ab staining is shown in Supplementary Fig.\u0026nbsp;10. The slides were then washed with PBS 0.1% TWEEN 3 times for 5 minutes and then stained with DAPI (D9542, Sigma-Aldrich, Milan, Italy) to detect the nuclei.\u003c/p\u003e \u003cp\u003eAll slides were analysed using Eclipse Ti microscope equipped with Confocal Spinning Disk. In healthy specimens and UC biopsies, the fields (high power field \u0026ndash;HPF-, 20x magnification, area\u0026thinsp;=\u0026thinsp;0.4 \u0026micro;m\u003csup\u003e2\u003c/sup\u003e) were randomly chosen; stained cells were counted by two independent researchers in a blinded manner. To statistically determine the number of stained cells in UC patients, 27 HPF from 10 healthy samples, 30 HPF from 10 active UC patients, and 28 HPF from 7 quiescent UC patients were assessed for GLP-1 total and GILZ-GLP-1 co-expression; 18 HPF from 7 healthy samples, 32 HPF from 6 active UC patients, and 24 HPF from 5 quiescent UC patients were assessed for 5HT\u003csup\u003e\u0026minus;\u003c/sup\u003eGILZ co-expression.\u003c/p\u003e \u003cp\u003eDensitometric analysis of fluorescence in single cells was carried out with the software ImageJ. After isolating, thresholding, and subtracting background, fluorescence intensity mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SE in the selected area was calculated by the software. Cells were analysed within the same field, in separate stained samples. Values below 100 arbitrarily identified low GILZ-expressing cells, values above 100 arbitrarily identified high GILZ-expressing cells. A schematic description of the identification of GILZ\u003csup\u003elow\u003c/sup\u003e and GILZ\u003csup\u003ehigh\u003c/sup\u003e expressing cells distinguishing 5HT (EC cells) and GLP-1 cells (L-cells) is reported in Supplementary Fig.\u0026nbsp;11. Co-localization analyses of GILZ and GLP-1, or GILZ and SYP were performed using the JacoP plug in for ImageJ, as previously described [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e, \u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNCI-H716 cells were cytospun onto glass slides and fixed with 10% formalin. After washing in PBS, cells were blocked with buffer containing 0.1% Triton-X and 1% bovine serum albumin. Cells were then incubated o.n. with goat anti-GILZ (sc-26520, discontinued, Santa Cruz) and anti-GLP-1 (ab26278, Abcam,) Abs. After washing with PBS Tween 0,1%, cells were incubated for 1 h with secondary anti-goat-Alexa 488 and anti-mouse Alexa 555 (Alexafluor, Thermo Fisher Scientific) Abs. After adding DAPI, slides were mounted with cover glass and analyzed using a Zeiss Axioplan fluorescence microscope (Zeiss, Oberkochen, Germany) equipped with a Spot-2 cooled camera (SPOT Imaging Solution, Sterling Heights, MI, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eCell cultures\u003c/h2\u003e \u003cp\u003eCaco2 cells were a kind gift of Prof. Domenico Delfino. Caco2 cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) containing 10% of fetal bovine serum (FBS), 1% of non-essential amino acids (MEM NEAA), 1% of sodium pyruvate and 50 IU/mL penicillin and 50 \u0026micro;g/mL streptomycin at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. NCI-H716 cell line was purchased from CLS Cell Lines Service GmbH (Eppelheim, Germany). NCI-H716 were cultured in RPMI 1640 containing 10% of FBS and 50 IU/mL penicillin and 50 \u0026micro;g/mL streptomycin at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eTreatments and co-cultures\u003c/h2\u003e \u003cp\u003eOn day\u0026thinsp;\u0026minus;\u0026thinsp;2 of the experiment, Caco2 cells were seeded in 12-wells plates (3x10\u003csup\u003e5\u003c/sup\u003e cell/ml) and incubated for 24h at 37\u0026deg;C. On day\u0026thinsp;\u0026minus;\u0026thinsp;1, cells were stimulated with 10 ng/ml Tumor Necrosis Factor α (TNFα) (recombinant human- Cell guidance system, Cambridge, UK). After further 24 hours, TNFα was withdrawn by replacing with fresh medium. Corning\u0026reg; Transwell\u0026reg; 12 well plates (pores 0.4 \u0026micro;M diameter) (Merck, cat# CLS3401-48EA, Darmstadt, Germany) were inserted in each well containing Caco2 cells previously exposed to TNFα for 24h. NCI-H716 were seeded in the apical side of the transwell (inserts) at concentration ratios of 1:10, 1:20, 1:50 (NCI-H716: Caco2). At day 1 and 2 of co-culture, mRNA extraction from Caco2 cells was carried out to evaluate IL-8 expression. For Caco2-NCI-H716 co-culture experiments, NCI-H716 cells were grown in complete DMEM medium for 2 weeks, and GLP-1 and GILZ expression levels were analysed by RT-qPCR (not shown). No significant changes in either proliferation or mRNA expression levels were noticed. TAT-GILZ (5 \u0026micro;g/mL) recombinant protein, a cell-permeable fusion protein, and control TAT peptide (2.5 \u0026micro;g/mL) were used for \u003cem\u003ein vitro\u003c/em\u003e experiments [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e, \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]. IL-8 release in the culture supernatants was quantified with Human IL-8 Uncoated ELISA kit (Invitrogen, Thermo Fisher Scientific), according to the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eRNA interference assay\u003c/h2\u003e \u003cp\u003eNCI-H716 cells were seeded in cell culture flasks at 2x10^5 c/w in 24 well-plate, following the manufacturer\u0026rsquo;s instructions. Positive control HS cell death (siRNA CTRL) and Hyperfect transfection reagent were added to two separate groups as controls (Qiagen, Hilden, Germany). GILZ was transiently knocked down in NCI-H716 cells by siRNA GILZ (TSC22D3) for 24h and then added to the inserts on transwell plates, in which Caco2 cells had been previously seeded and treated with TNFα for 24h (see MM for co-culture experiments in transwell). Twenty-four hours later, mRNA from apical (NCI-H716 silenced) and bottom (Caco2) cells was extracted to measure GILZ and IL-8 expression, respectively. Cell cycle analysis was performed in all groups both 24h and 48h after silencing, by propidiun iodide staining. Briefly, cells were collected, centrifuged and suspended in propidium iodide-hypotonic solution, and kept 1h at 4\u0026deg;C. The analysis was conducted on a Becton Dickinson FACScan running LYSIS II software. For a more detailed description of the entire procedure, see the schematic in Supplementary Fig.\u0026nbsp;9C.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative RT-PCR\u003c/h2\u003e \u003cp\u003emRNA was extracted from Caco2 cells using RNeasy Plus Mini Kit (Qiagen, Hilden, Germany). The extracted mRNA was retro-transcribed by QuantiTect Reverse Transcription Kit (Qiagen, Hilden, Germany). Quantitative Real-time PCR (RT-qPCR) was performed in triplicate on QuantStudio 1 Real-Time PCR System (Applied Biosystem, Waltham, MA, USA), following the TaqMan\u0026reg; Gene Expression Assays Protocol to detect GILZ by a FAM\u0026trade; probe (cat# Hs00929365_m1, Thermo Fisher Scientific, Waltham, MA USA), and the eukaryotic 18S rRNA endogenous control (VIC\u0026trade;/MGB probe, primer limited) (Cat# 4319413E Thermo Fisher Scientific, Waltham, MA, USA), using TaqMan\u0026trade; Gene Expression Master Mix (Applied Biosystems, Waltham, MA, USA). SYBR\u0026trade; Green Assay Protocol (Applied Biosystems, Waltham, MA, USA) was used to measure IL-8 (Forward primer 5\u0026rsquo;ACTCCAAACCTTTCCACCCC3\u0026rsquo;- Reverse primer 5\u0026rsquo;TTCTCAGCCCTCTTCAAAAACTTC3\u0026rsquo;), using human GAPDH (5\u0026rsquo;GCTCCTCCTGTTCGACAGTCA3\u0026rsquo;- Reverse primer 5\u0026rsquo;GCAACAATATCCACTTTACCAG3\u0026rsquo;) as housekeeping gene. Samples were run in triplicate and two-three distinct experiments were performed in each experimental setting. The method 2\u003csup\u003e\u0026minus;∆CT\u003c/sup\u003e was used to calculate the relative expression levels.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eBioinformatics analysis\u003c/h2\u003e \u003cp\u003ePublicly available scRNA-seq data from the study by Elmentaite \u003cem\u003eet al\u003c/em\u003e [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] were retrieved from the Human Cell Atlas (HCA) Data Portal (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://data.humancellatlas.org/\u003c/span\u003e\u003cspan address=\"https://data.humancellatlas.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Only data corresponding to normal colonic tissue from adult donors were included in the analysis. Data exploration and visualization were performed using the CZ CELLxGENE platform (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://cellxgene.cziscience.com/\u003c/span\u003e\u003cspan address=\"https://cellxgene.cziscience.com/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). This tool was also used to generate Uniform Manifold Approximation and Projection (UMAP) plots and to quantify the number of positive cells for selected markers in each individual donor.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eStatistical analyses were performed using Prism 10.4.2 software (GraphPad Software, Boston, MA, USA). Normality was assessed with Kolmogorov\u0026ndash;Smirnov test. Pairwise or multiple comparisons of values with normal distribution were carried out using Student\u0026rsquo;s t test (unpaired), one-sample t test (theoretical mean\u0026thinsp;=\u0026thinsp;1) and one-way ANOVA. Post hoc tests were conducted where appropriate. Results were considered significant at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05, and data are reported as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (SEM).\u003c/p\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe author(s) received no specific funding for this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study was approved by the ethics committee Spedali Civili, Brescia, ID no NP 4811.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contributions\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLR, GL, SR contributed to the conception and design of the experiments. LR, GL, MRS, and MP performed the experiments. LC performed statistical and bioinformatics analysis. LR, LC, GL, and SR analyzed the data. GN, VV, CR, and GM provided material support and contributed revision of the manuscript. SR, GL, LC wrote the manuscript. All authors read and approved the final paper\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding Statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors received no specific funding for this work.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003ePaglialunga M, Flamini S, Contini R, Febo M, Ricci E, Ronchetti S, \u003cem\u003eet al.\u003c/em\u003e Anti-Inflammatory Effects of Synthetic Peptides Based on Glucocorticoid-Induced Leucine Zipper (GILZ) Protein for the Treatment of Inflammatory Bowel Diseases (IBDs). \u003cem\u003eCells\u003c/em\u003e 2023, 12(18).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCari L, Rosati L, Leoncini G, Lusenti E, Gentili M, Nocentini G, \u003cem\u003eet al.\u003c/em\u003e Association of GILZ with MUC2, TLR2, and TLR4 in Inflammatory Bowel Disease. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 2023, 24(3).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNataraja C, Flynn J, Dankers W, Northcott M, Zhu W, Sherlock R, \u003cem\u003eet al.\u003c/em\u003e GILZ regulates type I interferon release and sequesters STAT1. \u003cem\u003eJ Autoimmun\u003c/em\u003e 2022, 131: 102858.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBuoso E, Masi M, Limosani RV, Fagiani F, Oliviero C, Colombo G, \u003cem\u003eet al.\u003c/em\u003e Disruption of Epithelial Barrier Integrity via Altered GILZ/c-Rel/RACK1 Signaling in Inflammatory Bowel Disease. \u003cem\u003eJ Crohns Colitis\u003c/em\u003e 2025, 19(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBereshchenko O, Coppo M, Bruscoli S, Biagioli M, Cimino M, Frammartino T, \u003cem\u003eet al.\u003c/em\u003e GILZ promotes production of peripherally induced Treg cells and mediates the crosstalk between glucocorticoids and TGF-beta signaling. \u003cem\u003eCell Rep\u003c/em\u003e 2014, 7(2): 464\u0026ndash;475.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCannarile L, Cuzzocrea S, Santucci L, Agostini M, Mazzon E, Esposito E, \u003cem\u003eet al.\u003c/em\u003e Glucocorticoid-induced leucine zipper is protective in Th1-mediated models of colitis. \u003cem\u003eGastroenterology\u003c/em\u003e 2009, 136(2): 530\u0026ndash;541.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBruscoli S, Sorcini D, Flamini S, Gagliardi A, Adamo F, Ronchetti S, \u003cem\u003eet al.\u003c/em\u003e Glucocorticoid-Induced Leucine Zipper Inhibits Interferon-Gamma Production in B Cells and Suppresses Colitis in Mice. \u003cem\u003eFront Immunol\u003c/em\u003e 2018, 9: 1720.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBruscoli S, Riccardi C, Ronchetti S. GILZ as a Regulator of Cell Fate and Inflammation. \u003cem\u003eCells\u003c/em\u003e 2021, 11(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGoodman WA, Bedoyan SM, Havran HL, Richardson B, Cameron MJ, Pizarro TT. Impaired estrogen signaling underlies regulatory T cell loss-of-function in the chronically inflamed intestine. \u003cem\u003eProc Natl Acad Sci U S A\u003c/em\u003e 2020, 117(29): 17166\u0026ndash;17176.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaban B, Marchetti C, Khodadadi H, Malik A, Emami G, Lin PC, \u003cem\u003eet al.\u003c/em\u003e Glucocorticoid-Induced Leucine Zipper Promotes Neutrophil and T-Cell Polarization with Protective Effects in Acute Kidney Injury. \u003cem\u003eJ Pharmacol Exp Ther\u003c/em\u003e 2018, 367(3): 483\u0026ndash;493.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeoncini G, Gentili M, Lusenti E, Caruso L, Calafa C, Migliorati G, \u003cem\u003eet al.\u003c/em\u003e The novel role of glucocorticoid-induced leucine zipper as a marker of mucosal healing in inflammatory bowel diseases. \u003cem\u003ePharmacol Res\u003c/em\u003e 2022, 182: 106353.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFurness JB, Kunze WA, Clerc N. Nutrient tasting and signaling mechanisms in the gut. II. The intestine as a sensory organ: neural, endocrine, and immune responses. \u003cem\u003eAm J Physiol\u003c/em\u003e 1999, 277(5): G922\u0026ndash;928.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee J, Cummings BP, Martin E, Sharp JW, Graham JL, Stanhope KL, \u003cem\u003eet al.\u003c/em\u003e Glucose sensing by gut endocrine cells and activation of the vagal afferent pathway is impaired in a rodent model of type 2 diabetes mellitus. \u003cem\u003eAm J Physiol Regul Integr Comp Physiol\u003c/em\u003e 2012, 302(6): R657\u0026ndash;666.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBohorquez DV, Samsa LA, Roholt A, Medicetty S, Chandra R, Liddle RA. An enteroendocrine cell-enteric glia connection revealed by 3D electron microscopy. \u003cem\u003ePLoS One\u003c/em\u003e 2014, 9(2): e89881.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBohorquez DV, Liddle RA. The gut connectome: making sense of what you eat. \u003cem\u003eJ Clin Invest\u003c/em\u003e 2015, 125(3): 888\u0026ndash;890.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBertrand PP. The cornucopia of intestinal chemosensory transduction. \u003cem\u003eFront Neurosci\u003c/em\u003e 2009, 3: 48.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbdalqadir N, Adeli K. GLP-1 and GLP-2 Orchestrate Intestine Integrity, Gut Microbiota, and Immune System Crosstalk. \u003cem\u003eMicroorganisms\u003c/em\u003e 2022, 10(10).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhlman H, Nilsson. The gut as the largest endocrine organ in the body. \u003cem\u003eAnn Oncol\u003c/em\u003e 2001, 12 Suppl 2: S63\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeumer J, Puschhof J, Bauza-Martinez J, Martinez-Silgado A, Elmentaite R, James KR, \u003cem\u003eet al.\u003c/em\u003e High-Resolution mRNA and Secretome Atlas of Human Enteroendocrine Cells. \u003cem\u003eCell\u003c/em\u003e 2020, 181(6): 1291\u0026ndash;1306 e1219.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmith CA, O'Flaherty EAA, Guccio N, Punnoose A, Darwish T, Lewis JE, \u003cem\u003eet al.\u003c/em\u003e Single-cell transcriptomic atlas of enteroendocrine cells along the murine gastrointestinal tract. \u003cem\u003ePLoS One\u003c/em\u003e 2024, 19(10): e0308942.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoberts GP, Larraufie P, Richards P, Kay RG, Galvin SG, Miedzybrodzka EL, \u003cem\u003eet al.\u003c/em\u003e Comparison of Human and Murine Enteroendocrine Cells by Transcriptomic and Peptidomic Profiling. \u003cem\u003eDiabetes\u003c/em\u003e 2019, 68(5): 1062\u0026ndash;1072.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeumer J, Clevers H. Cell fate specification and differentiation in the adult mammalian intestine. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e 2021, 22(1): 39\u0026ndash;53.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKolev HM, Kaestner KH. Mammalian Intestinal Development and Differentiation-The State of the Art. \u003cem\u003eCell Mol Gastroenterol Hepatol\u003c/em\u003e 2023, 16(5): 809\u0026ndash;821.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAtanga R, Singh V, In JG. Intestinal Enteroendocrine Cells: Present and Future Druggable Targets. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 2023, 24(10).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKuhre RE, Deacon CF, Holst JJ, Petersen N. What Is an L-Cell and How Do We Study the Secretory Mechanisms of the L-Cell? \u003cem\u003eFront Endocrinol (Lausanne)\u003c/em\u003e 2021, 12: 694284.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKumar V. GLP-1/GLP-1R axis: from metabolism (obesity and T2DM) to immunity. \u003cem\u003eOpen Biol\u003c/em\u003e 2025, 15(7): 240303.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLeoncini G, Ronchetti S, Villanacci V. Mucosal barrier dysfunction and relapse in ulcerative colitis: Is there more that meets the eye? \u003cem\u003eDig Liver Dis\u003c/em\u003e 2024, 56(8): 1420.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eD'Amico F, Fasulo E, Jairath V, Paridaens K, Peyrin-Biroulet L, Danese S. Management and treatment optimization of patients with mild to moderate ulcerative colitis. \u003cem\u003eExpert Rev Clin Immunol\u003c/em\u003e 2024, 20(3): 277\u0026ndash;290.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWetwittayakhlang P, Bessissow T, Lakatos PL. Novel and emerging drugs for the treatment of Crohn's disease: a review of phase II and III trials. \u003cem\u003eExpert Opin Emerg Drugs\u003c/em\u003e 2024, 29(1): 19\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWong M, Larson BK, Dhall D. Neuroendocrine proliferations in inflammatory bowel disease: differentiating neuroendocrine tumours from neuroendocrine cell micronests. \u003cem\u003eHistopathology\u003c/em\u003e 2019, 74(3): 415\u0026ndash;423.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKanada S, Sugita A, Mikami T, Ohashi K, Hayashi H. Microcarcinoid arising in patients with long-standing ulcerative colitis: histological analysis. \u003cem\u003eHum Pathol\u003c/em\u003e 2017, 64: 28\u0026ndash;36.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAoki S, Watanabe M, Hasegawa H, Nishibori H, Mukai M, Kitajima M. Rectal carcinoid arising in ulcerative colitis associated with rectal adenocarcinoma. \u003cem\u003eJ Gastroenterol\u003c/em\u003e 2004, 39(7): 697\u0026ndash;698.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFu K, Igarashi S, Jindo O, Ishikawa T, Hirabayashi K, Kotake K, \u003cem\u003eet al.\u003c/em\u003e Synchronous colitic cancers and microcarcinoids in a patient with long-standing and extensive ulcerative colitis: a case report and review of the literature. \u003cem\u003eSurg Laparosc Endosc Percutan Tech\u003c/em\u003e 2008, 18(3): 304\u0026ndash;307.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Salhy M, Mazzawi T, Umezawa K, Gilja OH. Enteroendocrine cells, stem cells and differentiation progenitors in rats with TNBS-induced colitis. \u003cem\u003eInt J Mol Med\u003c/em\u003e 2016, 38(6): 1743\u0026ndash;1751.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEl-Salhy M, Hatlebakk JG. Changes in enteroendocrine and immune cells following colitis induction by TNBS in rats. \u003cem\u003eMol Med Rep\u003c/em\u003e 2016, 14(6): 4967\u0026ndash;4974.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWorthington JJ. The intestinal immunoendocrine axis: novel cross-talk between enteroendocrine cells and the immune system during infection and inflammatory disease. \u003cem\u003eBiochem Soc Trans\u003c/em\u003e 2015, 43(4): 727\u0026ndash;733.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu Y, Yang W, Li Y, Cong Y. Enteroendocrine Cells: Sensing Gut Microbiota and Regulating Inflammatory Bowel Diseases. \u003cem\u003eInflamm Bowel Dis\u003c/em\u003e 2020, 26(1): 11\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFurness JB, Rivera LR, Cho HJ, Bravo DM, Callaghan B. The gut as a sensory organ. \u003cem\u003eNat Rev Gastroenterol Hepatol\u003c/em\u003e 2013, 10(12): 729\u0026ndash;740.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLebrun LJ, Lenaerts K, Kiers D, Pais de Barros JP, Le Guern N, Plesnik J, \u003cem\u003eet al.\u003c/em\u003e Enteroendocrine L Cells Sense LPS after Gut Barrier Injury to Enhance GLP-1 Secretion. \u003cem\u003eCell Rep\u003c/em\u003e 2017, 21(5): 1160\u0026ndash;1168.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNwako JG, Patel SD, Roach TJ, Gupte SR, Williams SG, Riedman AM, \u003cem\u003eet al.\u003c/em\u003e Enteroendocrine cells regulate intestinal barrier permeability. \u003cem\u003eAm J Physiol Cell Physiol\u003c/em\u003e 2025, 328(5): C1501\u0026ndash;C1508.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eParikh K, Antanaviciute A, Fawkner-Corbett D, Jagielowicz M, Aulicino A, Lagerholm C, \u003cem\u003eet al.\u003c/em\u003e Colonic epithelial cell diversity in health and inflammatory bowel disease. \u003cem\u003eNature\u003c/em\u003e 2019, 567(7746): 49\u0026ndash;55.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolte S, Cordelieres FP. A guided tour into subcellular colocalization analysis in light microscopy. \u003cem\u003eJ Microsc\u003c/em\u003e 2006, 224(Pt 3): 213\u0026ndash;232.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo X, Lv J, Xi R. The specification and function of enteroendocrine cells in Drosophila and mammals: a comparative review. \u003cem\u003eFEBS J\u003c/em\u003e 2022, 289(16): 4773\u0026ndash;4796.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJenny M, Uhl C, Roche C, Duluc I, Guillermin V, Guillemot F, \u003cem\u003eet al.\u003c/em\u003e Neurogenin3 is differentially required for endocrine cell fate specification in the intestinal and gastric epithelium. \u003cem\u003eEMBO J\u003c/em\u003e 2002, 21(23): 6338\u0026ndash;6347.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElmentaite R, Kumasaka N, Roberts K, Fleming A, Dann E, King HW, \u003cem\u003eet al.\u003c/em\u003e Cells of the human intestinal tract mapped across space and time. \u003cem\u003eNature\u003c/em\u003e 2021, 597(7875): 250\u0026ndash;255.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReimer RA, Darimont C, Gremlich S, Nicolas-Metral V, Ruegg UT, Mace K. A human cellular model for studying the regulation of glucagon-like peptide-1 secretion. \u003cem\u003eEndocrinology\u003c/em\u003e 2001, 142(10): 4522\u0026ndash;4528.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGentili M, Sabbatini S, Nunzi E, Lusenti E, Cari L, Mencacci A, \u003cem\u003eet al.\u003c/em\u003e Glucocorticoid-Induced Leucine Zipper Protein and Yeast-Extracted Compound Alleviate Colitis and Reduce Fungal Dysbiosis. \u003cem\u003eBiomolecules\u003c/em\u003e 2024, 14(10).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRonchetti S, Gentili M, Ricci E, Migliorati G, Riccardi C. Glucocorticoid-Induced Leucine Zipper as a Druggable Target in Inflammatory Bowel Diseases. \u003cem\u003eInflamm Bowel Dis\u003c/em\u003e 2020, 26(7): 1017\u0026ndash;1025.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGentili M, Hidalgo-Garcia L, Vezza T, Ricci E, Migliorati G, Rodriguez-Nogales A, \u003cem\u003eet al.\u003c/em\u003e A recombinant glucocorticoid-induced leucine zipper protein ameliorates symptoms of dextran sulfate sodium-induced colitis by improving intestinal permeability. \u003cem\u003eFASEB J\u003c/em\u003e 2021, 35(11): e21950.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGould VE, Lee I, Wiedenmann B, Moll R, Chejfec G, Franke WW. Synaptophysin: a novel marker for neurons, certain neuroendocrine cells, and their neoplasms. \u003cem\u003eHum Pathol\u003c/em\u003e 1986, 17(10): 979\u0026ndash;983.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHarada Y, Hiasa M. Immunological identification of vesicular nucleotide transporter in intestinal L cells. \u003cem\u003eBiol Pharm Bull\u003c/em\u003e 2014, 37(7): 1090\u0026ndash;1095.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUrbauer E, Aguanno D, Kuellmer K, Metwaly A, Waldschmitt N, Ahmed M, \u003cem\u003eet al.\u003c/em\u003e Reduced Intestinal GLP-1(+) Cell Numbers Are Associated With an Inflammation-related Epithelial Metabolic Signature. \u003cem\u003eCell Mol Gastroenterol Hepatol\u003c/em\u003e 2026, 20(2): 101656.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOhara-Imaizumi M, Aoyagi K, Akimoto Y, Nakamichi Y, Nishiwaki C, Kawakami H, \u003cem\u003eet al.\u003c/em\u003e Imaging exocytosis of single glucagon-like peptide-1 containing granules in a murine enteroendocrine cell line with total internal reflection fluorescent microscopy. \u003cem\u003eBiochem Biophys Res Commun\u003c/em\u003e 2009, 390(1): 16\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKappe C, Zhang Q, Holst JJ, Nystrom T, Sjoholm A. Evidence for paracrine/autocrine regulation of GLP-1-producing cells. \u003cem\u003eAm J Physiol Cell Physiol\u003c/em\u003e 2013, 305(10): C1041\u0026ndash;1049.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYu H, Davoudi M, Sadegh-Nejadi S, Miao X, Bagherieh M, Afrisham R. Impact of monotherapy and combination therapy with glucagon-like peptide-1 receptor agonists on exosomal and non-exosomal MicroRNA signatures in type 2 diabetes mellitus: a systematic review. \u003cem\u003eJ Transl Med\u003c/em\u003e 2025, 23(1): 477.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBeumer J, Gehart H, Clevers H. Enteroendocrine Dynamics - New Tools Reveal Hormonal Plasticity in the Gut. \u003cem\u003eEndocr Rev\u003c/em\u003e 2020, 41(5).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKang L, Fang X, Song YH, He ZX, Wang ZJ, Wang SL, \u003cem\u003eet al.\u003c/em\u003e Neutrophil-Epithelial Crosstalk During Intestinal Inflammation. \u003cem\u003eCell Mol Gastroenterol Hepatol\u003c/em\u003e 2022, 14(6): 1257\u0026ndash;1267.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhou GX, Liu ZJ. Potential roles of neutrophils in regulating intestinal mucosal inflammation of inflammatory bowel disease. \u003cem\u003eJ Dig Dis\u003c/em\u003e 2017, 18(9): 495\u0026ndash;503.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBendotti G, Montefusco L, Lunati ME, Usuelli V, Pastore I, Lazzaroni E, \u003cem\u003eet al.\u003c/em\u003e The anti-inflammatory and immunological properties of GLP-1 Receptor Agonists. \u003cem\u003ePharmacol Res\u003c/em\u003e 2022, 182: 106320.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee YS, Jun HS. Anti-Inflammatory Effects of GLP-1-Based Therapies beyond Glucose Control. \u003cem\u003eMediators Inflamm\u003c/em\u003e 2016, 2016: 3094642.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShen Q, Huang Z, Yao J, Jin Y. Extracellular vesicles-mediated interaction within intestinal microenvironment in inflammatory bowel disease. \u003cem\u003eJ Adv Res\u003c/em\u003e 2022, 37: 221\u0026ndash;233.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAhren B. Gut peptides and type 2 diabetes mellitus treatment. \u003cem\u003eCurr Diab Rep\u003c/em\u003e 2003, 3(5): 365\u0026ndash;372.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMuhammad A, Abdulkareem TMK, Alharbi AEB, Alessa NA, Bin Qaed S, Ebrahim EK, \u003cem\u003eet al.\u003c/em\u003e The Interplay of Inflammatory Bowel Disease (IBD) and Diabetes in Pediatrics: A Systematic Review. \u003cem\u003eCureus\u003c/em\u003e 2024, 16(9): e70425.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVillumsen M, Schelde AB, Jimenez-Solem E, Jess T, Allin KH. GLP-1 based therapies and disease course of inflammatory bowel disease. \u003cem\u003eeClinicalMedicine\u003c/em\u003e 2021, 37.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMigliorisi G, Gabbiadini R, Dal Buono A, Ferraris M, Privitera G, Petronio L, \u003cem\u003eet al.\u003c/em\u003e GLP-1 receptor agonists in IBD: exploring the crossroads of metabolism and inflammation. \u003cem\u003eFront Immunol\u003c/em\u003e 2025, 16: 1610368.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKhan WI, Motomura Y, Wang H, El-Sharkawy RT, Verdu EF, Verma-Gandhu M, \u003cem\u003eet al.\u003c/em\u003e Critical role of MCP-1 in the pathogenesis of experimental colitis in the context of immune and enterochromaffin cells. \u003cem\u003eAm J Physiol Gastrointest Liver Physiol\u003c/em\u003e 2006, 291(5): G803\u0026ndash;811.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMagro F, Vieira-Coelho MA, Fraga S, Serrao MP, Veloso FT, Ribeiro T, \u003cem\u003eet al.\u003c/em\u003e Impaired synthesis or cellular storage of norepinephrine, dopamine, and 5-hydroxytryptamine in human inflammatory bowel disease. \u003cem\u003eDig Dis Sci\u003c/em\u003e 2002, 47(1): 216\u0026ndash;224.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShajib MS, Chauhan U, Adeeb S, Chetty Y, Armstrong D, Halder SLS, \u003cem\u003eet al.\u003c/em\u003e Characterization of Serotonin Signaling Components in Patients with Inflammatory Bowel Disease. \u003cem\u003eJ Can Assoc Gastroenterol\u003c/em\u003e 2019, 2(3): 132\u0026ndash;140.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCoates MD, Mahoney CR, Linden DR, Sampson JE, Chen J, Blaszyk H, \u003cem\u003eet al.\u003c/em\u003e Molecular defects in mucosal serotonin content and decreased serotonin reuptake transporter in ulcerative colitis and irritable bowel syndrome. \u003cem\u003eGastroenterology\u003c/em\u003e 2004, 126(7): 1657\u0026ndash;1664.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePandya P, Jethva M, Rubin E, Birnbaum RY, Braiman A, Isakov N. PICOT binding to chromatin-associated EED negatively regulates cyclin D2 expression by increasing H3K27me3 at the CCND2 gene promoter. \u003cem\u003eCell Death Dis\u003c/em\u003e 2019, 10(10): 685.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVago JP, Galvao I, Negreiros-Lima GL, Teixeira LCR, Lima KM, Sugimoto MA, \u003cem\u003eet al.\u003c/em\u003e Glucocorticoid-induced leucine zipper modulates macrophage polarization and apoptotic cell clearance. \u003cem\u003ePharmacol Res\u003c/em\u003e 2020, 158: 104842.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRonchetti S, Migliorati G, Riccardi C. GILZ as a Mediator of the Anti-Inflammatory Effects of Glucocorticoids. \u003cem\u003eFront Endocrinol (Lausanne)\u003c/em\u003e 2015, 6: 170.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"cell-death-discovery","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddiscovery","sideBox":"Learn more about [Cell Death Discovery](http://www.nature.com/cddiscovery/)","snPcode":"41420","submissionUrl":"https://mts-cddiscovery.nature.com/","title":"Cell Death Discovery","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"","lastPublishedDoi":"10.21203/rs.3.rs-7590228/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7590228/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThe Glucocorticoid-Induced Leucine Zipper (GILZ) is a key mediator of the anti-inflammatory effects of glucocorticoids, primarily within the immune system. Recent evidence has implicated GILZ as a secretive protein in goblet cells, with reduced expression linked to active Inflammatory Bowel Disease (IBD), suggesting a role in intestinal cell homeostasis. In this context, GILZ has been found also in enteroendocrine cells (EEC), but its role remained undefined. This study aimed at identifying GILZ-expressing EEC subtypes, dissecting how the secretive function is affected by inflammation in human ulcerative colitis (UC) and exploring its role in these cells. GILZ was predominantly expressed in glucagon-like-peptide-1 (GLP-1)-secreting L-cells, across all stages of EEC differentiation. GILZ was also expressed in serotonin (5HT)-producing enterochromaffin cells (EC), even though at low levels. Such an expression profile was supported by analysis of publicly available single-cell RNA sequencing datasets, identifying both EEC progenitors and mature subsets. Interestingly, confocal immunofluorescence localized GILZ to cytoplasmic granules partially co-staining with GLP-1-containing vesicles. Histological analysis of mucosal colonic biopsies revealed a global reduction in EEC during active UC as compared to healthy individuals and quiescent UC. Specifically, GILZ-expressing L-cells were significantly reduced in active UC and only partially restored in quiescent disease. In contrast, 5HT-producing EC cells were still reduced during active UC but fully recovered in quiescent disease. \u003cem\u003eIn vitro\u003c/em\u003e, NCI-H716 L-cell line-secreted products reduced IL-8 secretion in Caco2 epithelial cells, indicating an anti-inflammatory effect. This activity was attenuated following GILZ silencing. Interestingly, treatment with a recombinant TAT-GILZ protein directly diminished IL-8 in Caco2 cells. Collectively, our findings identify GILZ as a novel secretory product of L-cells with potential anti-inflammatory properties. Restoring GILZ secretion may represent a promising therapeutic strategy to mitigate chronic intestinal inflammation in UC.\u003c/p\u003e","manuscriptTitle":"Glucocorticoid-induced Leucine Zipper (GILZ) is a novel secreted protein by intestinal L-cells and is dysregulated during active ulcerative colitis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-04-15 06:26:22","doi":"10.21203/rs.3.rs-7590228/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"revise","date":"2026-05-05T11:15:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-05-03T14:42:42+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-05-03T14:42:05+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"","date":"2026-05-03T14:42:04+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-04-14T16:14:40+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-04-14T12:17:07+00:00","index":"","fulltext":""},{"type":"submitted","content":"Cell Death Discovery","date":"2026-04-14T12:17:06+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"cell-death-discovery","isNatureJournal":false,"hasQc":false,"allowDirectSubmit":false,"externalIdentity":"cddiscovery","sideBox":"Learn more about [Cell Death Discovery](http://www.nature.com/cddiscovery/)","snPcode":"41420","submissionUrl":"https://mts-cddiscovery.nature.com/","title":"Cell Death Discovery","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"ejp","reportingPortfolio":"Nature AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"4c7e3ff8-8575-4289-9dfb-acf85d4242e2","owner":[],"postedDate":"April 15th, 2026","published":true,"recentEditorialEvents":[{"type":"decision","content":"revise","date":"2026-05-05T11:15:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"This content is not available.","date":"2026-05-03T14:42:42+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewerAgreed","content":"This content is not available.","date":"2026-05-03T14:42:05+00:00","index":1,"fulltext":"This content is not available."},{"type":"reviewersInvited","content":"1","date":"2026-05-03T14:42:04+00:00","index":"","fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[{"id":66312287,"name":"Health sciences/Diseases/Gastrointestinal diseases/Inflammatory bowel disease/Ulcerative colitis"},{"id":66312288,"name":"Biological sciences/Immunology/Inflammation"},{"id":66312289,"name":"Health sciences/Anatomy/Gastrointestinal system/Large intestine/Colon"}],"tags":[],"updatedAt":"2026-05-05T13:18:00+00:00","versionOfRecord":[],"versionCreatedAt":"2026-04-15 06:26:22","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-7590228","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7590228","identity":"rs-7590228","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.