'Candidatus Phytoplasma mali' SAP11-Like protein modulates expression of genes involved in metabolic pathways, photosynthesis, and defense in Nicotiana occidentalis leaves.

preprint OA: closed
Full text JSON View at publisher

Abstract

Background: ' Candidatus Phytoplasma mali', the causal agent of apple proliferation disease, exerts influence on its host plant through various effector proteins, including SAP11 CaPm which interacts with different TCP transcription factors. This study examines the transcriptional response of the plant upon early expression of SAP11 CaPm . For that purpose, leaves of Nicotiana occidentalis H.-M. Wheeler were Agrobacterium-infiltrated to induce transient expression of SAP11 CaPm and changes in the transcriptome were recorded until 5 days post infection. Results: : The analysis revealed that presence of SAP11 CaPm in leaves leads to downregulation of genes involved in defense response and related to photosynthetic processes, while expression of genes involved in metabolic pathways was enhanced. Conclusions: : The results indicate that early SAP11 CaPm expression might be important for the colonization of the host plant since phytoplasmas lack many metabolic genes and are thus dependent on metabolites from their host plant.
Full text 216,613 characters · extracted from preprint-html · click to expand
'Candidatus Phytoplasma mali' SAP11-Like protein modulates expression of genes involved in metabolic pathways, photosynthesis, and defense in Nicotiana occidentalis leaves. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article 'Candidatus Phytoplasma mali' SAP11-Like protein modulates expression of genes involved in metabolic pathways, photosynthesis, and defense in Nicotiana occidentalis leaves. Cecilia Mittelberger, Mirko Moser, Bettina Hause, Katrin Janik This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3821494/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 10 You are reading this latest preprint version Abstract Background: ' Candidatus Phytoplasma mali', the causal agent of apple proliferation disease, exerts influence on its host plant through various effector proteins, including SAP11 CaPm which interacts with different TCP transcription factors. This study examines the transcriptional response of the plant upon early expression of SAP11 CaPm . For that purpose, leaves of Nicotiana occidentalis H.-M. Wheeler were Agrobacterium-infiltrated to induce transient expression of SAP11 CaPm and changes in the transcriptome were recorded until 5 days post infection. Results: The analysis revealed that presence of SAP11 CaPm in leaves leads to downregulation of genes involved in defense response and related to photosynthetic processes, while expression of genes involved in metabolic pathways was enhanced. Conclusions: The results indicate that early SAP11 CaPm expression might be important for the colonization of the host plant since phytoplasmas lack many metabolic genes and are thus dependent on metabolites from their host plant. Apple proliferation plant defense RNA-seq SAP11 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Background 'Candidatus Phytoplasma mali ' (' Ca . P. mali') is a plant pathogen, that is associated to proliferation disease in apple ( Malus x domestica Borkh.). This cell wall-less bacterium belongs to the class of Mollicutes and has one of the smallest genomes among all so far known phytoplasma species [ 1 ]. Phytoplasmas reside in the plant phloem and are transmitted by phloem sucking psyllids. ' Ca . P. mali' manipulates its host plant by secreting effector proteins via a sec-dependent secretion system [ 2 ]. Several effector proteins are known from different phytoplasma [ 3 ]. So far, in ' Ca . P. mali' four effector proteins, namely SAP11 CaPm [ 4 ], PME2 [ 5 ], PM19_00185 [ 6 ] and SAP05 CaPm [ 7 ], and the virulence factor AAA + ATPase AP460 [ 8 ] have been identified as host manipulating factors. While little or nothing is known about PME2’s, SAP05 CaPm ´s and PM19_00185´s function in apple trees, the potential function of the ' Ca . P. mali' SAP11 homolog of SAP11 AYWB (from ' Candidatus Phytoplasma asteris'), has been also described in apple [ 4 , 9 – 11 ]. SAP11 AYWB binds and destabilizes three different TCP (TEOSINTE BRANCHED1/ CYCLOIDEA/ PROLIFERATING CELL FACTOR 1 and 2) transcription factors and is involved in the development of different symptoms [ 12 , 13 ]. In contrast to SAP11 AYWB , SAP11 CaPm localizes not only to the cell nucleus, but also to the cytoplasm [ 14 ]. However, it has been shown that it binds -similar as SAP11 AYWB - two class II CIN-like TCPs, namely MdTCP4a (orthologue to AtTCP4) and MdTCP13a (orthologue to AtTCP13), [ 4 ] formerly known as MdTCP25 and MdTCP24 respectively [ 15 ] as well as to the class II CYC/TB1 TCP MdTCP18a (orthologue to AtTCP18) (formerly known as MdTCP16 as described in [ 16 ]). SAP11 CaPm -binding to its TCP-interaction partners causes severe growth aberrations, early bud break and hormonal disbalance within the plant [ 14 ]. Effector binding of MdTCP4a and MdTCP13a is supposed to be at the basis of the changes in jasmonate (JA) and abscisic acid (ABA) levels observed in infected plants and might be the reason for the development of late flowers, leaf reddening and altered root architecture [ 4 ]. The binding of MdTCP18a is supposed to counteract the MdTCP18a upregulation in infected plants, leading to an early bud break and uncontrolled shoot outgrowth [ 16 ]. The stable overexpression of SAP11 AYWB in Arabidopsis plants resulted in a total of 59 upregulated and 104 downregulated genes as revealed by RNA-seq [ 17 ]. From the 59 upregulated genes, 18 genes were functionally annotated as inorganic phosphorus (P i ) starvation-induced genes. In the group of downregulated genes, LIPOXYGENASE2 ( LOX2 ), a gene encoding an enzyme involved in JA biosynthesis, and PATHOGENESIS-RELATED GENE1 (PR1) and ELICITOR-ACTIVATED GENE3-1 (ELI3-1) , two salicylic acid (SA) responsive genes, were found. This indicates that SAP11 AYWB suppresses the defense response while enhancing bacterial growth in Arabidopsis plants. In addition, it has been shown that defense response to insect vectors is also reduced in SAP11 AYWB overexpressing Arabidopsis plants [ 18 ]. Nicotiana occidentalis H.-M. Wheeler plants directly infected with ' Ca . P. mali' showed 157 proteins with an increased and 173 with a decreased expression compared to healthy plants pointing to the fact that a single effector, such as SAP11 only affects a subset of genes deregulated by the pathogen [ 19 ]. The proteins encoded by genes with an increased expression comprised mainly the alpha-linolenic acid synthesis, while those with downregulation were involved in porphyrin and chlorophyll metabolism [ 19 ]. This was in line with increased JA levels and leaf yellowing of infected plants. Even though such studies help to understand possible functions of SAP11 CaPm , only little is known so far about the very early role of SAP11 CaPm during early infection of plants with ' Ca . P. mali'. Thus, the aim of this study was to gain a better understanding of the transcriptional changes that occur in the plant host during early occurrence of the effector protein. Infiltration RNA-seq [ 20 ] was used to unravel expression networks and effector function in so far healthy plants upon expression of SAP11 CaPm . Moreover, N. occidentalis H.-M. Wheeler was chosen since it has been described as the appropriate model plant to study ' Ca . P. mali' effector functions [ 10 , 19 , 21 – 23 ]. Therefore, the gene encoding the effector protein SAP11 CaPm was transiently expressed by agroinfiltration in N. occidentalis H.-M. Wheeler leaves and differential gene expression was analyzed until 5 days post infiltration in the respective leaf tissue. Transcriptional changes in the infiltrated leaves revealed that SAP11 CaPm affects mainly genes involved in defense responses, photosynthesis, and metabolic pathways at early time points of its occurrence in the cells. Methods Plant Material and Agroinfiltration Nicotiana occidentalis H.-M. Wheeler seeds were kindly provided by Kajohn Boonrod from RLP AgroScience GmbH, Neustadt, Germany [ 10 , 22 ]. Seedlings were grown in a plant growth chamber (Percival AR22L, Percival Scientific, Perry, IA, USA) under long photoperiod conditions (16 h/8 h, 24°C/22°C, 70% rH). Four to five-week-old plants were used for agroinfiltration. For agroinfiltration the coding sequence of the mature SAP11 CaPm effector protein from ' Ca . P. mali' strain STAA (Accession: KM501063) was subcloned into the GreenGate-entry module pGGC00 [ 24 ] using the primer pair ATP00189pP_Cfw (AACAGGTCTCAGGCTCCATGTCTCCTCCTAAAAAAGATTCTA) / ATP00189pP_Drv (AACAGGTCTCACTGATTTTTTTCCTTTGTCTTTATTGTTA). Transformation constructs coding for SAP11 CaPm :GFP under the control of CaMV 35S promoter and flanked by the RBCS terminator and a plant kanamycin resistance marker were assembled using modules from the GreenGate-kit [ 24 ]. In detail, a GreenGate reaction containing 150 ng pGGA004 ( p35S ), 150 ng pGGB003 (B-dummy), 150 ng pGGC000- SAP11 CaPm , 150 ng pGGD001 (linker-GFP), 150 ng pGGE001 ( tRBCS ), 150 ng pGGF007 ( pNOS::KanR:tNOS ), and 100 ng pGGZ001 (empty destination vector) was combined in a total volume of 15 µL. For the GreenGate reaction 1.5 µL 10× CutSmart Buffer (New England Biolab, Ipswich, MA, USA), 1.5 µL ATP (10 mM), 1.0 µL T4 DNA Ligase (5 u/µL) (Thermo Fisher Scientific, Waltham, MA, USA), and 1.0 µL BsaI-HF®v2 (20,000 u/mL) (New England Biolab, Ipswich, MA, USA) were added to the module-mixture, and 30 cycles at 37°C and at 16°C for 2 in each, followed by 50°C for 5 min and 80°C for 5 min were performed. Subsequently, 5 µL of the reaction mixture were used for heat-shock transformation of ccdB-sensitive One Shot® TOP10 chemically competent E. coli (Invitrogen, Carlsbad, CA, USA). A second vector containing only the GFP gene fused to a nuclear localization signal was assembled, using the pGGC012 module (GFP-NLS). The correctness of the assembled plant expression vectors was confirmed by sequencing. The validated GreenGate expression vectors, 35S::SAP11 CaPm : GFP and 35S::GFP-NLS were transferred together with pSOUP helper plasmid into electrocompetent A. tumefaciens strain EHA105. The A. tumefaciens clones were cultured for 2 days at 28°C in selective LB medium. For infiltration 0.5 OD/mL were resuspended in infiltration medium (10 mM MgCl2, 10 mM MES, 200 µM acetosyringone, pH 5.7), regenerated for 4h at 28°C and infiltrated with a blunt syringe into three leaves from four- to five-week-old N. occidentalis H.-M. Wheeler plants. Six plants were infiltrated with the effector expressing 35S::SAP11 CaPm : GFP construct and six plants were infiltrated with 35S::GFP-NLS serving as controls. Additional six plants were not infiltrated and used as non-infiltrated controls. The infiltrated area was marked with a pen on the adaxial leaf side and six leaf discs with a size of 1 cm² (two/infiltrated area) were excised immediately after infiltration from one plant of each variant. Leaf disc excision was repeated on different plants in a 24-h-rhythm. Leaf discs were immediately flash frozen in liquid nitrogen. Infiltration and leaf disc sampling were repeated with three independent plant sets, grown at three different time points. cDNA Library Construction and Sequencing A total of 36 leaf discs samples of plants from all three treatments for the timepoints 0 h, 24 h, 72 h and 120 h were sent on dry ice for RNA extraction, library preparation and sequencing to StarSEQ (Mainz, Germany). Additionally, 15 samples were prepared from different growth stages of untreated N. occidentalis H.-M. Wheeler plants and send on dry ice to StarSEQ. RNA of those samples together with RNA of the 36 leaf disc samples was pooled and used for the de novo transcriptome assembly. The stranded RNA sequencing library was prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolab, Ipswich, MA, USA). The library for the de novo transcriptome assembly was sequenced on a Illumnia NextSeq500 platform in 2 x 150 nt paired-end mode. The libraries of the 36 leaf samples were sequenced on the same platform in 1 x 75 nt single-end mode. Quality assessment of the reads was performed using the FASTQC tool [ 25 ]. Adapter trimming of paired end reads was done with the FASTQ Toolkit (BaseSpace Labs) retaining reads with a minimum read length of 32 nt. De novo transcriptome assembly of Nicotiana occidentalis The whole workflow for de novo transcriptome assembly and RNA-seq analysis is depicted in Fig. 1 . First, all adapter trimmed paired end reads were quality trimmed with a sliding window of 4 nt, a minimum phred quality score of 20 and a minimal read length of 75 nt using the tool Trimmomatic v.0.36 [ 26 ]. The de novo assembly was then performed in strand-specific mode using Trinity v. 2.9 [ 27 ]. The whole de novo assembled transcriptome was first annotated using Trinotate v.3.2.0 [ 28 ] with the help of Transdecoder v.5.5.0 [ 29 ] to estimate all possible coding regions. Since the annotation contained several transcripts not belonging to Nicotiana , the whole transcriptome was decontaminated using the MCSC Decontamination method [ 30 ] filtering for transcripts belonging to the order of Solanales. The remaining decontaminated transcriptome was reannotated with Trinotate v.3.2.1 using homology search to SwissProt sequence database with Blast 2.12.0+ [ 31 ], to PFAM database for protein domain identification with HMMER (hmmer v.3.3.2) [ 32 ] and for the prediction of a signal peptide with SignalP v.5.0.b [ 33 ] and of a transmembrane domain with tmhmm v.2.0c [ 34 ]. The annotated transcripts were visualized using the build in TrinotateWeb tool. Differential Expression Analysis, GO enrichment analysis Transcripts were quantified using Trinity v.2.11.0 build in Salmon (v.1.4.0) [ 35 ] pipeline. Selection of differentially expressed transcripts (DETs) was afterwards performed with the Trinity v.2.11.0 build in DESeq2 pipeline [ 36 ], where parameters for filtering are set to > 4-fold change and a false discovery rate (FDR) < 0.001. Lists of DETs were annotated by homology search with Blast 2.12.0+ [ 31 ] against standard nucleotide collection database (nt) with an e-value cut off set to 0.001. The lists of DETs were further analyzed and subset by Venn diagrams using jvenn [ 37 ]. Gene ontology (GO) assignments were first extracted from Trinotate output and then all lists of up and downregulated DETs and the Venn subsets were functional enriched with the Trinity v2.11.0 build in GOseq [ 38 ] pipeline, using the de-novo assembled and decontaminated N. occidentalis H.-M. Wheeler transcriptome as background. The functional enrichment was visualized using RStudio 2022.07.1 (RStudio, PBC) with R v4.2.0 [ 39 ] and the Bioconductor packages goseq v.1.48.0 [ 40 ] and rrvgo v.1.8.0 [ 41 ]. For a detailed analysis of enriched transcripts, the GO assignments were filtered with a script for defence or stress related terms and phytohormone related terms. In detail, files with GO assignments were searched using strings for defence/stress (“stress”, “defence”, “immune”) and for phytohormone related terms (“salicylic”, “auxin”, “gibberel”, “jasmonic”, “ethylene”, “cytokinine”, “abscisic”, “brassinosteroi”). For further functional characterization of up- and downregulated transcripts the different subsets were analyzed with STRING database v.12.0 [ 42 ] using the whole N. tabacum L. genome as background for network analysis. In detail the protein sequences of DETs were uploaded to the multiple sequences search interface, annotated with STRING by homology search within the N. tabacum L. genome and network was visualized with protein interactions based on functional and physical protein associations. The network was then clustered with MCL (Markov Cluster Algorithm) [ 43 ] clustering using an inflation parameter of 4. Enriched gene ontologies and KEGG pathways of the biggest cluster were downloaded. RNA extraction, cDNA synthesis and qPCR For validation of DETs, the agroinfiltration approach was repeated with a new set of plants, using three biological replicates. The excised leaf discs were immediately flash frozen in liquid nitrogen, grinded using a mortar and pistil, and 100 mg of frozen leaf powder was used for RNA extraction with Spectrum™ Plant Total RNA Kit (Merck, Darmstadt, Germany) following protocol A of the manual. RNA concentration was measured with a spectrophotometer (Implen N60). Using 2 µg of RNA, genomic DNA removal and cDNA synthesis was performed with SuperScript™ IV VILO™ Master Mix with ezDNase™ enzyme. To find suitable and stable expressed reference genes, primer pairs for NbPP2a, NbNQO, NbGAPDH and NbEF1a, identified as reference genes in N. benthamiana Domin [ 44 ] as well as the endogenous universal qPCR control UNI28S [ 45 ] were selected. They bound in-silico (tested with Geneious R11.1.5) to transcripts within the de-novo assembled N. occidentalis H.-M. Wheeler transcriptome and were thus tested in a qPCR assay. The qPCR data of all candidates were analyzed by RefFinder [ 46 ] and the two most stable genes, PP2a and NQO were used as reference genes. Diluted cDNA was used for qPCR assays, using SYBR chemistry. In detail, 2 µL of template were used in a 10 µL reaction mixture containing 5 µL 2x SYBR FAST qPCR Kit Master Mix (Kapa Biosystems), 2.6 µL nuclease-free water and 0.20 µL each of forward and reverse primer (10 µM). All qPCR reactions were run on a CFX384 Touch Real-Time PCR Detection system, using the following conditions: initial denaturation at 95°C for 20 s; 35 cycles of 95°C for 3 s and 60°C for 30 s; and a melting curve ramp from 65 to 95°C at increments of 0.5°C every 5 s. To determine qPCR efficiency of the respective target together with each qPCR run a five-point serial dilution of N. occidentalis H.-M. Wheeler cDNA (1:10, 1:20, 1:50, 1:100, 1:200) was analyzed. As an additional quality control of qPCR, a three-point serial dilution (1:10, 1:50, 1:100) was analyzed, amplifying the reference genes NbNQO and NbPP2a . Data analysis was performed using CFX Manager Software (Bio-Rad) and RStudio 2022.07.1 (RStudio, PBC) with R v4.2.0 [ 39 ] using the MCMC qPCR package (v.1.2.4) [ 47 ] applying an informed model. Results Expression of SAP11 CaPm in Nicotiana occidentalis To analyze early effects of SAP11 CaPm expression on the transcriptome of N. occidentalis H.-M. Wheeler, leaves were infiltrated with A. tumefaciens harboring a construct encoding SAP11 CaPm fused to GFP. As controls, infiltration with nuclear localized GFP (GFP-NLS) and non-infiltrated plants were used. Samples were taken every 24 h up to 120 h and subjected to RNA-seq. To verify the expression of SAP11 CaPm , leaf samples later used for RNA-seq as well as leaf samples from a second independent experiment, were analyzed by RT-qPCR (Fig. 2 ). Within 24 h after infiltration, the first transcript accumulation was detectable. In the leaf samples set used for RNA-seq, the expression reached its maximum 96 h after infiltration and decreased 120 h post infiltration. Coherently, the analysis on the number of reads obtained by RNA-seq and indicative for expression of SAP11 CaPm showed this kinetics. In the second independent leaf set SAP11 CaPm expression was stable between 48 h and 96 h after infiltration and dropped only slightly after 120 h. To verify the presence of SAP11 CaPm fused to GFP in N. occidentalis H.-M. Wheeler cells, leaves were examined using confocal laser scanning microscopy. The occurrence of SAP11 CaPm :GFP as well as of GFP-NLS from the control-infiltrations became visible at 48 h after infiltration, thereby lagging behind the rise of transcripts (Fig. 3 ). SAP11 CaPm :GFP was observed to localize to the cell nucleus and the cytoplasm of infiltrated N. occidentalis H.-M. Wheeler cells, while the GFP-NLS in control-infiltration localized only to the cell nucleus. De Novo transcriptome assembly A total of 54,704,261 (GC content: 43%) adapter and quality trimmed paired end reads from a pool of 51 RNA samples from N. occidentalis H.-M. Wheeler plants infiltrated or not were used for the de novo transcriptome assembly with Trinity v2.9. The clean reads were assembled, resulting in 166,787 transcripts, with an average length of 1,034 bp and an N 50 of 1,504 bp. The transcriptome was further decontaminated from sequences originating from species other than the order Solanales using the Model-based Categorical Sequence Clustering MCSC decontamination pipeline, that is based on the Model-based Categorical Sequence Clustering (MCSC) algorithm [ 30 ]. The decontaminated transcriptome contained 153,640 transcripts with an average length of 1,076 bp, N 50 of 1,559 bp and a GC content of 39.57%. This Transcriptome Shotgun Assembly project has been deposited at DDBJ/ENA/GenBank under the accession GKBG00000000. The version described in this paper is the first version, GKBG01000000. The sequencing dataset used in this study is available in the NCBI repository with BioProject ID PRJNA871046. Differential expression analysis The RNA-seq libraries obtained from leaf samples infiltrated with A. tumefaciens to express either SAP11 CaPm : GFP or GFP-NLS or non-infiltrated were subjected to transcriptome analysis. To get insights into SAP11 CaPm -mediated changes, differential expression analysis was done using DEseq2 [ 36 ] within the Trinity Package (v2.11.0) [ 27 ], making pairwise comparisons of non-infiltrated (noic), control-infiltrated (ctrlinf) and SAP11 CaPm infiltrated (SAP11 CaPm ) samples at different time points (Fig. 4 ). With that, differentially expressed transcripts (DETs) were identified, which occurred over time within a treatment group or between treatment groups at the same time point (Fig. 5 ). The first DETs in infiltrated leaves were detectable at 24 h after infiltration (Fig. 5 A, D). In comparison to non-infiltrated leaves, control-infiltrated N. occidentalis H.-M. Wheeler leaves showed 318 upregulated and 115 downregulated transcripts. Only a few DETs were detectable between control-infiltrated and the SAP11 CaPm -infiltrated samples: 34 transcripts were downregulated in SAP11 CaPm expressing samples compared to the control-infiltration. Seven of these 34 transcripts were upregulated in control-infiltrated samples compared to the non-infiltrated samples. At 72 h after infiltration (Fig. 5 B, D). a more substantial number of DETs were evident. Control-infiltrated leaves exhibited 1026 upregulated and 181 downregulated transcripts compared to non-infiltrated leaves. In contrast, SAP11 CaPm -expressing leaves showed only two upregulated and 25 downregulated transcripts compared to control-infiltrated leaves. Six out of these 25 downregulated transcripts were upregulated in control-infiltrated leaves. The highest number of DETs was observed at 120 h after infiltration (Fig. 5 C, D). Control-infiltrated samples had 1983 upregulated and 1184 downregulated transcripts compared to non-infiltrated leaves. The comparison between SAP11 CaPm infiltration and control-infiltration revealed that 193 transcripts were upregulated, and 440 transcripts were downregulated due to SAP11 CaPm infiltration. Among these 44 of the upregulated transcripts were downregulated between non-infiltrated samples and control-infiltration and 73 downregulated transcripts were upregulated in the control-infiltrated leaves (Fig. 5 C). Table 1 shows transcripts that resulted differentially expressed at different timepoints upon SAP11 CaPm expression. Interestingly, a transcript encoding a protein modifier of snc1,1 (MOS1) was downregulated 24 h after infiltration (L2FC -11.54) but upregulated 120 h after infiltration (L2FC 12.40). Three transcripts were downregulated at 24 h and 120 h but only for one of these, the preprotein translocase subunit SCY1, is sufficient further information available on its function. Six genes were downregulated at 72 h and 120 h after infiltration with SAP11 CaPm (Table 1 ) in contrast to control-infiltration. Among those genes, genes encoding the serine/threonine-protein phosphatase BSL1, the protein CHROMATIN REMODELING 8 (CHR8) and a NTRC-like thioredoxin reductase could be detected. Despite the downregulation in SAP11 CaPm infiltrated samples after 72 h and 120 h, the NTRC-like thioredoxin reductase, as well as the pre-mRNA-splicing factor prp12 and THO complex subunit 4D-like were upregulated in control-infiltrated samples in comparison to the no-infiltration-control at some timepoints: NTRC-like thioredoxin reductase after 72 h and 120 h, pre-mRNA-splicing factor prp12 after 72 h and THO complex subunit 4D-like after 24 h and 72 h. The putative DUF21 domain-containing protein At3g13070, as well as BSL1 and the pre-mRNA-splicing factor prp12 were not only downregulated in SAP11 CaPm infiltrated samples in comparison to control-infiltration but also in comparison to the not-infiltrated samples. Table 1 Annotations of DETs, that are differentially regulated at different time points (A and B) upon SAP11 CaPm expression. Time point A L2FC Time point B L2FC Annotation 24 h -12.35 120 h -9.51 XM_019400596.1 PREDICTED: Nicotiana attenuata preprotein translocase subunit SCY1 24 h -12.03 120 h -9.31 XM_019375308.1 PREDICTED: Nicotiana attenuata putative DUF21 domain-containing protein At3g13070 24 h -11.31 120 h -10.25 XM_009759060.1 PREDICTED: Nicotiana sylvestris angio-associated migratory cell protein (LOC104210218) 24 h -11.38 72 h 11.26 XM_016613005.1 PREDICTED: Nicotiana tabacum acyl-CoA thioesterase 2-like (LOC107791023) 24 h -11.54 120 h 12.40 XM_009765541.1 PREDICTED: Nicotiana sylvestris protein MODIFIER OF SNC1 1 (LOC104215684) 72 h -12.14 120 h -10.69 XM_019370017.1 PREDICTED: Nicotiana attenuata serine/threonine-protein phosphatase BSL1 (LOC109207134) 72 h -11.45 120 h -10.19 XM_009610029.3 PREDICTED: Nicotiana tomentosiformis protein CHROMATIN REMODELING 8 (LOC104102344) 72 h -3.49 120 h -9.25 XM_009774985.1 PREDICTED: Nicotiana sylvestris dedicator of cytokinesis protein 7 (LOC104223519) 72 h -12.11 120 h -8.89 XM_016623444.1 PREDICTED: Nicotiana tabacum thioredoxin reductase NTRC-like (LOC107800295) 72 h -2.38 120 h -9.11 XM_019377213.1 PREDICTED: Nicotiana attenuata pre-mRNA-splicing factor prp12 (LOC109213418) 72 h -12.23 120 h -10.20 XM_016605885.1 PREDICTED: Nicotiana tabacum THO complex subunit 4D-like (LOC107784716) qPCR Validation of selected DETs. A total of 15 transcripts, that were differentially expressed between control-infiltration and SAP11 CaPm infiltration, was selected as candidates for qPCR validation (Table 2 ). Table 2 Selected transcripts with annotation and L2FC changes for qPCR validation. Sample A Sample B Accession Nr. Description L2FC ctrlinf_120h SAP11 CaPm _120h XM_019373029.1 PREDICTED: Nicotiana attenuata calmodulin-binding receptor-like cytoplasmic kinase 3 (LOC109209712) -2.3 ctrlinf_120h SAP11 CaPm _120h XM_009804809.1 PREDICTED: Nicotiana sylvestris probable leucine-rich repeat receptor-like protein kinase At5g49770 (LOC104248540) -9.5 ctrlinf_120h SAP11 CaPm _120h XM_019390873.1 PREDICTED: Nicotiana attenuata proline dehydrogenase 2 13.3 ctrlinf_120h SAP11 CaPm _120h XM_019378812.1 PREDICTED: Nicotiana attenuata protein PHYLLO 12.4 ctrlinf_120h SAP11 CaPm _120h XM_019370442.1 PREDICTED: Nicotiana attenuata calmodulin-7 (LOC109207504) -10.9 ctrlinf_120h SAP11 CaPm _120h JF897607.1 Nicotiana benthamiana chloroplast PsbP1 precursor (psbP1) mRNA -11.2 noic_120h SAP11 CaPm _120h XM_016603442.1 PREDICTED: Nicotiana tabacum probable WRKY transcription factor 31 (LOC107782559) 12.6 ctrlinf_120h SAP11 CaPm _120h XM_016603442.1 PREDICTED: Nicotiana tabacum probable WRKY transcription factor 31 (LOC107782559) 13.1 ctrlinf_120h SAP11 CaPm _120h XM_019379586.1 PREDICTED: Nicotiana attenuata oxygen-evolving enhancer protein 1 -11.2 ctrlinf_120h SAP11 CaPm _120h XM_019372421.1 PREDICTED: Nicotiana attenuata SKP1-like protein 21 (LOC109209196) -8.9 ctrlinf_24h SAP11 CaPm _24h XM_019403282.1 PREDICTED: Nicotiana XXXattenuate polyadenylate-binding protein-interacting protein 7 (LOC109237039) -11.4 ctrlinf_120h SAP11 CaPm _120h XM_016640507.1 PREDICTED: Nicotiana tabacum protein kinase APK1A 12.7 ctrlinf_72h SAP11 CaPm _72h XM_016623416.1 PREDICTED: Nicotiana tabacum probable xyloglucan endotransglucosylase/hydrolase protein 6 (LOC107800268) -2.8 ctrlinf_120h SAP11 CaPm _120h XM_009778335.1 PREDICTED: Nicotiana sylvestris TMV resistance protein N-like (LOC104226353) -10.7 ctrlinf_120h SAP11 CaPm _120h XM_016646486.1 PREDICTED: Nicotiana tabacum protein LUTEIN DEFICIENT 5 -9.7 ctrlinf_120h SAP11 CaPm _120h XM_016646486.1 PREDICTED: Nicotiana tabacum protein LUTEIN DEFICIENT 5 12.0 ctrlinf_120h SAP11 CaPm _120h XM_019407249.1 PREDICTED: Nicotiana attenuata patatin-like protein 2 (LOC109240587) -10.0 RT-qPCR analyses from the 15 selected genes revealed high variance between biological replicates. Therefore, no significant differences could be detected in the selected comparisons. The expression pattern, however, followed the same trend as those in RNA-seq data (Fig. 6 ). Taken together, these validation results of selected genes, the SAP11 CaPm expression verified by qPCR (Fig. 2 ) and the RNA-seq data obtained provide a reliable insight into the early effects of SAP11 CaPm on the transcriptome of N. occidentalis H.-M. Wheeler. Gene Ontology (GO) enrichment and analysis All groups of up- and downregulated DETs (Fig. 5 ) were analyzed using the Trinity v2.11.0 build in pipeline for GOseq [ 38 ]. The results were separated by the three sub-ontologies of GO: Molecular Function (MF), Cellular Component (CC) and Biological Process (BP) (Fig. 7 ). The datasets were further analyzed with the rrvgo package [ 41 ] which groups GO terms based on their semantic similarity and results were represented by a scatter plot (see Additional file 1). After 24 h and 72 h no significant (FDR < 0.5) enriched GO terms were found in the group of SAP11 CaPm downregulated transcripts in comparison to control-infiltration. The two upregulated transcripts in SAP11 CaPm expressing samples at 72 h were assigned to the term “regulation of protein metabolic process” (BP). Enriched terms in the group of downregulated transcripts in SAP11 CaPm expressing leaves compared to control-infiltration at 120 h comprised transcripts that were categorized into “cellular process”, “biosynthetic process” or “response to external stimulus” (Fig. 7 ). Enriched GO terms in MF were mainly related to binding processes, such as “mRNA binding”, “organic cyclic compound binding” or “magnesium chelatase activity”, whereas CC enriched terms were “plastid”, “chloroplast” or “membrane-bounded organelle” (Fig. 7 ). Employing the rrvgo analysis within the set of 366 transcripts (Fig. 4 ; ctrlinf-SAP11 CaPm down) unaffected by infiltration but downregulated during SAP11 CaPm expression unveiled a cluster associated with both "defence response" and "response to external stimulus". The group of 149 upregulated transcripts (Fig. 4 ) in SAP11 CaPm expressing samples after 120 h compared to the control-infiltration mainly contained transcripts that were assigned to BP GO terms like “proton transmembrane transport”, “reverse transcription involved in RNA − mediated transposition” and “ATP biosynthetic process”. The enriched MF GO terms were related to “endodeoxyribonuclease activity” and the enriched CC GO terms were mainly allocated to “mitochondrial protein − containing complex” and “proton − transporting ATP synthase complex, coupling factor F(o)”. The rrvgo analysis of all 193 upregulated transcripts at 120 h showed a cluster assigned to “ATP biosynthetic process” and “proton transmembrane transport” (Additional file 1). In the group of upregulated transcripts found only in the control-infiltrated samples at 24 h, 72 h and 120 h after infiltration, GO terms for the category BP are enriched such as “defence response”, “response to biotic stimulus” or “response to stress. Downregulated transcripts after 24 h were enriched in BP GO terms related to “homeostasis”, while 72 h after infiltration the enriched BP terms were assigned to “photosynthesis, light harvesting”, “protein − chromophore linkage” or “electron transport chain”. At 120 h after infiltration the most enriched BP terms were “starch metabolic process”, “cation transport” and “photosynthetic electron transport chain” (Fig. 7 ). The rrvgo analysis revealed a cluster of transcripts related to “ATP biosynthetic process” that is, in contrast to infiltration with SAP11 CaPm (ctrlinf - SAP11 CaPm ), upregulated upon control-infiltration (Additional file 1). For both timepoints, 72 h and 120 h most of the enriched CC terms are chloroplast related (“thylakoid membrane”, “photosystem”, “chloroplast”). Functional analysis of groups The GO annotations were selectively refined to include transcripts associated with defense or stress terms and phytohormone-related terms. As depicted in Fig. 8 , the distribution of defense/stress and phytohormone-related terms in single DET groups is illustrated. Over 25% of the upregulated transcripts in the control-infiltrated samples were identified as defense or stress-related. Notably, in the downregulated DETs of control-infiltrated samples, the proportion of defense/stress-related transcripts decreases over time. In the group of upregulated DETs in SAP11 CaPm -infiltrated leaves compared to control-infiltrated samples, almost no defense/stress or phytohormone-related transcripts were observed after 72 h (0%) or 120 h (0.5%). Conversely, in the downregulated transcripts of the same group, 28% of the transcripts (72 h) and 19.5% (120 h) are associated with defense/stress or phytohormone-related terms. The Additional file 2 lists all transcripts that were assigned to defense/stress or phytohormone-related terms. Network analysis A network analysis of the different groups of DETs was performed using STRING [ 42 ]. It showed that the pathway belonging to phenylpropanoid biosynthesis was upregulated upon infiltration (Fig. 9 , noic – ctrlinf up), while the starch and sucrose metabolism was downregulated due to the infiltration process itself (Fig. 9 , noic – ctrlinf down). The main network cluster in the group of downregulated transcripts upon SAP11 CaPm infiltration (ctrlinf vs SAP11 CaPm ) showed enriched KEGG pathways related to ribosome, while the main cluster of up regulated transcripts is enriched in oxidative phosphorylation and metabolic pathways. Detailed information about KEGG enriched transcripts and annotation of the main network cluster transcripts can be found in Additional file 3 and Additional file 4. Discussion Effectors originating from pathogens are important players in the process, how a pathogen modulates the metabolism of its host. To get insights into the role of SAP11 CaPm , an effector produced by ' Ca . P. mali', the causal agent of apple proliferation disease, early changes in gene expression upon expression of SAP11 CaPm were analyzed by infiltration RNA-seq [ 20 ]. For this, SAP11 CaPm was transiently expressed by agroinfiltration in N. occidentalis H.-M. Wheeler leaves, since it has been shown that this model plant can be infected with ' Ca . P. mali' [ 10 , 19 , 21 – 23 ]. A reference genome of N. occidentalis H.-M. Wheeler is, however, not available yet thus we opted for an approach where the N. occidentalis H.-M. Wheeler transcriptome was assembled de novo and used as a reference for the differential expression analysis. The transcript levels of SAP11 CaPm increased continuously until 96 h after infiltration, while it decreased at 120 h after infiltration. This differed slightly from a second independent experiment, where the expression remained stable between 48 h and 120 h after infiltration. Those differences in SAP11 CaPm expression strength might affect the putative changes in host’s gene expression profiles, although the protein was detectable to almost similar levels up to 120 h after infiltration. Indeed, the comparison of RNA-seq data with qPCR data of selected genes from the independent leaf samples, showed a common trend in both data sets, proofing RNA-seq data to be reliable. In infected apple trees, the natural host plant, SAP11 CaPm expression is not stable throughout the year [ 16 ] and the degree of colonization by phytoplasma, plant growth and climatic conditions might influence the spatio-temporal expression of the effector. Nonetheless, using another natural host of ' Ca . P. mali', allowing transient expression assays, helps to unravel the transcriptional changes in the plant due to the action of one single effector protein. The highest number of DETs was detected at 120 h after infiltration. Interestingly, six genes were commonly downregulated at 72 h and 120 h after infiltration; four of these transcripts were allocated to defense-related terms in the GO annotation. Among them, the genes encoding the protein phosphatase BSL1 and chromatin remodeling8 (CHR8) were identified. The protein phosphatase BSL1 belongs to the BSU1 family and contributes to the brassinosteroid signalling. BSL1 interacts with the Phytophtora infestans effector protein PiAVR2 and acts as a susceptibility factor by affecting the balance between growth and immunity in plants [ 49 – 51 ]. CHR8 belongs to the switch2/sucrose non-fermenting2 (SWI2/SNF2) chromatin remodeling gene family that is involved in DNA damage response (Shaked et al. 2006). It has been shown that CHR8 is upregulated during an artificial infection of A. thaliana with cabbage leaf curl virus [ 52 ] as well as during genotoxic stress [ 53 ], indicating its potential role in plant stress response. The gene encoding the modifier of snc1,1 (MOS1) was downregulated at 24 h and upregulated at 120 h after SAP11 CaPm infiltration. MOS1 regulates the nucleotide binding site-Leu-rich repeat (NB-LRR) type R protein SNC1 [ 54 ]. MOS1 interacts with AtTCP15, while AtTCP15 directly binds to SNC1 and thereby modulates the plant immune response [ 55 ]. Due to that binding, MOS1 enhances the activity of SNC1 and helps to reinforce the defense response. It seems that the MOS1 triggered immune response is suppressed in the early stage of SAP11 CaPm expression, while it recovers later. Our results show that the occurrence of SAP11 CaPm led to a downregulation of plant defense (Fig. 8 ). Nonetheless, it should be noted that the infiltration process itself induces several transcriptional changes within the infiltrated leaf area [ 56 , 57 ]. Agroinfiltration induces host defense and alters phytohormone levels [ 56 , 58 , 59 ]. This is in line with the findings in Fig. 8 . Transcripts related to plant defense and phytohormones are upregulated in control-infiltrated leaves. However, when comparing control-infiltration to SAP11 CaPm infiltration, it is evident that defense and phytohormone related transcripts are downregulated, indicating that SAP11 CaPm is able to suppress plant defense response. At the same time, however, the ATP biosynthetic processes seem to be upregulated. Phytoplasmas are highly dependent on metabolic compounds from their hosts since they lack different metabolic genes, among them genes for ATP synthase, glycolysis and for oxidative phosphorylation [ 60 – 63 ]. In the same line, the ATP biosynthetic process and the oxidative phosphorylation are upregulated upon SAP11 CaPm expression in N. occidentalis H.-M. Wheeler. This might reflect the enhanced levels of glycerolipid and glycerophospholipid metabolites and the numerous differentially expressed carbohydrate metabolism genes shown for SCV phytoplasma infected sweet cherry trees [ 64 , 65 ]. It is tempting to speculate that the enhancement of metabolic pathways in the host plant help the phytoplasma to obtain sufficient metabolites and nutrients necessary for proliferation and colonization. In contrast to metabolic genes, transcripts assigned to the chloroplast were downregulated 120 h upon SAP11 CaPm infiltration. Photosynthesis rates have been shown to be reduced in many different phytoplasma infections [ 66 – 68 ]. In line with that, several transcriptomic and proteomic studies of different phytoplasma infected plants have shown that numerous genes involved in photosynthesis are downregulated during infection [ 69 ]. The finding that SCY1 is strongly downregulated after 24 h and consistently at 120 h opens new insights on the possible SAP11 impact on chloroplast. SCY1 is involved in preprotein localization to the thylakoid [ 70 ] and mutant plants for SCY1 show impairment in thylakoid biogenesis [ 71 ] with a chloroplast-to-nucleus retrograde signal whit impaired production of nuclear-encoded chloroplast proteins [ 72 ] and chlorotic phenotypes [ 73 ]. During darkness periods SCY1 increases in content in the chloroplast which would increase the import of nuclear-encoded proteins [ 74 ]. However, it is still unknown whether phytoplasma effector proteins target directly the chloroplast or whether photosynthesis is compromised due to the changed plant metabolism [ 75 ]. Although, they [ 75 ] proposed a potential role of SAP11 in reducing the activity of photosystem II (PSII) by binding the AtTCP13 transcription factor. AtTCP13 is also known as PTF1, a transcription factor that regulates gene expression in chloroplasts via the plastid-encoded polymerase PEP [ 76 ]. PEP is the major chloroplast transcriptase and among the PEP controlled genes, also psbD was found, that encodes the reaction center protein D2 of PSII. Since in A. thaliana ptf1 mutants the expression of psbD is reduced [ 77 ], it can be assumed that SAP11 binding to TCP13 has a similar effect. Even though, psbD was not downregulated in this study, two other genes encoding proteins from PSII were downregulated upon SAP11 CaPm expression, namely the oxygen-evolving enhancer proteins 1 (OEE1/PsbO) and OEE2 (PsbP). Interestingly, OEE2/PsbP is directly targeted by a Plasmopara viticola RXLR effector protein [ 78 , 79 ], while OEE1/PsbO binds to HIPM (HrpN-interacting protein from Malus spp.), a susceptibility gene for Erwinia amylovora infection in apple [ 80 ]. Nicotiana benthamiana Domin psbP mutants showed a reduced growth and bleached leaves and were less susceptible to Phytophtora capsici infection [ 78 ]. In the same line, transgenic grapevine lines overexpression psbP were more susceptible to P. viticola infection [ 78 ], indicating that PsbP downregulation enhances immunity. In contrast OEE1/PsbO and OEE2/PsbP proteins were more abundant in leaves of powdery mildew resistant cucumbers than in susceptible ones [ 81 ]. Conclusions Our findings revealed a downregulation of defense-related genes, suggesting a suppression of the plant's immune response by SAP11 CaPm . Moreover, the modulation of genes involved in oxidative phosphorylation, as well as upregulation of ATP biosynthetic processes, hinted at a potential strategy employed by the phytoplasma via its effectors to exploit host metabolic pathways for its proliferation and colonization. Additionally, the downregulation of transcripts related to chloroplast, such as SCY1, OEE1/PsbO or OEE2/PsbP suggest a potential link between SAP11 CaPm and the compromise of photosynthetic processes, possibly through interactions with chloroplast-related factors. Our study contributes to the understanding of SAP11 CaPm 's impact on host plants, however, questions regarding the direct targeting of chloroplasts and the intricate mechanisms leading to photosynthesis reduction and the effect on ATP biosynthetic processes and oxidative phosphorylationremain open. Future research elucidating these aspects will, advance our understanding of phytoplasma-plant interactions and will result in new strategies for mitigating the impact of phytoplasma infections in agricultural settings. Abbreviations ABA Abscisic acid ATP Adenosine Triphosphate BP Biological Process BSL1 Serine/Threonine-protein phosphatase BSL1, BSU1-like 1 BSU1 BRI1 SUPPRESSOR 1 ' Ca . P. mali' ' Candidatus Phytoplasma mali' CaMV 35S Cauliflower Mosaic Virus 35S promoter CC Cellular Component cDNA Complementary DNA CHR8 Chromatin Remodeling 8 DET Differentially Expressed Transcript DUF21 Domain of Unknown Function 21 ELI3-1 ELICITOR-ACTIVATED GENE3-1 FDR False Discovery Rate GC Guanine-Cytosine (content in DNA) GFP Green Fluorescent Protein GO Gene Ontology JA Jasmonate KEGG Kyoto Encyclopedia of Genes and Genomes L2FC Log2 Fold Change LOX2 LIPOXYGENASE2 MF Molecular Function MOS1 Modifier of snc1,1 NADPH Nicotinamide Adenine Dinucleotide Phosphate NB-LRR Nucleotide-Binding Leucine-Rich Repeat NTRC NADPH-dependent thioredoxin reductase C nt Nucleotide collection database OEE1/PsbO Oxygen-Evolving Enhancer Protein 1 OEE2/PsbP Oxygen-Evolving Enhancer Protein 2 PEP Plastid-Encoded Polymerase PiAVR2 Phytophthora infestans effector protein AVR2 PR1 PATHOGENESIS-RELATED GENE1 qPCR Quantitative Polymerase Chain Reaction RNA-seq RNA sequencing RBCS Ribulose-1,5-bisphosphate carboxylase/oxygenase small subunit RT-qPCR Reverse Transcription Quantitative Polymerase Chain Reaction SA Salicylic acid SCV Sweet Cherry Virescence phytoplasma SEM Standard Error of the Mean SWI2/SNF2 SWITCH2/SUCROSE NON-FERMENTING2 TCP TEOSINTE BRANCHED1, CYCLOIDEA, and PROLIFERATING CELL FACTORS TMM Trimmed Mean of M values tRBCS Ribulose-1,5-bisphosphate carboxylase/oxygenase terminator Declarations Ethics approval and consent to participate Not Applicable Consent for publication Not Applicable Availability of data and materials The datasets generated and/or analyzed during the current study are available in the NCBI repository with BioProject ID PRJNA871046 and contains 13 BioSample datasets (https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA871046). The Transcriptome Shotgun Assembly project has been deposited at DDBJ/ENA/GenBank under the accession GKBG00000000 (https://www.ncbi.nlm.nih.gov/nuccore/2428580569). Competing interests The authors declare that they have no competing interests. Funding The work was performed as part of the project APPLIII and APPLiv within the framework agreement in the field of invasive species in fruit growing and major pathologies, co-funded by the Autonomous Province of Bozen/Bolzano, Italy, and the South Tyrolean Apple Consortium. The authors thank the Department of Innovation, Research, University and Museums of the Autonomous Province of Bozen/Bolzano covering the Open Access publication costs. Authors' contributions CM contributed to the study design, performed all experiments, analyzed, and interpreted the data and wrote and revised the manuscript. MM analyzed and interpreted the data and revised the manuscript. BH contributed to the study design, interpreted the data, and revised the manuscript. KJ contributed to the study design, helped in analyzing and interpreting the data, contributed to the writing and revision of the manuscript. All authors read and approved the final manuscript. Acknowledgements We express our gratitude to Christine Kerschbamer and Katherina Telser for their assistance in the sampling and RNA extraction processes. Special thanks to Hagen Stellmach for his valuable advice and guidance in agroinfiltration. Our appreciation also goes to Sabine Öttl for providing primers for reference genes. Additionally, we acknowledge Andreas Gallmetzer for his support in ensuring RNA quality and integrity. References Kube M, Schneider B, Kuhl H, Dandekar T, Heitmann K, Migdoll AM, et al. The linear chromosome of the plant-pathogenic mycoplasma ‘ Candidatus Phytoplasma mali’. BMC Genomics. 2008. 10.1186/1471-2164-9-306 . Tomkins M, Kliot A, Marée AF, Hogenhout SA. A multi-layered mechanistic modelling approach to understand how effector genes extend beyond phytoplasma to modulate plant hosts, insect vectors and the environment. Curr Opin Plant Biol. 2018;44:39–48. 10.1016/j.pbi.2018.02.002 . Rashid U, Bilal S, Bhat KA, Shah TA, Wani TA, Bhat FA, et al. Phytoplasma Effectors and their Role in Plant-Insect Interaction. Int J Curr Microbiol App Sci. 2018;7:1136–48. 10.20546/ijcmas.2018.702.141 . Janik K, Mithöfer A, Raffeiner M, Stellmach H, Hause B, Schlink K, Mithofer A. An effector of apple proliferation phytoplasma targets TCP transcription factors-a generalized virulence strategy of phytoplasma? Mol Plant Pathol. 2017;18:435–42. 10.1111/mpp.12409 . Mittelberger C, Stellmach H, Hause B, Kerschbamer C, Schlink K, Letschka T, Janik K. A Novel Effector Protein of Apple Proliferation Phytoplasma Disrupts Cell Integrity of Nicotiana spp. Protoplasts. Int J Mol Sci. 2019;20:1–16. 10.3390/ijms20184613 . Strohmayer A, Moser M, Si-Ammour A, Krczal G, Boonrod K. Candidatus Phytoplasma mali’ genome encodes a protein that functions as a E3 Ubiquitin Ligase and could inhibit plant basal defense. Mol Plant Microbe Interact. 2019. 10.1094/MPMI-04-19-0107-R . Huang W, MacLean AM, Sugio A, Maqbool A, Busscher M, Cho S-T, et al. Parasitic modulation of host development by ubiquitin-independent protein degradation. Cell. 2021;184:5201–5214e12. 10.1016/j.cell.2021.08.029 . Seemüller E, Zikeli K, Furch ACU, Wensing A, Jelkmann W. Virulence of ‘Candidatus Phytoplasma mali’ strains is closely linked to conserved substitutions in AAA + ATPase AP460 and their supposed effect on enzyme function. Eur J Plant Pathol. 2017;86:141. 10.1007/s10658-017-1318-2 . Bai X, Correa VR, Toruño TY, Ammar E-D, Kamoun S, Hogenhout SA. AY-WB phytoplasma secretes a protein that targets plant cell nuclei. Mol Plant Microbe Interact. 2009;22:18–30. 10.1094/MPMI-22-1-0018 . Boonrod K, Strohmayer A, Schwarz T, Braun M, Tropf T, Krczal G. Beyond Destabilizing Activity of SAP11-like Effector of Candidatus Phytoplasma mali Strain PM19. Microorganisms. 2022. 10.3390/microorganisms10071406 . Strohmayer A, Schwarz T, Braun M, Krczal G, Boonrod K. The Effect of the Anticipated Nuclear Localization Sequence of ‘ Candidatus Phytoplasma mali’ SAP11-like Protein on Localization of the Protein and Destabilization of TCP Transcription Factor. Microorganisms. 2021;9:1–17. 10.3390/microorganisms9081756 . Sugio A, Kingdom HN, MacLean AM, Grieve VM, Hogenhout SA. Phytoplasma protein effector SAP11 enhances insect vector reproduction by manipulating plant development and defense hormone biosynthesis. Proc Natl Acad Sci U S A. 2011;108:1254–63. 10.1073/pnas.1105664108 . Sugio A, MacLean AM, Hogenhout SA. The small phytoplasma virulence effector SAP11 contains distinct domains required for nuclear targeting and CIN-TCP binding and destabilization. New Phytol. 2014;202:838–48. 10.1111/nph.12721 . Chang SH, Tan CM, Wu C-T, Lin T-H, Jiang S-Y, Liu R-C, et al. Alterations of plant architecture and phase transition by the phytoplasma virulence factor SAP11. J Exp Bot. 2018;69:5389–401. 10.1093/jxb/ery318 . Tabarelli M, Malnoy M, Janik K. Chasing Consistency: An Update of the TCP Gene Family of Malus × Domestica. Genes (Basel). 2022. 10.3390/genes13101696 . Mittelberger C, Hause B, Janik K. The ‘Candidatus Phytoplasma mali’ effector protein SAP11CaPm interacts with MdTCP16, a class II CYC/TB1 transcription factor that is highly expressed during phytoplasma infection. PLoS ONE. 2022;17:e0272467. 10.1371/journal.pone.0272467 . Lu Y-T, Li M-Y, Cheng K-T, Tan CM, Su L-W, Lin W-Y, et al. Transgenic plants that express the phytoplasma effector SAP11 show altered phosphate starvation and defense responses. Plant Physiol. 2014;164:1456–69. 10.1104/pp.113.229740 . Pecher P, Moro G, Canale MC, Capdevielle S, Singh A, MacLean A, et al. Phytoplasma SAP11 effector destabilization of TCP transcription factors differentially impact development and defence of Arabidopsis versus maize. PLoS Pathog. 2019;15:1–27. 10.1371/journal.ppat.1008035 . Luge T, Kube M, Freiwald A, Meierhofer D, Seemüller E, Sauer S. Transcriptomics assisted proteomic analysis of Nicotiana occidentalis infected by Candidatus Phytoplasma mali strain AT. Proteomics. 2014;14:1882–9. 10.1002/pmic.201300551 . Bond DM, Albert NW, Lee RH, Gillard GB, Brown CM, Hellens RP, Macknight RC. Infiltration-RNAseq: transcriptome profiling of Agrobacterium-mediated infiltration of transcription factors to discover gene function and expression networks in plants. Plant Methods. 2016;12:41. 10.1186/s13007-016-0141-7 . Seemüller E, Kiss E, Sule S, Schneider B. Multiple infection of apple trees by distinct strains of ‘Candidatus Phytoplasma mali’ and its pathological relevance. Phytopathology. 2010;100:863–70. 10.1094/PHYTO-100-9-0863 . Boonrod K, Munteanu B, Jarausch B, Jarausch W, Krczal G. An immunodominant membrane protein (Imp) of ‘ Candidatus Phytoplasma mali’ binds to plant actin. Mol Plant Microbe Interact. 2012;25:889–95. 10.1094/MPMI-11-11-0303 . Schneider B, Sule S, Jelkmann W, Seemüller E. Suppression of aggressive strains of ‘Candidatus phytoplasma mali’ by mild strains in Catharanthus roseus and Nicotiana occidentalis and indication of similar action in apple trees. Phytopathology. 2014;104:453–61. 10.1094/PHYTO-08-13-0230-R . Lampropoulos A, Sutikovic Z, Wenzl C, Maegele I, Lohmann JU, Forner J. GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis. PLoS ONE. 2013;8:e83043. 10.1371/journal.pone.0083043 . Andrews S, Lindenbaum P, Howard B, Ewels P. FastQC; 2011–7. Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–20. 10.1093/bioinformatics/btu170 . Grabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol. 2011;29:644–52. 10.1038/nbt.1883 . Bryant DM, Johnson K, DiTommaso T, Tickle T, Couger MB, Payzin-Dogru D, et al. A Tissue-Mapped Axolotl De Novo Transcriptome Enables Identification of Limb Regeneration Factors. Cell Rep. 2017;18:762–76. 10.1016/j.celrep.2016.12.063 . Haas BJ, Papanicolaou A, Yassour M, Grabherr M, Blood PD, Bowden J, et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat Protoc. 2013;8:1494–512. 10.1038/nprot.2013.084 . Lafond-Lapalme J, Duceppe M-O, Wang S, Moffett P, Mimee B. A new method for decontamination of de novo transcriptomes using a hierarchical clustering algorithm. Bioinformatics. 2017;33:1293–300. 10.1093/bioinformatics/btw793 . Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10. 10.1016/S0022-2836(05)80360-2 . Eddy SR, Accelerated Profile HMM, Searches. PLoS Comput Biol. 2011;7:e1002195. 10.1371/journal.pcbi.1002195 . Almagro Armenteros JJ, Tsirigos KD, Sønderby CK, Petersen TN, Winther O, Brunak S, et al. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat Biotechnol. 2019;37:420–3. 10.1038/s41587-019-0036-z . Krogh A, Larsson B, von Heijne G, Sonnhammer EL. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol. 2001;305:567–80. 10.1006/jmbi.2000.4315 . Patro R, Duggal G, Love MI, Irizarry RA, Kingsford C. Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods. 2017;14:417–9. 10.1038/nmeth.4197 . Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550. 10.1186/s13059-014-0550-8 . Bardou P, Mariette J, Escudié F, Djemiel C, Klopp C. jvenn: an interactive Venn diagram viewer. BMC Bioinformatics. 2014;15:293. 10.1186/1471-2105-15-293 . Young MD, Wakefield MJ, Smyth GK, Oshlack A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010;11:R14. 10.1186/gb-2010-11-2-r14 . R Core Team. R: A Language and Environment for Statistical Computing. Vienna, Austria: R Foundation for Statistical Computing; 2022. Young MD, goseq. Bioconductor; 2017. Sayols S. rrvgo: a Bioconductor package to reduce and visualize Gene Ontology terms. Bioconductor; 2020. Szklarczyk D, Gable AL, Nastou KC, Lyon D, Kirsch R, Pyysalo S, et al. The STRING database in 2021: customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021;49:D605–12. 10.1093/nar/gkaa1074 . van Dongen S. Graph Clustering Via a Discrete Uncoupling Process. SIAM J Matrix Anal & Appl. 2008;30:121–41. 10.1137/040608635 . Pombo MA, Ramos RN, Zheng Y, Fei Z, Martin GB, Rosli HG. Transcriptome-based identification and validation of reference genes for plant-bacteria interaction studies using Nicotiana benthamiana. Sci Rep. 2019;9:1632. 10.1038/s41598-018-38247-2 . Mittelberger C, Obkircher L, Oberkofler V, Ianeselli A, Kerschbamer C, Gallmetzer A, et al. Development of a universal endogenous qPCR control for eukaryotic DNA samples. Plant Methods. 2020;16:341. 10.1186/s13007-020-00597-2 . Xie F, Xiao P, Chen D, Xu L, Zhang B. miRDeepFinder: a miRNA analysis tool for deep sequencing of plant small RNAs. Plant Mol Biol. 2012. 10.1007/s11103-012-9885-2 . Matz MV, Wright RM, Scott JG. No control genes required: Bayesian analysis of qRT-PCR data. PLoS ONE. 2013;8:e71448. 10.1371/journal.pone.0071448 . Robinson MD, Oshlack A. A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biol. 2010;11:R25. 10.1186/gb-2010-11-3-r25 . Wang H, Trusch F, Turnbull D, Aguilera-Galvez C, Breen S, Naqvi S, et al. Evolutionarily distinct resistance proteins detect a pathogen effector through its association with different host targets. New Phytol. 2021;232:1368–81. 10.1111/nph.17660 . Turnbull D, Wang H, Breen S, Malec M, Naqvi S, Yang L, et al. AVR2 Targets BSL Family Members, Which Act as Susceptibility Factors to Suppress Host Immunity. Plant Physiol. 2019;180:571–81. 10.1104/pp.18.01143 . Saunders DGO, Breen S, Win J, Schornack S, Hein I, Bozkurt TO, et al. Host protein BSL1 associates with Phytophthora infestans RXLR effector AVR2 and the Solanum demissum Immune receptor R2 to mediate disease resistance. Plant Cell. 2012;24:3420–34. 10.1105/tpc.112.099861 . Ascencio-Ibáñez JT, Sozzani R, Lee T-J, Chu T-M, Wolfinger RD, Cella R, Hanley-Bowdoin L. Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. Plant Physiol. 2008;148:436–54. 10.1104/pp.108.121038 . Shaked H, Avivi-Ragolsky N, Levy AA. Involvement of the Arabidopsis SWI2/SNF2 chromatin remodeling gene family in DNA damage response and recombination. Genetics. 2006;173:985–94. 10.1534/genetics.105.051664 . Li Y, Tessaro MJ, Li X, Zhang Y. Regulation of the expression of plant resistance gene SNC1 by a protein with a conserved BAT2 domain. Plant Physiol. 2010;153:1425–34. 10.1104/pp.110.156240 . Zhang N, Wang Z, Bao Z, Yang L, Wu D, Shu X, Hua J. MOS1 functions closely with TCP transcription factors to modulate immunity and cell cycle in Arabidopsis. Plant J. 2018;93:66–78. 10.1111/tpj.13757 . Pruss GJ, Nester EW, Vance V. Infiltration with Agrobacterium tumefaciens induces host defense and development-dependent responses in the infiltrated zone. Mol Plant Microbe Interact. 2008;21:1528–38. 10.1094/MPMI-21-12-1528 . Drapal M, Enfissi EMA, Fraser PD. Metabolic effects of agro-infiltration on N. benthamiana accessions. Transgenic Res. 2021;30:303–15. 10.1007/s11248-021-00256-9 . Rico A, Bennett MH, Forcat S, Huang WE, Preston GM. Agroinfiltration reduces ABA levels and suppresses Pseudomonas syringae-elicited salicylic acid production in Nicotiana tabacum. PLoS ONE. 2010;5:e8977. 10.1371/journal.pone.0008977 . Sheikh AH, Raghuram B, Eschen-Lippold L, Scheel D, Lee J, Sinha AK. Agroinfiltration by cytokinin-producing Agrobacterium sp. strain GV3101 primes defense responses in Nicotiana tabacum. Mol Plant Microbe Interact. 2014;27:1175–85. 10.1094/MPMI-04-14-0114-R . Oshima K, Maejima K, Namba S. Genomic and evolutionary aspects of phytoplasmas. Front Microbiol. 2013;4:230. 10.3389/fmicb.2013.00230 . Kube M, Mitrovic J, Duduk B, Rabus R, Seemüller E. Current View on Phytoplasma Genomes and Encoded Metabolism. Sci World J. 2012;2012:185942. 10.1100/2012/185942 . Namba S. Molecular and biological properties of phytoplasmas. Proc Jpn Acad Ser B Phys Biol Sci. 2019;95:401–18. 10.2183/pjab.95.028 . Xue C, Zhang Y, Li H, Liu Z, Gao W, Liu M, et al. The genome of Candidatus phytoplasma ziziphi provides insights into their biological characteristics. BMC Plant Biol. 2023;23:251. 10.1186/s12870-023-04243-6 . Tan Y, Wang J, Davis RE, Wei H, Zong X, Wei W, et al. Transcriptome analysis reveals a complex array of differentially expressed genes accompanying a source-to‐sink change in phytoplasma‐infected sweet cherry leaves. Ann Appl Biology. 2019;175:69–82. 10.1111/aab.12511 . Tan Y, Li Q, Zhao Y, Wei H, Wang J, Baker CJ, et al. Integration of metabolomics and existing omics data reveals new insights into phytoplasma-induced metabolic reprogramming in host plants. PLoS ONE. 2021;16:e0246203. 10.1371/journal.pone.0246203 . Mittelberger C, Yalcinkaya H, Pichler C, Gasser J, Scherzer G, Erhart T, et al. Pathogen-Induced Leaf Chlorosis: Products of Chlorophyll Breakdown Found in Degreened Leaves of Phytoplasma-Infected Apple ( Malus x domestica Borkh.) and Apricot ( Prunus armeniaca L.) Trees Relate to the Pheophorbide a Oxygenase / Phyllobilin Pathway. J Agric Food Chem. 2017;65:2651–60. 10.1021/acs.jafc.6b05501 . Bertamini M, Muthuchelian K, Grando MS, Nedunchezhian N. Effects of phytoplasma infection on growth and photosynthesis in leaves of field grown apple ( Malus pumila Mill. cv. Golden Delicious). Photosynthetica. 2002;40:157–60. Tan Y, Wei H-R, Wang J-W, Zong X-J, Zhu D-Z, Liu Q-Z. Phytoplasmas change the source–sink relationship of field-grown sweet cherry by disturbing leaf function. Physiol Mol Plant Pathol. 2015;92:22–7. 10.1016/j.pmpp.2015.08.012 . Dermastia M, Kube M, Šeruga-Musić M. Transcriptomic and Proteomic Studies of Phytoplasma-Infected Plants. In: Bertaccini A, Oshima K, Kube M, Rao GP, editors. Phytoplasmas: Plant Pathogenic Bacteria - III. Singapore: Springer Singapore; 2019. pp. 35–55. 10.1007/978-981-13-9632-8_3 . Fincher V, Dabney-Smith C, Cline K. Functional assembly of thylakoid deltapH-dependent/Tat protein transport pathway components in vitro. Eur J Biochem. 2003;270:4930–41. 10.1046/j.1432-1033.2003.03894.x . Williams-Carrier R, Stiffler N, Belcher S, Kroeger T, Stern DB, Monde R-A, et al. Use of Illumina sequencing to identify transposon insertions underlying mutant phenotypes in high-copy Mutator lines of maize. Plant J. 2010;63:167–77. 10.1111/j.1365-313X.2010.04231.x . Liu D, Wu ZM, Hou L. Loss-of-function mutation in SCY1 triggers chloroplast-to-nucleus retrograde signaling in Arabidopsis thaliana. Skalitzky CA, Martin JR, Harwood JH, Beirne JJ, Adamczyk BJ, Heck GR, et al. Plastids contain a second sec translocase system with essential functions. Plant Physiol. 2011;155:354–69. 10.1104/pp.110.166546 . Wang J, Yu Q, Xiong H, Wang J, Chen S, Yang Z, Dai S. Proteomic Insight into the Response of Arabidopsis Chloroplasts to Darkness. PLoS ONE. 2016;11:e0154235. 10.1371/journal.pone.0154235 . Janik K, Mittelberger C, Moser M. Lights out. The chloroplast under attack during phytoplasma infection? Annual Plant Reviews. 2020:1–28. 10.1002/9781119312994.apr0747 . Yamburenko MV, Zubo YO, Borner T. Abscisic acid affects transcription of chloroplast genes via protein phosphatase 2C-dependent activation of nuclear genes: repression by guanosine-3’-5’-bisdiphosphate and activation by sigma factor 5. Plant J. 2015;82:1030–41. 10.1111/tpj.12876 . Baba K, Nakano T, Yamagishi K, Yoshida S. Involvement of a Nuclear-Encoded Basic Helix-Loop-Helix Protein in Transcription of the Light-Responsive Promoter of psbD 1 . Plant Physiol. 2001;125:595–603. Liu R, Chen T, Yin X, Xiang G, Peng J, Fu Q, et al. A Plasmopara viticola RXLR effector targets a chloroplast protein PsbP to inhibit ROS production in grapevine. Plant J. 2021;106:1557–70. 10.1111/tpj.15252 . Breen S, McLellan H, Birch PRJ, Gilroy EM. Tuning the Wavelength: Manipulation of Light Signaling to Control Plant Defense. Int J Mol Sci. 2023. 10.3390/ijms24043803 . Campa M, Piazza S, Righetti L, Oh C-S, Conterno L, Borejsza-Wysocka E, et al. HIPM Is a Susceptibility Gene of Malus spp.: Reduced Expression Reduces Susceptibility to Erwinia amylovora. Mol Plant Microbe Interact. 2019;32:167–75. 10.1094/MPMI-05-18-0120-R . Fan H, Ren L, Meng X, Song T, Meng K, Yu Y. Proteome-level investigation of Cucumis sativus-derived resistance to Sphaerotheca fuliginea. Acta Physiol Plant. 2014;36:1781–91. 10.1007/s11738-014-1552-6 . Additional Declarations No competing interests reported. Supplementary Files Additionalfile1.pdf Additional file 1: Scatter Plot of GO terms. Scatter plot depicting groups and distance between terms plotted using rrvgo package. (PDF) Additionalfile2.xlsx Additional file 2: Annotation of transcripts related to defense or phytohormone terms. Table with transcripts belonging to stress, defense or phytohormone related GO terms with their annotations based on nucleotide BLAST results. (XLSX) Additionalfile3.xlsx Additional file 3: KEGG annotation of the main cluster transcripts, analyzed by STRING. Transcript annotation is based on Nicotiana tabacum L. organism search within STRING. (XLSX) Addtionalfile4.xlsx Additional file 4: Annotation of the main cluster transcripts, analyzed by STRING. Transcript annotation is based on Nicotiana tabacum L. organism search within STRING. (XLSX) Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 27 Feb, 2024 Reviews received at journal 23 Feb, 2024 Reviewers agreed at journal 14 Feb, 2024 Reviews received at journal 14 Jan, 2024 Reviewers agreed at journal 07 Jan, 2024 Reviewers agreed at journal 06 Jan, 2024 Reviewers invited by journal 05 Jan, 2024 Editor assigned by journal 05 Jan, 2024 Submission checks completed at journal 05 Jan, 2024 First submitted to journal 29 Dec, 2023 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3821494","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":265695800,"identity":"0061f758-5ef4-467e-873d-0e32f9d92cf9","order_by":0,"name":"Cecilia Mittelberger","email":"","orcid":"","institution":"Research Centre Laimburg, Pfatten (Vadena), South Tyrol","correspondingAuthor":false,"prefix":"","firstName":"Cecilia","middleName":"","lastName":"Mittelberger","suffix":""},{"id":265695801,"identity":"ad683a38-4a60-4e40-8db0-197e6e5a42ee","order_by":1,"name":"Mirko Moser","email":"","orcid":"","institution":"Fondazione Edmund Mach","correspondingAuthor":false,"prefix":"","firstName":"Mirko","middleName":"","lastName":"Moser","suffix":""},{"id":265695802,"identity":"fc8e1188-d3e0-4780-a0e6-64ad22fe3f23","order_by":2,"name":"Bettina Hause","email":"","orcid":"","institution":"Leibniz Institute of Plant Biochemistry","correspondingAuthor":false,"prefix":"","firstName":"Bettina","middleName":"","lastName":"Hause","suffix":""},{"id":265695803,"identity":"0374e639-bc9d-4ead-8415-ac3f22750397","order_by":3,"name":"Katrin Janik","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABAElEQVRIiWNgGAWjYBACCRCRwMDAzMDA2MzwoYCBByIEJbFrYUZoYZxhgNCCUw9YCxQwM/MYIMzHqUWy/fyxDw93MLDzz25uNrYxsJPRnd1j9vELg0UdLi3SPMnMMxLPMDBL3DnYnJxjkMxjdueM8WwZPA6TY0hmZkhsAzrvRmLz4RwDZh6zGznGzBL4tPA/hmiRB2mxMKgnrEVaAmqLAVBLMoPBYbAWxg94tEjOeGwM1CLBbAjUYthjcBzol2PFzAwGEpINOLRInE98zPizzSZZ7kb6Y4kfFdX2ZrebNzP+qKjjx2ULTGcyChcSQQSAHQqP8QdhHaNgFIyCUTByAAAWLUgqioWpgQAAAABJRU5ErkJggg==","orcid":"","institution":"Research Centre Laimburg, Pfatten (Vadena), South Tyrol","correspondingAuthor":true,"prefix":"","firstName":"Katrin","middleName":"","lastName":"Janik","suffix":""}],"badges":[],"createdAt":"2023-12-29 13:59:12","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3821494/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3821494/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":49294499,"identity":"bbc04d30-a833-4e49-a4e4-79615463bdba","added_by":"auto","created_at":"2024-01-08 06:42:25","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":972514,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eWorkflow for \u003c/em\u003ede novo\u003cem\u003e transcriptome assembly and RNA-seq analysis. Steps marked with StarSEQ were perfomed by StarSEQ (Mainz, Germany), while the other steps were performed in house using the denominated tools and software.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-3821494/v1/3a5df97c61963b0939d6e024.png"},{"id":49294362,"identity":"711f2adb-3ab2-4f67-aca5-5078900f8fff","added_by":"auto","created_at":"2024-01-08 06:34:25","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":72631,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eExpression of \u003c/em\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e\u003cem\u003e in leaf samples analyzed by RNA-seq and qPCR.\u0026nbsp; Beside the RNA-seq sample set a second independent sample set was analyzed only by qPCR. Data represent the mean +/- SEM of 3 biological replicates. TMM = trimmed mean of M values [48].\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-3821494/v1/f4d3d06e4bad42bf5e5a4e3e.png"},{"id":49294365,"identity":"5b80ee4e-11d9-481e-a0f9-83d03c682ff3","added_by":"auto","created_at":"2024-01-08 06:34:25","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":4588114,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eDetection of GFP-NLS and SAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e:GFP in infiltrated N. occidentalis leaves. GFP fluorescence was visualized by confocal laser scanning microscopy. Bars represent 20 µm.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-3821494/v1/76299704392f3f160fac4b2a.png"},{"id":49294502,"identity":"bdbf0e80-5b07-490f-bd8d-8aaefc3e0ad5","added_by":"auto","created_at":"2024-01-08 06:42:25","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1747990,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eIdentification of DETs in leaf samples of three different treatment groups. The first control group was not infiltrated (noic), the second control group was infiltrated with GFP-NLS under control of 35S promoter (ctrlinf) and the third group was infiltrated with \u003c/em\u003e35S::SAP11\u003csub\u003eCaPm\u003c/sub\u003e:GFP\u003cem\u003e (SAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e). Arrows show the comparisons that were made with DEseq2 [36].\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-3821494/v1/2d749ea9572ef2b80d549911.png"},{"id":49294364,"identity":"7f258bed-a427-41d7-9481-c6d64c1cea85","added_by":"auto","created_at":"2024-01-08 06:34:25","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":763028,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eNumbers of DETs at log2fold change (L2FC) of ≥ ±2; 4-fold differential expression, p-value cutoff for FDR \u0026lt; 0.001. The VENN diagram shows DETs detected at (A) 24, (B) 72 and (C) 120 h after infiltration. Up- and downregulated transcripts in control-infiltrated samples and SAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e infiltrated samples were analyzed using jvenn [37]. (D) The barplot summarizes for each time point the total number of up- (green) and downregulated (blue) transcripts upon control- infiltration in comparison to non -infiltration and up- (red) or downregulated (yellow) transcripts due to infiltration with SAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e\u003cem\u003e in comparison to control-infiltration.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-3821494/v1/ab79a5947e98cf24014e8a0a.png"},{"id":49294371,"identity":"9b22948a-aa61-408a-a4d8-e3fc020ee51f","added_by":"auto","created_at":"2024-01-08 06:34:25","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":155389,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eHeatmap of transcript accumulation as determined by RT-qPCR analysis and as TMM from RNA-seq data. Values are given as sum normalized values.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-3821494/v1/d2107d668b945cfdc9cb3d87.png"},{"id":49294503,"identity":"b6f9035c-f7ab-4e43-b2c1-8a8cfa55ae23","added_by":"auto","created_at":"2024-01-08 06:42:25","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":511300,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eGO enrichment in samples taken 120 h after infiltration. The GO enrichment is separated by biological process (green), molecular function (blue) and cellular component (yellow). The y-axis represents the top 10 GO terms, while the x-axis displays the percentage of enriched GO terms within each category. The size of the filled circles corresponds to the number of transcripts associated with the GO term, and the color of the circles reflects the adjusted p-value.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-3821494/v1/842f195594ddfd6f998ba9b8.png"},{"id":49294372,"identity":"fdfc40bd-4caa-4882-81ae-9bcee2e114ef","added_by":"auto","created_at":"2024-01-08 06:34:25","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":280628,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eAnalysis of GO annotations. Percentage of defense and phytohormone related differentially expressed transcripts, according to GO annotation.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-3821494/v1/9b36162d00d6dd81431259b7.png"},{"id":49294374,"identity":"6dd8f4e3-cb35-466f-a5b5-5c56d4e4b732","added_by":"auto","created_at":"2024-01-08 06:34:25","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":1363539,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eNetwork analysis of up- and downregulated transcripts. STRING analysis was followed by MCL (Markov Cluster Algorithm) clustering. The main network clusters within each group with their KEGG annotations (see coloring) are shown.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-3821494/v1/6a97bffa1122af9b6e7e20dd.png"},{"id":49295281,"identity":"cd9f6a46-53a7-40cb-be06-d73559a8de55","added_by":"auto","created_at":"2024-01-08 06:58:27","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3931433,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3821494/v1/06af83bf-b3b5-4ff4-a168-33894a4fcdf6.pdf"},{"id":49294373,"identity":"41468749-bcbf-4169-901f-07dda97e1cdf","added_by":"auto","created_at":"2024-01-08 06:34:25","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3656279,"visible":true,"origin":"","legend":"\u003cp\u003eAdditional file 1: Scatter Plot of GO terms. Scatter plot depicting groups and distance between terms plotted using rrvgo package. (PDF)\u003c/p\u003e","description":"","filename":"Additionalfile1.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3821494/v1/dc75893952687dca43ba9f50.pdf"},{"id":49294824,"identity":"d32a5bda-a43a-4d96-8c8b-f1b07d571915","added_by":"auto","created_at":"2024-01-08 06:50:25","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":58304,"visible":true,"origin":"","legend":"\u003cp\u003eAdditional file 2: Annotation of transcripts related to defense or phytohormone terms. Table with transcripts belonging to stress, defense or phytohormone related GO terms with their annotations based on nucleotide BLAST results. (XLSX)\u003c/p\u003e","description":"","filename":"Additionalfile2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3821494/v1/9f11728f85753fd4c951f9b6.xlsx"},{"id":49294500,"identity":"ccd932c5-f7a3-40f8-ac3c-e146f4c4f0ac","added_by":"auto","created_at":"2024-01-08 06:42:25","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":15648,"visible":true,"origin":"","legend":"\u003cp\u003eAdditional file 3: KEGG annotation of the main cluster transcripts, analyzed by STRING. Transcript annotation is based on \u003cem\u003eNicotiana tabacum\u003c/em\u003e L. organism search within STRING. (XLSX)\u003c/p\u003e","description":"","filename":"Additionalfile3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3821494/v1/433acfb6224cbf8e9ee2c2d7.xlsx"},{"id":49294368,"identity":"57fe173f-e58a-4aed-8b44-3ee7f73e6411","added_by":"auto","created_at":"2024-01-08 06:34:25","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":24397,"visible":true,"origin":"","legend":"\u003cp\u003eAdditional file 4: Annotation of the main cluster transcripts, analyzed by STRING. Transcript annotation is based on \u003cem\u003eNicotiana tabacum\u003c/em\u003e L. organism search within STRING. (XLSX)\u003c/p\u003e","description":"","filename":"Addtionalfile4.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-3821494/v1/ead594f6b166197a55d7a03b.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"'Candidatus Phytoplasma mali' SAP11-Like protein modulates expression of genes involved in metabolic pathways, photosynthesis, and defense in Nicotiana occidentalis leaves.","fulltext":[{"header":"Background","content":"\u003cp\u003e \u003cem\u003e'Candidatus\u003c/em\u003e Phytoplasma mali\u003cem\u003e'\u003c/em\u003e ('\u003cem\u003eCa\u003c/em\u003e. P. mali') is a plant pathogen, that is associated to proliferation disease in apple (\u003cem\u003eMalus\u003c/em\u003e x \u003cem\u003edomestica\u003c/em\u003e Borkh.). This cell wall-less bacterium belongs to the class of Mollicutes and has one of the smallest genomes among all so far known phytoplasma species [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Phytoplasmas reside in the plant phloem and are transmitted by phloem sucking psyllids. '\u003cem\u003eCa\u003c/em\u003e. P. mali' manipulates its host plant by secreting effector proteins via a sec-dependent secretion system [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Several effector proteins are known from different phytoplasma [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. So far, in '\u003cem\u003eCa\u003c/em\u003e. P. mali' four effector proteins, namely SAP11\u003csub\u003eCaPm\u003c/sub\u003e [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], PME2 [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], PM19_00185 [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] and SAP05\u003csub\u003eCaPm\u003c/sub\u003e [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e], and the virulence factor AAA\u0026thinsp;+\u0026thinsp;ATPase AP460 [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] have been identified as host manipulating factors. While little or nothing is known about PME2\u0026rsquo;s, SAP05\u003csub\u003eCaPm\u003c/sub\u003e\u0026acute;s and PM19_00185\u0026acute;s function in apple trees, the potential function of the '\u003cem\u003eCa\u003c/em\u003e. P. mali' SAP11 homolog of SAP11\u003csub\u003eAYWB\u003c/sub\u003e (from '\u003cem\u003eCandidatus\u003c/em\u003e Phytoplasma asteris'), has been also described in apple [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e, \u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. SAP11\u003csub\u003eAYWB\u003c/sub\u003e binds and destabilizes three different TCP (TEOSINTE BRANCHED1/ CYCLOIDEA/ PROLIFERATING CELL FACTOR 1 and 2) transcription factors and is involved in the development of different symptoms [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In contrast to SAP11\u003csub\u003eAYWB\u003c/sub\u003e, SAP11\u003csub\u003eCaPm\u003c/sub\u003e localizes not only to the cell nucleus, but also to the cytoplasm [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. However, it has been shown that it binds -similar as SAP11\u003csub\u003eAYWB\u003c/sub\u003e- two class II CIN-like TCPs, namely MdTCP4a (orthologue to AtTCP4) and MdTCP13a (orthologue to AtTCP13), [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] formerly known as MdTCP25 and MdTCP24 respectively [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] as well as to the class II CYC/TB1 TCP MdTCP18a (orthologue to AtTCP18) (formerly known as MdTCP16 as described in [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]). SAP11\u003csub\u003eCaPm\u003c/sub\u003e-binding to its TCP-interaction partners causes severe growth aberrations, early bud break and hormonal disbalance within the plant [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Effector binding of MdTCP4a and MdTCP13a is supposed to be at the basis of the changes in jasmonate (JA) and abscisic acid (ABA) levels observed in infected plants and might be the reason for the development of late flowers, leaf reddening and altered root architecture [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. The binding of MdTCP18a is supposed to counteract the \u003cem\u003eMdTCP18a\u003c/em\u003e upregulation in infected plants, leading to an early bud break and uncontrolled shoot outgrowth [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe stable overexpression of \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eAYWB\u003c/em\u003e\u003c/sub\u003e in \u003cem\u003eArabidopsis\u003c/em\u003e plants resulted in a total of 59 upregulated and 104 downregulated genes as revealed by RNA-seq [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. From the 59 upregulated genes, 18 genes were functionally annotated as inorganic phosphorus (P\u003csub\u003ei\u003c/sub\u003e) starvation-induced genes. In the group of downregulated genes, \u003cem\u003eLIPOXYGENASE2\u003c/em\u003e (\u003cem\u003eLOX2\u003c/em\u003e), a gene encoding an enzyme involved in JA biosynthesis, and \u003cem\u003ePATHOGENESIS-RELATED GENE1 (PR1)\u003c/em\u003e and \u003cem\u003eELICITOR-ACTIVATED GENE3-1 (ELI3-1)\u003c/em\u003e, two salicylic acid (SA) responsive genes, were found. This indicates that SAP11\u003csub\u003eAYWB\u003c/sub\u003e suppresses the defense response while enhancing bacterial growth in \u003cem\u003eArabidopsis\u003c/em\u003e plants. In addition, it has been shown that defense response to insect vectors is also reduced in SAP11\u003csub\u003eAYWB\u003c/sub\u003e overexpressing \u003cem\u003eArabidopsis\u003c/em\u003e plants [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. \u003cem\u003eNicotiana occidentalis\u003c/em\u003e H.-M. Wheeler plants directly infected with '\u003cem\u003eCa\u003c/em\u003e. P. mali' showed 157 proteins with an increased and 173 with a decreased expression compared to healthy plants pointing to the fact that a single effector, such as SAP11 only affects a subset of genes deregulated by the pathogen [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. The proteins encoded by genes with an increased expression comprised mainly the alpha-linolenic acid synthesis, while those with downregulation were involved in porphyrin and chlorophyll metabolism [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. This was in line with increased JA levels and leaf yellowing of infected plants.\u003c/p\u003e \u003cp\u003eEven though such studies help to understand possible functions of SAP11\u003csub\u003eCaPm\u003c/sub\u003e, only little is known so far about the very early role of SAP11\u003csub\u003eCaPm\u003c/sub\u003e during early infection of plants with '\u003cem\u003eCa\u003c/em\u003e. P. mali'. Thus, the aim of this study was to gain a better understanding of the transcriptional changes that occur in the plant host during early occurrence of the effector protein. Infiltration RNA-seq [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] was used to unravel expression networks and effector function in so far healthy plants upon expression of \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e. Moreover, \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler was chosen since it has been described as the appropriate model plant to study '\u003cem\u003eCa\u003c/em\u003e. P. mali' effector functions [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Therefore, the gene encoding the effector protein SAP11\u003csub\u003eCaPm\u003c/sub\u003e was transiently expressed by agroinfiltration in \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler leaves and differential gene expression was analyzed until 5 days post infiltration in the respective leaf tissue. Transcriptional changes in the infiltrated leaves revealed that SAP11\u003csub\u003eCaPm\u003c/sub\u003e affects mainly genes involved in defense responses, photosynthesis, and metabolic pathways at early time points of its occurrence in the cells.\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003ePlant Material and Agroinfiltration\u003c/h2\u003e \u003cp\u003e \u003cem\u003eNicotiana occidentalis\u003c/em\u003e H.-M. Wheeler seeds were kindly provided by Kajohn Boonrod from RLP AgroScience GmbH, Neustadt, Germany [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. Seedlings were grown in a plant growth chamber (Percival AR22L, Percival Scientific, Perry, IA, USA) under long photoperiod conditions (16 h/8 h, 24\u0026deg;C/22\u0026deg;C, 70% rH). Four to five-week-old plants were used for agroinfiltration.\u003c/p\u003e \u003cp\u003eFor agroinfiltration the coding sequence of the mature SAP11\u003csub\u003eCaPm\u003c/sub\u003e effector protein from '\u003cem\u003eCa\u003c/em\u003e. P. mali' strain STAA (Accession: KM501063) was subcloned into the GreenGate-entry module pGGC00 [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e] using the primer pair ATP00189pP_Cfw (AACAGGTCTCAGGCTCCATGTCTCCTCCTAAAAAAGATTCTA) / ATP00189pP_Drv (AACAGGTCTCACTGATTTTTTTCCTTTGTCTTTATTGTTA).\u003c/p\u003e \u003cp\u003eTransformation constructs coding for SAP11\u003csub\u003eCaPm\u003c/sub\u003e:GFP under the control of CaMV \u003cem\u003e35S\u003c/em\u003e promoter and flanked by the RBCS terminator and a plant kanamycin resistance marker were assembled using modules from the GreenGate-kit [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. In detail, a GreenGate reaction containing 150 ng pGGA004 (\u003cem\u003ep35S\u003c/em\u003e), 150 ng pGGB003 (B-dummy), 150 ng pGGC000- SAP11\u003csub\u003eCaPm\u003c/sub\u003e, 150 ng pGGD001 (linker-GFP), 150 ng pGGE001 (\u003cem\u003etRBCS\u003c/em\u003e), 150 ng pGGF007 (\u003cem\u003epNOS::KanR:tNOS\u003c/em\u003e), and 100 ng pGGZ001 (empty destination vector) was combined in a total volume of 15 \u0026micro;L. For the GreenGate reaction 1.5 \u0026micro;L 10\u0026times; CutSmart Buffer (New England Biolab, Ipswich, MA, USA), 1.5 \u0026micro;L ATP (10 mM), 1.0 \u0026micro;L T4 DNA Ligase (5 u/\u0026micro;L) (Thermo Fisher Scientific, Waltham, MA, USA), and 1.0 \u0026micro;L BsaI-HF\u0026reg;v2 (20,000 u/mL) (New England Biolab, Ipswich, MA, USA) were added to the module-mixture, and 30 cycles at 37\u0026deg;C and at 16\u0026deg;C for 2 in each, followed by 50\u0026deg;C for 5 min and 80\u0026deg;C for 5 min were performed. Subsequently, 5 \u0026micro;L of the reaction mixture were used for heat-shock transformation of ccdB-sensitive One Shot\u0026reg; TOP10 chemically competent \u003cem\u003eE. coli\u003c/em\u003e (Invitrogen, Carlsbad, CA, USA). A second vector containing only the GFP gene fused to a nuclear localization signal was assembled, using the pGGC012 module (GFP-NLS). The correctness of the assembled plant expression vectors was confirmed by sequencing.\u003c/p\u003e \u003cp\u003eThe validated GreenGate expression vectors, \u003cem\u003e35S::SAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e:\u003cem\u003eGFP\u003c/em\u003e and \u003cem\u003e35S::GFP-NLS\u003c/em\u003e were transferred together with \u003cem\u003epSOUP\u003c/em\u003e helper plasmid into electrocompetent \u003cem\u003eA. tumefaciens\u003c/em\u003e strain EHA105. The \u003cem\u003eA. tumefaciens\u003c/em\u003e clones were cultured for 2 days at 28\u0026deg;C in selective LB medium. For infiltration 0.5 OD/mL were resuspended in infiltration medium (10 mM MgCl2, 10 mM MES, 200 \u0026micro;M acetosyringone, pH 5.7), regenerated for 4h at 28\u0026deg;C and infiltrated with a blunt syringe into three leaves from four- to five-week-old \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler plants. Six plants were infiltrated with the effector expressing \u003cem\u003e35S::SAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e:\u003cem\u003eGFP\u003c/em\u003e construct and six plants were infiltrated with \u003cem\u003e35S::GFP-NLS\u003c/em\u003e serving as controls. Additional six plants were not infiltrated and used as non-infiltrated controls. The infiltrated area was marked with a pen on the adaxial leaf side and six leaf discs with a size of 1 cm\u0026sup2; (two/infiltrated area) were excised immediately after infiltration from one plant of each variant. Leaf disc excision was repeated on different plants in a 24-h-rhythm. Leaf discs were immediately flash frozen in liquid nitrogen. Infiltration and leaf disc sampling were repeated with three independent plant sets, grown at three different time points.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003ecDNA Library Construction and Sequencing\u003c/h2\u003e \u003cp\u003eA total of 36 leaf discs samples of plants from all three treatments for the timepoints 0 h, 24 h, 72 h and 120 h were sent on dry ice for RNA extraction, library preparation and sequencing to StarSEQ (Mainz, Germany). Additionally, 15 samples were prepared from different growth stages of untreated \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler plants and send on dry ice to StarSEQ. RNA of those samples together with RNA of the 36 leaf disc samples was pooled and used for the \u003cem\u003ede novo\u003c/em\u003e transcriptome assembly.\u003c/p\u003e \u003cp\u003eThe stranded RNA sequencing library was prepared using the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolab, Ipswich, MA, USA). The library for the de novo transcriptome assembly was sequenced on a Illumnia NextSeq500 platform in 2 x 150 nt paired-end mode. The libraries of the 36 leaf samples were sequenced on the same platform in 1 x 75 nt single-end mode.\u003c/p\u003e \u003cp\u003eQuality assessment of the reads was performed using the FASTQC tool [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eAdapter trimming of paired end reads was done with the FASTQ Toolkit (BaseSpace Labs) retaining reads with a minimum read length of 32 nt.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDe novo\u003c/b\u003e \u003cb\u003etranscriptome assembly of\u003c/b\u003e \u003cb\u003eNicotiana occidentalis\u003c/b\u003e\u003c/p\u003e \u003cp\u003eThe whole workflow for \u003cem\u003ede novo\u003c/em\u003e transcriptome assembly and RNA-seq analysis is depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. First, all adapter trimmed paired end reads were quality trimmed with a sliding window of 4 nt, a minimum phred quality score of 20 and a minimal read length of 75 nt using the tool Trimmomatic v.0.36 [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. The \u003cem\u003ede novo\u003c/em\u003e assembly was then performed in strand-specific mode using Trinity v. 2.9 [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The whole de novo assembled transcriptome was first annotated using Trinotate v.3.2.0 [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e] with the help of Transdecoder v.5.5.0 [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] to estimate all possible coding regions. Since the annotation contained several transcripts not belonging to \u003cem\u003eNicotiana\u003c/em\u003e, the whole transcriptome was decontaminated using the MCSC Decontamination method [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] filtering for transcripts belonging to the order of \u003cem\u003eSolanales.\u003c/em\u003e The remaining decontaminated transcriptome was reannotated with Trinotate v.3.2.1 using homology search to SwissProt sequence database with Blast 2.12.0+ [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], to PFAM database for protein domain identification with HMMER (hmmer v.3.3.2) [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e] and for the prediction of a signal peptide with SignalP v.5.0.b [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e] and of a transmembrane domain with tmhmm v.2.0c [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The annotated transcripts were visualized using the build in TrinotateWeb tool.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eDifferential Expression Analysis, GO enrichment analysis\u003c/h2\u003e \u003cp\u003eTranscripts were quantified using Trinity v.2.11.0 build in Salmon (v.1.4.0) [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e] pipeline. Selection of differentially expressed transcripts (DETs) was afterwards performed with the Trinity v.2.11.0 build in DESeq2 pipeline [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], where parameters for filtering are set to \u0026gt;\u0026thinsp;4-fold change and a false discovery rate (FDR)\u0026thinsp;\u0026lt;\u0026thinsp;0.001.\u003c/p\u003e \u003cp\u003eLists of DETs were annotated by homology search with Blast 2.12.0+ [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] against standard nucleotide collection database (nt) with an e-value cut off set to 0.001.\u003c/p\u003e \u003cp\u003eThe lists of DETs were further analyzed and subset by Venn diagrams using jvenn [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eGene ontology (GO) assignments were first extracted from Trinotate output and then all lists of up and downregulated DETs and the Venn subsets were functional enriched with the Trinity v2.11.0 build in GOseq [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e] pipeline, using the \u003cem\u003ede-novo\u003c/em\u003e assembled and decontaminated \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler transcriptome as background.\u003c/p\u003e \u003cp\u003eThe functional enrichment was visualized using RStudio 2022.07.1 (RStudio, PBC) with R v4.2.0 [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] and the Bioconductor packages goseq v.1.48.0 [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e] and rrvgo v.1.8.0 [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eFor a detailed analysis of enriched transcripts, the GO assignments were filtered with a script for defence or stress related terms and phytohormone related terms. In detail, files with GO assignments were searched using strings for defence/stress (\u0026ldquo;stress\u0026rdquo;, \u0026ldquo;defence\u0026rdquo;, \u0026ldquo;immune\u0026rdquo;) and for phytohormone related terms (\u0026ldquo;salicylic\u0026rdquo;, \u0026ldquo;auxin\u0026rdquo;, \u0026ldquo;gibberel\u0026rdquo;, \u0026ldquo;jasmonic\u0026rdquo;, \u0026ldquo;ethylene\u0026rdquo;, \u0026ldquo;cytokinine\u0026rdquo;, \u0026ldquo;abscisic\u0026rdquo;, \u0026ldquo;brassinosteroi\u0026rdquo;).\u003c/p\u003e \u003cp\u003eFor further functional characterization of up- and downregulated transcripts the different subsets were analyzed with STRING database v.12.0 [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e] using the whole \u003cem\u003eN. tabacum\u003c/em\u003e L. genome as background for network analysis. In detail the protein sequences of DETs were uploaded to the multiple sequences search interface, annotated with STRING by homology search within the \u003cem\u003eN. tabacum\u003c/em\u003e L. genome and network was visualized with protein interactions based on functional and physical protein associations. The network was then clustered with MCL (Markov Cluster Algorithm) [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e] clustering using an inflation parameter of 4. Enriched gene ontologies and KEGG pathways of the biggest cluster were downloaded.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eRNA extraction, cDNA synthesis and qPCR\u003c/h2\u003e \u003cp\u003eFor validation of DETs, the agroinfiltration approach was repeated with a new set of plants, using three biological replicates. The excised leaf discs were immediately flash frozen in liquid nitrogen, grinded using a mortar and pistil, and 100 mg of frozen leaf powder was used for RNA extraction with Spectrum\u0026trade; Plant Total RNA Kit (Merck, Darmstadt, Germany) following protocol A of the manual. RNA concentration was measured with a spectrophotometer (Implen N60). Using 2 \u0026micro;g of RNA, genomic DNA removal and cDNA synthesis was performed with SuperScript\u0026trade; IV VILO\u0026trade; Master Mix with ezDNase\u0026trade; enzyme.\u003c/p\u003e \u003cp\u003eTo find suitable and stable expressed reference genes, primer pairs for NbPP2a, NbNQO, NbGAPDH and NbEF1a, identified as reference genes in \u003cem\u003eN. benthamiana\u003c/em\u003e Domin [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e] as well as the endogenous universal qPCR control UNI28S [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e] were selected. They bound \u003cem\u003ein-silico\u003c/em\u003e (tested with Geneious R11.1.5) to transcripts within the \u003cem\u003ede-novo\u003c/em\u003e assembled \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler transcriptome and were thus tested in a qPCR assay. The qPCR data of all candidates were analyzed by RefFinder [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e] and the two most stable genes, \u003cem\u003ePP2a\u003c/em\u003e and \u003cem\u003eNQO\u003c/em\u003e were used as reference genes.\u003c/p\u003e \u003cp\u003eDiluted cDNA was used for qPCR assays, using SYBR chemistry. In detail, 2 \u0026micro;L of template were used in a 10 \u0026micro;L reaction mixture containing 5 \u0026micro;L 2x SYBR FAST qPCR Kit Master Mix (Kapa Biosystems), 2.6 \u0026micro;L nuclease-free water and 0.20 \u0026micro;L each of forward and reverse primer (10 \u0026micro;M). All qPCR reactions were run on a CFX384 Touch Real-Time PCR Detection system, using the following conditions: initial denaturation at 95\u0026deg;C for 20 s; 35 cycles of 95\u0026deg;C for 3 s and 60\u0026deg;C for 30 s; and a melting curve ramp from 65 to 95\u0026deg;C at increments of 0.5\u0026deg;C every 5 s.\u003c/p\u003e \u003cp\u003eTo determine qPCR efficiency of the respective target together with each qPCR run a five-point serial dilution of \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler cDNA (1:10, 1:20, 1:50, 1:100, 1:200) was analyzed. As an additional quality control of qPCR, a three-point serial dilution (1:10, 1:50, 1:100) was analyzed, amplifying the reference genes \u003cem\u003eNbNQO\u003c/em\u003e and \u003cem\u003eNbPP2a\u003c/em\u003e. Data analysis was performed using CFX Manager Software (Bio-Rad) and RStudio 2022.07.1 (RStudio, PBC) with R v4.2.0 [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e] using the MCMC qPCR package (v.1.2.4) [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] applying an informed model.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003e \u003cb\u003eExpression of\u003c/b\u003e \u003cb\u003eSAP11\u003c/b\u003e\u003csub\u003e\u003cb\u003eCaPm\u003c/b\u003e\u003c/sub\u003e \u003cb\u003ein\u003c/b\u003e \u003cb\u003eNicotiana occidentalis\u003c/b\u003e\u003c/p\u003e \u003cp\u003eTo analyze early effects of \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e expression on the transcriptome of \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler, leaves were infiltrated with \u003cem\u003eA. tumefaciens\u003c/em\u003e harboring a construct encoding SAP11\u003csub\u003eCaPm\u003c/sub\u003e fused to GFP. As controls, infiltration with nuclear localized GFP (GFP-NLS) and non-infiltrated plants were used. Samples were taken every 24 h up to 120 h and subjected to RNA-seq.\u0026nbsp;To verify the expression of \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e, leaf samples later used for RNA-seq as well as leaf samples from a second independent experiment, were analyzed by RT-qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Within 24 h after infiltration, the first transcript accumulation was detectable. In the leaf samples set used for RNA-seq, the expression reached its maximum 96 h after infiltration and decreased 120 h post infiltration. Coherently, the analysis on the number of reads obtained by RNA-seq and indicative for expression of \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e showed this kinetics. In the second independent leaf set \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e expression was stable between 48 h and 96 h after infiltration and dropped only slightly after 120 h.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo verify the presence of SAP11\u003csub\u003eCaPm\u003c/sub\u003e fused to GFP in \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler cells, leaves were examined using confocal laser scanning microscopy. The occurrence of SAP11\u003csub\u003eCaPm\u003c/sub\u003e:GFP as well as of GFP-NLS from the control-infiltrations became visible at 48 h after infiltration, thereby lagging behind the rise of transcripts (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). SAP11\u003csub\u003eCaPm\u003c/sub\u003e:GFP was observed to localize to the cell nucleus and the cytoplasm of infiltrated \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler cells, while the GFP-NLS in control-infiltration localized only to the cell nucleus.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eDe Novo transcriptome assembly\u003c/h2\u003e \u003cp\u003eA total of 54,704,261 (GC content: 43%) adapter and quality trimmed paired end reads from a pool of 51 RNA samples from \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler plants infiltrated or not were used for the \u003cem\u003ede novo\u003c/em\u003e transcriptome assembly with Trinity v2.9. The clean reads were assembled, resulting in 166,787 transcripts, with an average length of 1,034 bp and an N\u003csub\u003e50\u003c/sub\u003e of 1,504 bp.\u003c/p\u003e \u003cp\u003eThe transcriptome was further decontaminated from sequences originating from species other than the order \u003cem\u003eSolanales\u003c/em\u003e using the Model-based Categorical Sequence Clustering MCSC decontamination pipeline, that is based on the Model-based Categorical Sequence Clustering (MCSC) algorithm [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The decontaminated transcriptome contained 153,640 transcripts with an average length of 1,076 bp, N\u003csub\u003e50\u003c/sub\u003e of 1,559 bp and a GC content of 39.57%.\u003c/p\u003e \u003cp\u003eThis Transcriptome Shotgun Assembly project has been deposited at DDBJ/ENA/GenBank under the accession GKBG00000000. The version described in this paper is the first version, GKBG01000000.\u003c/p\u003e \u003cp\u003eThe sequencing dataset used in this study is available in the NCBI repository with BioProject ID PRJNA871046.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eDifferential expression analysis\u003c/h3\u003e\n\u003cp\u003eThe RNA-seq libraries obtained from leaf samples infiltrated with \u003cem\u003eA. tumefaciens\u003c/em\u003e to express either \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e:\u003cem\u003eGFP\u003c/em\u003e or \u003cem\u003eGFP-NLS\u003c/em\u003e or non-infiltrated were subjected to transcriptome analysis. To get insights into SAP11\u003csub\u003eCaPm\u003c/sub\u003e-mediated changes, differential expression analysis was done using DEseq2 [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e] within the Trinity Package (v2.11.0) [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e], making pairwise comparisons of non-infiltrated (noic), control-infiltrated (ctrlinf) and SAP11\u003csub\u003eCaPm\u003c/sub\u003e infiltrated (SAP11\u003csub\u003eCaPm\u003c/sub\u003e) samples at different time points (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eWith that, differentially expressed transcripts (DETs) were identified, which occurred over time within a treatment group or between treatment groups at the same time point (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe first DETs in infiltrated leaves were detectable at 24 h after infiltration (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, D). In comparison to non-infiltrated leaves, control-infiltrated \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler leaves showed 318 upregulated and 115 downregulated transcripts. Only a few DETs were detectable between control-infiltrated and the SAP11\u003csub\u003eCaPm\u003c/sub\u003e-infiltrated samples: 34 transcripts were downregulated in SAP11\u003csub\u003eCaPm\u003c/sub\u003e expressing samples compared to the control-infiltration. Seven of these 34 transcripts were upregulated in control-infiltrated samples compared to the non-infiltrated samples.\u003c/p\u003e \u003cp\u003eAt 72 h after infiltration (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, D). a more substantial number of DETs were evident. Control-infiltrated leaves exhibited 1026 upregulated and 181 downregulated transcripts compared to non-infiltrated leaves. In contrast, SAP11\u003csub\u003eCaPm\u003c/sub\u003e-expressing leaves showed only two upregulated and 25 downregulated transcripts compared to control-infiltrated leaves. Six out of these 25 downregulated transcripts were upregulated in control-infiltrated leaves.\u003c/p\u003e \u003cp\u003eThe highest number of DETs was observed at 120 h after infiltration (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, D).\u003c/p\u003e \u003cp\u003eControl-infiltrated samples had 1983 upregulated and 1184 downregulated transcripts compared to non-infiltrated leaves. The comparison between SAP11\u003csub\u003eCaPm\u003c/sub\u003e infiltration and control-infiltration revealed that 193 transcripts were upregulated, and 440 transcripts were downregulated due to SAP11\u003csub\u003eCaPm\u003c/sub\u003e infiltration. Among these 44 of the upregulated transcripts were downregulated between non-infiltrated samples and control-infiltration and 73 downregulated transcripts were upregulated in the control-infiltrated leaves (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTable\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e shows transcripts that resulted differentially expressed at different timepoints upon SAP11\u003csub\u003eCaPm\u003c/sub\u003e expression. Interestingly, a transcript encoding a protein modifier of \u003cem\u003esnc1,1\u003c/em\u003e (MOS1) was downregulated 24 h after infiltration (L2FC -11.54) but upregulated 120 h after infiltration (L2FC 12.40). Three transcripts were downregulated at 24 h and 120 h but only for one of these, the preprotein translocase subunit SCY1, is sufficient further information available on its function.\u003c/p\u003e \u003cp\u003eSix genes were downregulated at 72 h and 120 h after infiltration with SAP11\u003csub\u003eCaPm\u003c/sub\u003e (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) in contrast to control-infiltration. Among those genes, genes encoding the serine/threonine-protein phosphatase BSL1, the protein CHROMATIN REMODELING 8 (CHR8) and a NTRC-like thioredoxin reductase could be detected. Despite the downregulation in SAP11\u003csub\u003eCaPm\u003c/sub\u003e infiltrated samples after 72 h and 120 h, the NTRC-like thioredoxin reductase, as well as the pre-mRNA-splicing factor prp12 and THO complex subunit 4D-like were upregulated in control-infiltrated samples in comparison to the no-infiltration-control at some timepoints: NTRC-like thioredoxin reductase after 72 h and 120 h, pre-mRNA-splicing factor prp12 after 72 h and THO complex subunit 4D-like after 24 h and 72 h.\u003c/p\u003e \u003cp\u003eThe putative DUF21 domain-containing protein At3g13070, as well as BSL1 and the pre-mRNA-splicing factor prp12 were not only downregulated in SAP11\u003csub\u003eCaPm\u003c/sub\u003e infiltrated samples in comparison to control-infiltration but also in comparison to the not-infiltrated samples.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eAnnotations of DETs, that are differentially regulated at different time points (A and B) upon SAP11\u003csub\u003eCaPm\u003c/sub\u003e expression.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTime point A\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eL2FC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTime point B\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eL2FC\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eAnnotation\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e24 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-12.35\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e120 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-9.51\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eXM_019400596.1 PREDICTED: \u003cem\u003eNicotiana attenuata\u003c/em\u003e preprotein translocase subunit SCY1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e24 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-12.03\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e120 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-9.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eXM_019375308.1 PREDICTED: \u003cem\u003eNicotiana attenuata\u003c/em\u003e putative DUF21 domain-containing protein At3g13070\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e24 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-11.31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e120 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-10.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eXM_009759060.1 PREDICTED: \u003cem\u003eNicotiana sylvestris\u003c/em\u003e angio-associated migratory cell protein (LOC104210218)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e24 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-11.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e72 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e11.26\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eXM_016613005.1 PREDICTED: \u003cem\u003eNicotiana tabacum\u003c/em\u003e acyl-CoA thioesterase 2-like (LOC107791023)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e24 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-11.54\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e120 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e12.40\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eXM_009765541.1 PREDICTED: \u003cem\u003eNicotiana sylvestris\u003c/em\u003e protein MODIFIER OF SNC1 1 (LOC104215684)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e72 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-12.14\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e120 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-10.69\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eXM_019370017.1 PREDICTED: \u003cem\u003eNicotiana attenuata\u003c/em\u003e serine/threonine-protein phosphatase BSL1 (LOC109207134)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e72 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-11.45\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e120 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-10.19\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eXM_009610029.3 PREDICTED: \u003cem\u003eNicotiana tomentosiformis\u003c/em\u003e protein CHROMATIN REMODELING 8 (LOC104102344)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e72 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-3.49\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e120 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-9.25\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eXM_009774985.1 PREDICTED: \u003cem\u003eNicotiana sylvestris\u003c/em\u003e dedicator of cytokinesis protein 7 (LOC104223519)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e72 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-12.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e120 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-8.89\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eXM_016623444.1 PREDICTED: \u003cem\u003eNicotiana tabacum\u003c/em\u003e thioredoxin reductase NTRC-like (LOC107800295)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e72 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-2.38\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e120 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-9.11\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eXM_019377213.1 PREDICTED: \u003cem\u003eNicotiana attenuata\u003c/em\u003e pre-mRNA-splicing factor prp12 (LOC109213418)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e72 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e-12.23\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e120 h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e-10.20\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003eXM_016605885.1 PREDICTED: \u003cem\u003eNicotiana tabacum\u003c/em\u003e THO complex subunit 4D-like (LOC107784716)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eqPCR Validation of selected DETs.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eA total of 15 transcripts, that were differentially expressed between control-infiltration and SAP11\u003csub\u003eCaPm\u003c/sub\u003e infiltration, was selected as candidates for qPCR validation (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSelected transcripts with annotation and L2FC changes for qPCR validation.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSample A\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSample B\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAccession Nr.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eDescription\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eL2FC\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_019373029.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana attenuata\u003c/em\u003e calmodulin-binding receptor-like cytoplasmic kinase 3 (LOC109209712)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-2.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_009804809.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana sylvestris\u003c/em\u003e probable leucine-rich repeat receptor-like protein kinase At5g49770 (LOC104248540)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-9.5\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_019390873.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana attenuata\u003c/em\u003e proline dehydrogenase 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e13.3\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_019378812.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana attenuata\u003c/em\u003e protein PHYLLO\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e12.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_019370442.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana attenuata\u003c/em\u003e calmodulin-7 (LOC109207504)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-10.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eJF897607.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e\u003cem\u003eNicotiana benthamiana\u003c/em\u003e chloroplast PsbP1 precursor (psbP1) mRNA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-11.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003enoic_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_016603442.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana tabacum\u003c/em\u003e probable WRKY transcription factor 31 (LOC107782559)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e12.6\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_016603442.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana tabacum\u003c/em\u003e probable WRKY transcription factor 31 (LOC107782559)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e13.1\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_019379586.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana attenuata\u003c/em\u003e oxygen-evolving enhancer protein 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-11.2\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_019372421.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana attenuata\u003c/em\u003e SKP1-like protein 21 (LOC109209196)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-8.9\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_24h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_24h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_019403282.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: Nicotiana XXXattenuate polyadenylate-binding protein-interacting protein 7 (LOC109237039)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-11.4\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_016640507.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana tabacum\u003c/em\u003e protein kinase APK1A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e12.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_72h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_72h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_016623416.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana tabacum\u003c/em\u003e probable xyloglucan endotransglucosylase/hydrolase protein 6 (LOC107800268)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-2.8\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_009778335.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana sylvestris\u003c/em\u003e TMV resistance protein N-like (LOC104226353)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-10.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_016646486.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana tabacum\u003c/em\u003e protein LUTEIN DEFICIENT 5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-9.7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_016646486.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana tabacum\u003c/em\u003e protein LUTEIN DEFICIENT 5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e12.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ectrlinf_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSAP11\u003csub\u003eCaPm\u003c/sub\u003e_120h\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eXM_019407249.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePREDICTED: \u003cem\u003eNicotiana attenuata\u003c/em\u003e patatin-like protein 2 (LOC109240587)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e-10.0\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eRT-qPCR analyses from the 15 selected genes revealed high variance between biological replicates. Therefore, no significant differences could be detected in the selected comparisons. The expression pattern, however, followed the same trend as those in RNA-seq data (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e). Taken together, these validation results of selected genes, the SAP11\u003csub\u003eCaPm\u003c/sub\u003e expression verified by qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) and the RNA-seq data obtained provide a reliable insight into the early effects of SAP11\u003csub\u003eCaPm\u003c/sub\u003e on the transcriptome of \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eGene Ontology (GO) enrichment and analysis\u003c/h2\u003e \u003cp\u003eAll groups of up- and downregulated DETs (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e) were analyzed using the Trinity v2.11.0 build in pipeline for GOseq [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. The results were separated by the three sub-ontologies of GO: Molecular Function (MF), Cellular Component (CC) and Biological Process (BP) (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The datasets were further analyzed with the rrvgo package [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e] which groups GO terms based on their semantic similarity and results were represented by a scatter plot (see Additional file 1).\u003c/p\u003e \u003cp\u003eAfter 24 h and 72 h no significant (FDR\u0026thinsp;\u0026lt;\u0026thinsp;0.5) enriched GO terms were found in the group of SAP11\u003csub\u003eCaPm\u003c/sub\u003e downregulated transcripts in comparison to control-infiltration. The two upregulated transcripts in SAP11\u003csub\u003eCaPm\u003c/sub\u003e expressing samples at 72 h were assigned to the term \u0026ldquo;regulation of protein metabolic process\u0026rdquo; (BP). Enriched terms in the group of downregulated transcripts in SAP11\u003csub\u003eCaPm\u003c/sub\u003e expressing leaves compared to control-infiltration at 120 h comprised transcripts that were categorized into \u0026ldquo;cellular process\u0026rdquo;, \u0026ldquo;biosynthetic process\u0026rdquo; or \u0026ldquo;response to external stimulus\u0026rdquo; (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Enriched GO terms in MF were mainly related to binding processes, such as \u0026ldquo;mRNA binding\u0026rdquo;, \u0026ldquo;organic cyclic compound binding\u0026rdquo; or \u0026ldquo;magnesium chelatase activity\u0026rdquo;, whereas CC enriched terms were \u0026ldquo;plastid\u0026rdquo;, \u0026ldquo;chloroplast\u0026rdquo; or \u0026ldquo;membrane-bounded organelle\u0026rdquo; (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Employing the rrvgo analysis within the set of 366 transcripts (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e; ctrlinf-SAP11\u003csub\u003eCaPm\u003c/sub\u003e down) unaffected by infiltration but downregulated during SAP11\u003csub\u003eCaPm\u003c/sub\u003e expression unveiled a cluster associated with both \"defence response\" and \"response to external stimulus\". The group of 149 upregulated transcripts (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e) in SAP11\u003csub\u003eCaPm\u003c/sub\u003e expressing samples after 120 h compared to the control-infiltration mainly contained transcripts that were assigned to BP GO terms like \u0026ldquo;proton transmembrane transport\u0026rdquo;, \u0026ldquo;reverse transcription involved in RNA\u0026thinsp;\u0026minus;\u0026thinsp;mediated transposition\u0026rdquo; and \u0026ldquo;ATP biosynthetic process\u0026rdquo;. The enriched MF GO terms were related to \u0026ldquo;endodeoxyribonuclease activity\u0026rdquo; and the enriched CC GO terms were mainly allocated to \u0026ldquo;mitochondrial protein\u0026thinsp;\u0026minus;\u0026thinsp;containing complex\u0026rdquo; and \u0026ldquo;proton\u0026thinsp;\u0026minus;\u0026thinsp;transporting ATP synthase complex, coupling factor F(o)\u0026rdquo;. The rrvgo analysis of all 193 upregulated transcripts at 120 h showed a cluster assigned to \u0026ldquo;ATP biosynthetic process\u0026rdquo; and \u0026ldquo;proton transmembrane transport\u0026rdquo; (Additional file 1).\u003c/p\u003e \u003cp\u003eIn the group of upregulated transcripts found only in the control-infiltrated samples at 24 h, 72 h and 120 h after infiltration, GO terms for the category BP are enriched such as \u0026ldquo;defence response\u0026rdquo;, \u0026ldquo;response to biotic stimulus\u0026rdquo; or \u0026ldquo;response to stress. Downregulated transcripts after 24 h were enriched in BP GO terms related to \u0026ldquo;homeostasis\u0026rdquo;, while 72 h after infiltration the enriched BP terms were assigned to \u0026ldquo;photosynthesis, light harvesting\u0026rdquo;, \u0026ldquo;protein\u0026thinsp;\u0026minus;\u0026thinsp;chromophore linkage\u0026rdquo; or \u0026ldquo;electron transport chain\u0026rdquo;. At 120 h after infiltration the most enriched BP terms were \u0026ldquo;starch metabolic process\u0026rdquo;, \u0026ldquo;cation transport\u0026rdquo; and \u0026ldquo;photosynthetic electron transport chain\u0026rdquo; (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The rrvgo analysis revealed a cluster of transcripts related to \u0026ldquo;ATP biosynthetic process\u0026rdquo; that is, in contrast to infiltration with SAP11\u003csub\u003eCaPm\u003c/sub\u003e (ctrlinf - SAP11\u003csub\u003eCaPm\u003c/sub\u003e), upregulated upon control-infiltration (Additional file 1). For both timepoints, 72 h and 120 h most of the enriched CC terms are chloroplast related (\u0026ldquo;thylakoid membrane\u0026rdquo;, \u0026ldquo;photosystem\u0026rdquo;, \u0026ldquo;chloroplast\u0026rdquo;).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eFunctional analysis of groups\u003c/h2\u003e \u003cp\u003eThe GO annotations were selectively refined to include transcripts associated with defense or stress terms and phytohormone-related terms. As depicted in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e, the distribution of defense/stress and phytohormone-related terms in single DET groups is illustrated. Over 25% of the upregulated transcripts in the control-infiltrated samples were identified as defense or stress-related. Notably, in the downregulated DETs of control-infiltrated samples, the proportion of defense/stress-related transcripts decreases over time. In the group of upregulated DETs in SAP11\u003csub\u003eCaPm\u003c/sub\u003e-infiltrated leaves compared to control-infiltrated samples, almost no defense/stress or phytohormone-related transcripts were observed after 72 h (0%) or 120 h (0.5%). Conversely, in the downregulated transcripts of the same group, 28% of the transcripts (72 h) and 19.5% (120 h) are associated with defense/stress or phytohormone-related terms. The Additional file 2 lists all transcripts that were assigned to defense/stress or phytohormone-related terms.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eNetwork analysis\u003c/h2\u003e \u003cp\u003eA network analysis of the different groups of DETs was performed using STRING [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt showed that the pathway belonging to phenylpropanoid biosynthesis was upregulated upon infiltration (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e, noic \u0026ndash; ctrlinf up), while the starch and sucrose metabolism was downregulated due to the infiltration process itself (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e, noic \u0026ndash; ctrlinf down).\u003c/p\u003e \u003cp\u003eThe main network cluster in the group of downregulated transcripts upon SAP11\u003csub\u003eCaPm\u003c/sub\u003e infiltration (ctrlinf vs SAP11\u003csub\u003eCaPm\u003c/sub\u003e) showed enriched KEGG pathways related to ribosome, while the main cluster of up regulated transcripts is enriched in oxidative phosphorylation and metabolic pathways. Detailed information about KEGG enriched transcripts and annotation of the main network cluster transcripts can be found in Additional file 3 and Additional file 4.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eEffectors originating from pathogens are important players in the process, how a pathogen modulates the metabolism of its host. To get insights into the role of SAP11\u003csub\u003eCaPm\u003c/sub\u003e, an effector produced by '\u003cem\u003eCa\u003c/em\u003e. P. mali', the causal agent of apple proliferation disease, early changes in gene expression upon expression of SAP11\u003csub\u003eCaPm\u003c/sub\u003e were analyzed by infiltration RNA-seq [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. For this, \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e was transiently expressed by agroinfiltration in \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler leaves, since it has been shown that this model plant can be infected with '\u003cem\u003eCa\u003c/em\u003e. P. mali' [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. A reference genome of \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler is, however, not available yet thus we opted for an approach where the \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler transcriptome was assembled \u003cem\u003ede novo\u003c/em\u003e and used as a reference for the differential expression analysis.\u003c/p\u003e \u003cp\u003eThe transcript levels of \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e increased continuously until 96 h after infiltration, while it decreased at 120 h after infiltration. This differed slightly from a second independent experiment, where the expression remained stable between 48 h and 120 h after infiltration. Those differences in \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e expression strength might affect the putative changes in host\u0026rsquo;s gene expression profiles, although the protein was detectable to almost similar levels up to 120 h after infiltration. Indeed, the comparison of RNA-seq data with qPCR data of selected genes from the independent leaf samples, showed a common trend in both data sets, proofing RNA-seq data to be reliable. In infected apple trees, the natural host plant, \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e expression is not stable throughout the year [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] and the degree of colonization by phytoplasma, plant growth and climatic conditions might influence the spatio-temporal expression of the effector. Nonetheless, using another natural host of '\u003cem\u003eCa\u003c/em\u003e. P. mali', allowing transient expression assays, helps to unravel the transcriptional changes in the plant due to the action of one single effector protein. The highest number of DETs was detected at 120 h after infiltration. Interestingly, six genes were commonly downregulated at 72 h and 120 h after infiltration; four of these transcripts were allocated to defense-related terms in the GO annotation. Among them, the genes encoding the protein phosphatase BSL1 and chromatin remodeling8 (CHR8) were identified. The protein phosphatase BSL1 belongs to the BSU1 family and contributes to the brassinosteroid signalling. BSL1 interacts with the \u003cem\u003ePhytophtora infestans\u003c/em\u003e effector protein PiAVR2 and acts as a susceptibility factor by affecting the balance between growth and immunity in plants [\u003cspan additionalcitationids=\"CR50\" citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCHR8 belongs to the switch2/sucrose non-fermenting2 (SWI2/SNF2) chromatin remodeling gene family that is involved in DNA damage response (Shaked et al. 2006). It has been shown that CHR8 is upregulated during an artificial infection of \u003cem\u003eA. thaliana\u003c/em\u003e with cabbage leaf curl virus [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e] as well as during genotoxic stress [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], indicating its potential role in plant stress response.\u003c/p\u003e \u003cp\u003eThe gene encoding the modifier of snc1,1 (MOS1) was downregulated at 24 h and upregulated at 120 h after \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e infiltration. MOS1 regulates the nucleotide binding site-Leu-rich repeat (NB-LRR) type R protein SNC1 [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. MOS1 interacts with AtTCP15, while AtTCP15 directly binds to SNC1 and thereby modulates the plant immune response [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Due to that binding, MOS1 enhances the activity of SNC1 and helps to reinforce the defense response. It seems that the MOS1 triggered immune response is suppressed in the early stage of SAP11\u003csub\u003eCaPm\u003c/sub\u003e expression, while it recovers later.\u003c/p\u003e \u003cp\u003eOur results show that the occurrence of SAP11\u003csub\u003eCaPm\u003c/sub\u003e led to a downregulation of plant defense (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). Nonetheless, it should be noted that the infiltration process itself induces several transcriptional changes within the infiltrated leaf area [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e]. Agroinfiltration induces host defense and alters phytohormone levels [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e, \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e]. This is in line with the findings in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e. Transcripts related to plant defense and phytohormones are upregulated in control-infiltrated leaves. However, when comparing control-infiltration to SAP11\u003csub\u003eCaPm\u003c/sub\u003e infiltration, it is evident that defense and phytohormone related transcripts are downregulated, indicating that SAP11\u003csub\u003eCaPm\u003c/sub\u003e is able to suppress plant defense response.\u003c/p\u003e \u003cp\u003eAt the same time, however, the ATP biosynthetic processes seem to be upregulated. Phytoplasmas are highly dependent on metabolic compounds from their hosts since they lack different metabolic genes, among them genes for ATP synthase, glycolysis and for oxidative phosphorylation [\u003cspan additionalcitationids=\"CR61 CR62\" citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIn the same line, the ATP biosynthetic process and the oxidative phosphorylation are upregulated upon SAP11\u003csub\u003eCaPm\u003c/sub\u003e expression in \u003cem\u003eN. occidentalis\u003c/em\u003e H.-M. Wheeler. This might reflect the enhanced levels of glycerolipid and glycerophospholipid metabolites and the numerous differentially expressed carbohydrate metabolism genes shown for SCV phytoplasma infected sweet cherry trees [\u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e, \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eIt is tempting to speculate that the enhancement of metabolic pathways in the host plant help the phytoplasma to obtain sufficient metabolites and nutrients necessary for proliferation and colonization.\u003c/p\u003e \u003cp\u003eIn contrast to metabolic genes, transcripts assigned to the chloroplast were downregulated 120 h upon SAP11\u003csub\u003eCaPm\u003c/sub\u003e infiltration. Photosynthesis rates have been shown to be reduced in many different phytoplasma infections [\u003cspan additionalcitationids=\"CR67\" citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e68\u003c/span\u003e]. In line with that, several transcriptomic and proteomic studies of different phytoplasma infected plants have shown that numerous genes involved in photosynthesis are downregulated during infection [\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e69\u003c/span\u003e]. The finding that SCY1 is strongly downregulated after 24 h and consistently at 120 h opens new insights on the possible SAP11 impact on chloroplast. SCY1 is involved in preprotein localization to the thylakoid [\u003cspan citationid=\"CR70\" class=\"CitationRef\"\u003e70\u003c/span\u003e] and mutant plants for SCY1 show impairment in thylakoid biogenesis [\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e] with a chloroplast-to-nucleus retrograde signal whit impaired production of nuclear-encoded chloroplast proteins [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e] and chlorotic phenotypes [\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e]. During darkness periods SCY1 increases in content in the chloroplast which would increase the import of nuclear-encoded proteins [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eHowever, it is still unknown whether phytoplasma effector proteins target directly the chloroplast or whether photosynthesis is compromised due to the changed plant metabolism [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. Although, they [\u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e] proposed a potential role of SAP11 in reducing the activity of photosystem II (PSII) by binding the AtTCP13 transcription factor. AtTCP13 is also known as PTF1, a transcription factor that regulates gene expression in chloroplasts via the plastid-encoded polymerase PEP [\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e]. PEP is the major chloroplast transcriptase and among the PEP controlled genes, also \u003cem\u003epsbD\u003c/em\u003e was found, that encodes the reaction center protein D2 of PSII. Since in \u003cem\u003eA. thaliana ptf1\u003c/em\u003e mutants the expression of \u003cem\u003epsbD\u003c/em\u003e is reduced [\u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e], it can be assumed that SAP11 binding to TCP13 has a similar effect.\u003c/p\u003e \u003cp\u003eEven though, \u003cem\u003epsbD\u003c/em\u003e was not downregulated in this study, two other genes encoding proteins from PSII were downregulated upon SAP11\u003csub\u003eCaPm\u003c/sub\u003e expression, namely the oxygen-evolving enhancer proteins 1 (OEE1/PsbO) and OEE2 (PsbP). Interestingly, OEE2/PsbP is directly targeted by a \u003cem\u003ePlasmopara viticola\u003c/em\u003e RXLR effector protein [\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e, \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e79\u003c/span\u003e], while OEE1/PsbO binds to HIPM (HrpN-interacting protein from \u003cem\u003eMalus\u003c/em\u003e spp.), a susceptibility gene for \u003cem\u003eErwinia amylovora\u003c/em\u003e infection in apple [\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e80\u003c/span\u003e]. \u003cem\u003eNicotiana benthamiana\u003c/em\u003e Domin \u003cem\u003epsbP\u003c/em\u003e mutants showed a reduced growth and bleached leaves and were less susceptible to \u003cem\u003ePhytophtora capsici\u003c/em\u003e infection [\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e]. In the same line, transgenic grapevine lines overexpression \u003cem\u003epsbP\u003c/em\u003e were more susceptible to \u003cem\u003eP. viticola\u003c/em\u003e infection [\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e78\u003c/span\u003e], indicating that PsbP downregulation enhances immunity. In contrast OEE1/PsbO and OEE2/PsbP proteins were more abundant in leaves of powdery mildew resistant cucumbers than in susceptible ones [\u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e81\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eOur findings revealed a downregulation of defense-related genes, suggesting a suppression of the plant's immune response by \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e. Moreover, the modulation of genes involved in oxidative phosphorylation, as well as upregulation of ATP biosynthetic processes, hinted at a potential strategy employed by the phytoplasma via its effectors to exploit host metabolic pathways for its proliferation and colonization.\u003c/p\u003e \u003cp\u003eAdditionally, the downregulation of transcripts related to chloroplast, such as SCY1, OEE1/PsbO or OEE2/PsbP suggest a potential link between SAP11\u003csub\u003eCaPm\u003c/sub\u003e and the compromise of photosynthetic processes, possibly through interactions with chloroplast-related factors.\u003c/p\u003e \u003cp\u003eOur study contributes to the understanding of SAP11\u003csub\u003eCaPm\u003c/sub\u003e's impact on host plants, however, questions regarding the direct targeting of chloroplasts and the intricate mechanisms leading to photosynthesis reduction and the effect on ATP biosynthetic processes and oxidative phosphorylationremain open. Future research elucidating these aspects will, advance our understanding of phytoplasma-plant interactions and will result in new strategies for mitigating the impact of phytoplasma infections in agricultural settings.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eABA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAbscisic acid\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eATP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eAdenosine Triphosphate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBiological Process\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBSL1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSerine/Threonine-protein phosphatase BSL1, BSU1-like 1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBSU1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBRI1 SUPPRESSOR 1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003e'\u003cem\u003eCa\u003c/em\u003e. P. mali'\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e'\u003cem\u003eCandidatus\u003c/em\u003e Phytoplasma mali'\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCaMV 35S\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCauliflower Mosaic Virus 35S promoter\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCellular Component\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ecDNA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eComplementary DNA\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCHR8\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eChromatin Remodeling 8\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDET\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDifferentially Expressed Transcript\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDUF21\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDomain of Unknown Function 21\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eELI3-1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eELICITOR-ACTIVATED GENE3-1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFDR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eFalse Discovery Rate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGuanine-Cytosine (content in DNA)\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGFP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGreen Fluorescent Protein\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGO\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGene Ontology\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eJA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eJasmonate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eKEGG\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eKyoto Encyclopedia of Genes and Genomes\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eL2FC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eLog2 Fold Change\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLOX2\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eLIPOXYGENASE2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMF\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eMolecular Function\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eMOS1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eModifier of snc1,1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNADPH\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNicotinamide Adenine Dinucleotide Phosphate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNB-LRR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNucleotide-Binding Leucine-Rich Repeat\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNTRC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNADPH-dependent thioredoxin reductase C\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ent\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNucleotide collection database\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eOEE1/PsbO\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eOxygen-Evolving Enhancer Protein 1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eOEE2/PsbP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eOxygen-Evolving Enhancer Protein 2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePEP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePlastid-Encoded Polymerase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePiAVR2\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003e \u003cem\u003ePhytophthora infestans\u003c/em\u003e effector protein AVR2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePR1\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePATHOGENESIS-RELATED GENE1\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eqPCR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eQuantitative Polymerase Chain Reaction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRNA-seq\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRNA sequencing\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRBCS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRibulose-1,5-bisphosphate carboxylase/oxygenase small subunit\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRT-qPCR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eReverse Transcription Quantitative Polymerase Chain Reaction\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSalicylic acid\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSCV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSweet Cherry Virescence phytoplasma\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSEM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eStandard Error of the Mean\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSWI2/SNF2\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSWITCH2/SUCROSE NON-FERMENTING2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTCP\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTEOSINTE BRANCHED1, CYCLOIDEA, and PROLIFERATING CELL FACTORS\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTMM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTrimmed Mean of M values\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003etRBCS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRibulose-1,5-bisphosphate carboxylase/oxygenase terminator\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cem\u003eEthics approval and consent to participate\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eConsent for publication\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eNot Applicable\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAvailability of data and materials\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets generated and/or analyzed during the current study are available in the NCBI repository with BioProject ID PRJNA871046 and contains 13 BioSample datasets (https://www.ncbi.nlm.nih.gov/bioproject/?term=PRJNA871046). The Transcriptome Shotgun Assembly project has been deposited at DDBJ/ENA/GenBank under the accession GKBG00000000 (https://www.ncbi.nlm.nih.gov/nuccore/2428580569).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCompeting interests\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eFunding\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe work was performed as part of the project APPLIII and APPLiv within the framework agreement in the field of invasive species in fruit growing and major pathologies, co-funded by the Autonomous Province of Bozen/Bolzano, Italy, and the South Tyrolean Apple Consortium. The authors thank the Department of Innovation, Research, University and Museums of the Autonomous Province of Bozen/Bolzano covering the Open Access publication costs.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAuthors' contributions\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eCM contributed to the study design, performed all experiments, analyzed, and interpreted the data and wrote and revised the manuscript. MM analyzed and interpreted the data and revised the manuscript. BH contributed to the study design, interpreted the data, and revised the manuscript. KJ contributed to the study design, helped in analyzing and interpreting the data, contributed to the writing and revision of the manuscript. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAcknowledgements\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eWe express our gratitude to Christine Kerschbamer and Katherina Telser for their assistance in the sampling and RNA extraction processes. Special thanks to Hagen Stellmach for his valuable advice and guidance in agroinfiltration. Our appreciation also goes to Sabine \u0026Ouml;ttl for providing primers for reference genes. Additionally, we acknowledge Andreas Gallmetzer for his support in ensuring RNA quality and integrity.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eKube M, Schneider B, Kuhl H, Dandekar T, Heitmann K, Migdoll AM, et al. The linear chromosome of the plant-pathogenic mycoplasma \u0026lsquo;\u003cem\u003eCandidatus\u003c/em\u003e Phytoplasma mali\u0026rsquo;. BMC Genomics. 2008. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1471-2164-9-306\u003c/span\u003e\u003cspan address=\"10.1186/1471-2164-9-306\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTomkins M, Kliot A, Mar\u0026eacute;e AF, Hogenhout SA. A multi-layered mechanistic modelling approach to understand how effector genes extend beyond phytoplasma to modulate plant hosts, insect vectors and the environment. Curr Opin Plant Biol. 2018;44:39\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pbi.2018.02.002\u003c/span\u003e\u003cspan address=\"10.1016/j.pbi.2018.02.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRashid U, Bilal S, Bhat KA, Shah TA, Wani TA, Bhat FA, et al. Phytoplasma Effectors and their Role in Plant-Insect Interaction. Int J Curr Microbiol App Sci. 2018;7:1136\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.20546/ijcmas.2018.702.141\u003c/span\u003e\u003cspan address=\"10.20546/ijcmas.2018.702.141\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJanik K, Mith\u0026ouml;fer A, Raffeiner M, Stellmach H, Hause B, Schlink K, Mithofer A. An effector of apple proliferation phytoplasma targets TCP transcription factors-a generalized virulence strategy of phytoplasma? Mol Plant Pathol. 2017;18:435\u0026ndash;42. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/mpp.12409\u003c/span\u003e\u003cspan address=\"10.1111/mpp.12409\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMittelberger C, Stellmach H, Hause B, Kerschbamer C, Schlink K, Letschka T, Janik K. A Novel Effector Protein of Apple Proliferation Phytoplasma Disrupts Cell Integrity of Nicotiana spp. Protoplasts. Int J Mol Sci. 2019;20:1\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms20184613\u003c/span\u003e\u003cspan address=\"10.3390/ijms20184613\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStrohmayer A, Moser M, Si-Ammour A, Krczal G, Boonrod K. Candidatus Phytoplasma mali\u0026rsquo; genome encodes a protein that functions as a E3 Ubiquitin Ligase and could inhibit plant basal defense. Mol Plant Microbe Interact. 2019. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1094/MPMI-04-19-0107-R\u003c/span\u003e\u003cspan address=\"10.1094/MPMI-04-19-0107-R\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHuang W, MacLean AM, Sugio A, Maqbool A, Busscher M, Cho S-T, et al. Parasitic modulation of host development by ubiquitin-independent protein degradation. Cell. 2021;184:5201\u0026ndash;5214e12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2021.08.029\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2021.08.029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeem\u0026uuml;ller E, Zikeli K, Furch ACU, Wensing A, Jelkmann W. Virulence of \u0026lsquo;Candidatus Phytoplasma mali\u0026rsquo; strains is closely linked to conserved substitutions in AAA\u0026thinsp;+\u0026thinsp;ATPase AP460 and their supposed effect on enzyme function. Eur J Plant Pathol. 2017;86:141. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10658-017-1318-2\u003c/span\u003e\u003cspan address=\"10.1007/s10658-017-1318-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBai X, Correa VR, Toru\u0026ntilde;o TY, Ammar E-D, Kamoun S, Hogenhout SA. AY-WB phytoplasma secretes a protein that targets plant cell nuclei. Mol Plant Microbe Interact. 2009;22:18\u0026ndash;30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1094/MPMI-22-1-0018\u003c/span\u003e\u003cspan address=\"10.1094/MPMI-22-1-0018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoonrod K, Strohmayer A, Schwarz T, Braun M, Tropf T, Krczal G. Beyond Destabilizing Activity of SAP11-like Effector of Candidatus Phytoplasma mali Strain PM19. Microorganisms. 2022. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/microorganisms10071406\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms10071406\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStrohmayer A, Schwarz T, Braun M, Krczal G, Boonrod K. The Effect of the Anticipated Nuclear Localization Sequence of \u0026lsquo;\u003cem\u003eCandidatus\u003c/em\u003e Phytoplasma mali\u0026rsquo; SAP11-like Protein on Localization of the Protein and Destabilization of TCP Transcription Factor. Microorganisms. 2021;9:1\u0026ndash;17. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/microorganisms9081756\u003c/span\u003e\u003cspan address=\"10.3390/microorganisms9081756\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSugio A, Kingdom HN, MacLean AM, Grieve VM, Hogenhout SA. Phytoplasma protein effector SAP11 enhances insect vector reproduction by manipulating plant development and defense hormone biosynthesis. Proc Natl Acad Sci U S A. 2011;108:1254\u0026ndash;63. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1073/pnas.1105664108\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1105664108\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSugio A, MacLean AM, Hogenhout SA. The small phytoplasma virulence effector SAP11 contains distinct domains required for nuclear targeting and CIN-TCP binding and destabilization. New Phytol. 2014;202:838\u0026ndash;48. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/nph.12721\u003c/span\u003e\u003cspan address=\"10.1111/nph.12721\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChang SH, Tan CM, Wu C-T, Lin T-H, Jiang S-Y, Liu R-C, et al. Alterations of plant architecture and phase transition by the phytoplasma virulence factor SAP11. J Exp Bot. 2018;69:5389\u0026ndash;401. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/jxb/ery318\u003c/span\u003e\u003cspan address=\"10.1093/jxb/ery318\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTabarelli M, Malnoy M, Janik K. Chasing Consistency: An Update of the TCP Gene Family of Malus \u0026times; Domestica. Genes (Basel). 2022. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/genes13101696\u003c/span\u003e\u003cspan address=\"10.3390/genes13101696\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMittelberger C, Hause B, Janik K. The \u0026lsquo;Candidatus Phytoplasma mali\u0026rsquo; effector protein SAP11CaPm interacts with MdTCP16, a class II CYC/TB1 transcription factor that is highly expressed during phytoplasma infection. PLoS ONE. 2022;17:e0272467. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0272467\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0272467\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLu Y-T, Li M-Y, Cheng K-T, Tan CM, Su L-W, Lin W-Y, et al. Transgenic plants that express the phytoplasma effector SAP11 show altered phosphate starvation and defense responses. Plant Physiol. 2014;164:1456\u0026ndash;69. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1104/pp.113.229740\u003c/span\u003e\u003cspan address=\"10.1104/pp.113.229740\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePecher P, Moro G, Canale MC, Capdevielle S, Singh A, MacLean A, et al. Phytoplasma SAP11 effector destabilization of TCP transcription factors differentially impact development and defence of Arabidopsis versus maize. PLoS Pathog. 2019;15:1\u0026ndash;27. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.ppat.1008035\u003c/span\u003e\u003cspan address=\"10.1371/journal.ppat.1008035\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLuge T, Kube M, Freiwald A, Meierhofer D, Seem\u0026uuml;ller E, Sauer S. Transcriptomics assisted proteomic analysis of \u003cem\u003eNicotiana occidentalis\u003c/em\u003e infected by \u003cem\u003eCandidatus\u003c/em\u003e Phytoplasma mali strain AT. Proteomics. 2014;14:1882\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/pmic.201300551\u003c/span\u003e\u003cspan address=\"10.1002/pmic.201300551\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBond DM, Albert NW, Lee RH, Gillard GB, Brown CM, Hellens RP, Macknight RC. Infiltration-RNAseq: transcriptome profiling of Agrobacterium-mediated infiltration of transcription factors to discover gene function and expression networks in plants. Plant Methods. 2016;12:41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13007-016-0141-7\u003c/span\u003e\u003cspan address=\"10.1186/s13007-016-0141-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSeem\u0026uuml;ller E, Kiss E, Sule S, Schneider B. Multiple infection of apple trees by distinct strains of \u0026lsquo;Candidatus Phytoplasma mali\u0026rsquo; and its pathological relevance. Phytopathology. 2010;100:863\u0026ndash;70. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1094/PHYTO-100-9-0863\u003c/span\u003e\u003cspan address=\"10.1094/PHYTO-100-9-0863\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBoonrod K, Munteanu B, Jarausch B, Jarausch W, Krczal G. An immunodominant membrane protein (Imp) of \u0026lsquo;\u003cem\u003eCandidatus\u003c/em\u003e Phytoplasma mali\u0026rsquo; binds to plant actin. Mol Plant Microbe Interact. 2012;25:889\u0026ndash;95. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1094/MPMI-11-11-0303\u003c/span\u003e\u003cspan address=\"10.1094/MPMI-11-11-0303\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchneider B, Sule S, Jelkmann W, Seem\u0026uuml;ller E. Suppression of aggressive strains of \u0026lsquo;Candidatus phytoplasma mali\u0026rsquo; by mild strains in Catharanthus roseus and Nicotiana occidentalis and indication of similar action in apple trees. Phytopathology. 2014;104:453\u0026ndash;61. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1094/PHYTO-08-13-0230-R\u003c/span\u003e\u003cspan address=\"10.1094/PHYTO-08-13-0230-R\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLampropoulos A, Sutikovic Z, Wenzl C, Maegele I, Lohmann JU, Forner J. GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis. PLoS ONE. 2013;8:e83043. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0083043\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0083043\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAndrews S, Lindenbaum P, Howard B, Ewels P. FastQC; 2011\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/bioinformatics/btu170\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btu170\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGrabherr MG, Haas BJ, Yassour M, Levin JZ, Thompson DA, Amit I, et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat Biotechnol. 2011;29:644\u0026ndash;52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nbt.1883\u003c/span\u003e\u003cspan address=\"10.1038/nbt.1883\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBryant DM, Johnson K, DiTommaso T, Tickle T, Couger MB, Payzin-Dogru D, et al. A Tissue-Mapped Axolotl De Novo Transcriptome Enables Identification of Limb Regeneration Factors. Cell Rep. 2017;18:762\u0026ndash;76. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.celrep.2016.12.063\u003c/span\u003e\u003cspan address=\"10.1016/j.celrep.2016.12.063\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHaas BJ, Papanicolaou A, Yassour M, Grabherr M, Blood PD, Bowden J, et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat Protoc. 2013;8:1494\u0026ndash;512. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nprot.2013.084\u003c/span\u003e\u003cspan address=\"10.1038/nprot.2013.084\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLafond-Lapalme J, Duceppe M-O, Wang S, Moffett P, Mimee B. A new method for decontamination of de novo transcriptomes using a hierarchical clustering algorithm. Bioinformatics. 2017;33:1293\u0026ndash;300. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/bioinformatics/btw793\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btw793\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAltschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403\u0026ndash;10. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/S0022-2836(05)80360-2\u003c/span\u003e\u003cspan address=\"10.1016/S0022-2836(05)80360-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEddy SR, Accelerated Profile HMM, Searches. PLoS Comput Biol. 2011;7:e1002195. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pcbi.1002195\u003c/span\u003e\u003cspan address=\"10.1371/journal.pcbi.1002195\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlmagro Armenteros JJ, Tsirigos KD, S\u0026oslash;nderby CK, Petersen TN, Winther O, Brunak S, et al. SignalP 5.0 improves signal peptide predictions using deep neural networks. Nat Biotechnol. 2019;37:420\u0026ndash;3. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41587-019-0036-z\u003c/span\u003e\u003cspan address=\"10.1038/s41587-019-0036-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKrogh A, Larsson B, von Heijne G, Sonnhammer EL. Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J Mol Biol. 2001;305:567\u0026ndash;80. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1006/jmbi.2000.4315\u003c/span\u003e\u003cspan address=\"10.1006/jmbi.2000.4315\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePatro R, Duggal G, Love MI, Irizarry RA, Kingsford C. Salmon provides fast and bias-aware quantification of transcript expression. Nat Methods. 2017;14:417\u0026ndash;9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/nmeth.4197\u003c/span\u003e\u003cspan address=\"10.1038/nmeth.4197\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLove MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13059-014-0550-8\u003c/span\u003e\u003cspan address=\"10.1186/s13059-014-0550-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBardou P, Mariette J, Escudi\u0026eacute; F, Djemiel C, Klopp C. jvenn: an interactive Venn diagram viewer. BMC Bioinformatics. 2014;15:293. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1471-2105-15-293\u003c/span\u003e\u003cspan address=\"10.1186/1471-2105-15-293\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoung MD, Wakefield MJ, Smyth GK, Oshlack A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 2010;11:R14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/gb-2010-11-2-r14\u003c/span\u003e\u003cspan address=\"10.1186/gb-2010-11-2-r14\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eR Core Team. R: A Language and Environment for Statistical Computing. Vienna, Austria: R Foundation for Statistical Computing; 2022.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYoung MD, goseq. Bioconductor; 2017.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSayols S. rrvgo: a Bioconductor package to reduce and visualize Gene Ontology terms. Bioconductor; 2020.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSzklarczyk D, Gable AL, Nastou KC, Lyon D, Kirsch R, Pyysalo S, et al. The STRING database in 2021: customizable protein-protein networks, and functional characterization of user-uploaded gene/measurement sets. Nucleic Acids Res. 2021;49:D605\u0026ndash;12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/nar/gkaa1074\u003c/span\u003e\u003cspan address=\"10.1093/nar/gkaa1074\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003evan Dongen S. Graph Clustering Via a Discrete Uncoupling Process. SIAM J Matrix Anal \u0026amp; Appl. 2008;30:121\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1137/040608635\u003c/span\u003e\u003cspan address=\"10.1137/040608635\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePombo MA, Ramos RN, Zheng Y, Fei Z, Martin GB, Rosli HG. Transcriptome-based identification and validation of reference genes for plant-bacteria interaction studies using Nicotiana benthamiana. Sci Rep. 2019;9:1632. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-018-38247-2\u003c/span\u003e\u003cspan address=\"10.1038/s41598-018-38247-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMittelberger C, Obkircher L, Oberkofler V, Ianeselli A, Kerschbamer C, Gallmetzer A, et al. Development of a universal endogenous qPCR control for eukaryotic DNA samples. Plant Methods. 2020;16:341. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s13007-020-00597-2\u003c/span\u003e\u003cspan address=\"10.1186/s13007-020-00597-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXie F, Xiao P, Chen D, Xu L, Zhang B. miRDeepFinder: a miRNA analysis tool for deep sequencing of plant small RNAs. Plant Mol Biol. 2012. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11103-012-9885-2\u003c/span\u003e\u003cspan address=\"10.1007/s11103-012-9885-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMatz MV, Wright RM, Scott JG. No control genes required: Bayesian analysis of qRT-PCR data. PLoS ONE. 2013;8:e71448. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0071448\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0071448\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRobinson MD, Oshlack A. A scaling normalization method for differential expression analysis of RNA-seq data. Genome Biol. 2010;11:R25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/gb-2010-11-3-r25\u003c/span\u003e\u003cspan address=\"10.1186/gb-2010-11-3-r25\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang H, Trusch F, Turnbull D, Aguilera-Galvez C, Breen S, Naqvi S, et al. Evolutionarily distinct resistance proteins detect a pathogen effector through its association with different host targets. New Phytol. 2021;232:1368\u0026ndash;81. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/nph.17660\u003c/span\u003e\u003cspan address=\"10.1111/nph.17660\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTurnbull D, Wang H, Breen S, Malec M, Naqvi S, Yang L, et al. AVR2 Targets BSL Family Members, Which Act as Susceptibility Factors to Suppress Host Immunity. Plant Physiol. 2019;180:571\u0026ndash;81. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1104/pp.18.01143\u003c/span\u003e\u003cspan address=\"10.1104/pp.18.01143\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSaunders DGO, Breen S, Win J, Schornack S, Hein I, Bozkurt TO, et al. Host protein BSL1 associates with Phytophthora infestans RXLR effector AVR2 and the Solanum demissum Immune receptor R2 to mediate disease resistance. Plant Cell. 2012;24:3420\u0026ndash;34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1105/tpc.112.099861\u003c/span\u003e\u003cspan address=\"10.1105/tpc.112.099861\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAscencio-Ib\u0026aacute;\u0026ntilde;ez JT, Sozzani R, Lee T-J, Chu T-M, Wolfinger RD, Cella R, Hanley-Bowdoin L. Global analysis of Arabidopsis gene expression uncovers a complex array of changes impacting pathogen response and cell cycle during geminivirus infection. Plant Physiol. 2008;148:436\u0026ndash;54. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1104/pp.108.121038\u003c/span\u003e\u003cspan address=\"10.1104/pp.108.121038\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShaked H, Avivi-Ragolsky N, Levy AA. Involvement of the Arabidopsis SWI2/SNF2 chromatin remodeling gene family in DNA damage response and recombination. Genetics. 2006;173:985\u0026ndash;94. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1534/genetics.105.051664\u003c/span\u003e\u003cspan address=\"10.1534/genetics.105.051664\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi Y, Tessaro MJ, Li X, Zhang Y. Regulation of the expression of plant resistance gene SNC1 by a protein with a conserved BAT2 domain. Plant Physiol. 2010;153:1425\u0026ndash;34. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1104/pp.110.156240\u003c/span\u003e\u003cspan address=\"10.1104/pp.110.156240\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang N, Wang Z, Bao Z, Yang L, Wu D, Shu X, Hua J. MOS1 functions closely with TCP transcription factors to modulate immunity and cell cycle in Arabidopsis. Plant J. 2018;93:66\u0026ndash;78. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/tpj.13757\u003c/span\u003e\u003cspan address=\"10.1111/tpj.13757\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePruss GJ, Nester EW, Vance V. Infiltration with Agrobacterium tumefaciens induces host defense and development-dependent responses in the infiltrated zone. Mol Plant Microbe Interact. 2008;21:1528\u0026ndash;38. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1094/MPMI-21-12-1528\u003c/span\u003e\u003cspan address=\"10.1094/MPMI-21-12-1528\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDrapal M, Enfissi EMA, Fraser PD. Metabolic effects of agro-infiltration on N. benthamiana accessions. Transgenic Res. 2021;30:303\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11248-021-00256-9\u003c/span\u003e\u003cspan address=\"10.1007/s11248-021-00256-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRico A, Bennett MH, Forcat S, Huang WE, Preston GM. Agroinfiltration reduces ABA levels and suppresses Pseudomonas syringae-elicited salicylic acid production in Nicotiana tabacum. PLoS ONE. 2010;5:e8977. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0008977\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0008977\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheikh AH, Raghuram B, Eschen-Lippold L, Scheel D, Lee J, Sinha AK. Agroinfiltration by cytokinin-producing Agrobacterium sp. strain GV3101 primes defense responses in Nicotiana tabacum. Mol Plant Microbe Interact. 2014;27:1175\u0026ndash;85. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1094/MPMI-04-14-0114-R\u003c/span\u003e\u003cspan address=\"10.1094/MPMI-04-14-0114-R\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOshima K, Maejima K, Namba S. Genomic and evolutionary aspects of phytoplasmas. Front Microbiol. 2013;4:230. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3389/fmicb.2013.00230\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2013.00230\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKube M, Mitrovic J, Duduk B, Rabus R, Seem\u0026uuml;ller E. Current View on Phytoplasma Genomes and Encoded Metabolism. Sci World J. 2012;2012:185942. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1100/2012/185942\u003c/span\u003e\u003cspan address=\"10.1100/2012/185942\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNamba S. Molecular and biological properties of phytoplasmas. Proc Jpn Acad Ser B Phys Biol Sci. 2019;95:401\u0026ndash;18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.2183/pjab.95.028\u003c/span\u003e\u003cspan address=\"10.2183/pjab.95.028\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXue C, Zhang Y, Li H, Liu Z, Gao W, Liu M, et al. The genome of Candidatus phytoplasma ziziphi provides insights into their biological characteristics. BMC Plant Biol. 2023;23:251. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12870-023-04243-6\u003c/span\u003e\u003cspan address=\"10.1186/s12870-023-04243-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan Y, Wang J, Davis RE, Wei H, Zong X, Wei W, et al. Transcriptome analysis reveals a complex array of differentially expressed genes accompanying a source-to‐sink change in phytoplasma‐infected sweet cherry leaves. Ann Appl Biology. 2019;175:69\u0026ndash;82. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/aab.12511\u003c/span\u003e\u003cspan address=\"10.1111/aab.12511\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan Y, Li Q, Zhao Y, Wei H, Wang J, Baker CJ, et al. Integration of metabolomics and existing omics data reveals new insights into phytoplasma-induced metabolic reprogramming in host plants. PLoS ONE. 2021;16:e0246203. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0246203\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0246203\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMittelberger C, Yalcinkaya H, Pichler C, Gasser J, Scherzer G, Erhart T, et al. Pathogen-Induced Leaf Chlorosis: Products of Chlorophyll Breakdown Found in Degreened Leaves of Phytoplasma-Infected Apple (\u003cem\u003eMalus\u003c/em\u003e x \u003cem\u003edomestica\u003c/em\u003e Borkh.) and Apricot (\u003cem\u003ePrunus armeniaca\u003c/em\u003e L.) Trees Relate to the Pheophorbide \u003cem\u003ea\u003c/em\u003e Oxygenase / Phyllobilin Pathway. J Agric Food Chem. 2017;65:2651\u0026ndash;60. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1021/acs.jafc.6b05501\u003c/span\u003e\u003cspan address=\"10.1021/acs.jafc.6b05501\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBertamini M, Muthuchelian K, Grando MS, Nedunchezhian N. Effects of phytoplasma infection on growth and photosynthesis in leaves of field grown apple (\u003cem\u003eMalus pumila\u003c/em\u003e Mill. cv. Golden Delicious). Photosynthetica. 2002;40:157\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTan Y, Wei H-R, Wang J-W, Zong X-J, Zhu D-Z, Liu Q-Z. Phytoplasmas change the source\u0026ndash;sink relationship of field-grown sweet cherry by disturbing leaf function. Physiol Mol Plant Pathol. 2015;92:22\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pmpp.2015.08.012\u003c/span\u003e\u003cspan address=\"10.1016/j.pmpp.2015.08.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDermastia M, Kube M, Šeruga-Musić M. Transcriptomic and Proteomic Studies of Phytoplasma-Infected Plants. In: Bertaccini A, Oshima K, Kube M, Rao GP, editors. Phytoplasmas: Plant Pathogenic Bacteria - III. Singapore: Springer Singapore; 2019. pp. 35\u0026ndash;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-981-13-9632-8_3\u003c/span\u003e\u003cspan address=\"10.1007/978-981-13-9632-8_3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFincher V, Dabney-Smith C, Cline K. Functional assembly of thylakoid deltapH-dependent/Tat protein transport pathway components in vitro. Eur J Biochem. 2003;270:4930\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1046/j.1432-1033.2003.03894.x\u003c/span\u003e\u003cspan address=\"10.1046/j.1432-1033.2003.03894.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilliams-Carrier R, Stiffler N, Belcher S, Kroeger T, Stern DB, Monde R-A, et al. Use of Illumina sequencing to identify transposon insertions underlying mutant phenotypes in high-copy Mutator lines of maize. Plant J. 2010;63:167\u0026ndash;77. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1365-313X.2010.04231.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-313X.2010.04231.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu D, Wu ZM, Hou L. Loss-of-function mutation in SCY1 triggers chloroplast-to-nucleus retrograde signaling in Arabidopsis thaliana.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSkalitzky CA, Martin JR, Harwood JH, Beirne JJ, Adamczyk BJ, Heck GR, et al. Plastids contain a second sec translocase system with essential functions. Plant Physiol. 2011;155:354\u0026ndash;69. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1104/pp.110.166546\u003c/span\u003e\u003cspan address=\"10.1104/pp.110.166546\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Yu Q, Xiong H, Wang J, Chen S, Yang Z, Dai S. Proteomic Insight into the Response of Arabidopsis Chloroplasts to Darkness. PLoS ONE. 2016;11:e0154235. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pone.0154235\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0154235\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJanik K, Mittelberger C, Moser M. Lights out. The chloroplast under attack during phytoplasma infection? Annual Plant Reviews. 2020:1\u0026ndash;28. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1002/9781119312994.apr0747\u003c/span\u003e\u003cspan address=\"10.1002/9781119312994.apr0747\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYamburenko MV, Zubo YO, Borner T. Abscisic acid affects transcription of chloroplast genes via protein phosphatase 2C-dependent activation of nuclear genes: repression by guanosine-3\u0026rsquo;-5\u0026rsquo;-bisdiphosphate and activation by sigma factor 5. Plant J. 2015;82:1030\u0026ndash;41. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/tpj.12876\u003c/span\u003e\u003cspan address=\"10.1111/tpj.12876\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBaba K, Nakano T, Yamagishi K, Yoshida S. Involvement of a Nuclear-Encoded Basic Helix-Loop-Helix Protein in Transcription of the Light-Responsive Promoter of \u003cem\u003epsbD\u003c/em\u003e\u003csup\u003e\u003cem\u003e1\u003c/em\u003e\u003c/sup\u003e. Plant Physiol. 2001;125:595\u0026ndash;603.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu R, Chen T, Yin X, Xiang G, Peng J, Fu Q, et al. A Plasmopara viticola RXLR effector targets a chloroplast protein PsbP to inhibit ROS production in grapevine. Plant J. 2021;106:1557\u0026ndash;70. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/tpj.15252\u003c/span\u003e\u003cspan address=\"10.1111/tpj.15252\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBreen S, McLellan H, Birch PRJ, Gilroy EM. Tuning the Wavelength: Manipulation of Light Signaling to Control Plant Defense. Int J Mol Sci. 2023. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms24043803\u003c/span\u003e\u003cspan address=\"10.3390/ijms24043803\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCampa M, Piazza S, Righetti L, Oh C-S, Conterno L, Borejsza-Wysocka E, et al. HIPM Is a Susceptibility Gene of Malus spp.: Reduced Expression Reduces Susceptibility to Erwinia amylovora. Mol Plant Microbe Interact. 2019;32:167\u0026ndash;75. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1094/MPMI-05-18-0120-R\u003c/span\u003e\u003cspan address=\"10.1094/MPMI-05-18-0120-R\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan H, Ren L, Meng X, Song T, Meng K, Yu Y. Proteome-level investigation of Cucumis sativus-derived resistance to Sphaerotheca fuliginea. Acta Physiol Plant. 2014;36:1781\u0026ndash;91. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11738-014-1552-6\u003c/span\u003e\u003cspan address=\"10.1007/s11738-014-1552-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Apple proliferation, plant defense, RNA-seq, SAP11","lastPublishedDoi":"10.21203/rs.3.rs-3821494/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3821494/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground:\u003c/strong\u003e '\u003cem\u003eCandidatus\u003c/em\u003e Phytoplasma mali', the causal agent of apple proliferation disease, exerts influence on its host plant through various effector proteins, including SAP11\u003csub\u003eCaPm\u003c/sub\u003e which interacts with different TCP transcription factors. This study examines the transcriptional response of the plant upon early expression of \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e. For that purpose, leaves of \u003cem\u003eNicotiana occidentalis\u003c/em\u003e H.-M. Wheeler\u003cem\u003e \u003c/em\u003ewere Agrobacterium-infiltrated to induce transient expression of \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e and changes in the transcriptome were recorded until 5 days post infection.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e The analysis revealed that presence of SAP11\u003csub\u003eCaPm\u003c/sub\u003e in leaves leads to downregulation of genes involved in defense response and related to photosynthetic processes, while expression of genes involved in metabolic pathways was enhanced.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions:\u003c/strong\u003e The results indicate that early \u003cem\u003eSAP11\u003c/em\u003e\u003csub\u003e\u003cem\u003eCaPm\u003c/em\u003e\u003c/sub\u003e expression might be important for the colonization of the host plant since phytoplasmas lack many metabolic genes and are thus dependent on metabolites from their host plant.\u003c/p\u003e","manuscriptTitle":"'Candidatus Phytoplasma mali' SAP11-Like protein modulates expression of genes involved in metabolic pathways, photosynthesis, and defense in Nicotiana occidentalis leaves.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-08 06:34:20","doi":"10.21203/rs.3.rs-3821494/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-02-27T13:42:51+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-02-23T16:39:58+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"1549f935-1e2e-4fd5-af48-87b503ba99da","date":"2024-02-14T16:50:33+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-01-14T15:04:06+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"811c33da-65be-40cd-b8da-63f5685aa5f2","date":"2024-01-08T02:33:15+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"027fb05c-d358-4b5c-ae3d-23aa97537e90","date":"2024-01-06T11:41:14+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-01-05T10:30:57+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-05T09:37:50+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-05T09:37:13+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Plant Biology","date":"2023-12-29T13:54:39+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-plant-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"pbio","sideBox":"Learn more about [BMC Plant Biology](http://bmcplantbiol.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/pbio/default.aspx","title":"BMC Plant Biology","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"57b6243f-d4f9-4142-b164-160caa574457","owner":[],"postedDate":"January 8th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2024-04-30T17:37:58+00:00","versionOfRecord":[],"versionCreatedAt":"2024-01-08 06:34:20","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-3821494","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3821494","identity":"rs-3821494","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00