Anti-hyperalgesic effects of photobiomodulation therapy (904 nm) on streptozotocin-induced diabetic neuropathy: A role for MAPK pathway and calcium dynamics

Anti-hyperalgesic effects of photobiomodulation therapy (904 nm) on streptozotocin-induced diabetic neuropathy: A role for MAPK pathway and calcium dynamics | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Anti-hyperalgesic effects of photobiomodulation therapy (904 nm) on streptozotocin-induced diabetic neuropathy: A role for MAPK pathway and calcium dynamics Willians Fernando Vieira, Kauê Franco Malange, Silviane Fernandes de Magalhães, and 7 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-1612307/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Several recent studies have established the efficacy of photobiomodulation therapy (PBMT) in painful clinical conditions. Diabetic neuropathy (DN) can be related to activating mitogen-activated protein kinases (MAPK), such as p38, in the peripheral nerve. MAPK pathway is activated in response to extracellular stimuli, including interleukins TNF-α and IL-1β. We verified the pain relief potential of PBMT in streptozotocin (STZ)-induced diabetic neuropathic rats and its influence on the MAPK pathway regulation and calcium (Ca 2+ ) dynamics. We then observed that PBMT applied to the L4-L5 dorsal root ganglion (DRG) region reduced the intensity of hyperalgesia, decreased TNF-α and IL-1β levels, and p38-MAPK mRNA expression in DRG of diabetic neuropathic rats. DN induced the activation of phosphorylated p38 (p-38) MAPK co-localized with TRPV1 + neurons; PBMT partially prevented p-38 activation. DN was related to an increase of p38-MAPK expression due to proinflammatory interleukins, and the PBMT (904 nm) treatment counteracted this condition. Also, the sensitization of DRG-neurons by the hyperglycemic condition demonstrated during the Ca 2+ dynamics was reduced by PBMT, contributing to its anti-hyperalgesic effects. photophysical and photochemical therapy low-level laser gallium-arsenide CatWalk system dorsal root ganglion Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Introduction Diabetes can damage the peripheral nervous system (PNS) in various ways, and diabetic neuropathy (DN) is one of the most common complications of untreated diabetes 1 . DN is a chronic complex disorder that affects the peripheral nerves, causing a painful condition involving superior and inferior limbs 1 – 4 with an incidence rate of about 70% of diabetic patients 5 , 6 . The mechanism by which hyperglycemia leads to peripheral nerve injury is not very clear, but it is known that several metabolic pathways are affected 7 . The main events involve the polyol pathway, through the aldose reductase (AR) activation 8 – 11 , the protein glycosylation, and the advanced glycation end-products (AGEs) production 10 , 12 , 13 . In addition, the formation of free radicals linked to oxidative stress 14 , 15 , the reduced neurotrophic support 16 , 17 , and the increased protein kinase C activation (PKC) 9 , 18 contribute to the peripheral damage. As a result of the metabolic imbalance, the mitochondrial failure 10 , 19 , 20 and inflammatory processes are also frequent and related to the phosphorylation of mitogen-activated protein kinases (MAPKs) 21 – 25 . MAPK is a family of serine/threonine protein kinases responsible for transducing extracellular stimuli into intracellular posttranslational and transcriptional responses 26 – 28 . It comprises p38-MAPK, extracellular signal-regulated protein kinase (ERK1/2), and c-Jun N-terminal kinase/stress-activated protein kinase (SAPK/JNK) 29 . The three main subfamilies of MAPK (p38, ERK1/2, and JNK) coordinate several functions: gene transcription, protein synthesis, cell cycle, proliferation, differentiation, and apoptosis 30 – 33 . MAPK pathway can be activated by extracellular stimuli, such as proinflammatory cytokines 34 – 36 and oxidative stress 30 , 37 , and its function is also influenced by several parallel pathways, including Ca 2+ dynamics 38,39 . Rosen et al. (1994) 39 demonstrated that membrane depolarization of PC12 cells leads to calcium influx through L-type calcium channels and activates the dual-specificity MAPK kinase MEK1, which phosphorylates and activates MAPK. Inline, hyperglycemia seems to be one of the factors which could stimulate the MAPKs phosphorylation 40 , 41 , once the activation of p38 has been seen in peripheral sensory neurons of diabetic rats 42 , specifically in the dorsal root ganglia (DRG) 43 – 46 . Similarly, the phosphorylation of JNK leads to apoptosis of hyperglycemia-stressed neurons via activation of caspase-3 22,47−49 . Furthermore, in chronic pain, MAPK signaling stimulates the transient receptor potential vanilloid subtype 1 (TRPV1) expression, a highly Ca2+-permeable channel50, thus implicating several diabetes complications, including thermal hyperalgesia 51 . Owing to the complexity of the metabolic alterations observed in DN, there are several pharmacological targets for treating the painful condition, but with low efficacy. Most patients refer to some relief of the symptoms, but it regresses over time, even before treatment ends 52 . Characterized as an athermal process, photobiomodulation therapy (PBMT) involves activating specific cellular chromophores, especially red and infrared lights, such as the cytochrome c oxidase (CCO; mitochondrial complex IV) 53 . This process is triggered by photophysical and photochemical reactions inside the cells when the Light crosses the cell membrane 54 – 56 , causing the modulation of specific pathways related to cellular survival, the increase in adenosine triphosphate (ATP), oxygen production, and nitric oxide (NO) release, for example 57 . The resultant "photobiomodulation process" can be used as a therapy to treat some painful conditions 58 – 65 , including DN, at least partly, as observed in a previous study conducted by our group 66 . Based on that, this study aimed to analyze the anti-hyperalgesic effects of PBMT (904 nm) on streptozotocin (STZ)-induced diabetic neuropathy, considering the possible role of MAPK pathway in the course of the disease and as a target for the PBMT. Results And Discussion PBMT did not alter the metabolic parameters linked to STZ-induced type-1 diabetes since the clinical signals of type-1 diabetes (hyperglycemia, weight loss, polyuria, polydipsia, and polyphagia) in the STZ-PBMT group remained equal to those of untreated STZ group . Type-1 diabetes induction protocol through low doses of STZ (five low doses, a single dose of 25 mg/kg per day) was suitable for installing irreversible hyperglycemia. All rats submitted to STZ injections (STZ and STZ + PBMT groups) became hyperglycemic (≥ 250 mg/dL of blood glucose concentration; 349.07 ± 48.23 mg/dL) after five STZ-low doses, reaching the threshold for diabetes between the fourth and fifth days (Fig. 1 , panels A and B). Diabetic rats also presented other characteristic metabolic alterations, such as polyuria, polyphagia, and polydipsia (data not shown), and stopped gaining weight with a slight loss (in grams) throughout the experimental period (Fig. 1 , panel C). STZ is a diabetogenic antibiotic known for its selective capacity to kill the pancreatic beta cells (β-cells), commonly used for type-1 diabetes induction in animal models 67 – 70 . STZ is taken up by the β-cells glucose transporter GLUT2 and triggers immune mechanisms 68 , 69 . According to Wang and Gleichmann (1995; 1998) 68 , 69 , STZ restricts GLUT2 expression in vivo and in vitro when administered through multiple low-doses protocol, which is a method for producing fewer STZ side effects, such as neurotoxicity. In general, rats submitted to STZ injections show deficits in insulin production, leading to hyperglycemia and, consequently, polydipsia and polyuria 70 . All those diabetes signals were observed in rats submitted to the low doses STZ protocol (STZ and STZ + PBMT groups), which characterizes a reproducible model of diabetes induction, as shown in previous studies from our group 66,71−74 . Diabetic rats, submitted or not to PBMT (STZ + PBMT and STZ groups, respectively), showed similar levels of hyperglycemia on days 21, 24, and 28 of the experimental protocol (454.94 ± 37.10 mg/dL). The same was observed regarding the rats' weight, once this parameter was only dependent on the diabetic condition and not on the laser treatment. In like manner, PBMT did not cause any influence over healthy rats (control, non-diabetic and non-hyperalgesic; SCB + PBMT group), as shown in Fig. 1 (panels B and C). Our results using NIR light (904 nm; 70 mW; 2.03 J; 29 s) corroborate with the study performed by Peplow and colleagues (2012) 75 , in which PBMT (660 nm; 100 mW; 4.7–6.3 J/cm²; 20 s) applied for wound healing in diabetic patients, showed no interference neither on hyperglycemia nor on patients' metabolic status. PBMT leads to an anti-hyperalgesic effect against the DN mechanical hyperalgesia induced by low doses STZ, which was unrelated to a putative influence of PBMT in the metabolic and clinical signals type-1 diabetes, as shown above. PBMT reduced the STZ-induced diabetic hyperalgesia . The data reproduced previous results obtained from our research group 66 . On the 21st day (after the first PBMT session), there was no reduction in the mechanical hyperalgesia intensity (Δ withdrawal threshold, g). However, on the 24th and 28th days, a time-significant reduction (p < 0.01 and p < 0.001, respectively) was observed in the intensity of hyperalgesia of STZ + PBMT group when compared to STZ group, characterizing an anti-hyperalgesic effect promoted by PBMT. Nonetheless, when PBMT was applied to control rats (SCB + PBMT), there was no change in the mechanical withdrawal thresholds in a similar condition observed in SCB (vehicle) and naïve groups, as shown in Fig. 1 (panels D and E; the latest in detail for the PBMT period). PBMT has long been used for the clinical treatment of neuropathic pain showing satisfactory results 76 , 77 , but its analgesic mechanisms are not entirely understood. The inhibition of the neuronal hyperactivity by the infrared light seems to be one of the ways that PBMT acts directly over the neurons 78 , 79 , and consequently the pain. Holanda et al. (2016 and 2017) 52 , 80 suggested a neuromodulation effect once they showed that patients with back pain submitted to PBMT (808 nm; 100 mW; 8.4 J; 84 s; a single session) on L4-L5 levels presented a significant pain relief. This modulatory effect could be the key to regulating the neuronal activity severely affected by hyperglycemia to avoid painful sensibility. Motor function dysfunction related to DN and detected by CatWalk system was amended by PBMT, likely due to PBMT anti-hyperalgesic property. Our analysis was based on a previous study identifying dynamic motor function alterations related to STZ-induced DN 74 . The results showed that PBMT was able to improve the Maximum Contact Area (cm²) and the Print Area (cm²) (Fig. 2 , panels A and B, respectively) of the rats' hind paws after 4 (24th day) and 8 (28th day) laser irradiation sessions, likely suggesting analgesia amelioration ought to improvement of nerve conduction. Statistical differences were observed between STZ + PBMT and STZ groups in such periods. No difference was observed for the Stride Length (cm) parameter (Fig. 2 , panel C), except between both neuropathic groups (STZ and STZ + PBMT) vs. control groups (Naïve, SCB, and SCB + PBMT). Areas of the digits and plantar pad (glabrous) appeared well delimited in the footprints of the right hind paw (RH) from rats of the STZ + PBMT group on days 24th and 28th (Fig. 2 , panel D: e), which were similar to the observed in Naïve and SCB groups (Fig. 2 , panel D: a, b, d), thus differing from the STZ group (Fig. 2 , panel D: c). The latest showed a reduction in the contact area with a low resolution of the footprints on the 28th day. According to Zochodne et al. (2008) 81 , non-controlled diabetes leads to damage of sensory neurons before the involvement of the motor ones. DN is associated with postural changes in this process, involving the alteration of foot positioning during gait 82 and alterations in pressure applied throughout the stand phase 83 , 84 . Vieira et al. (2020) 74 demonstrated that Maximum Intensity (a. u.) was the main parameter to demonstrate alteration on the 14th day after starting STZ injections, which corroborates the data obtained by Benitez et al. (2015) 84 . Diabetic animals (STZ group), which presented significant changes in the mechanical threshold on the 14th day, as observed in the electronic von Frey test results for mechanical hyperalgesia, applied less pressure during the paws' contact with the glass floor of the CatWalk XT system. These findings follow the pattern of sensory changes in DN, also known as "stocking-and-glove," which occurs as a sensory disorder of the extremities of limbs, compromising functionality 85 , 86 . Few studies evaluated the influence of PBMT on motor parameters in animal models, primarily when the CatWalk XT system was used. Vieira and colleagues (2016) 60 analyzed the influence of low-level laser therapy (LLLT) using the GaAs laser (904 nm; 4 J/cm²) on motor changes resulting from snake venom-induced myonecrosis. At 3 h after the venom injection, mice presented a semi-inflected posture of the right hind limb. When PBMT was performed, for the same period (3 h), animals presented values of Maximum Intensity (u. a.), Stand (s), and Balance (s) similar to control. The semi-flexion posture could represent a protective reflex to a painful stimulus. In the DN model, rats did not present a hind limb semi-flexion; however, they applied less pressure (represented by less intensity and smaller paw contact area) during gait. In this sense, PBMT could normalize part of the altered gait we observed in DN, which may be related to the anti-hyperalgesic effect promoted by light therapy. Altogether, we suggest that type-1 diabetes-derived neuropathic pain likely results from impairment in sensory and motor neurons. PBMT was able to reduce the levels of cytokines. To further investigate whether the anti-hyperalgesic effect promoted by PBMT could be linked to reducing the DN-associated cytokines, we studied the concentration of TNF-α, IL-1β, IL-6, and CINC-1 by ELISA immunoassay. DRG from diabetic neuropathic rats, PBMT-untreated (STZ group), showed increased concentrations of IL-1β and IL-10 (Fig. 3 , panels B and E); levels of TNF-α, IL-6, and CINC-1 showed no alterations regarding the DN setting (Fig. 3 , panels A, C, and D), but presented alterations when the groups were exposed to PBMT (Fig. 3 , panels A, C, and D). Specifically, there was a significant increase in IL-1β in the STZ group compared to all the other groups (p < 0.05), especially in the STZ + PBMT group (p < 0.05), as shown in Fig. 3 (panel B). As for IL-1β, the levels of IL-10 (an anti-inflammatory cytokine) showed increased levels in the STZ group but not in the controls or the STZ + PBMT group (p < 0.05) (Fig. 3 , panel E). Differently, levels of TNF-α showed no alterations caused by the diabetic neuropathy (STZ group), which were the same for control groups, except for STZ + PBMT group, which showed a significant reduction (p < 0.01) in the concentration of TNF-α, compared to STZ (without PBMT) (Fig. 3 , panel A). CINC-1 concentrations reduced significantly (p < 0.05) only for the SCB + PBMT group (One-way ANOVA followed by Bonferroni post- hoc test) (Fig. 3 , panel D). As reported by Hsieh and collaborators (2012) 87 , PBMT (660 nm; 30 mW; 9 J/cm²; 60 s; 7 consecutive days; 63 J/cm² cumulative energy density) applied for the treatment of chronic pain induced by sciatic nerve constriction, caused a reduction in the concentration of proinflammatory cytokines, such as TNF-α, IL-1β, and HIF-1α (hypoxia-inducible factor-1α), corroborating our results. The same reduction in TNF-α levels promoted by PBMT (950 nm; 2.5 J/cm 2 ; 32 s; 15 consecutive days; 37.5 J/cm² cumulative energy density) was observed in a mice model of sciatic nerve crush injury, reported by Cidral-Filho et al. (2013) 88 . These shreds of evidence bring the discussion on the high anti-inflammatory capacity exhibited by PBMT. In this regard, the anti-inflammatory effects promoted by PBMT were previously observed in carrageenan-induced inflammation in rats' paws, in which both 660 nm and 684 nm low-level lasers (30 mW; 7.5 J/cm²; 196 s; a single point) reduced the edema formation and inflammatory cell migration at 4 h after carrageenan injections 89 . Inflammatory cytokines can activate diverse cell membrane receptors, thus transmitting environmental signals, and in several cell lines, activation of G-protein-coupled-receptors (GPCRs) and receptor tyrosine kinases (RTKs) activate MAPKs (for review, see Kholodenko, 2012) 90 . MAPK cascades signaling are evolutionarily conserved pathways related to the intracellular signal transduction in response to various extracellular stimuli (for review, see Plotnikov et al., 2011) 91 . MAPK controls many cellular processes, such as growth, proliferation, differentiation, motility, stress response, survival, and apoptosis 92 . All three groups of MAPK (p38; ERK1/2; JNK) can be activated by osmotic perturbations derived from glucose, polyol pathway, oxidative stress, and advanced glycation end products (AGE) 93 . These events are highly involved in the etiology of the DN 1 . PBMT reverses the STZ-increased of p38 MAPK gene- and protein expression. To examine a possible interaction between the inflammation and MAP kinases, we further assessed MAPKs gene- and protein expression in L4-L5 DRG, once these molecular targets are supposed to be altered in DN, due to a condition imposed by the uncontrolled diabetes 93 . Before the Real-Time quantitative PCR experiments, primers for target- (p38, ERK1/2, and JNK) and housekeeping genes (endogenous control, Arfgef1, and Serpinb6) were tested for their efficacy by the standard curve construction. It was done through serial dilutions of naïve cDNA (1:4; 1:8; 1:16; 1:32; 1:64) and a fixed primer concentration (100 nM). High efficiency was observed for all tested primers, including the endogenous controls (99.9; r² 0.98) (data not shown). Then, the expression of target genes was normalized by the mean values of Ct (cycle threshold) from a pool of Arfgef1 and Serpinb6 gene expression. It was observed a significant increase in the expression of p38 mRNA in the STZ group compared to Naïve and SCB (vehicle) (p < 0.01) and SCB + PBMT groups (p < 0.001; unpaired t-test ). In addition, p38 mRNA expression in the hyperalgesic group (STZ) was significantly higher in comparison to the laser-exposed one (STZ + PBMT) (p < 0.05; unpaired Student t-test ), as shown in Fig. 4 , panel A. Slight differences between the groups regarding ERK1/2 and JNK mRNA expression were not significant (Fig. 4 , panels B and C). The immunofluorescence experiments also found a higher increase in the expression of activated MAPK, especially p-p38, in the STZ group (Fig. 5 , panels H and I). The fluorescence regarding p-38 phosphorylation in the hyperalgesic rats was reduced by the PBMT treatment, as shown in the STZ + PBMT group, in which there was some p-38 activation but in a lower number of neurons in comparison to STZ group (Fig. 5 , panels K and L). For both STZ and STZ + PBMT groups, the activation of p38 was highly concentrated in the nuclei of the DRG afferent neurons, as shown by DAPI co-staining (Fig. 5 , panels I and L in detail). Besides the lower number of p-p38 positive neurons in the STZ + PBMT group, it was also possible to observe as another difference in comparison to the STZ group a higher intensity of fluorescence (represented by green) scattered in neurons cytoplasm with some vesicle-like conformations (Fig. 5 , panels K and L in detail). Also corroborating gene expression results, low phosphorylation of ERK1/2 protein was detected. However, for both laser-treated groups (SCB + PBMT and STZ + PBMT; Fig. 6 , panels E and K, respectively), the levels of fluorescence-related p-ERK1/2 activation were even lower in comparison to the non-irradiated groups (SCB and STZ; Fig. 6 , panels B and H, respectively). An interesting observation regarding the STZ + PBMT group is the presence of p-ERK1/2 accrued in the vicinity of the plasma membrane, as shown in Fig. 6 (panels K and L in detail). In line with the low phosphorylation of ERK1/2 for SCB + PBMT and STZ + PBMT groups, a very low fluorescence intensity regarding p-JNK staining was observed in such irradiated groups (Fig. 7 , panels E and K, respectively). For SCB and STZ groups, there was a basal expression of p-JNK, as observed in a diffused way in the cytoplasm, as shown in Fig. 7 (panels B and H, respectively). Studies have shown that MAPK activation is linked to allodynia and hyperalgesia in different disease conditions 94 – 96 . p38-MAPK, the most studied member of MAPK family, is typically activated by extracellular stress and proinflammatory cytokines, with a prominent role in the inflammatory process once there is a significant reduction in inflammation after the systemic administration of p38 pharmacological inhibitor 97 . A study of 8-12-week STZ-administered rats showed activation of all the main MAPKs (p38; JNK; ERK1/2) in L4-L5 DRG, although with delayed activation of JNK, relative to p38 and ERK1/2 41 . It is well known that TNF-α and IL-1β play a key role in developing and maintaining pain after peripheral nerve injury 98 . Consequently, as p38 regulates TNF-α and IL-1β biosynthesis, both reductions culminate in anti-inflammatory effects with a positive reflex in analgesia 99 . Therefore, our data showed that PBMT, which can be considered a photophysical and photochemical effector of cell events, promoted a reduction in the concentrations of TNF-α and IL-1β, associated with less activation (phosphorylation) of p38, which can help explain the analgesic effect of the therapy. p38 has several proinflammatory roles, and systemically administered p38 inhibitors produce anti-inflammatory effects by reducing the synthesis of TNF-α and IL-1β, as well as COX-2 induction of inflammatory cells 28 , 99 . Hence, the pharmacological and/or non-pharmacological therapies that reduce the concentration of proinflammatory molecules might reduce the painful condition. The light modulation against MAPK activation caused by PBMT (He-Ne; 632.8 nm; 4.5 mW; 3 s each 1.8 mm x 1.8 mm square of the tissue-culture plate) was studied by Shefer and colleagues (2001) 100 in skeletal muscle cells, which showed increased levels of ERK1/2 under laser irradiation, and no effect over p38 and JNK expression. Aleksic and collaborators (2010) 101 also verified activation of ERK1/2 in osteoblast cell cultures submitted to laser irradiation (Er: YAG; 2.94 µm; fluence between 0.7–17.2 J/cm²), with no effect on p38 and JNK expression. According to Ji et al. (2002) 99 , p38 activation in the DRG is initiated by retrograde transport of nerve growth factor (NGF) release from inflamed tissue. It increases both the translation and the transport of TRPV1 (a polymodal receptor channel) to the peripheral nociceptor terminal, contributing to the maintenance of inflammatory heat pain hypersensitivity. In addition, p-p38 was found mainly in small neurons of the DRG, suggesting a higher activation in type-C sensory fibers. The p-p38 staining is co-localized to TRPV1 in DRG. Complementarily to the immunofluorescence staining of p-p38 in DRG, it was further analyzed whether its expression was involved in a particular type of nerve fibers, i.e., type-C fibers (small DRG neurons; unmyelinated; TRPV1 + ). It was found that TRPV1 + fibers in all experimental groups and most of the afferent neurons present in DRG sections were classified as type-C, with higher intensity of fluorescence and occurrence in the STZ and STZ + PBMT groups (Fig. 8 , panels K and O, respectively). The co-staining of p-p38 and TRPV1 + fibers was widely distributed (Fig. 8 , panels L and P, respectively), with a prevalence of TRPV1 + signal (red) over p-p38 (green) in the STZ + PBMT group, as shown in Fig. 8 (panel P, in detail). The relation between TRPV1 and MAPK is because TRPV1 leads to proliferation through Ca 2+ entry, ATP release, membrane P2Y2 purinergic receptor activation, and the transactivation of epidermal growth factor receptor (EGFR). Thus, the increase in [Ca 2+ ] i and the binding of ATP to P2Y2 upregulate the intracellular IP3 via phospholipase C (PLC). The upregulation of IP3 leads to the opening of store-operated channels (SOC), which causes Ca 2+ release from the endoplasmic reticulum (ER). The previous TRPV1-mediated EGFR transactivation prompts Ras/Raf/MAPK signaling (for review, see Zhai et al., 2020) 102 . TRPV1 is highly expressed in cutaneous nociceptive nerve endings 103 , being also easily exposed to sunlight and activated by ultraviolet (UV) light. Lee et al. (2009) 104 showed that UV light activates Ca 2+ influx and non-selective cationic current in immortalized human keratinocytes (HaCaT cells), and this activation was suppressed by capsazepine, a TRPV1 antagonist, thus showing an interaction between the Light and TRPV1 channels. In this sense, Wang et al. (2017) 105 showed that PBMT through a 980 nm laser device (3 J/cm²; continuous wave) induced a thermal effect and, consequently, the TRPV1 activation in adipose-derived stem cells. Different from our study, during in vitro studies, local increases in temperature of the cell membrane might be caused by laser irradiation, even using low-level devices. Our histological sections from DRG show activation of TRPV1 in diabetic hyperalgesic rats submitted to PBMT. However, further studies should be done to investigate better the involvement of TRPV1 in the anti-hyperalgesic effect of PBMT observed in our STZ-induced DN model. PBMT influenced Ca 2+ dynamics in DRG-cultured neurons. Inline, the activation of MAPK pathway and its modulation by PBMT seems to be related to the Ca 2+ dynamics in the DRG environment. An increase in the fluorescence intensity of FLUO-4 AM-stained DRG neurons was observed after the stimuli with 15 mM KCl and, especially, 50 mM KCl for all the groups (Fig. 9 , panel A). Remarkably, the increased fluorescence regarding the Δ[Ca 2+ ] i after a 15 mM KCl stimulus was mainly observed in neurons previously maintained in the hyperglycemic medium (High-glucose group) (Fig. 9 , panels B and C). DRG-neurons kept in hyperglycemic medium (55 mM glucose) and exposed to PBMT (High-glucose + PBMT group) showed significant (p < 0.001) less intensity of fluorescence during the 15 mM KCl stimulus in comparison to the High-glucose group (Fig. 9 , panels B and C). During the 50 mM KCl peak, which serves as a control for stimulating the Ca 2+ influx in responsive neurons, the main difference (p < 0.05) was observed between the fluorescence intensity of the Low-glucose group in comparison to the Low-glucose + PBMT group (Fig. 9 , panels D and E). When the 50 mM KCl stimulus ceased, the fluorescence intensity decreased in both hyperglycemic groups, although it did not return to basal levels (Fig. 9 , panels D and E). Beyond the fluorescence intensity (Δ[Ca 2+ ] i ) we also quantify the percentage (%) of 15 mM KCl-responsive cells concerning the total number of neurons responsive to 50 mM KCl (Fig. 9 , panel F). The percentage (%) of neurons that responded to the 15 mM KCl molarity concerning all responsive ones was higher in the hyperglycemic group in comparison to the normoglycemic (p < 0.001) and to the hyperglycemic + PBMT group (p < 0.05). This result suggests that a hyperglycemic medium (55 mM of glucose) sensitizes the DRG-neurons and that sensitization is reduced by the PBMT exposure, which represents one of the possible analgesic mechanisms of the therapy. Conclusion PBMT might represent a novel therapeutic approach for treating diabetic neuropathic hyperalgesia, based on its beneficial photophysical and photochemical effects against the functional, molecular and cellular alterations observed in such disease, ruled by MAPK pathway and calcium dynamics. Materials And Methods Ethics statement and animals . All experiments were approved by the institutional Committee for Ethics in Animal Use (CEUA/UNICAMP, permit number 5337-1/2019) and followed the ARRIVE guidelines. The experiments were also performed according to the Brazilian National Council for Animal Experimentation Control (CONCEA) and the Brazilian College of Animal Experimentation (COBEA) guidelines. Male Lewis rats (LEW/HsdUnib, Harlan, USA, 1996), 4-8-week-old, weighing 200-250 g, provided by the University's Multidisciplinary Center for Biological Research (CEMIB) were used. Rats were maintained in plastic cages with sawdust bedding (changed three times a week), in some four per cage, and received food (commercial chow for rodents) and filtered water ad libitum , in a temperature- and humidity-controlled room under 12/12 h dark/light cycle. Rats were randomly divided into five experimental groups, consisting of eight rats (n = 8) per group: Naïve (intact rats; received no injection and no PBMT); SCB (received five doses of vehicle, 0.1 M sodium citrate buffer, and no PBMT); STZ (received five doses of STZ, 25 mg/kg per dose, and no PBMT); SCB+PBMT (received five doses of the vehicle and were submitted to PBMT); STZ+PBMT (received five doses of STZ and were submitted to PBMT). All efforts were made to minimize the number of rats and their suffering. Type-1 diabetes was induction through multiple low-doses of streptozotocin (STZ). The type-1 diabetes induction was performed according to previous studies performed by our group 66,71-74 , consisting in a low dose of streptozotocin (25 mg/kg) [STZ; N-(Methylnitrosocarbamoyl)-α-D-glucosamine; Sigma-Aldrich ® , St. Louis, MO, USA)], diluted in the vehicle (0.1 M sodium citrate buffer (pH 4.5)) intraperitoneally (i. p.) administered once a day, during five consecutive days (STZ and STZ+PBMT groups). The same volume of vehicle was injected daily in control animals (SCB and SCB+PBMT groups), ranging from 50 to 62.5 µL, according to rats' weight. Blood glucose measurements from the tail vein were performed with an Accu-Chek ® Sensor Comfort (Roche Diagnostics ® , Germany). The development of hyperglycemia and the rats' body mass were monitored on days 0, 7, 14, 21, 24, and 28 after starting the STZ or vehicle injections. The electronic von Frey test. The hyperalgesia was measured through the mechanical withdrawal thresholds that were determined by applying the electronic von Frey test (Insight ® , Ribeirão Preto, SP, Brazil) with a polypropylene pipette tip adapted to a hand-held force transducer with crescent pressure in the plantar surface of the right and left rats' hind paws. The equipment automatically transduces the pressure applied to the paw mid-plantar surface into gram-force (g) once the paw is withdrawn. Rats were randomly placed into individual plastic cages with a metal mesh floor, followed by 30 minutes of acclimatization before the test. Electronic von Frey tests were applied to all experimental groups at 0, 7, 14, 21, 24, and 28 days after starting the STZ or vehicle injections, always in the mid-morning period, by a blind examiner to the groups and treatment. For the STZ+PBMT group, an additional analysis was done 19 days after starting the STZ injections to select only hyperalgesic rats for the PBMT exposure. CatWalk dynamic motor function analysis. CatWalk walking track test (Noldus Inc., Wageningen, Netherlands) consists of an illuminated walkway glass floor with a high-speed video camera (Gevicam GP-3360; GEViCAM Inc., Milpitas, CA, USA) equipped with a wide-angle lens (6.0 mm; DF6HA-1B, Fujinon Corp., China). The camera was positioned underneath the walkway at 56 cm, and the CatWalkTM XT 10.6 software automatically recorded the paw prints as the animal crossed the pathway in a calibrated 20 x 10 cm length lane. The green LED plus a red-illuminated background creates a contrast in the glass floor according to animal steps. CatWalk XT configurations were set up according to the parameters used by Vieira et al. (2020) 74 . For the current study we considered the average between the hind paws [right hind paw (RH) and left hind paw (LH)] regarding the Maximum Contact Area (cm²), Print Area (cm²), and the Stride Length (cm), which were analyzed at 0, 7, 14, 21, 24, and 28 days after starting STZ or vehicle injections, always in the afternoon with the room lights switched off. Each rat performed 3 runs every analysis period, thus completing 24 runs per group per period. Photobiomodulation therapy through low-level laser irradiation (904 nm). Rats from SCB+PBMT and STZ+PBMT groups were submitted to low-level laser irradiation for eight days (from the 21 st to the 28 th day after STZ or vehicle injections), once a day, always in the morning. For the STZ+PBMT group, only hyperalgesic rats were considered to receive the laser treatment; once in our diabetic neuropathy model, about 20 % of the rats receiving STZ injections did not become hyperalgesic (data not shown). PBMT through low-level laser irradiation was performed with an Endophoton LLT1307 (KLD Biosistemas Equip. Elet. Ltda ® , Amparo, SP, Brazil) class IIIB laser device. Rats were anesthetized with Isoflurane (3 %) (Cristália ® , Itapira, SP, Brazil), and the laser irradiation was applied directly on the rat dorsal shaved skin a single point between L4-L5 spine levels, bilaterally. Laser parameters are described in Table 1. Table 1. PBMT parameters. Laser Wavelength Power Output Irradiance GaAs 904 nm 70 mW 0.001 cm² 7000 mW/cm² Emission Total energy Time Contact Treated area Continuous 2.03 J 29” per point Direct ~ 1.0 cm² GaAs = Gallium-Arsenide; nm = nanometers; mW = milliWatts; J = Joule; (”) = seconds; cm² = square centimeters; mW/cm² = milliWatts per square centimeter. DRG collection, tissue preparation, and homogenization. For the analyses of inflammatory cytokines levels and MAPK gene expression, rats were anesthetized under Isoflurane (3 %) (Cristália ® ) and humanely euthanized. After dissection, L4 and L5 DRG were collected, snap-frozen in liquid nitrogen (-196.15 ºC), and stored at -80 ºC for posterior homogenization. To the DRG samples for ELISA immunoassays were added RIPA Lysis and Extraction Buffer (Thermo Scientific TM , Waltham, MA, USA), containing sodium orthovanadate, protease inhibitor, and PMSF (phenylmethanesulfonyl fluoride) (Thermo Scientific TM ). Samples were placed in a FastPrep ® homogenizer (MP Biomedicals TM , Santa Ana, CA, USA) and then were shaken at 4 ºC (5 x 20 seconds) between 5 minutes intervals. After that, homogenized DRG were kept under continuous agitation for 3 hours at 4 ºC and then centrifuged at 12,000 rpm for 15 minutes at 4 ºC. The resulting supernatant was transferred to a new tube. Protein concentrations were measured through the Bradford assay 106 . For MAPK gene expression through real-time RT-qPCR, DRG were fragmented and homogenized in TRIzol ® (Invitrogen Life Technologies TM , Carlsbad, CA, USA) (1 mL/mg) for isolating the total RNA, according to the manufacturer's instructions. To the homogenate were added 0.2 mL of chloroform (Sigma-Aldrich ® ), and after 3 minutes of resting at room temperature, it was centrifuged at 12,000 rpm for 15 minutes at 4 ºC. The aqueous phase was transferred to a new tube, in which 0.5 mL of isopropanol was added. After new centrifugation, the pellet was washed with 75 % ethanol, and the total RNA was resuspended in UltraPure TM DEPC-treated water (Thermo Scientific TM ). Total DRG RNA was quantified using an ultra-low-volume spectrophotometer (Epoch Microplate Spectrometer, BioTek Instruments Inc., Winooski, VT, USA). For DRG immunofluorescence, rats were anesthetized with ketamine (85 mg/kg, i. p.) and xylazine (10 mg/kg, i. p.) and then exsanguinated via cardiac perfusion (through the ascending aorta) with saline solution (0.9 % NaCl, 200 mL). After exsanguination, rats were perfused with 4 % paraformaldehyde (PFA, pH 7.4, 4 ºC, 300 mL). After finishing the perfusion, L4 and L5 DRG were collected and post-fixed in 4 % PFA overnight at 4 ºC, followed by 48 h in 30 % sucrose at 4 ºC. Individual DRG were embedded in Tissue-Tek ® O.C.T. compound (Sakura ® Finetek, CA, USA), and 14 µm non-serial sections were made on a cryostat (Leica Biosystems, Wetzlar, Germany) using gelatinized slides. ELISA immunoassay for measuring the cytokines concentrations (IL-1β, TNF-α, IL-6, CINC-1 and IL-10). The levels of pro- (IL-1β, TNF-α, IL-6, and CINC-1) and anti-inflammatory (IL-10) cytokines were measured by enzyme-linked immunosorbent assay (ELISA). For IL-1β, TNF-α, IL-6, and CINC-1 were used 96-well-plates through the DuoSet ® ELISA kit (R&D Systems, Minneapolis, MN, USA), and the results were expressed in picograms per milliliter (pg/mL). For the IL-10, concentrations were measured through the RayBio ® Rat IL-10 ELISA kit (#ELR-IL10) (RayBiotech, Peachtree Corners, GA, USA), and the results were expressed in picograms per milliliter per milligram (pg/mL/mg) of tissue. The manufacturer's instructions were followed for both ELISA immunoassay kits. The absorbance was determined at 450 nm using an Asys UVM 340 microplate reader (Biochrom Ltd., Cambridge, UK), and the results were obtained by comparing the optical density to the standard-curve densities. Real-time quantitative RT-PCR for MAPK gene expression. 500 ng of total RNA extracted from L4 and L5 DRG were subjected to cDNA synthesis (SuperScript TM VILO TM cDNA Synthesis Kit, Invitrogen Life Technologies TM ) according to the manufacturer's protocol. Specific primers for p38-MAPK, ERK1/2, JNK, Arfgef1, and Serpinb6 genes were designed with the " Pick Primers ," available on NCBI/Primer-blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast) and synthesized commercially. The amplicons were set to less than 200 base pairs, and dimers, cross-dimers, and hairpins were eliminated during primers design (or were kept to a minimum). Primer sequences are described in Table 2. The annealing temperature was set at 60 ºC, and the GC (guanine-cytosine) content was 50-55 %. Table 2 . 5'-3'gene sequences. Gene Sequence GenBank p38 (#) FW: GGCTGACATAATCCACAGGG NM_031020.2 RV: CCGGTCATTTCGTCATCAGT ERK1/2 (#) FW: TGTGTTCAGCTCAGACTTCC NM_133283.1 RV: CGTTTGATGAAGGCATGGTT JNK (#) FW: TGCTACTTGCCAATCCCATC NM_053829.2 RV: AGATAACAGGGTGTCCGCTA Arfgef1 (*) FW: CAACAGGTTTAAAGCTCACGCA NM_001277056.1 RV: TCCTGTTCAGGTGGTTGTGA Serpinb6 (*) FW: GAGTCTAGGGTACGTTCTGCTG NM_199085.2 RV: TCCATGATGGTGAACCTGCCC (#) target genes; (*) housekeeping; FW = forward; RV = reverse. The 2 −ΔΔCt method 107 performed relative gene expression analysis to an internal control index. The reactions were carried out at the StepOne Plus Real-Time PCR (Applied Biosystems, Foster City, CA, USA) using SYBR Green as a fluorescent signal (Power SYBR™ Green PCR Master Mix, Applied Biosystems, USA) and 1:10 of the obtained cDNA from each sample. DRG immunofluorescence for detection of phosphorylated MAPKs. DRG sections were incubated in 0.1 M glycine for 30 minutes, followed by a blockage with 2 % bovine serum albumin (BSA) and permeabilization in 0.2 % Triton X-100 for 1 hour at room temperature. For anti-phospho-p44/42 MAPK (ERK 1/2) and anti-phospho-SAPK/JNK, an additional step was done before the 2 % BSA blocking, consisting of methanol 100 % permeabilization at -20 ºC. Then, sections were incubated in 0.1 M PBS plus 0.1 % Triton-100 and 1 % BSA overnight in a humid atmosphere at 4 ºC with the specific primary antibodies. The following antibodies were used: anti-phospho-p38 MAPK (Thr180/Tyr182) (D3F9) XP ® Rabbit mAb (1:500); anti-phospho-p44/42 MAPK (ERK 1/2) (Thr202/Tyr204) (D13.14.4E) XP ® Rabbit mAb (1:200); and anti-phospho-SAPK/JNK (Th183/Tyr185) (G9) Mouse mAb (1:400), all from Cell Signaling Technology ® (Danvers, MA, USA). After the incubation period, the sections were washed twice in the same incubation solution (without the antibodies) and then washed 5 times in 0.1 M PBS, 5 minutes each time. Sections were then incubated with the secondary antibodies (donkey anti-rabbit or anti-mouse Alexa 488, 1:1000, #A21206, Thermo Fisher) diluted in the same primary antibody solution for 1 hour at room temperature. After incubation, DRG sections were washed with 0.1 M PBS five times for 5 minutes. Nuclei were stained with 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI, 0.25 µg/mL, D9542, Sigma–Aldrich) diluted in 0.1 M PBS, for 10 minutes at room temperature. After confirming the positive fluorescence, the final images were obtained in a Zeiss Axio Observer Z1 LSM780-NLO (Carl Zeiss AG, Oberkochen, Germany) confocal laser-scanning microscope, with the aid of the EC Plan-Neofluar 20x/0.50 Dry and EC Plan-Neofluar 40x/1.30 Oil DIC objective lens, in the National Institute of Science and Photonics Technology Applied to Cellular Biology (INFABiC/UNICAMP, Campinas, SP, Brazil). Thus, the sections were coverslipped using Vectashield® (Vector Laboratories, Burlingame, CA, USA). Negative controls were prepared without incubation in primary antibodies to confirm that there was no non-specific binding of the secondary antibodies. Sections were first examined in an epifluorescence inverted Leica DMI 600B microscope coupled with a DFC360FX camera and a Leica fluorescent Light source CTR7000HS (Leica Microsystems). DRG primary cell culture. Primary cell culture of DRG neurons was performed according to the protocol described by Linhart and colleagues (2003) 108 and modified by our research group as published by Manzo et al. (2017) 109 and do Prado et al. (2020) 73 . Healthy male Lewis rats (LEW/HsdUnib, Harlan, USA, 1996) were used for 4-weeks-old, weighing about 200 g. Rats were humanely euthanized under deep anesthesia (3 % Isoflurane; Cristália ® ) followed by decapitation. Sixteen to twenty thoracic and lumbar DRGs were collected and placed in Hank's Balanced Salt Solution (HBSS, containing 10 mM of HEPES). Then, cells were dissociated by incubation with HBSS containing 0.28 U/mL of collagenase type II for 60 minutes at 37 ºC followed by 6 minutes in 0.25 mg/mL trypsin. For inhibiting trypsin action, cells were washed twice in DMEM supplemented with fetal bovine serum (FBS; 10 %), 50 U/mL of penicillin, and 50 mg/mL of streptomycin. Mechanically-dissociated cells were plated on laminin and poly-D-lysine-coated coverslips and maintained at 37 ºC and 5 % CO 2 . All cell culture supplies were purchased from Sigma-Aldrich ® except FBS, which was purchased from Vitrocell Embriolife (Campinas, SP, Brazil). Calcium imaging. After completing 24 hours of incubation under normoglycemic (5.5 mM of glucose) or hyperglycemic (55 mM of glucose) cell medium, sensory DRG neurons were exposed to PBMT with the same parameters described in Table 1 but with indirect contact through the " swiping motion ," where the laser probe output was kept in a distance of 1 cm far from the cell medium. Immediately after the irradiation, DRG-cultured neurons were incubated in HBSS containing 10 µM of FLUO-4, AM, and 1 % PowerLoad (Thermo Fisher) for 40 minutes, protected from the Light at 37 ºC and 5 % CO 2 . Coverslips were inserted into a perfusion chamber (Warner Instruments, Holliston, MA, USA) and placed on an inverted Leica DMI 600B microscope coupled to a DFC360FX camera and a Leica fluorescent Light source CTR7000HS (480 nm excitation, 527/30 nm suppression filters) (Leica Microsystems). A computer-controlled valve system (Warner Instruments) was used for cell perfusion with different KCl molarities [5 mM (basal), 15 mM (partial), and 50 mM (maximum)], and the flow rate was set at 5 mL/minute (complete change of chamber volume every 2 seconds) 73,109 . Images were taken at the rate of one image per second, and the values of fluorescence intensity, Δ[Ca 2+ ] i , were normalized by ΔF/F0, where ΔF equals the final fluorescence (F) minus the basal fluorescence (F0). Data were also presented as the percentage of 15 mM KCl-responsive cells about the total number of cells responsive to 50 mM KCl, in four distinct situations: (i) when cells were incubated in low-glucose; (ii) low-glucose plus PBMT; (iii) high-glucose or (iv) high-glucose plus PBMT. Statistical analysis. For comparisons between groups and treatment time, we used Two-way ANOVA followed by Bonferroni post- hoc test. One-way ANOVA made other comparisons between three or more groups, followed by Bonferroni post- hoc test. For comparisons between only two groups, we used an unpaired Student t-test . p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***) were considered statistically significant. All statistical tests were performed on the GraphPad Prism ® software, versions 5 and 7. Numerical values were expressed as mean ± standard error of the mean (SEM). Declarations Compliance with ethical standards All experiments were approved by the institutional Committee for Ethics in Animal Use (CEUA/UNICAMP, permit number 5337-1/2019) and followed the ARRIVE guidelines. The experiments were also performed according to the Brazilian National Council for Animal Experimentation Control (CONCEA) and the Brazilian College of Animal Experimentation (COBEA) guidelines. Data availability The data that support the findings of this study are available upon request from the corresponding author [WFV]. Acknowledgments São Paulo Research Foundation financed this study (FAPESP) (Grants #2014/25153-7; #2015/12673-5; #2018/05108-8) and by Coordination for the Improvement of Higher Education Personnel (CAPES). We wish to thank the National Institute of Science and Photonics Technology Applied to Cellular Biology (INFABiC) for support on imaging acquisition; we also thank César Eduardo Bissoto for all technical support. Authors contributions WFV and CAP designed the study; WFV, KFM, SFM, JBPL, GGS, CMN carried out the experiments; WFV, ALRO, MACH, CHT, and CAP drafted the manuscript. All authors critically reviewed the manuscript and approved it for submission. Competing interests The authors declare they have no conflict of interest. References Feldman, E. L., Nave, K., Jensen, T. S. & Bennett, D. L. H. New horizons in diabetic neuropathy: mechanisms, bioenergetics, and pain. Neuron. 93 , 1296–1313 (2017). Callaghan, B. C., Cheng, H. T., Stables, C. L., Smith, A. L. & Feldman, E. L. Diabetic neuropathy: clinical manifestations and current treatments. Lancet Neurol. 11 , 521–534 (2012). Jensen, T. S. & Finnerup, N. B. Allodynia and hyperalgesia in neuropathic pain: clinical manifestations and mechanisms. Lancet Neurol. 13 , 924–935 (2014). Truini, A., Garcia-Larrea, L. & Cruccu, G. Reappraising neuropathic pain in humans — how symptoms help disclose mechanisms. Nat. Rev. Neurol. 9 , 572–582 (2013). Gandhi, R. A. & Selvarajah, D. Understanding and treating painful diabetic neuropathy: time for a paradigm shift. Diabet. Med. 32 , 771–777 (2015). Harris, K., Boland, C., Meade, L. & Battise, D. Adjunctive therapy for glucose control in patients with type 1 diabetes. Diabetes Metab. Syndr. Obes. 11 , 159–173 (2018). Yagihashi, S., Mizukami, H. & Sugimoto, K. Mechanism of diabetic neuropathy: Where are we now and where to go? J. Diabetes Investig. 2 , 18–32 (2011). Lee, A. Y. & Chung, S. S. Contributions of polyol pathway to oxidative stress in diabetic cataract. FASEB J. 13 , 23–30 (1999). Brownlee, M. Biochemistry and molecular cell biology of diabetic complications. Nature. 414 , 813–820 (2001). Yan, L-J. Pathogenesis of chronic hyperglycemia: from reductive stress to oxidative stress. J. Diabetes Res . 2014, 137919 (2014). Schreiber, A. K., Nones, C. F. M., Reis, R. C., Chichorro, J. G. & Cunha, J. M. Diabetic neuropathic pain: Physiopathology and treatment. World J Diabetes. 6 , 432–444 (2015). Thornalley, P. J. Glycation in diabetic neuropathy: characteristics, consequences, causes, and therapeutic options. Int. Rev. Neurobiol. 50 , 37–57 (2002). Juranek, J., Ray, R., Banach, M. & Rai, V. Receptor for advanced glycation end-products in neurodegenerative diseases a bad reputation. Rev. Neurosci. 26 , 691–698 (2015). Greene, D. A., Stevens, M. J., Obrosova, I. & Feldman, E. L. Glucose-induced oxidative stress and programmed cell death in diabetic neuropathy. Eur. J. Pharmacol. 375 , 217–223 (1999). Pop-Busui, R., Sima, A. & Stevens, M. Diabetic neuropathy and oxidative stress. Diabetes Metab. Res. Rev. 22 , 257–273 (2006). Ishii, D. N. & Lupien, S. B. Insulin-like growth factors protect against diabetic neuropathy: effects on sensory nerve regeneration in rats. J. Neurosci. Res. 40 , 138–144 (1995). Fernyhough, P. & Calcutt, N. A. Abnormal calcium homeostasis in peripheral neuropathies. Cell Calcium. 47 , 130–139 (2010). Koya, D., et al . Characterization of protein kinase C beta isoform activation on the gene expression of transforming growth factor-beta, extracellular matrix components, and prostanoids in the glomeruli of diabetic rats. J. Clin. Invest. 100 , 115–126 (1997). Akude, E., et al . Diminished superoxide generation is associated with respiratory chain dysfunction and changes in the mitochondrial proteome of sensory neurons from diabetic rats. Diabetes. 60 , 288–297 (2011). Chowdhury, S. K. R., et al . Mitochondrial respiratory chain dysfunction in dorsal root ganglia of streptozotocin-induced diabetic rats and its correction by insulin treatment. Diabetes. 59 , 1082–1091 (2010). Younger, D. S., Rosoklija, G., Hays, A. P., Trojaborg, W. & Latov, N. Diabetic peripheral neuropathy: a clinicopathologic and immunohistochemical analysis of sural nerve biopsies. Muscle Nerve. 19 , 722–727 (1996). Tomlinson, D. R. & Gardiner, N. J. Diabetic neuropathies: components of etiology. J. Peripher. Nerv. Syst. 13 , 112–121 (2008). Satoh, J., Yagihashi, S. & Toyota, T. The possible role of tumor necrosis factor-α in diabetic polyneuropathy. Exp. Diabesity Res. 4 , 65–71 (2003). Yamagishi, S-I., et al . Correction of protein kinase C activity and macrophage migration in peripheral nerve by pioglitazone, peroxisome proliferator activated-gamma-ligand, in insulin-deficient diabetic rats. J. Neurochem. 104 , 491–499 (2008). Du, Y., et al . Effects of p38 MAPK inhibition on early stages of diabetic retinopathy and sensory nerve function. Invest. Ophthalmol. Vis. Sci. 51 , 2158–2164 (2010). Seger, R. & Krebs, E. G. The MAPK signaling cascade. FASEB J. 9 , 726–735 (1995). Lewis, T. S., Shapiro, P. S. & Ahn, N. G. Signal transduction through MAP kinase cascades. Adv. Cancer Res. 74 , 49–139 (1993). Widmann, C., Gibson, S., Jarpe, M. B. & Johnson, G. L. Mitogen-activated protein kinase: conservation of a three-kinase module from yeast to human. Physiol. Rev. 79 , 143–180 (1999). Obata, K. & Noguchi, K. MAPK activation in nociceptive neurons and pain hypersensitivity. Life Sci. 74 , 2643–2653 (2004). Johnson, G. L. & Lapadat, R. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science. 298 , 1911–1912 (2002). Krishna, M. & Narang, H. The complexity of mitogen-activated protein kinases (MAPKs) made simple. Cell Mol. Life Sci. 65 , 3525–3544 (2008). Yang, S-H., Sharrocks, A. D. & Whitmarsh, A. J. Transcriptional regulation by the MAP kinase signaling cascades. Gene. 320 , 3–21 (2003). Bonny, C., Borsello, T. & Zine, A. Targeting the JNK pathway as a therapeutic protective strategy for nervous system diseases. Rev. Neurosci. 67 , 57–67 (2005). Tsuda, M., Ueno, H., Kataoka, A., Tozaki-Saitoh, H. & Inoue, K. Activation of dorsal horn microglia contributes to diabetes-induced tactile allodynia via extracellular signal-regulated protein kinase signaling. Glia. 56 , 378–386 (2008). Wodarski, R., Clark, A. K., Grist, J., Marchand, F. & Malcangio, M. Gabapentin reverses microglial activation in the spinal cord of streptozotocin-induced diabetic rats. Eur. J. Pain, 13 , 807–811 (2009). Manning, A. M. & Davis, R. J. Targeting JNK for therapeutic benefit: from junk to gold? Nat. Rev. Drug Discov. 2 , 554–565 (2003). Agell, N., Bachs, O., Rocamora, N. & Villalonga, P. Modulation of the Ras/Raf/MEK/ERK pathway by Ca(2+), and calmodulin. Cell Signal. 4 , 649–654 (2002). White, C. D. & Sacks, D. B. Regulation of MAP kinase signaling by calcium. Methods Mol. Biol. 661 , 151–165 (2010). Rosen, L. B., Ginty, D. D., Weber, M. J. & Greenberg, M. E. Membrane depolarization and calcium influx stimulate MEK and MAP kinase via activation of Ras. Neuron. 12 , 1207–1221 (1994). Purves, T., et al . A role for mitogen-activated protein kinases in the etiology of diabetic neuropathy. FASEB J. 15 , 2508–2514 (2001). Price, S. A., Agthong, S., Middlemas, A. B. & Tomlinson, D. R. Mitogen-activated protein kinase p38 mediates reduced nerve conduction velocity in experimental diabetic neuropathy: interactions with aldose reductase. Diabetes. 53 , 1851–1856 (2004). Tsuda, M., Mizokoshi, A., Shigemoto-Mogami, Y., Koizumi, S. & Inoue, K. Activation of p38 mitogen-activated protein kinase in spinal hyperactive microglia contributes to pain hypersensitivity following peripheral nerve injury. Glia. 45 , 89–95 (2004). Daulhac, L., et al . Diabetes-induced mechanical hyperalgesia involves spinal mitogen-activated protein kinase activation in neurons and microglia via N-methyl-D-aspartate-dependent mechanisms. Mol. Pharmacol. 70 , 1246–1254 (2006). Piao, Z. G., et al . Activation of glia and microglial p38 MAPK in medullary dorsal horn contributes to tactile hypersensitivity following trigeminal sensory nerve injury. Pain. 121 , 219–231 (2006). Xu, J-T., et al . p38 activation in uninjured primary afferent neurons and in spinal microglia contributes to the development of neuropathic pain induced by selective motor fiber injury. Exp. Neurol. 204 , 355–365 (2007). Cheng, H-L. & Feldman, E. L. Bidirectional regulation of p38 kinase and c-Jun N-terminal protein kinase by insulin-like growth factor-I. J. Biol. Chem. 273 , 14560–14565 (1998). Cheng, C. & Zochodne, D. W. Sensory neurons with activated caspase-3 survive long-term experimental diabetes. Diabetes. 52 , 2363–2371 (2003). Vincent, A. M., McLean, L. L., Backus, C. & Feldman, E. L. Short-term hyperglycemia produces oxidative damage and apoptosis in neurons. FASEB J. 19 , 638–640 (2005). Senning, E. N. & Gordon, S. E. Activity and Ca 2+ regulate the mobility of TRPV1 channels in the plasma membrane of sensory neurons. eLife. 4 , e03819 (2015). Way, K. J., Katai, N. & King, G. L. Protein kinase C and the development of diabetic vascular complications. Diabet. Med. 18 , 945–959 (2001). Pabbidi, R. M., et al . Influence of TRPV1 on diabetes-induced alterations in thermal pain sensitivity. Mol. Pain. 4 , 1–17 (2008). Holanda, V. M., Chavantes, M. C., Wu, X. & Anders, J. J. The mechanistic basis for photobiomodulation therapy of neuropathic pain by near infrared laser light. Lasers Surg. Med. 49 , 516–524 (2017). Passarella, S. & Karu, T. Absorption of monochromatic and narrow band radiation in the visible and near IR by both mitochondrial and non-mitochondrial photoacceptors results in photobiomodulation. J. Photochem. Photobiol. B. 140 , 344–358 (2014). Tsai, S-R. & Hamblin, M. R. Biological effects and medical applications of infrared radiation. J. Photochem. Photobiol. B. 170 , 197–207 (2017). Anders, J. J., Lanzafame, R. J. & Arany, P. R. Low-level light/laser therapy versus photobiomodulation therapy. Photomed. Laser Surg. 33 , 183–184 (2015). Chung, H., et al . The nuts and bolts of low-level laser (Light) therapy. Ann. Biomed. Eng. 40 , 516–533 (2012). Hamblin, M. R. Mechanisms and mitochondrial redox signaling in photobiomodulation. Photochem. Photobiol. 94 , 199–212 (2018). Alcântara, C. C., et al . Effect of low-level laser therapy (LLLT) on acute neural recovery and inflammation-related gene expression after crush injury in rat sciatic nerve. Lasers Surg. Med. 45 , 246–252 (2013). Chow, R. T., Johnson, M. I., Lopes-Martins, R. A. B. & Bjordal, J. M. Efficacy of low-level laser therapy in the management of neck pain: a systematic review and meta-analysis of randomised placebo or active-treatment controlled trials. Lancet. 374 , 1897–1908 (2009). Vieira, W. F., Kenzo-Kagawa, B., Cogo, J. C., Baranauskas, V. & da Cruz-Höfling, M. A. Low-level laser therapy (904 nm) counteracts motor deficit of mice hind limb following skeletal muscle injury caused by snakebite-mimicking intramuscular venom injection. PLoS One. 11 , e0158980 (2016). Vieira, W. F., et al . Vibrational spectroscopy of muscular tissue intoxicated by snake venom and exposed to photobiomodulation therapy. Lasers Med. Sci. 33 , 503–512 (2017). Bjordal, J. M., Couppé, C., Chow, R. T., Tunér, J. & Ljunggren, E. A. A systematic review of low level laser therapy with location-specific doses for pain from chronic joint disorders. Aust. J. Physiother. 49 , 107–116 (2003). Gigo-Benato, D., et al . Effects of 660 and 780 nm low-level laser therapy on neuromuscular recovery after crush injury in rat sciatic nerve. Lasers Surg. Med. 42 , 673–682 (2010). Posten, W., et al . Low-level laser therapy for wound healing: mechanism and efficacy. Dermatol. Surg. 31 , 334–340 (2005). Vieira, W. F., et al . Exploring the ability of low-level laser irradiation to reduce myonecrosis and increase Myogenin transcription after Bothrops jararacussu envenomation. Photochem. Photobiol. Sci. 20 , 571–583 (2021). Vieira, W. F., de Magalhães, S. F., Farias, F. H., de Thomaz, A. A. & Parada, C. A. Raman spectroscopy of dorsal root ganglia from streptozotocin-induced diabetic neuropathic rats submitted to photobiomodulation therapy. J. Biophotonics. 12 , 1–14 (2019). Szkudelski, T. The mechanism of alloxan and streptozotocin action in B cells of the rat pancreas. Physiol. Res. 50 , 537–546 (2001). Wang, Z. & Gleichmann, H. Glucose transporter 2 expression: prevention of streptozotocin-induced reduction in beta-cells with 5-thio-D-glucose. Exp. Clin. Endocrinol. Diabetes. 103 , 83–97 (1995). Wang, Z. & Gleichmann, H. GLUT2 in pancreatic islets: crucial target molecule in diabetes induced with multiple low doses of streptozotocin in mice. Diabetes. 47 , 50–56 (1998). Furman, B. L. Streptozotocin-induced diabetic models in mice and rats. Curr. Protoc. Pharmacol . 70 , 5.47.1–5.47.20 (2015). Athie, M. C. P., et al . Transcriptome analysis of dorsal root ganglia's diabetic neuropathy reveals mechanisms involved in pain and regeneration. Life Sci. 205 , 54–62 (2018). Teixeira, J. M. et al . Diabetes-induced neuropathic mechanical hyperalgesia depends on P 2 X 4 receptor activation in dorsal root ganglia. Neuroscience. 398 , 158–170 (2019). do Prado, F. C., et al . The onset speed of hyperglycemia is important to the development of neuropathic hyperalgesia in streptozotocin-induced diabetic rats. Eur. J. Neurosci. 52 , 3642–3651 (2020). Vieira, W. F., et al . Gait analysis correlates mechanical hyperalgesia in a model of streptozotocin-induced diabetic neuropathy: A CatWalk dynamic motor function study. Neurosci. Lett. 736 , 135253 (2020). Peplow, P. V., Chung, T-Y. & Baxter, G. D. Laser photostimulation (660 nm) of wound healing in diabetic mice is not brought about by ameliorating diabetes. Lasers Surg. Med. 44 , 26–29 (2012). Chow, R. T. & Barnsley, L. Systematic review of the literature of low-level laser therapy (LLLT) in the management of neck pain. Lasers Surg. Med. 37 , 46–52 (2005). Byrnes, K. R., et al . Light promotes regeneration and functional recovery and alters the immune response after spinal cord injury. Lasers Surg. Med. 36 , 171–185 (2005). Snyder-Mackler, L. & Bork, C. E. Effect of helium-neon laser irradiation on peripheral sensory nerve latency. Phys. Ther. 68 , 223–225 (1988). Maeda, T. Morphological demonstration of low reactive laser therapeutic pain attenuation effect of the gallium aluminium arsenide diode laser. Laser Ther. 1 , 23–26 (1989). Holanda, V. M., et al . Photobiomodulation of the dorsal root ganglion for the treatment of low back pain: A pilot study. Lasers Surg. Med. 48 , 653–659 (2016). Zochodne, D. W., Ramji, N. & Toth, C. Neuronal targeting in diabetes mellitus: A story of sensory neurons and motor neurons. Neuroscientist. 14 , 311–318 (2008). Kambiz, S., et al . An early diagnostic tool for diabetic peripheral neuropathy in rats. PLoS One. 10 , e0126892 (2015). Schwartz, A. V., et al . Diabetes-related complications, glycemic control, and falls in older adults. Diabetes Care. 31 , 391–396 (2008). Benitez, S. U., Carneiro, E. M. & Oliveira, A. L. R. Synaptic input changes to spinal cord motoneurons correlate with motor control impairments in a type 1 diabetes mellitus model. Brain Behav. 5 , e00372 (2015). Edwards, J. L., Vincent, A., Cheng, T. & Feldman, E. L. Diabetic neuropathy: mechanisms to management. Pharmacol. Ther. 120 , 1–34 (2008). Callaghan, B. C., Cheng, H., Stables, C. L., Smith, A. L. & Feldman, E. L. Diabetic neuropathy: Clinical manifestations and current treatments. Lancet Neurol. 11 , 521–534 (2012). Hsieh, Y-L., et al . Low-level laser therapy alleviates neuropathic pain and promotes function recovery in rats with chronic constriction injury: Possible involvements in hypoxia-inducible factor 1α (HIF-1α). J. Comp. Neurol. 520 , 2903–2916 (2012). Cidral-Filho, F. J., et al . Light-emitting diode therapy induces analgesia and decreases spinal cord and sciatic nerve tumour necrosis factor- α levels after sciatic nerve crush in mice. Eur. J. Pain. 17 , 1193–1204 (2013). Albertini, R., et al . Anti-inflammatory effects of low-level laser therapy (LLLT) with two different red wavelengths (660 nm and 684 nm) in carrageenan-induced rat paw edema. J. Photochem. Photobiol. B. 89 , 50–55 (2007). Kholodenko, B. N. MAP kinase cascade signaling and endocytic trafficking: a marriage of convenience? Trends Cell Biol. 12 , 173–177 (2002). Plotnikov, A., Zehorai, E., Procaccia, S. & Seger, R. The MAPK cascades: signaling components, nuclear roles and mechanisms of nuclear translocation. Biochim. Biophys. Acta. 1813 , 1619–1633 (2011). Pimienta, G. & Pascual, J. Canonical and alternative MAPK signaling. Cell Cycle. 6 , 2628–2632 (2007). Tomlinson, D. R. Mitogen-activated protein kinases as glucose transducers for diabetic complications. Diabetologia. 42 , 1271–1281 (1999). Ciruela, A., et al . Identification of MEK1 as a novel target for the treatment of neuropathic pain. Br. J. Pharmacol. 138 , 751–756 (2003). Galan, A., Cervero, F. & Laird, J. M. A. Extracellular signaling-regulated kinase-1 and – 2 (ERK 1/2) mediate referred hyperalgesia in a murine model of visceral pain. Brain Res. Mol. Brain Res. 116 , 126–134 (2003). Kumar, S., Boehm, J. & Lee, J. C. p38 MAP kinases: key signalling molecules as therapeutic targets for inflammatory diseases. Nat. Rev. Drug Discov. 2 , 717–726 (2003). Boyle, D. L., et al . Regulation of peripheral inflammation by spinal p38 MAP kinase in rats. PLoS Med. 3 , e338 (2006). Verri, W. A. Jr., et al . Hypernociceptive role of cytokines and chemokines: targets for analgesic drug development? Pharmacol. Ther. 112 , 116–138 (2006). Ji, R-R. & Suter, M. R. p38 MAPK, microglial signaling, and neuropathic pain. Mol. Pain. 3 , 1–9 (2007). Shefer, G., Oron, U., Irintchev, A., Wernig, A. & Halevy, O. Skeletal muscle cell activation by low-energy laser irradiation: a role for the MAPK/ERK pathway. J. Cell Physiol. 187 , 73–80 (2001). Aleksic, V., et al . Low-level Er: YAG laser irradiation enhances osteoblast proliferation through activation of MAPK/ERK. Lasers Med. Sci. 25 , 559–569 (2010). Zhai, K., Liskova, A., Kubatka, P. & Büsselberg, D. Calcium entry through TRPV1: A potential target for the regulation of proliferation and apoptosis in cancerous and healthy cells. Int. J. Mol. Sci. 21 , 4177 (2020). Story, G. M., et al . ANKTM1, a TRP-like channel expressed in nociceptive neurons, is activated by cold temperatures. Cell. 112 , 819–829 (2003). Lee, Y. M. et al . A novel role for the TRPV1 channel in UV-induced matrix metalloproteinase (MMP)-1 expression in HaCaT cells. J. Cell Physiol. 219 , 766–775 (2009). Wang, Y., Huang, Y-Y., Wang, Y., Lyu, P. & Hamblin, M. R. Photobiomodulation of human adipose-derived stem cells using 810 nm and 980 nm lasers operates via different mechanisms of action. Biochim. Biophys. Acta Gen. Subj. 1861 , 441–449 (2017). Bradford, M. M. A rapid and sensitive method for the quantitation microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72 , 248–254 (1976). Vandesompele, J., et al . Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3 , 1–12 (2002). Linhart, O., Obreja, O. & Kress, M. The inflammatory mediators serotonin, prostaglandin E2 and bradykinin evoke calcium influx in rat sensory neurons. Neuroscience. 118 , 69–74 (2003). Manzo, L. P., et al . Magnetic, but not non-magnetic, reduced graphene oxide in spinal cord increases nociceptive neuronal responsiveness. Nanomedicine. 13 , 1841–1851 (2017). Additional Declarations No competing interests reported. Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Major revision 22 Aug, 2022 Reviews received at journal 19 Aug, 2022 Reviews received at journal 03 Jun, 2022 Reviewers agreed at journal 12 May, 2022 Reviewers invited by journal 12 May, 2022 Editor assigned by journal 08 May, 2022 Editor invited by journal 05 May, 2022 Submission checks completed at journal 05 May, 2022 First submitted to journal 30 Apr, 2022 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-1612307","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":103882545,"identity":"780a8dc3-2dab-4860-a57c-85080a424cc6","order_by":0,"name":"Willians Fernando Vieira","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Willians","middleName":"Fernando","lastName":"Vieira","suffix":""},{"id":103882549,"identity":"d3305026-db88-422c-af72-23d4fbdb9a49","order_by":1,"name":"Kauê Franco Malange","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Kauê","middleName":"Franco","lastName":"Malange","suffix":""},{"id":103882552,"identity":"845c60c3-d3c0-4a4c-9b75-5bf2729674bd","order_by":2,"name":"Silviane Fernandes de Magalhães","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Silviane","middleName":"Fernandes","lastName":"de Magalhães","suffix":""},{"id":103882553,"identity":"cadb2f5b-f220-45ee-8769-2e5c31259ba1","order_by":3,"name":"Júlia Borges Paes Lemes","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Júlia","middleName":"Borges Paes","lastName":"Lemes","suffix":""},{"id":103882554,"identity":"01cbe2c9-235e-4acf-918f-c83a7dabf181","order_by":4,"name":"Gilson Gonçalves dos Santos","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Gilson","middleName":"Gonçalves dos","lastName":"Santos","suffix":""},{"id":103882555,"identity":"584a8f12-489b-40ab-aa47-2689be605377","order_by":5,"name":"Catarine Massucato Nishijima","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Catarine","middleName":"Massucato","lastName":"Nishijima","suffix":""},{"id":103882556,"identity":"dd4ea7c3-2a30-4449-9d24-850373fdd4d1","order_by":6,"name":"Alexandre Leite Rodrigues de Oliveira","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Alexandre","middleName":"Leite Rodrigues","lastName":"de Oliveira","suffix":""},{"id":103882557,"identity":"ce36ab5f-7808-4db7-8b7f-43f178a28dc4","order_by":7,"name":"Maria Alice da Cruz-Höfling","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Maria","middleName":"Alice da","lastName":"Cruz-Höfling","suffix":""},{"id":103882558,"identity":"73531447-a823-4b20-9d20-736ab5b18dcc","order_by":8,"name":"Carlos Amilcar Parada","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA2ElEQVRIiWNgGAWjYPACZgZ+IHkAzJYgVotkA8laDA7A2IS08LefPfi5osZa3vhG7sEDP2q25TFI9z7Aq0XiTF6y5Jlj6YbbbuQlHOw5druYQea4AV4tBgw5BpINbIcZt93IMTjMwHY7sUEiDb/DDPjfGP9s+HfYfvMMkJZ/xGiRyDGTbGw7nLhBAqiFsY0ILRI33qVZNvalJ88488bgYG/f7WI2mWP4tfD35x6+2fDN2ra/Pcf4w49vt/P4pdvwa2Fg4EHlJrAR0oCphbCOUTAKRsEoGGkAAM5NSsKkov7CAAAAAElFTkSuQmCC","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"Carlos","middleName":"Amilcar","lastName":"Parada","suffix":""},{"id":103882559,"identity":"2dbccd03-eb2c-4424-96c2-02230f4ccc3f","order_by":9,"name":"Cláudia Herrera Tambeli","email":"","orcid":"","institution":"University of Campinas (UNICAMP)","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Cláudia","middleName":"Herrera","lastName":"Tambeli","suffix":""}],"badges":[],"createdAt":"2022-04-30 18:14:06","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-1612307/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-1612307/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":21353983,"identity":"0cdb02ee-723b-4723-b421-4c2a3ebc1501","added_by":"auto","created_at":"2022-05-11 17:09:21","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":39757,"visible":true,"origin":"","legend":"\u003cp\u003eStreptozotocin (STZ)-induced hyperglycemia mimicking type-1 diabetes and PBMT influence over diabetes signals and diabetic neuropathic hyperalgesia. \u003cstrong\u003e(A)\u003c/strong\u003e Average morning glycemia (red line) from rats (n = 8) during the protocol of diabetes induction by multiple STZ low-doses; dotted horizontal black line: established diabetes threshold (glucose ≥ 250 mg/dL). \u003cstrong\u003e(B)\u003c/strong\u003e Rats from STZ (red line) and STZ+PBMT (green line) groups showed high levels of hyperglycemia at 7, 14, 21, 24, and 28 days; PBMT showed no influence on glycemic levels. \u003cstrong\u003e(C)\u003c/strong\u003e Rats from STZ (red line), and STZ+PBMT (green line) groups stopped gaining weight after the installation of diabetes. \u003cstrong\u003e(D)\u003c/strong\u003e Data from mechanical withdrawal thresholds (Δ; g; intensity of hyperalgesia) show that PBMT reduced significantly the intensity of hyperalgesia of the STZ+PBMT group (green line) in comparison with the STZ group (red line), at the 24\u003csup\u003eth\u003c/sup\u003e and the 28\u003csup\u003eth\u003c/sup\u003e days. \u003cstrong\u003e(E)\u003c/strong\u003e Bar graph emphasizing the PBMT anti-hyperalgesic effect during the period comprised between the 21\u003csup\u003est\u003c/sup\u003e and the 28\u003csup\u003eth\u003c/sup\u003e days, when is observed the mean peaks of hyperalgesia intensity (Δ withdrawal threshold, g). In panels A-C, symbol (***) means a significant difference (p \u0026lt; 0.001) between diabetic groups and controls (Two-way ANOVA followed by Bonferroni post-\u003cem\u003ehoc\u003c/em\u003e test). In panels D and E, symbols (**) and (***) mean significant difference (p \u0026lt; 0.01 and p \u0026lt; 0.001, respectively) between STZ and STZ+PBMT groups (Two-way ANOVA followed by Bonferroni post-\u003cem\u003ehoc\u003c/em\u003e test); symbol (#) means significant difference (p \u0026lt; 0.001) between STZ-induced groups in comparison to control groups (Two-way ANOVA followed by Bonferroni post-\u003cem\u003ehoc\u003c/em\u003e test [panel D]; One-way ANOVA followed by Bonferroni post-\u003cem\u003ehoc\u003c/em\u003e test [panel E]). Data are expressed as mean ± S.E.M.; vertical dotted black lines indicate PBMT period (21\u003csup\u003est\u003c/sup\u003e to 28\u003csup\u003eth\u003c/sup\u003e days).\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-1612307/v1/d89ce02d9404f0dc6b0b8deb.png"},{"id":21353394,"identity":"a4dffcc1-2100-4d04-bae9-0d9aed0b47f6","added_by":"auto","created_at":"2022-05-11 17:04:21","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":112601,"visible":true,"origin":"","legend":"\u003cp\u003eGait spatial parameters were altered in DN and thwarted by PBMT\u003cstrong\u003e. (A) \u003c/strong\u003eMaximum Contact Area (cm²). \u003cstrong\u003e(B)\u003c/strong\u003e Print Area (cm²). \u003cstrong\u003e(C)\u003c/strong\u003e Stride Length (cm). Data are expressed as mean ± S.E.M.; symbols (*) and (***) mean significant difference (p \u0026lt; 0.05 and p \u0026lt; 0.001, respectively) between STZ and STZ+PBMT groups; symbol (#) means significant difference (p \u0026lt; 0.001) between STZ-induced groups (STZ and STZ+PBMT) in comparison to control groups (Naïve; SCB; SCB+PBMT); Two-way ANOVA followed by Bonferroni post-\u003cem\u003ehoc\u003c/em\u003e test.\u003cstrong\u003e (D) \u003c/strong\u003eGeneral pattern of the hind paw 2D footprints; digits and footpad areas (glabrous) appeared well defined in the impression of the right hind paw (RH) of rats from the Naïve (a) and SCB groups (b). Differently, rats from STZ group (c) showed a reduction in the contact area, delimited by the white dotted line and indicated by the red arrows; rats from STZ+PBMT group (e) presented a footprint area closest to the control groups (red arrows). In the lower right frame (f), \u003cem\u003eBody Axis\u003c/em\u003e serves as a reference to observe the positioning of the paw during the analysis.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-1612307/v1/afa5c7054e226a2758b7f196.png"},{"id":21353392,"identity":"d11adfde-a49f-434f-9361-2afdcf4b84d9","added_by":"auto","created_at":"2022-05-11 17:04:21","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":71399,"visible":true,"origin":"","legend":"\u003cp\u003eEffects of PBMT over the DRG levels of TNF-α, IL-1β, IL-6, CINC-1, and IL-10. \u003cstrong\u003e(A)\u003c/strong\u003e There was no increase in the levels of TNF-α (pg/mL) in the STZ group (red symbols); STZ+PBMT group (green symbols) showed a significant reduction in the levels of TNF-α (pg/mL) in comparison to all the other groups. \u003cstrong\u003e(B)\u003c/strong\u003e For the levels of IL-1β (pg/mL), there was a significant increase in the STZ group (red symbols) in comparison with all the other groups. \u003cstrong\u003e(C)\u003c/strong\u003e Levels of IL-6 (pg/mL) were reduced significantly in SCB+PBMT (blue symbols) and STZ+PBMT (green symbols) groups, in comparison to all the other groups. \u003cstrong\u003e(D)\u003c/strong\u003e CINC-1 concentrations (pg/mL) showed a significant reduction in the SCB+PBMT group (blue symbols) only. \u003cstrong\u003e(E)\u003c/strong\u003e Levels of IL-10 (pg/mL/mg) showed a significant increase in the STZ group (red symbols) in comparison to all the other groups. Data are expressed as mean ± S.E.M.; symbols (*) and (**) mean p \u0026lt; 0.05 and p \u0026lt; 0.01, respectively; symbol (#) means that all control groups are significantly different from the STZ group (p \u0026lt; 0.05); One-way ANOVA followed by Bonferroni post-\u003cem\u003ehoc\u003c/em\u003e test.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-1612307/v1/e721e1fc17810d0fc4ee56a2.png"},{"id":21355587,"identity":"3e10c40b-702b-4cea-9d99-408a092bd9d6","added_by":"auto","created_at":"2022-05-11 17:19:21","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":44916,"visible":true,"origin":"","legend":"\u003cp\u003eQuantitative expression of MAPK mRNA. Gene expression values of p38 \u003cstrong\u003e(A)\u003c/strong\u003e, ERK1/2 \u003cstrong\u003e(B)\u003c/strong\u003e, and JNK \u003cstrong\u003e(C)\u003c/strong\u003e were index-normalized by a pool of endogenous controls (Arfgef1 and Serpinb6) expression. STZ group showed a higher gene expression of p38 than all the other groups, including STZ+PBMT. For ERK1/2 and JNK genes, there was no difference between the groups. Data are expressed as mean ± S.E.M.; symbols (*), (**), and (***) mean p \u0026lt; 0.05, p \u0026lt; 0.01, and p \u0026lt; 0,001 (respectively) in the comparisons between STZ (red symbols) and the other groups (Naïve, black symbols; SCB, gray symbols; SCB+PBMT, blue symbols; STZ+PBMT, green symbols); Unpaired Student\u003cem\u003e t-\u003c/em\u003etest.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-1612307/v1/7a6f7682f1d893cd6ff062b4.png"},{"id":21353985,"identity":"85577443-84f0-4595-b6c8-282c8d55d742","added_by":"auto","created_at":"2022-05-11 17:09:21","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":526924,"visible":true,"origin":"","legend":"\u003cp\u003eDRG histological micrographs of p-p38 MAPK by confocal microscopy.\u003cstrong\u003e \u003c/strong\u003eDRG transversal 14 µm-thick sections were submitted to immunofluorescence protocol for staining endogenous p38 phosphorylation in Thr180 and Tyr182 (panels B, E, H, and K). For nuclear staining, DAPI was used (panels A, D, G, and J). Merge (DAPI + p-p38) images are also shown (panels C, F, I, and L). It is possible to observe an increased fluorescence staining regarding the expression of p-p38 in the STZ group (panel H; white arrows) compared to the control groups (SCB and SCB+PBMT, panels B and E, respectively) and to the STZ+PBMT group (panel K; white arrows). Magnification: 40x; scale bars: 50 µm.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-1612307/v1/c443567a95d4cd47b9aee6eb.png"},{"id":21354697,"identity":"c5255fbc-8b60-4edd-b800-4273ea67af1d","added_by":"auto","created_at":"2022-05-11 17:14:21","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":658161,"visible":true,"origin":"","legend":"\u003cp\u003eDRG histological micrographs of p-ERK1/2 MAPK by confocal microscopy. DRG transversal 14 µm-thick sections submitted to immunofluorescence protocol for staining ERK1/2 phosphorylation in Thr202 and Tyr204 (p44/p42) (panels B, E, H, and K). For nuclear staining, DAPI was used (panels A, D, G, and J). Images of merge (DAPI + p-ERK1/2) are also shown (panels C, F, I, and L). There is low fluorescence regarding the expression of p-ERK1/2, especially for the SCB+PBMT (panel E) and STZ+PBMT (panel K) groups. Magnification: 40x; scale bars: 50 µm.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-1612307/v1/1ed9b2a0e11acacaaa6410c5.png"},{"id":21353400,"identity":"59685bdf-f7ec-4413-b4fa-2f7209b1dfc4","added_by":"auto","created_at":"2022-05-11 17:04:21","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":631547,"visible":true,"origin":"","legend":"\u003cp\u003eDRG histological micrographs of p-JNK MAPK by confocal microscopy. DRG transversal sections were 14 µm in thickness and submitted to immunofluorescence protocol for staining of endogenous p-JNK phosphorylation in Thr183 and Tyr185 (p46/p54) (panels B, E, H, and K). For nuclear staining, DAPI was used (panels A, D, G, and J). Merge (DAPI + p-JNK) images were also shown (panels C, F, I, and L). There is low fluorescence regarding the expression of p-JNK, especially for the SCB+PBMT (panel E) and STZ+PBMT (panel K) groups. Magnification: 40x; scale bars: 50 µm.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-1612307/v1/892fd9cf6e7d637d1b4ba881.png"},{"id":21353397,"identity":"baa2825d-ecfb-4367-b87d-399bc8fb6053","added_by":"auto","created_at":"2022-05-11 17:04:21","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":492558,"visible":true,"origin":"","legend":"\u003cp\u003eDRG histological micrographs of p-p38 MAPK and the co-staining of TRPV1 by confocal microscopy. DRG transversal sections were made in 14 µm thickness and submitted to immunofluorescence protocol for staining endogenous p38 phosphorylation in Thr180 and Tyr182 (panels B, F, J, and N) and TRPV1 (panels C, G, K, and O). For nuclear staining, DAPI was used (panels A, E, I, and M). Merge (DAPI+p-p38+TRPV1) images are also shown (panels D, H, L, and P). It was possible to observe an increased fluorescence co-staining of p-p38 and TRPV1 in the STZ group (panel L) compared to the control groups (Naïve, SCB, and SCB+PBMT, panels D, H, and L, respectively). STZ+PBMT group showed increased staining for TRPV1 and moderate staining for p-p38 MAPK (panels N, O, and P). Magnification: 40x; scale bars: 50 µm.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Figure8.png","url":"https://assets-eu.researchsquare.com/files/rs-1612307/v1/19ed28aac9ba2127d6cfa35e.png"},{"id":21353987,"identity":"18a85826-3f9a-4eed-b3a8-65823cd27312","added_by":"auto","created_at":"2022-05-11 17:09:21","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":146572,"visible":true,"origin":"","legend":"\u003cp\u003eCalcium dynamics of DRG neurons were affected by hyperglycemia and PBMT.\u003cstrong\u003e \u003c/strong\u003eFluorescence intensity (ΔF = F-F0/F0) was analyzed in DRG-neurons cultivated in low- (black line) or high-glucose (red line) media for 24 h and exposed to PBMT (green and blue lines) right before the test. \u003cstrong\u003e(A) \u003c/strong\u003eGeneral representation of fluorescence intensities (ΔF = F-F0/F0) after extracellular stimuli with 5 mM (basal), 15 mM (intermediary), and 50 mM (high) of KCl; ↑[K\u003csup\u003e+\u003c/sup\u003e]\u003csub\u003ee\u003c/sub\u003e was used to generate an increase in [Ca\u003csup\u003e2+\u003c/sup\u003e]i of DRG-neurons incubated with FLUO-4 AM. \u003cstrong\u003e(B)\u003c/strong\u003e During the intermediary stimulus (15 mM KCl), there was a significant difference in the ΔF when comparing the high-glucose and high-glucose+PBMT groups (comparison was done considering the ΔF delimited by the horizontal dotted lines); Two-way ANOVA followed by Bonferroni post-\u003cem\u003ehoc \u003c/em\u003etest. \u003cstrong\u003e(C) \u003c/strong\u003eSnap-acquired images of the DRG-cell culture during the time-lapse, right after the stimulus with 15 mM KCl. \u003cstrong\u003e(D) \u003c/strong\u003eAt the high stimulus (50 mM KCl), there was a significant difference between the low-glucose and low-glucose+PBMT groups. \u003cstrong\u003e(E) \u003c/strong\u003eSnap-acquired images of the DRG-cell culture during the time-lapse, right after the stimulus with 50 mM KCl. \u003cstrong\u003e(F) \u003c/strong\u003ePercentage (%) of responsive cells during the 15 mM stimulus; in the high-glucose group, about 60 % of all responsive cells, i.e., cells with increased fluorescence during the 50 mM KCl stimulus (positive control), also responded to the intermediary stimulus (15 mM KCl), being statistically different from the other groups. Data are expressed as mean ± S.E.M.; symbols (*) and (***) mean p \u0026lt; 0.05 and p \u0026lt; 0.001, respectively, in comparison to the high-glucose group; One-way ANOVA followed by Bonferroni post-\u003cem\u003ehoc\u003c/em\u003e test.\u003c/p\u003e\u003cp\u003e\u003cbr\u003e\u003c/p\u003e","description":"","filename":"Figure9.png","url":"https://assets-eu.researchsquare.com/files/rs-1612307/v1/acd5db22cd068d2d278b02f8.png"},{"id":21355588,"identity":"ca5ac7a9-7236-435d-8f6f-cda0b1a53775","added_by":"auto","created_at":"2022-05-11 17:19:26","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2934209,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-1612307/v1/84396075-1b26-4c7f-b31a-25c098698878.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Anti-hyperalgesic effects of photobiomodulation therapy (904 nm) on streptozotocin-induced diabetic neuropathy: A role for MAPK pathway and calcium dynamics","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDiabetes can damage the peripheral nervous system (PNS) in various ways, and diabetic neuropathy (DN) is one of the most common complications of untreated diabetes\u003csup\u003e\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e. DN is a chronic complex disorder that affects the peripheral nerves, causing a painful condition involving superior and inferior limbs\u003csup\u003e\u003cspan additionalcitationids=\"CR2 CR3\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u003c/sup\u003e with an incidence rate of about 70% of diabetic patients\u003csup\u003e\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e,\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e\u003c/sup\u003e. The mechanism by which hyperglycemia leads to peripheral nerve injury is not very clear, but it is known that several metabolic pathways are affected\u003csup\u003e\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u003c/sup\u003e. The main events involve the polyol pathway, through the aldose reductase (AR) activation\u003csup\u003e\u003cspan additionalcitationids=\"CR9 CR10\" citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u003c/sup\u003e, the protein glycosylation, and the advanced glycation end-products (AGEs) production\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e,\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u003c/sup\u003e. In addition, the formation of free radicals linked to oxidative stress\u003csup\u003e\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e,\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u003c/sup\u003e, the reduced neurotrophic support\u003csup\u003e\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e,\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e\u003c/sup\u003e, and the increased protein kinase C activation (PKC)\u003csup\u003e\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e,\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e\u003c/sup\u003e contribute to the peripheral damage. As a result of the metabolic imbalance, the mitochondrial failure\u003csup\u003e\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e,\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e,\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e\u003c/sup\u003e and inflammatory processes are also frequent and related to the phosphorylation of mitogen-activated protein kinases (MAPKs)\u003csup\u003e\u003cspan additionalcitationids=\"CR22 CR23 CR24\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eMAPK is a family of serine/threonine protein kinases responsible for transducing extracellular stimuli into intracellular posttranslational and transcriptional responses\u003csup\u003e\u003cspan additionalcitationids=\"CR27\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u003c/sup\u003e. It comprises p38-MAPK, extracellular signal-regulated protein kinase (ERK1/2), and c-Jun N-terminal kinase/stress-activated protein kinase (SAPK/JNK)\u003csup\u003e29\u003c/sup\u003e. The three main subfamilies of MAPK (p38, ERK1/2, and JNK) coordinate several functions: gene transcription, protein synthesis, cell cycle, proliferation, differentiation, and apoptosis\u003csup\u003e\u003cspan additionalcitationids=\"CR31 CR32\" citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e\u003c/sup\u003e. MAPK pathway can be activated by extracellular stimuli, such as proinflammatory cytokines\u003csup\u003e\u003cspan additionalcitationids=\"CR35\" citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e\u003c/sup\u003e and oxidative stress\u003csup\u003e\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e,\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e,\u003c/sup\u003e and its function is also influenced by several parallel pathways, including Ca\u003csup\u003e2+\u003c/sup\u003e dynamics\u003csup\u003e38,39\u003c/sup\u003e. Rosen et al. (1994)\u003csup\u003e\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e\u003c/sup\u003e demonstrated that membrane depolarization of PC12 cells leads to calcium influx through L-type calcium channels and activates the dual-specificity MAPK kinase MEK1, which phosphorylates and activates MAPK. Inline, hyperglycemia seems to be one of the factors which could stimulate the MAPKs phosphorylation\u003csup\u003e\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e,\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e\u003c/sup\u003e, once the activation of p38 has been seen in peripheral sensory neurons of diabetic rats\u003csup\u003e\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e\u003c/sup\u003e, specifically in the dorsal root ganglia (DRG)\u003csup\u003e\u003cspan additionalcitationids=\"CR44 CR45\" citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e\u003c/sup\u003e. Similarly, the phosphorylation of JNK leads to apoptosis of hyperglycemia-stressed neurons via activation of caspase-3\u003csup\u003e22,47\u0026minus;49\u003c/sup\u003e. Furthermore, in chronic pain, MAPK signaling stimulates the transient receptor potential vanilloid subtype 1 (TRPV1) expression, a highly Ca2+-permeable channel50, thus implicating several diabetes complications, including thermal hyperalgesia\u003csup\u003e\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e \u003cp\u003eOwing to the complexity of the metabolic alterations observed in DN, there are several pharmacological targets for treating the painful condition, but with low efficacy. Most patients refer to some relief of the symptoms, but it regresses over time, even before treatment ends\u003csup\u003e\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e\u003c/sup\u003e. Characterized as an athermal process, photobiomodulation therapy (PBMT) involves activating specific cellular chromophores, especially red and infrared lights, such as the cytochrome \u003cem\u003ec\u003c/em\u003e oxidase (CCO; mitochondrial complex IV)\u003csup\u003e\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e\u003c/sup\u003e. This process is triggered by photophysical and photochemical reactions inside the cells when the Light crosses the cell membrane\u003csup\u003e\u003cspan additionalcitationids=\"CR55\" citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e\u003c/sup\u003e, causing the modulation of specific pathways related to cellular survival, the increase in adenosine triphosphate (ATP), oxygen production, and nitric oxide (NO) release, for example\u003csup\u003e\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e\u003c/sup\u003e. The resultant \"photobiomodulation process\" can be used as a therapy to treat some painful conditions\u003csup\u003e\u003cspan additionalcitationids=\"CR59 CR60 CR61 CR62 CR63 CR64\" citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e65\u003c/span\u003e,\u003c/sup\u003e including DN, at least partly, as observed in a previous study conducted by our group\u003csup\u003e\u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e66\u003c/span\u003e\u003c/sup\u003e. Based on that, this study aimed to analyze the anti-hyperalgesic effects of PBMT (904 nm) on streptozotocin (STZ)-induced diabetic neuropathy, considering the possible role of MAPK pathway in the course of the disease and as a target for the PBMT.\u003c/p\u003e"},{"header":"Results And Discussion","content":"\u003cp\u003e\u003cstrong\u003ePBMT did not alter the metabolic parameters linked to STZ-induced type-1 diabetes since the clinical signals of type-1 diabetes (hyperglycemia, weight loss, polyuria, polydipsia, and polyphagia) in the STZ-PBMT group remained equal to those of untreated STZ group\u003c/strong\u003e. Type-1 diabetes induction protocol through low doses of STZ (five low doses, a single dose of 25 mg/kg per day) was suitable for installing irreversible hyperglycemia. All rats submitted to STZ injections (STZ and STZ\u0026thinsp;+\u0026thinsp;PBMT groups) became hyperglycemic (\u0026ge;\u0026thinsp;250 mg/dL of blood glucose concentration; 349.07\u0026thinsp;\u0026plusmn;\u0026thinsp;48.23 mg/dL) after five STZ-low doses, reaching the threshold for diabetes between the fourth and fifth days (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e, panels A and B). Diabetic rats also presented other characteristic metabolic alterations, such as polyuria, polyphagia, and polydipsia (data not shown), and stopped gaining weight with a slight loss (in grams) throughout the experimental period (Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e, panel C).\u003c/p\u003e\n\u003cp\u003eSTZ is a diabetogenic antibiotic known for its selective capacity to kill the pancreatic beta cells (\u0026beta;-cells), commonly used for type-1 diabetes induction in animal models\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e67\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e70\u003c/span\u003e\u003c/sup\u003e. STZ is taken up by the \u0026beta;-cells glucose transporter GLUT2 and triggers immune mechanisms\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e68\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e69\u003c/span\u003e\u003c/sup\u003e. According to Wang and Gleichmann (1995; 1998)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e68\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e69\u003c/span\u003e\u003c/sup\u003e, STZ restricts GLUT2 expression in vivo and in vitro when administered through multiple low-doses protocol, which is a method for producing fewer STZ side effects, such as neurotoxicity. In general, rats submitted to STZ injections show deficits in insulin production, leading to hyperglycemia and, consequently, polydipsia and polyuria\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e70\u003c/span\u003e\u003c/sup\u003e. All those diabetes signals were observed in rats submitted to the low doses STZ protocol (STZ and STZ\u0026thinsp;+\u0026thinsp;PBMT groups), which characterizes a reproducible model of diabetes induction, as shown in previous studies from our group\u003csup\u003e66,71\u0026minus;74\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eDiabetic rats, submitted or not to PBMT (STZ\u0026thinsp;+\u0026thinsp;PBMT and STZ groups, respectively), showed similar levels of hyperglycemia on days 21, 24, and 28 of the experimental protocol (454.94\u0026thinsp;\u0026plusmn;\u0026thinsp;37.10 mg/dL). The same was observed regarding the rats\u0026apos; weight, once this parameter was only dependent on the diabetic condition and not on the laser treatment. In like manner, PBMT did not cause any influence over healthy rats (control, non-diabetic and non-hyperalgesic; SCB\u0026thinsp;+\u0026thinsp;PBMT group), as shown in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e (panels B and C). Our results using NIR light (904 nm; 70 mW; 2.03 J; 29 s) corroborate with the study performed by Peplow and colleagues (2012)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e75\u003c/span\u003e\u003c/sup\u003e, in which PBMT (660 nm; 100 mW; 4.7\u0026ndash;6.3 J/cm\u0026sup2;; 20 s) applied for wound healing in diabetic patients, showed no interference neither on hyperglycemia nor on patients\u0026apos; metabolic status.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePBMT leads to an anti-hyperalgesic effect against the DN mechanical hyperalgesia induced by low doses STZ, which was unrelated to a putative influence of PBMT in the metabolic and clinical signals type-1 diabetes, as shown above. PBMT reduced the STZ-induced diabetic hyperalgesia\u003c/strong\u003e. The data reproduced previous results obtained from our research group\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e66\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eOn the 21st day (after the first PBMT session), there was no reduction in the mechanical hyperalgesia intensity (\u0026Delta; withdrawal threshold, g). However, on the 24th and 28th days, a time-significant reduction (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01 and p\u0026thinsp;\u0026lt;\u0026thinsp;0.001, respectively) was observed in the intensity of hyperalgesia of STZ\u0026thinsp;+\u0026thinsp;PBMT group when compared to STZ group, characterizing an anti-hyperalgesic effect promoted by PBMT. Nonetheless, when PBMT was applied to control rats (SCB\u0026thinsp;+\u0026thinsp;PBMT), there was no change in the mechanical withdrawal thresholds in a similar condition observed in SCB (vehicle) and na\u0026iuml;ve groups, as shown in Fig. \u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003e (panels D and E; the latest in detail for the PBMT period).\u003c/p\u003e\n\u003cp\u003ePBMT has long been used for the clinical treatment of neuropathic pain showing satisfactory results\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e76\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e77\u003c/span\u003e\u003c/sup\u003e, but its analgesic mechanisms are not entirely understood. The inhibition of the neuronal hyperactivity by the infrared light seems to be one of the ways that PBMT acts directly over the neurons\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e78\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e79\u003c/span\u003e\u003c/sup\u003e, and consequently the pain. Holanda et al. (2016 and 2017)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e52\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e80\u003c/span\u003e\u003c/sup\u003e suggested a neuromodulation effect once they showed that patients with back pain submitted to PBMT (808 nm; 100 mW; 8.4 J; 84 s; a single session) on L4-L5 levels presented a significant pain relief. This modulatory effect could be the key to regulating the neuronal activity severely affected by hyperglycemia to avoid painful sensibility.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMotor function dysfunction related to DN and detected by CatWalk system was amended by PBMT, likely due to PBMT anti-hyperalgesic property.\u003c/strong\u003e Our analysis was based on a previous study identifying dynamic motor function alterations related to STZ-induced DN\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e74\u003c/span\u003e\u003c/sup\u003e. The results showed that PBMT was able to improve the Maximum Contact Area (cm\u0026sup2;) and the Print Area (cm\u0026sup2;) (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, panels A and B, respectively) of the rats\u0026apos; hind paws after 4 (24th day) and 8 (28th day) laser irradiation sessions, likely suggesting analgesia amelioration ought to improvement of nerve conduction. Statistical differences were observed between STZ\u0026thinsp;+\u0026thinsp;PBMT and STZ groups in such periods. No difference was observed for the Stride Length (cm) parameter (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, panel C), except between both neuropathic groups (STZ and STZ\u0026thinsp;+\u0026thinsp;PBMT) vs. control groups (Na\u0026iuml;ve, SCB, and SCB\u0026thinsp;+\u0026thinsp;PBMT). Areas of the digits and plantar pad (glabrous) appeared well delimited in the footprints of the right hind paw (RH) from rats of the STZ\u0026thinsp;+\u0026thinsp;PBMT group on days 24th and 28th (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, panel D: e), which were similar to the observed in Na\u0026iuml;ve and SCB groups (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, panel D: a, b, d), thus differing from the STZ group (Fig. \u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e, panel D: c). The latest showed a reduction in the contact area with a low resolution of the footprints on the 28th day.\u003c/p\u003e\n\u003cp\u003eAccording to Zochodne et al. (2008)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e81\u003c/span\u003e\u003c/sup\u003e, non-controlled diabetes leads to damage of sensory neurons before the involvement of the motor ones. DN is associated with postural changes in this process, involving the alteration of foot positioning during gait\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e82\u003c/span\u003e\u003c/sup\u003e and alterations in pressure applied throughout the stand phase\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e83\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e84\u003c/span\u003e\u003c/sup\u003e. Vieira et al. (2020)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e74\u003c/span\u003e\u003c/sup\u003e demonstrated that Maximum Intensity (a. u.) was the main parameter to demonstrate alteration on the 14th day after starting STZ injections, which corroborates the data obtained by Benitez et al. (2015)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e84\u003c/span\u003e\u003c/sup\u003e. Diabetic animals (STZ group), which presented significant changes in the mechanical threshold on the 14th day, as observed in the electronic von Frey test results for mechanical hyperalgesia, applied less pressure during the paws\u0026apos; contact with the glass floor of the CatWalk XT system. These findings follow the pattern of sensory changes in DN, also known as \u0026quot;stocking-and-glove,\u0026quot; which occurs as a sensory disorder of the extremities of limbs, compromising functionality\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e85\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e86\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eFew studies evaluated the influence of PBMT on motor parameters in animal models, primarily when the CatWalk XT system was used. Vieira and colleagues (2016)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e60\u003c/span\u003e\u003c/sup\u003e analyzed the influence of low-level laser therapy (LLLT) using the GaAs laser (904 nm; 4 J/cm\u0026sup2;) on motor changes resulting from snake venom-induced myonecrosis. At 3 h after the venom injection, mice presented a semi-inflected posture of the right hind limb. When PBMT was performed, for the same period (3 h), animals presented values of Maximum Intensity (u. a.), Stand (s), and Balance (s) similar to control. The semi-flexion posture could represent a protective reflex to a painful stimulus. In the DN model, rats did not present a hind limb semi-flexion; however, they applied less pressure (represented by less intensity and smaller paw contact area) during gait. In this sense, PBMT could normalize part of the altered gait we observed in DN, which may be related to the anti-hyperalgesic effect promoted by light therapy. Altogether, we suggest that type-1 diabetes-derived neuropathic pain likely results from impairment in sensory and motor neurons.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePBMT was able to reduce the levels of cytokines.\u003c/strong\u003e To further investigate whether the anti-hyperalgesic effect promoted by PBMT could be linked to reducing the DN-associated cytokines, we studied the concentration of TNF-\u0026alpha;, IL-1\u0026beta;, IL-6, and CINC-1 by ELISA immunoassay. DRG from diabetic neuropathic rats, PBMT-untreated (STZ group), showed increased concentrations of IL-1\u0026beta; and IL-10 (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, panels B and E); levels of TNF-\u0026alpha;, IL-6, and CINC-1 showed no alterations regarding the DN setting (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, panels A, C, and D), but presented alterations when the groups were exposed to PBMT (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, panels A, C, and D). Specifically, there was a significant increase in IL-1\u0026beta; in the STZ group compared to all the other groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), especially in the STZ\u0026thinsp;+\u0026thinsp;PBMT group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), as shown in Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e (panel B). As for IL-1\u0026beta;, the levels of IL-10 (an anti-inflammatory cytokine) showed increased levels in the STZ group but not in the controls or the STZ\u0026thinsp;+\u0026thinsp;PBMT group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, panel E). Differently, levels of TNF-\u0026alpha; showed no alterations caused by the diabetic neuropathy (STZ group), which were the same for control groups, except for STZ\u0026thinsp;+\u0026thinsp;PBMT group, which showed a significant reduction (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) in the concentration of TNF-\u0026alpha;, compared to STZ (without PBMT) (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, panel A). CINC-1 concentrations reduced significantly (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) only for the SCB\u0026thinsp;+\u0026thinsp;PBMT group (One-way ANOVA followed by Bonferroni post-\u003cem\u003ehoc\u003c/em\u003e test) (Fig. \u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e, panel D).\u003c/p\u003e\n\u003cp\u003eAs reported by Hsieh and collaborators (2012)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e87\u003c/span\u003e\u003c/sup\u003e, PBMT (660 nm; 30 mW; 9 J/cm\u0026sup2;; 60 s; 7 consecutive days; 63 J/cm\u0026sup2; cumulative energy density) applied for the treatment of chronic pain induced by sciatic nerve constriction, caused a reduction in the concentration of proinflammatory cytokines, such as TNF-\u0026alpha;, IL-1\u0026beta;, and HIF-1\u0026alpha; (hypoxia-inducible factor-1\u0026alpha;), corroborating our results. The same reduction in TNF-\u0026alpha; levels promoted by PBMT (950 nm; 2.5 J/cm\u003csup\u003e2\u003c/sup\u003e; 32 s; 15 consecutive days; 37.5 J/cm\u0026sup2; cumulative energy density) was observed in a mice model of sciatic nerve crush injury, reported by Cidral-Filho et al. (2013)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e88\u003c/span\u003e\u003c/sup\u003e. These shreds of evidence bring the discussion on the high anti-inflammatory capacity exhibited by PBMT. In this regard, the anti-inflammatory effects promoted by PBMT were previously observed in carrageenan-induced inflammation in rats\u0026apos; paws, in which both 660 nm and 684 nm low-level lasers (30 mW; 7.5 J/cm\u0026sup2;; 196 s; a single point) reduced the edema formation and inflammatory cell migration at 4 h after carrageenan injections\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e89\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eInflammatory cytokines can activate diverse cell membrane receptors, thus transmitting environmental signals, and in several cell lines, activation of G-protein-coupled-receptors (GPCRs) and receptor tyrosine kinases (RTKs) activate MAPKs (for review, see Kholodenko, 2012)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e90\u003c/span\u003e\u003c/sup\u003e. MAPK cascades signaling are evolutionarily conserved pathways related to the intracellular signal transduction in response to various extracellular stimuli (for review, see Plotnikov et al., 2011)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e91\u003c/span\u003e\u003c/sup\u003e. MAPK controls many cellular processes, such as growth, proliferation, differentiation, motility, stress response, survival, and apoptosis\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e92\u003c/span\u003e\u003c/sup\u003e. All three groups of MAPK (p38; ERK1/2; JNK) can be activated by osmotic perturbations derived from glucose, polyol pathway, oxidative stress, and advanced glycation end products (AGE)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e93\u003c/span\u003e\u003c/sup\u003e. These events are highly involved in the etiology of the DN\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e1\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePBMT reverses the STZ-increased of p38 MAPK gene- and protein expression.\u003c/strong\u003e To examine a possible interaction between the inflammation and MAP kinases, we further assessed MAPKs gene- and protein expression in L4-L5 DRG, once these molecular targets are supposed to be altered in DN, due to a condition imposed by the uncontrolled diabetes\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e93\u003c/span\u003e\u003c/sup\u003e. Before the Real-Time quantitative PCR experiments, primers for target- (p38, ERK1/2, and JNK) and housekeeping genes (endogenous control, Arfgef1, and Serpinb6) were tested for their efficacy by the standard curve construction. It was done through serial dilutions of na\u0026iuml;ve cDNA (1:4; 1:8; 1:16; 1:32; 1:64) and a fixed primer concentration (100 nM). High efficiency was observed for all tested primers, including the endogenous controls (99.9; r\u0026sup2; 0.98) (data not shown). Then, the expression of target genes was normalized by the mean values of Ct (cycle threshold) from a pool of Arfgef1 and Serpinb6 gene expression.\u003c/p\u003e\n\u003cp\u003eIt was observed a significant increase in the expression of p38 mRNA in the STZ group compared to Na\u0026iuml;ve and SCB (vehicle) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01) and SCB\u0026thinsp;+\u0026thinsp;PBMT groups (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; unpaired \u003cem\u003et-test\u003c/em\u003e). In addition, p38 mRNA expression in the hyperalgesic group (STZ) was significantly higher in comparison to the laser-exposed one (STZ\u0026thinsp;+\u0026thinsp;PBMT) (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; unpaired Student \u003cem\u003et-test\u003c/em\u003e), as shown in Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, panel A. Slight differences between the groups regarding ERK1/2 and JNK mRNA expression were not significant (Fig. \u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003e, panels B and C).\u003c/p\u003e\n\u003cp\u003eThe immunofluorescence experiments also found a higher increase in the expression of activated MAPK, especially p-p38, in the STZ group (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, panels H and I). The fluorescence regarding p-38 phosphorylation in the hyperalgesic rats was reduced by the PBMT treatment, as shown in the STZ\u0026thinsp;+\u0026thinsp;PBMT group, in which there was some p-38 activation but in a lower number of neurons in comparison to STZ group (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, panels K and L). For both STZ and STZ\u0026thinsp;+\u0026thinsp;PBMT groups, the activation of p38 was highly concentrated in the nuclei of the DRG afferent neurons, as shown by DAPI co-staining (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, panels I and L in detail). Besides the lower number of p-p38 positive neurons in the STZ\u0026thinsp;+\u0026thinsp;PBMT group, it was also possible to observe as another difference in comparison to the STZ group a higher intensity of fluorescence (represented by green) scattered in neurons cytoplasm with some vesicle-like conformations (Fig. \u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003e, panels K and L in detail).\u003c/p\u003e\n\u003cp\u003eAlso corroborating gene expression results, low phosphorylation of ERK1/2 protein was detected. However, for both laser-treated groups (SCB\u0026thinsp;+\u0026thinsp;PBMT and STZ\u0026thinsp;+\u0026thinsp;PBMT; Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, panels E and K, respectively), the levels of fluorescence-related p-ERK1/2 activation were even lower in comparison to the non-irradiated groups (SCB and STZ; Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e, panels B and H, respectively). An interesting observation regarding the STZ\u0026thinsp;+\u0026thinsp;PBMT group is the presence of p-ERK1/2 accrued in the vicinity of the plasma membrane, as shown in Fig. \u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003e (panels K and L in detail).\u003c/p\u003e\n\u003cp\u003eIn line with the low phosphorylation of ERK1/2 for SCB\u0026thinsp;+\u0026thinsp;PBMT and STZ\u0026thinsp;+\u0026thinsp;PBMT groups, a very low fluorescence intensity regarding p-JNK staining was observed in such irradiated groups (Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e, panels E and K, respectively). For SCB and STZ groups, there was a basal expression of p-JNK, as observed in a diffused way in the cytoplasm, as shown in Fig. \u003cspan class=\"InternalRef\"\u003e7\u003c/span\u003e (panels B and H, respectively).\u003c/p\u003e\n\u003cp\u003eStudies have shown that MAPK activation is linked to allodynia and hyperalgesia in different disease conditions\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e94\u003c/span\u003e\u0026ndash;\u003cspan class=\"CitationRef\"\u003e96\u003c/span\u003e\u003c/sup\u003e. p38-MAPK, the most studied member of MAPK family, is typically activated by extracellular stress and proinflammatory cytokines, with a prominent role in the inflammatory process once there is a significant reduction in inflammation after the systemic administration of p38 pharmacological inhibitor\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e97\u003c/span\u003e\u003c/sup\u003e. A study of 8-12-week STZ-administered rats showed activation of all the main MAPKs (p38; JNK; ERK1/2) in L4-L5 DRG, although with delayed activation of JNK, relative to p38 and ERK1/2\u003csup\u003e41\u003c/sup\u003e. It is well known that TNF-\u0026alpha; and IL-1\u0026beta; play a key role in developing and maintaining pain after peripheral nerve injury\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e98\u003c/span\u003e\u003c/sup\u003e. Consequently, as p38 regulates TNF-\u0026alpha; and IL-1\u0026beta; biosynthesis, both reductions culminate in anti-inflammatory effects with a positive reflex in analgesia\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e99\u003c/span\u003e\u003c/sup\u003e. Therefore, our data showed that PBMT, which can be considered a photophysical and photochemical effector of cell events, promoted a reduction in the concentrations of TNF-\u0026alpha; and IL-1\u0026beta;, associated with less activation (phosphorylation) of p38, which can help explain the analgesic effect of the therapy. p38 has several proinflammatory roles, and systemically administered p38 inhibitors produce anti-inflammatory effects by reducing the synthesis of TNF-\u0026alpha; and IL-1\u0026beta;, as well as COX-2 induction of inflammatory cells\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e,\u003cspan class=\"CitationRef\"\u003e99\u003c/span\u003e\u003c/sup\u003e. Hence, the pharmacological and/or non-pharmacological therapies that reduce the concentration of proinflammatory molecules might reduce the painful condition.\u003c/p\u003e\n\u003cp\u003eThe light modulation against MAPK activation caused by PBMT (He-Ne; 632.8 nm; 4.5 mW; 3 s each 1.8 mm x 1.8 mm square of the tissue-culture plate) was studied by Shefer and colleagues (2001)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e100\u003c/span\u003e\u003c/sup\u003e in skeletal muscle cells, which showed increased levels of ERK1/2 under laser irradiation, and no effect over p38 and JNK expression. Aleksic and collaborators (2010)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e101\u003c/span\u003e\u003c/sup\u003e also verified activation of ERK1/2 in osteoblast cell cultures submitted to laser irradiation (Er: YAG; 2.94 \u0026micro;m; fluence between 0.7\u0026ndash;17.2 J/cm\u0026sup2;), with no effect on p38 and JNK expression. According to Ji et al. (2002)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e99\u003c/span\u003e\u003c/sup\u003e, p38 activation in the DRG is initiated by retrograde transport of nerve growth factor (NGF) release from inflamed tissue. It increases both the translation and the transport of TRPV1 (a polymodal receptor channel) to the peripheral nociceptor terminal, contributing to the maintenance of inflammatory heat pain hypersensitivity. In addition, p-p38 was found mainly in small neurons of the DRG, suggesting a higher activation in type-C sensory fibers.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe p-p38 staining is co-localized to TRPV1 in DRG.\u003c/strong\u003e Complementarily to the immunofluorescence staining of p-p38 in DRG, it was further analyzed whether its expression was involved in a particular type of nerve fibers, i.e., type-C fibers (small DRG neurons; unmyelinated; TRPV1\u003csup\u003e+\u003c/sup\u003e). It was found that TRPV1\u003csup\u003e+\u003c/sup\u003e fibers in all experimental groups and most of the afferent neurons present in DRG sections were classified as type-C, with higher intensity of fluorescence and occurrence in the STZ and STZ\u0026thinsp;+\u0026thinsp;PBMT groups (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e, panels K and O, respectively). The co-staining of p-p38 and TRPV1\u003csup\u003e+\u003c/sup\u003e fibers was widely distributed (Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e, panels L and P, respectively), with a prevalence of TRPV1\u003csup\u003e+\u003c/sup\u003e signal (red) over p-p38 (green) in the STZ\u0026thinsp;+\u0026thinsp;PBMT group, as shown in Fig. \u003cspan class=\"InternalRef\"\u003e8\u003c/span\u003e (panel P, in detail).\u003c/p\u003e\n\u003cp\u003eThe relation between TRPV1 and MAPK is because TRPV1 leads to proliferation through Ca\u003csup\u003e2+\u003c/sup\u003e entry, ATP release, membrane P2Y2 purinergic receptor activation, and the transactivation of epidermal growth factor receptor (EGFR). Thus, the increase in [Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e and the binding of ATP to P2Y2 upregulate the intracellular IP3 via phospholipase C (PLC). The upregulation of IP3 leads to the opening of store-operated channels (SOC), which causes Ca\u003csup\u003e2+\u003c/sup\u003e release from the endoplasmic reticulum (ER). The previous TRPV1-mediated EGFR transactivation prompts Ras/Raf/MAPK signaling (for review, see Zhai et al., 2020)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e102\u003c/span\u003e\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003eTRPV1 is highly expressed in cutaneous nociceptive nerve endings\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e103\u003c/span\u003e\u003c/sup\u003e, being also easily exposed to sunlight and activated by ultraviolet (UV) light. Lee et al. (2009)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e104\u003c/span\u003e\u003c/sup\u003e showed that UV light activates Ca\u003csup\u003e2+\u003c/sup\u003e influx and non-selective cationic current in immortalized human keratinocytes (HaCaT cells), and this activation was suppressed by capsazepine, a TRPV1 antagonist, thus showing an interaction between the Light and TRPV1 channels. In this sense, Wang et al. (2017)\u003csup\u003e\u003cspan class=\"CitationRef\"\u003e105\u003c/span\u003e\u003c/sup\u003e showed that PBMT through a 980 nm laser device (3 J/cm\u0026sup2;; continuous wave) induced a thermal effect and, consequently, the TRPV1 activation in adipose-derived stem cells. Different from our study, during \u003cem\u003ein vitro\u003c/em\u003e studies, local increases in temperature of the cell membrane might be caused by laser irradiation, even using low-level devices. Our histological sections from DRG show activation of TRPV1 in diabetic hyperalgesic rats submitted to PBMT. However, further studies should be done to investigate better the involvement of TRPV1 in the anti-hyperalgesic effect of PBMT observed in our STZ-induced DN model.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePBMT influenced Ca\u003c/strong\u003e \u003csup\u003e\u0026nbsp;\u003cstrong\u003e2+\u003c/strong\u003e\u0026nbsp;\u003c/sup\u003e \u003cstrong\u003edynamics in DRG-cultured neurons.\u003c/strong\u003e Inline, the activation of MAPK pathway and its modulation by PBMT seems to be related to the Ca\u003csup\u003e2+\u003c/sup\u003e dynamics in the DRG environment. An increase in the fluorescence intensity of FLUO-4 AM-stained DRG neurons was observed after the stimuli with 15 mM KCl and, especially, 50 mM KCl for all the groups (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e, panel A). Remarkably, the increased fluorescence regarding the \u0026Delta;[Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e after a 15 mM KCl stimulus was mainly observed in neurons previously maintained in the hyperglycemic medium (High-glucose group) (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e, panels B and C). DRG-neurons kept in hyperglycemic medium (55 mM glucose) and exposed to PBMT (High-glucose\u0026thinsp;+\u0026thinsp;PBMT group) showed significant (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) less intensity of fluorescence during the 15 mM KCl stimulus in comparison to the High-glucose group (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e, panels B and C). During the 50 mM KCl peak, which serves as a control for stimulating the Ca\u003csup\u003e2+\u003c/sup\u003e influx in responsive neurons, the main difference (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) was observed between the fluorescence intensity of the Low-glucose group in comparison to the Low-glucose\u0026thinsp;+\u0026thinsp;PBMT group (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e, panels D and E). When the 50 mM KCl stimulus ceased, the fluorescence intensity decreased in both hyperglycemic groups, although it did not return to basal levels (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e, panels D and E).\u003c/p\u003e\n\u003cp\u003eBeyond the fluorescence intensity (\u0026Delta;[Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e) we also quantify the percentage (%) of 15 mM KCl-responsive cells concerning the total number of neurons responsive to 50 mM KCl (Fig. \u003cspan class=\"InternalRef\"\u003e9\u003c/span\u003e, panel F). The percentage (%) of neurons that responded to the 15 mM KCl molarity concerning all responsive ones was higher in the hyperglycemic group in comparison to the normoglycemic (p\u0026thinsp;\u0026lt;\u0026thinsp;0.001) and to the hyperglycemic\u0026thinsp;+\u0026thinsp;PBMT group (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05). This result suggests that a hyperglycemic medium (55 mM of glucose) sensitizes the DRG-neurons and that sensitization is reduced by the PBMT exposure, which represents one of the possible analgesic mechanisms of the therapy.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003ePBMT might represent a novel therapeutic approach for treating diabetic neuropathic hyperalgesia, based on its beneficial photophysical and photochemical effects against the functional, molecular and cellular alterations observed in such disease, ruled by MAPK pathway and calcium dynamics.\u003c/p\u003e"},{"header":"Materials And Methods","content":"\u003cp\u003e\u003cstrong\u003eEthics statement and animals\u003c/strong\u003e. All experiments were approved by the institutional Committee for Ethics in Animal Use (CEUA/UNICAMP, permit number 5337-1/2019) and followed the ARRIVE guidelines. The experiments were also performed according to the Brazilian National Council for Animal Experimentation Control (CONCEA) and the Brazilian College of Animal Experimentation (COBEA) guidelines. Male Lewis rats (LEW/HsdUnib, Harlan, USA, 1996), 4-8-week-old, weighing 200-250 g, provided by the University\u0026apos;s Multidisciplinary Center for Biological Research (CEMIB) were used. Rats were maintained in plastic cages with sawdust bedding (changed three times a week), in some four per cage, and received food (commercial chow for rodents) and filtered water \u003cem\u003ead libitum\u003c/em\u003e, in a temperature- and humidity-controlled room under 12/12 h dark/light cycle.\u003c/p\u003e\n\u003cp\u003eRats were randomly divided into five experimental groups, consisting of eight rats (n = 8) per group: Na\u0026iuml;ve (intact rats; received no injection and no PBMT); SCB (received five doses of vehicle, 0.1 M sodium citrate buffer, and no PBMT); STZ (received five doses of STZ, 25 mg/kg per dose, and no PBMT); SCB+PBMT (received five doses of the vehicle and were submitted to PBMT); STZ+PBMT (received five doses of STZ and were submitted to PBMT). All efforts were made to minimize the number of rats and their suffering.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eType-1 diabetes was induction through multiple low-doses of streptozotocin (STZ).\u0026nbsp;\u003c/strong\u003eThe type-1 diabetes induction was performed according to previous studies performed by our group\u003csup\u003e66,71-74\u003c/sup\u003e, consisting in a low dose of streptozotocin (25 mg/kg) [STZ; N-(Methylnitrosocarbamoyl)-\u0026alpha;-D-glucosamine; Sigma-Aldrich\u003csup\u003e\u0026reg;\u003c/sup\u003e, St. Louis, MO, USA)], diluted in the vehicle (0.1 M sodium citrate buffer (pH 4.5)) intraperitoneally (i. p.) administered once a day, during five consecutive days (STZ and STZ+PBMT groups). The same volume of vehicle was injected daily in control animals (SCB and SCB+PBMT groups), ranging from 50 to 62.5 \u0026micro;L, according to rats\u0026apos; weight. Blood glucose measurements from the tail vein were performed with an Accu-Chek\u003csup\u003e\u0026reg;\u003c/sup\u003e Sensor Comfort (Roche Diagnostics\u003csup\u003e\u0026reg;\u003c/sup\u003e, Germany). The development of hyperglycemia and the rats\u0026apos; body mass were monitored on days 0, 7, 14, 21, 24, and 28 after starting the STZ or vehicle injections.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eThe electronic von Frey test.\u0026nbsp;\u003c/strong\u003eThe hyperalgesia was measured through the mechanical withdrawal thresholds that were determined by applying the electronic von Frey test (Insight\u003csup\u003e\u0026reg;\u003c/sup\u003e, Ribeir\u0026atilde;o Preto, SP, Brazil) with a polypropylene pipette tip adapted to a hand-held force transducer with crescent pressure in the plantar surface of the right and left rats\u0026apos; hind paws. The equipment automatically transduces the pressure applied to the paw mid-plantar surface into gram-force (g) once the paw is withdrawn. Rats were randomly placed into individual plastic cages with a metal mesh floor, followed by 30 minutes of acclimatization before the test. Electronic von Frey tests were applied to all experimental groups at 0, 7, 14, 21, 24, and 28 days after starting the STZ or vehicle injections, always in the mid-morning period, by a blind examiner to the groups and treatment. For the STZ+PBMT group, an additional analysis was done 19 days after starting the STZ injections to select only hyperalgesic rats for the PBMT exposure.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCatWalk dynamic motor function analysis.\u0026nbsp;\u003c/strong\u003eCatWalk walking track test (Noldus Inc., Wageningen, Netherlands) consists of an illuminated walkway glass floor with a high-speed video camera (Gevicam GP-3360; GEViCAM Inc., Milpitas, CA, USA) equipped with a wide-angle lens (6.0 mm; DF6HA-1B, Fujinon Corp., China). The camera was positioned underneath the walkway at 56 cm, and the CatWalkTM XT 10.6 software automatically recorded the paw prints as the animal crossed the pathway in a calibrated 20 x 10 cm length lane. The green LED plus a red-illuminated background creates a contrast in the glass floor according to animal steps. CatWalk XT configurations were set up according to the parameters used by Vieira et al. (2020)\u003csup\u003e74\u003c/sup\u003e. For the current study we considered the average between the hind paws [right hind paw (RH) and left hind paw (LH)] regarding the Maximum Contact Area (cm\u0026sup2;), Print Area (cm\u0026sup2;), and the Stride Length (cm), which were analyzed at 0, 7, 14, 21, 24, and 28 days after starting STZ or vehicle injections, always in the afternoon with the room lights switched off. Each rat performed 3 runs every analysis period, thus completing 24 runs per group per period.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003ePhotobiomodulation therapy through low-level laser irradiation (904 nm).\u0026nbsp;\u003c/strong\u003eRats from SCB+PBMT and STZ+PBMT groups were submitted to low-level laser irradiation for eight days (from the 21\u003csup\u003est\u003c/sup\u003e to the 28\u003csup\u003eth\u003c/sup\u003e day after STZ or vehicle injections), once a day, always in the morning. For the STZ+PBMT group, only hyperalgesic rats were considered to receive the laser treatment; once in our diabetic neuropathy model, about 20 % of the rats receiving STZ injections did not become hyperalgesic (data not shown). PBMT through low-level laser irradiation was performed with an Endophoton LLT1307 (KLD Biosistemas Equip. Elet. Ltda\u003csup\u003e\u0026reg;\u003c/sup\u003e, Amparo, SP, Brazil) class IIIB laser device. Rats were anesthetized with Isoflurane (3 %) (Crist\u0026aacute;lia\u003csup\u003e\u0026reg;\u003c/sup\u003e, Itapira, SP, Brazil), and the laser irradiation was applied directly on the rat dorsal shaved skin a single point between L4-L5 spine levels, bilaterally. Laser parameters are described in Table 1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 1.\u003c/strong\u003e PBMT parameters.\u003c/p\u003e\n\u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.266173752310536%\"\u003e\n \u003cp\u003e\u003cstrong\u003eLaser\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.88724584103512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eWavelength\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.22365988909427%\"\u003e\n \u003cp\u003e\u003cstrong\u003ePower\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.22365988909427%\"\u003e\n \u003cp\u003e\u003cstrong\u003eOutput\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.399260628465804%\"\u003e\n \u003cp\u003e\u003cstrong\u003eIrradiance\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.266173752310536%\"\u003e\n \u003cp\u003eGaAs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.88724584103512%\"\u003e\n \u003cp\u003e904 nm\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.22365988909427%\"\u003e\n \u003cp\u003e70 mW\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.22365988909427%\"\u003e\n \u003cp\u003e0.001 cm\u0026sup2;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.399260628465804%\"\u003e\n \u003cp\u003e7000 mW/cm\u0026sup2;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.266173752310536%\"\u003e\n \u003cp\u003e\u003cstrong\u003eEmission\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.88724584103512%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTotal energy\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.22365988909427%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTime\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.22365988909427%\"\u003e\n \u003cp\u003e\u003cstrong\u003eContact\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.399260628465804%\"\u003e\n \u003cp\u003e\u003cstrong\u003eTreated area\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"16.266173752310536%\"\u003e\n \u003cp\u003eContinuous\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"20.88724584103512%\"\u003e\n \u003cp\u003e2.03 J\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.22365988909427%\"\u003e\n \u003cp\u003e29\u0026rdquo; per point\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"19.22365988909427%\"\u003e\n \u003cp\u003eDirect\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"24.399260628465804%\"\u003e\n \u003cp\u003e~ 1.0 cm\u0026sup2;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e\n\u003cp\u003eGaAs = Gallium-Arsenide; nm = nanometers; mW = milliWatts; J = Joule; (\u0026rdquo;) = seconds; cm\u0026sup2; = square centimeters; mW/cm\u0026sup2; = milliWatts per square centimeter.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDRG collection, tissue preparation, and homogenization.\u0026nbsp;\u003c/strong\u003eFor the analyses of inflammatory cytokines levels and MAPK gene expression, rats were anesthetized under Isoflurane (3 %) (Crist\u0026aacute;lia\u003csup\u003e\u0026reg;\u003c/sup\u003e) and humanely euthanized. After dissection, L4 and L5 DRG were collected, snap-frozen in liquid nitrogen (-196.15 \u0026ordm;C), and stored at -80 \u0026ordm;C for posterior homogenization. To the DRG samples for ELISA immunoassays were added RIPA Lysis and Extraction Buffer (Thermo Scientific\u003csup\u003eTM\u003c/sup\u003e, Waltham, MA, USA), containing sodium orthovanadate, protease inhibitor, and PMSF (phenylmethanesulfonyl fluoride) (Thermo Scientific\u003csup\u003eTM\u003c/sup\u003e). Samples were placed in a FastPrep\u003csup\u003e\u0026reg;\u003c/sup\u003e homogenizer (MP Biomedicals\u003csup\u003eTM\u003c/sup\u003e, Santa Ana, CA, USA) and then were shaken at 4 \u0026ordm;C (5 x 20 seconds) between 5 minutes intervals. After that, homogenized DRG were kept under continuous agitation for 3 hours at 4 \u0026ordm;C and then centrifuged at 12,000 rpm for 15 minutes at 4 \u0026ordm;C. The resulting supernatant was transferred to a new tube. Protein concentrations were measured through the Bradford assay\u003csup\u003e106\u003c/sup\u003e.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;For MAPK gene expression through real-time RT-qPCR, DRG were fragmented and homogenized in TRIzol\u003csup\u003e\u0026reg;\u003c/sup\u003e (Invitrogen Life Technologies\u003csup\u003eTM\u003c/sup\u003e, Carlsbad, CA,\u0026nbsp;USA) (1 mL/mg) for isolating the total RNA, according to the manufacturer\u0026apos;s instructions. To the homogenate were added 0.2 mL of chloroform (Sigma-Aldrich\u003csup\u003e\u0026reg;\u003c/sup\u003e), and after 3 minutes of resting at room temperature, it was centrifuged at 12,000 rpm for 15 minutes at 4 \u0026ordm;C. The aqueous phase was transferred to a new tube, in which 0.5 mL of isopropanol was added. After new centrifugation, the pellet was washed with 75 % ethanol, and the total RNA was resuspended in UltraPure\u003csup\u003eTM\u003c/sup\u003e DEPC-treated water (Thermo Scientific\u003csup\u003eTM\u003c/sup\u003e). Total DRG RNA was quantified using an ultra-low-volume spectrophotometer (Epoch Microplate Spectrometer, BioTek Instruments Inc., Winooski, VT, USA). \u0026nbsp; \u0026nbsp; \u0026nbsp; \u0026nbsp;\u003c/p\u003e\n\u003cp\u003eFor DRG immunofluorescence, rats were anesthetized with ketamine (85 mg/kg, i. p.) and xylazine (10 mg/kg, i. p.) and then exsanguinated via cardiac perfusion (through the ascending aorta) with saline solution (0.9 % NaCl, 200 mL). After exsanguination, rats were perfused with 4 % paraformaldehyde (PFA, pH 7.4, 4 \u0026ordm;C, 300 mL). After finishing the perfusion, L4 and L5 DRG were collected and post-fixed in 4 % PFA overnight at 4 \u0026ordm;C, followed by 48 h in 30 % sucrose at 4 \u0026ordm;C. Individual DRG were embedded in Tissue-Tek\u003csup\u003e\u0026reg;\u003c/sup\u003e O.C.T. compound (Sakura\u003csup\u003e\u0026reg;\u003c/sup\u003e Finetek, CA, USA), and 14 \u0026micro;m non-serial sections were made on a cryostat (Leica Biosystems, Wetzlar, Germany) using gelatinized slides.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eELISA immunoassay for measuring the cytokines concentrations (IL-1\u0026beta;, TNF-\u0026alpha;, IL-6, CINC-1 and IL-10).\u0026nbsp;\u003c/strong\u003eThe levels of pro- (IL-1\u0026beta;, TNF-\u0026alpha;, IL-6, and CINC-1) and anti-inflammatory (IL-10) cytokines were measured by enzyme-linked immunosorbent assay (ELISA). For IL-1\u0026beta;, TNF-\u0026alpha;, IL-6, and CINC-1 were used 96-well-plates through the DuoSet\u003csup\u003e\u0026reg;\u003c/sup\u003e ELISA kit (R\u0026amp;D Systems, Minneapolis, MN, USA), and the results were expressed in picograms per milliliter (pg/mL). For the IL-10, concentrations were measured through the RayBio\u003csup\u003e\u0026reg;\u003c/sup\u003e Rat IL-10 ELISA kit (#ELR-IL10) (RayBiotech, Peachtree Corners, GA, USA), and the results were expressed in picograms per milliliter per milligram (pg/mL/mg) of tissue. The manufacturer\u0026apos;s instructions were followed for both ELISA immunoassay kits. The absorbance was determined at 450 nm using an Asys UVM 340 microplate reader (Biochrom Ltd., Cambridge, UK), and the results were obtained by comparing the optical density to the standard-curve densities.\u003c/p\u003e\n\u003cp\u003e\u0026nbsp;\u003cstrong\u003eReal-time quantitative RT-PCR for MAPK gene expression.\u0026nbsp;\u003c/strong\u003e500 ng of total RNA extracted from L4 and L5 DRG were subjected to cDNA synthesis (SuperScript\u003csup\u003eTM\u003c/sup\u003e VILO\u003csup\u003eTM\u003c/sup\u003e cDNA Synthesis Kit, Invitrogen Life Technologies\u003csup\u003eTM\u003c/sup\u003e) according to the manufacturer\u0026apos;s protocol. Specific primers for p38-MAPK, ERK1/2, JNK, Arfgef1, and Serpinb6 genes were designed with the \u0026quot;\u003cem\u003ePick Primers\u003c/em\u003e,\u0026quot; available on NCBI/Primer-blast (http://www.ncbi.nlm.nih.gov/tools/primer-blast) and synthesized commercially. The amplicons were set to less than 200 base pairs, and dimers, cross-dimers, and hairpins were eliminated during primers design (or were kept to a minimum). Primer sequences are described in Table 2. The annealing temperature was set at 60 \u0026ordm;C, and the GC (guanine-cytosine) content was 50-55 %.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eTable 2\u003c/strong\u003e. 5\u0026apos;-3\u0026apos;gene sequences.\u003c/p\u003e\n\u003cdiv align=\"center\"\u003e\n \u003ctable border=\"1\" cellpadding=\"0\" cellspacing=\"0\" width=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"23.232323232323232%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGene\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.505050505050505%\"\u003e\n \u003cp\u003e\u003cstrong\u003eSequence\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"26.262626262626263%\"\u003e\n \u003cp\u003e\u003cstrong\u003eGenBank\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" width=\"23.232323232323232%\"\u003e\n \u003cp\u003ep38\u003csup\u003e(#)\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.505050505050505%\"\u003e\n \u003cp\u003e\u003cstrong\u003eFW:\u003c/strong\u003e GGCTGACATAATCCACAGGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" width=\"26.262626262626263%\"\u003e\n \u003cp\u003eNM_031020.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003eRV:\u003c/strong\u003e CCGGTCATTTCGTCATCAGT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" width=\"23.232323232323232%\"\u003e\n \u003cp\u003eERK1/2\u003csup\u003e(#)\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.505050505050505%\"\u003e\n \u003cp\u003e\u003cstrong\u003eFW:\u003c/strong\u003e TGTGTTCAGCTCAGACTTCC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" width=\"26.262626262626263%\"\u003e\n \u003cp\u003eNM_133283.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003eRV:\u003c/strong\u003e CGTTTGATGAAGGCATGGTT\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" width=\"23.232323232323232%\"\u003e\n \u003cp\u003eJNK\u003csup\u003e(#)\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.505050505050505%\"\u003e\n \u003cp\u003e\u003cstrong\u003eFW:\u003c/strong\u003e TGCTACTTGCCAATCCCATC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" width=\"26.262626262626263%\"\u003e\n \u003cp\u003eNM_053829.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003eRV:\u003c/strong\u003e AGATAACAGGGTGTCCGCTA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" width=\"23.232323232323232%\"\u003e\n \u003cp\u003eArfgef1\u003csup\u003e(*)\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.505050505050505%\"\u003e\n \u003cp\u003e\u003cstrong\u003eFW:\u003c/strong\u003e CAACAGGTTTAAAGCTCACGCA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" width=\"26.262626262626263%\"\u003e\n \u003cp\u003eNM_001277056.1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003eRV:\u003c/strong\u003e TCCTGTTCAGGTGGTTGTGA\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd rowspan=\"2\" width=\"23.232323232323232%\"\u003e\n \u003cp\u003eSerpinb6\u003csup\u003e(*)\u003c/sup\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.505050505050505%\"\u003e\n \u003cp\u003e\u003cstrong\u003eFW:\u003c/strong\u003e GAGTCTAGGGTACGTTCTGCTG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd rowspan=\"2\" width=\"26.262626262626263%\"\u003e\n \u003cp\u003eNM_199085.2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"100%\"\u003e\n \u003cp\u003e\u003cstrong\u003eRV:\u003c/strong\u003e TCCATGATGGTGAACCTGCCC\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n \u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003e\u003csup\u003e(#)\u0026nbsp;\u003c/sup\u003etarget genes; \u003csup\u003e(*)\u003c/sup\u003e housekeeping; FW = forward; RV = reverse.\u003c/p\u003e\n\u003cp\u003eThe 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e method\u003csup\u003e107\u003c/sup\u003e performed relative gene expression analysis to an internal control index. The reactions were carried out at the StepOne Plus Real-Time PCR (Applied Biosystems, Foster City, CA, USA) using SYBR Green as a fluorescent signal (Power SYBR\u0026trade; Green PCR Master Mix, Applied Biosystems, USA) and 1:10 of the obtained cDNA from each sample.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDRG immunofluorescence for detection of phosphorylated MAPKs.\u0026nbsp;\u003c/strong\u003eDRG sections were incubated in 0.1 M glycine for 30 minutes, followed by a blockage with 2 % bovine serum albumin (BSA) and permeabilization in 0.2 % Triton X-100 for 1 hour at room temperature. For anti-phospho-p44/42 MAPK (ERK 1/2) and anti-phospho-SAPK/JNK, an additional step was done before the 2 % BSA blocking, consisting of methanol 100 % permeabilization at -20 \u0026ordm;C. Then, sections were incubated in 0.1 M PBS plus 0.1 % Triton-100 and 1 % BSA overnight in a humid atmosphere at 4 \u0026ordm;C with the specific primary antibodies. The following antibodies were used: anti-phospho-p38 MAPK (Thr180/Tyr182) (D3F9) XP\u003csup\u003e\u0026reg;\u003c/sup\u003e Rabbit mAb (1:500); anti-phospho-p44/42 MAPK (ERK 1/2) (Thr202/Tyr204) (D13.14.4E) XP\u003csup\u003e\u0026reg;\u003c/sup\u003e Rabbit mAb (1:200); and anti-phospho-SAPK/JNK (Th183/Tyr185) (G9) Mouse mAb (1:400), all from Cell Signaling Technology\u003csup\u003e\u0026reg;\u003c/sup\u003e (Danvers, MA, USA). After the incubation period, the sections were washed twice in the same incubation solution (without the antibodies) and then washed 5 times in 0.1 M PBS, 5 minutes each time. Sections were then incubated with the secondary antibodies (donkey anti-rabbit or anti-mouse Alexa 488, 1:1000, #A21206, Thermo Fisher) diluted in the same primary antibody solution for 1 hour at room temperature. After incubation, DRG sections were washed with 0.1 M PBS five times for 5 minutes.\u003c/p\u003e\n\u003cp\u003eNuclei were stained with 4\u0026prime;,6-Diamidino-2-phenylindole dihydrochloride (DAPI, 0.25 \u0026micro;g/mL, D9542, Sigma\u0026ndash;Aldrich) diluted in 0.1 M PBS, for 10 minutes at room temperature. After confirming the positive fluorescence, the final images were obtained in a Zeiss Axio Observer Z1 LSM780-NLO (Carl Zeiss AG, Oberkochen, Germany) confocal laser-scanning microscope, with the aid of the EC Plan-Neofluar 20x/0.50 Dry and EC Plan-Neofluar 40x/1.30 Oil DIC objective lens, in the National Institute of Science and Photonics Technology Applied to Cellular Biology (INFABiC/UNICAMP, Campinas, SP, Brazil). Thus, the sections were coverslipped using Vectashield\u0026reg; (Vector Laboratories, Burlingame, CA, USA). Negative controls were prepared without incubation in primary antibodies to confirm that there was no non-specific binding of the secondary antibodies. Sections were first examined in an epifluorescence inverted Leica DMI 600B microscope coupled with a DFC360FX camera and a Leica fluorescent Light source CTR7000HS (Leica Microsystems).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDRG primary cell culture.\u0026nbsp;\u003c/strong\u003ePrimary cell culture of DRG neurons was performed according to the protocol described by Linhart and colleagues (2003)\u003csup\u003e108\u0026nbsp;\u003c/sup\u003eand modified by our research group as published by Manzo et al. (2017)\u003csup\u003e109\u0026nbsp;\u003c/sup\u003eand do Prado et al. (2020)\u003csup\u003e73\u003c/sup\u003e. Healthy male Lewis rats (LEW/HsdUnib, Harlan, USA, 1996) were used for 4-weeks-old, weighing about 200 g. Rats were humanely euthanized under deep anesthesia (3 % Isoflurane; Crist\u0026aacute;lia\u003csup\u003e\u0026reg;\u003c/sup\u003e) followed by decapitation. Sixteen to twenty thoracic and lumbar DRGs were collected and placed in\u0026nbsp;Hank\u0026apos;s Balanced Salt Solution (HBSS, containing 10 mM of HEPES). Then, cells were dissociated by incubation with HBSS containing 0.28 U/mL of collagenase type II for 60 minutes at 37 \u0026ordm;C followed by 6 minutes in 0.25 mg/mL trypsin. For inhibiting trypsin action, cells were washed twice in DMEM supplemented with fetal bovine serum (FBS; 10 %), 50 U/mL of penicillin, and 50 mg/mL of streptomycin. Mechanically-dissociated cells were plated on laminin and poly-D-lysine-coated coverslips and maintained at 37 \u0026ordm;C and 5 % CO\u003csub\u003e2\u003c/sub\u003e. All cell culture supplies were purchased from Sigma-Aldrich\u003csup\u003e\u0026reg;\u003c/sup\u003e except FBS, which was purchased from Vitrocell Embriolife (Campinas, SP, Brazil).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCalcium imaging.\u0026nbsp;\u003c/strong\u003eAfter completing 24 hours of incubation under normoglycemic (5.5 mM of glucose) or hyperglycemic (55 mM of glucose) cell medium, sensory DRG neurons were exposed to PBMT with the same parameters described in Table 1 but with indirect contact through the \u0026quot;\u003cem\u003eswiping motion\u003c/em\u003e,\u0026quot; where the laser probe output was kept in a distance of 1 cm far from the cell medium. Immediately after the irradiation, DRG-cultured neurons were incubated in HBSS containing 10 \u0026micro;M of FLUO-4, AM, and 1 % PowerLoad (Thermo Fisher) for 40 minutes, protected from the Light at 37 \u0026ordm;C and 5 % CO\u003csub\u003e2\u003c/sub\u003e. Coverslips were inserted into a perfusion chamber (Warner Instruments, Holliston,\u0026nbsp;MA, USA) and placed on an inverted Leica DMI 600B microscope coupled to a DFC360FX camera and a Leica fluorescent Light source CTR7000HS (480 nm excitation, 527/30 nm suppression filters) (Leica Microsystems). A computer-controlled valve system (Warner Instruments) was used for cell perfusion with different KCl molarities [5 mM (basal), 15 mM (partial), and 50 mM (maximum)], and the flow rate was set at 5 mL/minute (complete change of chamber volume every 2 seconds)\u003csup\u003e73,109\u003c/sup\u003e. Images were taken at the rate of one image per second, and the values of fluorescence intensity, \u0026Delta;[Ca\u003csup\u003e2+\u003c/sup\u003e]\u003csub\u003ei\u003c/sub\u003e, were normalized by \u0026Delta;F/F0, where \u0026Delta;F equals the final fluorescence (F) minus the basal fluorescence (F0). Data were also presented as the percentage of 15 mM KCl-responsive cells\u0026nbsp;about the total number of cells responsive to 50 mM KCl, in four distinct situations: (i) when cells were incubated in low-glucose; (ii) low-glucose plus PBMT; (iii) high-glucose or (iv) high-glucose plus PBMT.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis.\u0026nbsp;\u003c/strong\u003eFor comparisons between groups and treatment time, we used Two-way ANOVA followed by Bonferroni post-\u003cem\u003ehoc\u003c/em\u003e test. One-way ANOVA made other comparisons between three or more groups, followed by Bonferroni post-\u003cem\u003ehoc\u003c/em\u003e test. For comparisons between only two groups, we used an unpaired Student \u003cem\u003et-test\u003c/em\u003e. p \u0026lt; 0.05 (*), p \u0026lt; 0.01 (**), and p \u0026lt; 0.001 (***) were considered statistically significant. All statistical tests were performed on the GraphPad Prism\u003csup\u003e\u0026reg;\u003c/sup\u003e software, versions 5 and 7. Numerical values were expressed as mean \u0026plusmn; standard error of the mean (SEM).\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eCompliance with ethical standards\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll experiments were approved by the institutional Committee for Ethics in Animal Use (CEUA/UNICAMP, permit number 5337-1/2019) and followed the ARRIVE guidelines. The experiments were also performed according to the Brazilian National Council for Animal Experimentation Control (CONCEA) and the Brazilian College of Animal Experimentation (COBEA) guidelines.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data that support the findings of this study are available upon request from the corresponding author [WFV].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eS\u0026atilde;o Paulo Research Foundation financed this study (FAPESP) (Grants #2014/25153-7; #2015/12673-5; #2018/05108-8) and by Coordination for the Improvement of Higher Education Personnel (CAPES). We wish to thank the National Institute of Science and Photonics Technology Applied to Cellular Biology (INFABiC) for support on imaging acquisition; we also thank C\u0026eacute;sar Eduardo Bissoto for all technical support.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWFV and CAP designed the study; WFV, KFM, SFM, JBPL, GGS, CMN carried out the experiments; WFV, ALRO, MACH, CHT, and CAP drafted the manuscript. All authors critically reviewed the manuscript and approved it for submission.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare they have no conflict of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003e\u003cspan\u003eFeldman, E. L., Nave, K., Jensen, T. S. \u0026amp; Bennett, D. L. H. New horizons in diabetic neuropathy: mechanisms, bioenergetics, and pain. Neuron. \u003cstrong\u003e93\u003c/strong\u003e, 1296\u0026ndash;1313 (2017).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eCallaghan, B. C., Cheng, H. T., Stables, C. L., Smith, A. L. \u0026amp; Feldman, E. L. Diabetic neuropathy: clinical manifestations and current treatments. Lancet Neurol. \u003cstrong\u003e11\u003c/strong\u003e, 521\u0026ndash;534 (2012).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eJensen, T. S. \u0026amp; Finnerup, N. B. Allodynia and hyperalgesia in neuropathic pain: clinical manifestations and mechanisms. Lancet Neurol. \u003cstrong\u003e13\u003c/strong\u003e, 924\u0026ndash;935 (2014).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eTruini, A., Garcia-Larrea, L. \u0026amp; Cruccu, G. Reappraising neuropathic pain in humans \u0026mdash; how symptoms help disclose mechanisms. Nat. Rev. Neurol. \u003cstrong\u003e9\u003c/strong\u003e, 572\u0026ndash;582 (2013).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eGandhi, R. A. \u0026amp; Selvarajah, D. Understanding and treating painful diabetic neuropathy: time for a paradigm shift. Diabet. Med. \u003cstrong\u003e32\u003c/strong\u003e, 771\u0026ndash;777 (2015).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHarris, K., Boland, C., Meade, L. \u0026amp; Battise, D. Adjunctive therapy for glucose control in patients with type 1 diabetes. Diabetes Metab. Syndr. Obes. \u003cstrong\u003e11\u003c/strong\u003e, 159\u0026ndash;173 (2018).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eYagihashi, S., Mizukami, H. \u0026amp; Sugimoto, K. Mechanism of diabetic neuropathy: Where are we now and where to go? J. Diabetes Investig. \u003cstrong\u003e2\u003c/strong\u003e, 18\u0026ndash;32 (2011).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLee, A. Y. \u0026amp; Chung, S. S. Contributions of polyol pathway to oxidative stress in diabetic cataract. FASEB J. \u003cstrong\u003e13\u003c/strong\u003e, 23\u0026ndash;30 (1999).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBrownlee, M. Biochemistry and molecular cell biology of diabetic complications. Nature. \u003cstrong\u003e414\u003c/strong\u003e, 813\u0026ndash;820 (2001).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eYan, L-J. Pathogenesis of chronic hyperglycemia: from reductive stress to oxidative stress. \u003cem\u003eJ. Diabetes Res\u003c/em\u003e. 2014, 137919 (2014).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSchreiber, A. K., Nones, C. F. M., Reis, R. C., Chichorro, J. G. \u0026amp; Cunha, J. M. Diabetic neuropathic pain: Physiopathology and treatment. World J Diabetes. \u003cstrong\u003e6\u003c/strong\u003e, 432\u0026ndash;444 (2015).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eThornalley, P. J. Glycation in diabetic neuropathy: characteristics, consequences, causes, and therapeutic options. Int. Rev. Neurobiol. \u003cstrong\u003e50\u003c/strong\u003e, 37\u0026ndash;57 (2002).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eJuranek, J., Ray, R., Banach, M. \u0026amp; Rai, V. Receptor for advanced glycation end-products in neurodegenerative diseases a bad reputation. Rev. Neurosci. \u003cstrong\u003e26\u003c/strong\u003e, 691\u0026ndash;698 (2015).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eGreene, D. A., Stevens, M. J., Obrosova, I. \u0026amp; Feldman, E. L. Glucose-induced oxidative stress and programmed cell death in diabetic neuropathy. Eur. J. Pharmacol. \u003cstrong\u003e375\u003c/strong\u003e, 217\u0026ndash;223 (1999).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003ePop-Busui, R., Sima, A. \u0026amp; Stevens, M. Diabetic neuropathy and oxidative stress. Diabetes Metab. Res. Rev. \u003cstrong\u003e22\u003c/strong\u003e, 257\u0026ndash;273 (2006).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eIshii, D. N. \u0026amp; Lupien, S. B. Insulin-like growth factors protect against diabetic neuropathy: effects on sensory nerve regeneration in rats. J. Neurosci. Res. \u003cstrong\u003e40\u003c/strong\u003e, 138\u0026ndash;144 (1995).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eFernyhough, P. \u0026amp; Calcutt, N. A. Abnormal calcium homeostasis in peripheral neuropathies. Cell Calcium. \u003cstrong\u003e47\u003c/strong\u003e, 130\u0026ndash;139 (2010).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eKoya, D., \u003cem\u003eet al\u003c/em\u003e. Characterization of protein kinase C beta isoform activation on the gene expression of transforming growth factor-beta, extracellular matrix components, and prostanoids in the glomeruli of diabetic rats. J. Clin. Invest. \u003cstrong\u003e100\u003c/strong\u003e, 115\u0026ndash;126 (1997).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAkude, E., \u003cem\u003eet al\u003c/em\u003e. Diminished superoxide generation is associated with respiratory chain dysfunction and changes in the mitochondrial proteome of sensory neurons from diabetic rats. Diabetes. \u003cstrong\u003e60\u003c/strong\u003e, 288\u0026ndash;297 (2011).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eChowdhury, S. K. R., \u003cem\u003eet al\u003c/em\u003e. Mitochondrial respiratory chain dysfunction in dorsal root ganglia of streptozotocin-induced diabetic rats and its correction by insulin treatment. Diabetes. \u003cstrong\u003e59\u003c/strong\u003e, 1082\u0026ndash;1091 (2010).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eYounger, D. S., Rosoklija, G., Hays, A. P., Trojaborg, W. \u0026amp; Latov, N. Diabetic peripheral neuropathy: a clinicopathologic and immunohistochemical analysis of sural nerve biopsies. Muscle Nerve. \u003cstrong\u003e19\u003c/strong\u003e, 722\u0026ndash;727 (1996).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eTomlinson, D. R. \u0026amp; Gardiner, N. J. Diabetic neuropathies: components of etiology. J. Peripher. Nerv. Syst. \u003cstrong\u003e13\u003c/strong\u003e, 112\u0026ndash;121 (2008).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSatoh, J., Yagihashi, S. \u0026amp; Toyota, T. The possible role of tumor necrosis factor-\u0026alpha; in diabetic polyneuropathy. Exp. Diabesity Res. \u003cstrong\u003e4\u003c/strong\u003e, 65\u0026ndash;71 (2003).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eYamagishi, S-I., \u003cem\u003eet al\u003c/em\u003e. Correction of protein kinase C activity and macrophage migration in peripheral nerve by pioglitazone, peroxisome proliferator activated-gamma-ligand, in insulin-deficient diabetic rats. J. Neurochem. \u003cstrong\u003e104\u003c/strong\u003e, 491\u0026ndash;499 (2008).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eDu, Y., \u003cem\u003eet al\u003c/em\u003e. Effects of p38 MAPK inhibition on early stages of diabetic retinopathy and sensory nerve function. Invest. Ophthalmol. Vis. Sci. \u003cstrong\u003e51\u003c/strong\u003e, 2158\u0026ndash;2164 (2010).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSeger, R. \u0026amp; Krebs, E. G. The MAPK signaling cascade. FASEB J. \u003cstrong\u003e9\u003c/strong\u003e, 726\u0026ndash;735 (1995).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLewis, T. S., Shapiro, P. S. \u0026amp; Ahn, N. G. Signal transduction through MAP kinase cascades. Adv. Cancer Res. \u003cstrong\u003e74\u003c/strong\u003e, 49\u0026ndash;139 (1993).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eWidmann, C., Gibson, S., Jarpe, M. B. \u0026amp; Johnson, G. L. Mitogen-activated protein kinase: conservation of a three-kinase module from yeast to human. Physiol. Rev. \u003cstrong\u003e79\u003c/strong\u003e, 143\u0026ndash;180 (1999).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eObata, K. \u0026amp; Noguchi, K. MAPK activation in nociceptive neurons and pain hypersensitivity. Life Sci. \u003cstrong\u003e74\u003c/strong\u003e, 2643\u0026ndash;2653 (2004).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eJohnson, G. L. \u0026amp; Lapadat, R. Mitogen-activated protein kinase pathways mediated by ERK, JNK, and p38 protein kinases. Science. \u003cstrong\u003e298\u003c/strong\u003e, 1911\u0026ndash;1912 (2002).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eKrishna, M. \u0026amp; Narang, H. The complexity of mitogen-activated protein kinases (MAPKs) made simple. Cell Mol. Life Sci. \u003cstrong\u003e65\u003c/strong\u003e, 3525\u0026ndash;3544 (2008).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eYang, S-H., Sharrocks, A. D. \u0026amp; Whitmarsh, A. J. Transcriptional regulation by the MAP kinase signaling cascades. Gene. \u003cstrong\u003e320\u003c/strong\u003e, 3\u0026ndash;21 (2003).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBonny, C., Borsello, T. \u0026amp; Zine, A. Targeting the JNK pathway as a therapeutic protective strategy for nervous system diseases. Rev. Neurosci. \u003cstrong\u003e67\u003c/strong\u003e, 57\u0026ndash;67 (2005).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eTsuda, M., Ueno, H., Kataoka, A., Tozaki-Saitoh, H. \u0026amp; Inoue, K. Activation of dorsal horn microglia contributes to diabetes-induced tactile allodynia via extracellular signal-regulated protein kinase signaling. Glia. \u003cstrong\u003e56\u003c/strong\u003e, 378\u0026ndash;386 (2008).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eWodarski, R., Clark, A. K., Grist, J., Marchand, F. \u0026amp; Malcangio, M. Gabapentin reverses microglial activation in the spinal cord of streptozotocin-induced diabetic rats. Eur. J. Pain, \u003cstrong\u003e13\u003c/strong\u003e, 807\u0026ndash;811 (2009).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eManning, A. M. \u0026amp; Davis, R. J. Targeting JNK for therapeutic benefit: from junk to gold? Nat. Rev. Drug Discov. \u003cstrong\u003e2\u003c/strong\u003e, 554\u0026ndash;565 (2003).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAgell, N., Bachs, O., Rocamora, N. \u0026amp; Villalonga, P. Modulation of the Ras/Raf/MEK/ERK pathway by Ca(2+), and calmodulin. Cell Signal. \u003cstrong\u003e4\u003c/strong\u003e, 649\u0026ndash;654 (2002).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eWhite, C. D. \u0026amp; Sacks, D. B. Regulation of MAP kinase signaling by calcium. Methods Mol. Biol. \u003cstrong\u003e661\u003c/strong\u003e, 151\u0026ndash;165 (2010).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eRosen, L. B., Ginty, D. D., Weber, M. J. \u0026amp; Greenberg, M. E. Membrane depolarization and calcium influx stimulate MEK and MAP kinase via activation of Ras. Neuron. \u003cstrong\u003e12\u003c/strong\u003e, 1207\u0026ndash;1221 (1994).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003ePurves, T., \u003cem\u003eet al\u003c/em\u003e. A role for mitogen-activated protein kinases in the etiology of diabetic neuropathy. FASEB J. \u003cstrong\u003e15\u003c/strong\u003e, 2508\u0026ndash;2514 (2001).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003ePrice, S. A., Agthong, S., Middlemas, A. B. \u0026amp; Tomlinson, D. R. Mitogen-activated protein kinase p38 mediates reduced nerve conduction velocity in experimental diabetic neuropathy: interactions with aldose reductase. Diabetes. \u003cstrong\u003e53\u003c/strong\u003e, 1851\u0026ndash;1856 (2004).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eTsuda, M., Mizokoshi, A., Shigemoto-Mogami, Y., Koizumi, S. \u0026amp; Inoue, K. Activation of p38 mitogen-activated protein kinase in spinal hyperactive microglia contributes to pain hypersensitivity following peripheral nerve injury. Glia. \u003cstrong\u003e45\u003c/strong\u003e, 89\u0026ndash;95 (2004).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eDaulhac, L., \u003cem\u003eet al\u003c/em\u003e. Diabetes-induced mechanical hyperalgesia involves spinal mitogen-activated protein kinase activation in neurons and microglia via N-methyl-D-aspartate-dependent mechanisms. Mol. Pharmacol. \u003cstrong\u003e70\u003c/strong\u003e, 1246\u0026ndash;1254 (2006).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003ePiao, Z. G., \u003cem\u003eet al\u003c/em\u003e. Activation of glia and microglial p38 MAPK in medullary dorsal horn contributes to tactile hypersensitivity following trigeminal sensory nerve injury. Pain. \u003cstrong\u003e121\u003c/strong\u003e, 219\u0026ndash;231 (2006).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eXu, J-T., \u003cem\u003eet al\u003c/em\u003e. p38 activation in uninjured primary afferent neurons and in spinal microglia contributes to the development of neuropathic pain induced by selective motor fiber injury. Exp. Neurol. \u003cstrong\u003e204\u003c/strong\u003e, 355\u0026ndash;365 (2007).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eCheng, H-L. \u0026amp; Feldman, E. L. Bidirectional regulation of p38 kinase and c-Jun N-terminal protein kinase by insulin-like growth factor-I. J. Biol. Chem. \u003cstrong\u003e273\u003c/strong\u003e, 14560\u0026ndash;14565 (1998).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eCheng, C. \u0026amp; Zochodne, D. W. Sensory neurons with activated caspase-3 survive long-term experimental diabetes. Diabetes. \u003cstrong\u003e52\u003c/strong\u003e, 2363\u0026ndash;2371 (2003).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eVincent, A. M., McLean, L. L., Backus, C. \u0026amp; Feldman, E. L. Short-term hyperglycemia produces oxidative damage and apoptosis in neurons. FASEB J. \u003cstrong\u003e19\u003c/strong\u003e, 638\u0026ndash;640 (2005).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSenning, E. N. \u0026amp; Gordon, S. E. Activity and Ca\u003csup\u003e2+\u003c/sup\u003e regulate the mobility of TRPV1 channels in the plasma membrane of sensory neurons. eLife. \u003cstrong\u003e4\u003c/strong\u003e, e03819 (2015).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eWay, K. J., Katai, N. \u0026amp; King, G. L. Protein kinase C and the development of diabetic vascular complications. Diabet. Med. \u003cstrong\u003e18\u003c/strong\u003e, 945\u0026ndash;959 (2001).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003ePabbidi, R. M., \u003cem\u003eet al\u003c/em\u003e. Influence of TRPV1 on diabetes-induced alterations in thermal pain sensitivity. Mol. Pain. \u003cstrong\u003e4\u003c/strong\u003e, 1\u0026ndash;17 (2008).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHolanda, V. M., Chavantes, M. C., Wu, X. \u0026amp; Anders, J. J. The mechanistic basis for photobiomodulation therapy of neuropathic pain by near infrared laser light. Lasers Surg. Med. \u003cstrong\u003e49\u003c/strong\u003e, 516\u0026ndash;524 (2017).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003ePassarella, S. \u0026amp; Karu, T. Absorption of monochromatic and narrow band radiation in the visible and near IR by both mitochondrial and non-mitochondrial photoacceptors results in photobiomodulation. J. Photochem. Photobiol. B. \u003cstrong\u003e140\u003c/strong\u003e, 344\u0026ndash;358 (2014).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eTsai, S-R. \u0026amp; Hamblin, M. R. Biological effects and medical applications of infrared radiation. J. Photochem. Photobiol. B. \u003cstrong\u003e170\u003c/strong\u003e, 197\u0026ndash;207 (2017).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAnders, J. J., Lanzafame, R. J. \u0026amp; Arany, P. R. Low-level light/laser therapy versus photobiomodulation therapy. Photomed. Laser Surg. \u003cstrong\u003e33\u003c/strong\u003e, 183\u0026ndash;184 (2015).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eChung, H., \u003cem\u003eet al\u003c/em\u003e. The nuts and bolts of low-level laser (Light) therapy. Ann. Biomed. Eng. \u003cstrong\u003e40\u003c/strong\u003e, 516\u0026ndash;533 (2012).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHamblin, M. R. Mechanisms and mitochondrial redox signaling in photobiomodulation. Photochem. Photobiol. \u003cstrong\u003e94\u003c/strong\u003e, 199\u0026ndash;212 (2018).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAlc\u0026acirc;ntara, C. C., \u003cem\u003eet al\u003c/em\u003e. Effect of low-level laser therapy (LLLT) on acute neural recovery and inflammation-related gene expression after crush injury in rat sciatic nerve. Lasers Surg. Med. \u003cstrong\u003e45\u003c/strong\u003e, 246\u0026ndash;252 (2013).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eChow, R. T., Johnson, M. I., Lopes-Martins, R. A. B. \u0026amp; Bjordal, J. M. Efficacy of low-level laser therapy in the management of neck pain: a systematic review and meta-analysis of randomised placebo or active-treatment controlled trials. Lancet. \u003cstrong\u003e374\u003c/strong\u003e, 1897\u0026ndash;1908 (2009).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eVieira, W. F., Kenzo-Kagawa, B., Cogo, J. C., Baranauskas, V. \u0026amp; da Cruz-H\u0026ouml;fling, M. A. Low-level laser therapy (904 nm) counteracts motor deficit of mice hind limb following skeletal muscle injury caused by snakebite-mimicking intramuscular venom injection. PLoS One. \u003cstrong\u003e11\u003c/strong\u003e, e0158980 (2016).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eVieira, W. F., \u003cem\u003eet al\u003c/em\u003e. Vibrational spectroscopy of muscular tissue intoxicated by snake venom and exposed to photobiomodulation therapy. Lasers Med. Sci. \u003cstrong\u003e33\u003c/strong\u003e, 503\u0026ndash;512 (2017).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBjordal, J. M., Coupp\u0026eacute;, C., Chow, R. T., Tun\u0026eacute;r, J. \u0026amp; Ljunggren, E. A. A systematic review of low level laser therapy with location-specific doses for pain from chronic joint disorders. Aust. J. Physiother. \u003cstrong\u003e49\u003c/strong\u003e, 107\u0026ndash;116 (2003).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eGigo-Benato, D., \u003cem\u003eet al\u003c/em\u003e. Effects of 660 and 780 nm low-level laser therapy on neuromuscular recovery after crush injury in rat sciatic nerve. Lasers Surg. Med. \u003cstrong\u003e42\u003c/strong\u003e, 673\u0026ndash;682 (2010).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003ePosten, W., \u003cem\u003eet al\u003c/em\u003e. Low-level laser therapy for wound healing: mechanism and efficacy. Dermatol. Surg. \u003cstrong\u003e31\u003c/strong\u003e, 334\u0026ndash;340 (2005).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eVieira, W. F., \u003cem\u003eet al\u003c/em\u003e. Exploring the ability of low-level laser irradiation to reduce myonecrosis and increase \u003cem\u003eMyogenin\u003c/em\u003e transcription after \u003cem\u003eBothrops jararacussu\u003c/em\u003e envenomation. Photochem. Photobiol. Sci. \u003cstrong\u003e20\u003c/strong\u003e, 571\u0026ndash;583 (2021).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eVieira, W. F., de Magalh\u0026atilde;es, S. F., Farias, F. H., de Thomaz, A. A. \u0026amp; Parada, C. A. Raman spectroscopy of dorsal root ganglia from streptozotocin-induced diabetic neuropathic rats submitted to photobiomodulation therapy. J. Biophotonics. \u003cstrong\u003e12\u003c/strong\u003e, 1\u0026ndash;14 (2019).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSzkudelski, T. The mechanism of alloxan and streptozotocin action in B cells of the rat pancreas. Physiol. Res. \u003cstrong\u003e50\u003c/strong\u003e, 537\u0026ndash;546 (2001).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eWang, Z. \u0026amp; Gleichmann, H. Glucose transporter 2 expression: prevention of streptozotocin-induced reduction in beta-cells with 5-thio-D-glucose. Exp. Clin. Endocrinol. Diabetes. \u003cstrong\u003e103\u003c/strong\u003e, 83\u0026ndash;97 (1995).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eWang, Z. \u0026amp; Gleichmann, H. GLUT2 in pancreatic islets: crucial target molecule in diabetes induced with multiple low doses of streptozotocin in mice. Diabetes. \u003cstrong\u003e47\u003c/strong\u003e, 50\u0026ndash;56 (1998).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eFurman, B. L. Streptozotocin-induced diabetic models in mice and rats. \u003cem\u003eCurr. Protoc. Pharmacol\u003c/em\u003e. \u003cstrong\u003e70\u003c/strong\u003e, 5.47.1\u0026ndash;5.47.20 (2015).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAthie, M. C. P., \u003cem\u003eet al\u003c/em\u003e. Transcriptome analysis of dorsal root ganglia\u0026apos;s diabetic neuropathy reveals mechanisms involved in pain and regeneration. Life Sci. \u003cstrong\u003e205\u003c/strong\u003e, 54\u0026ndash;62 (2018).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eTeixeira, J. M. \u003cem\u003eet al\u003c/em\u003e. Diabetes-induced neuropathic mechanical hyperalgesia depends on P\u003csub\u003e2\u003c/sub\u003eX\u003csub\u003e4\u003c/sub\u003e receptor activation in dorsal root ganglia. Neuroscience. \u003cstrong\u003e398\u003c/strong\u003e, 158\u0026ndash;170 (2019).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003edo Prado, F. C., \u003cem\u003eet al\u003c/em\u003e. The onset speed of hyperglycemia is important to the development of neuropathic hyperalgesia in streptozotocin-induced diabetic rats. Eur. J. Neurosci. \u003cstrong\u003e52\u003c/strong\u003e, 3642\u0026ndash;3651 (2020).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eVieira, W. F., \u003cem\u003eet al\u003c/em\u003e. Gait analysis correlates mechanical hyperalgesia in a model of streptozotocin-induced diabetic neuropathy: A CatWalk dynamic motor function study. Neurosci. Lett. \u003cstrong\u003e736\u003c/strong\u003e, 135253 (2020).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003ePeplow, P. V., Chung, T-Y. \u0026amp; Baxter, G. D. Laser photostimulation (660 nm) of wound healing in diabetic mice is not brought about by ameliorating diabetes. Lasers Surg. Med. \u003cstrong\u003e44\u003c/strong\u003e, 26\u0026ndash;29 (2012).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eChow, R. T. \u0026amp; Barnsley, L. Systematic review of the literature of low-level laser therapy (LLLT) in the management of neck pain. Lasers Surg. Med. \u003cstrong\u003e37\u003c/strong\u003e, 46\u0026ndash;52 (2005).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eByrnes, K. R., \u003cem\u003eet al\u003c/em\u003e. Light promotes regeneration and functional recovery and alters the immune response after spinal cord injury. Lasers Surg. Med. \u003cstrong\u003e36\u003c/strong\u003e, 171\u0026ndash;185 (2005).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSnyder-Mackler, L. \u0026amp; Bork, C. E. Effect of helium-neon laser irradiation on peripheral sensory nerve latency. Phys. Ther. \u003cstrong\u003e68\u003c/strong\u003e, 223\u0026ndash;225 (1988).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eMaeda, T. Morphological demonstration of low reactive laser therapeutic pain attenuation effect of the gallium aluminium arsenide diode laser. Laser Ther. \u003cstrong\u003e1\u003c/strong\u003e, 23\u0026ndash;26 (1989).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHolanda, V. M., \u003cem\u003eet al\u003c/em\u003e. Photobiomodulation of the dorsal root ganglion for the treatment of low back pain: A pilot study. Lasers Surg. Med. \u003cstrong\u003e48\u003c/strong\u003e, 653\u0026ndash;659 (2016).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eZochodne, D. W., Ramji, N. \u0026amp; Toth, C. Neuronal targeting in diabetes mellitus: A story of sensory neurons and motor neurons. Neuroscientist. \u003cstrong\u003e14\u003c/strong\u003e, 311\u0026ndash;318 (2008).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eKambiz, S., \u003cem\u003eet al\u003c/em\u003e. An early diagnostic tool for diabetic peripheral neuropathy in rats. PLoS One. \u003cstrong\u003e10\u003c/strong\u003e, e0126892 (2015).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eSchwartz, A. V., \u003cem\u003eet al\u003c/em\u003e. Diabetes-related complications, glycemic control, and falls in older adults. Diabetes Care. \u003cstrong\u003e31\u003c/strong\u003e, 391\u0026ndash;396 (2008).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBenitez, S. U., Carneiro, E. M. \u0026amp; Oliveira, A. L. R. Synaptic input changes to spinal cord motoneurons correlate with motor control impairments in a type 1 diabetes mellitus model. Brain Behav. \u003cstrong\u003e5\u003c/strong\u003e, e00372 (2015).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eEdwards, J. L., Vincent, A., Cheng, T. \u0026amp; Feldman, E. L. Diabetic neuropathy: mechanisms to management. Pharmacol. Ther. \u003cstrong\u003e120\u003c/strong\u003e, 1\u0026ndash;34 (2008).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eCallaghan, B. C., Cheng, H., Stables, C. L., Smith, A. L. \u0026amp; Feldman, E. L. Diabetic neuropathy: Clinical manifestations and current treatments. Lancet Neurol. \u003cstrong\u003e11\u003c/strong\u003e, 521\u0026ndash;534 (2012).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eHsieh, Y-L., \u003cem\u003eet al\u003c/em\u003e. Low-level laser therapy alleviates neuropathic pain and promotes function recovery in rats with chronic constriction injury: Possible involvements in hypoxia-inducible factor 1\u0026alpha; (HIF-1\u0026alpha;). J. Comp. Neurol. \u003cstrong\u003e520\u003c/strong\u003e, 2903\u0026ndash;2916 (2012).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eCidral-Filho, F. J., \u003cem\u003eet al\u003c/em\u003e. Light-emitting diode therapy induces analgesia and decreases spinal cord and sciatic nerve tumour necrosis factor- \u0026alpha; levels after sciatic nerve crush in mice. Eur. J. Pain. \u003cstrong\u003e17\u003c/strong\u003e, 1193\u0026ndash;1204 (2013).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAlbertini, R., \u003cem\u003eet al\u003c/em\u003e. Anti-inflammatory effects of low-level laser therapy (LLLT) with two different red wavelengths (660 nm and 684 nm) in carrageenan-induced rat paw edema. J. Photochem. Photobiol. B. \u003cstrong\u003e89\u003c/strong\u003e, 50\u0026ndash;55 (2007).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eKholodenko, B. N. MAP kinase cascade signaling and endocytic trafficking: a marriage of convenience? Trends Cell Biol. \u003cstrong\u003e12\u003c/strong\u003e, 173\u0026ndash;177 (2002).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003ePlotnikov, A., Zehorai, E., Procaccia, S. \u0026amp; Seger, R. The MAPK cascades: signaling components, nuclear roles and mechanisms of nuclear translocation. Biochim. Biophys. Acta. \u003cstrong\u003e1813\u003c/strong\u003e, 1619\u0026ndash;1633 (2011).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003ePimienta, G. \u0026amp; Pascual, J. Canonical and alternative MAPK signaling. Cell Cycle. \u003cstrong\u003e6\u003c/strong\u003e, 2628\u0026ndash;2632 (2007).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eTomlinson, D. R. Mitogen-activated protein kinases as glucose transducers for diabetic complications. Diabetologia. \u003cstrong\u003e42\u003c/strong\u003e, 1271\u0026ndash;1281 (1999).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eCiruela, A., \u003cem\u003eet al\u003c/em\u003e. Identification of MEK1 as a novel target for the treatment of neuropathic pain. Br. J. Pharmacol. \u003cstrong\u003e138\u003c/strong\u003e, 751\u0026ndash;756 (2003).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eGalan, A., Cervero, F. \u0026amp; Laird, J. M. A. Extracellular signaling-regulated kinase-1 and \u0026ndash; 2 (ERK 1/2) mediate referred hyperalgesia in a murine model of visceral pain. Brain Res. Mol. Brain Res. \u003cstrong\u003e116\u003c/strong\u003e, 126\u0026ndash;134 (2003).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eKumar, S., Boehm, J. \u0026amp; Lee, J. C. p38 MAP kinases: key signalling molecules as therapeutic targets for inflammatory diseases. Nat. Rev. Drug Discov. \u003cstrong\u003e2\u003c/strong\u003e, 717\u0026ndash;726 (2003).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBoyle, D. L., \u003cem\u003eet al\u003c/em\u003e. Regulation of peripheral inflammation by spinal p38 MAP kinase in rats. PLoS Med. \u003cstrong\u003e3\u003c/strong\u003e, e338 (2006).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eVerri, W. A. Jr., \u003cem\u003eet al\u003c/em\u003e. Hypernociceptive role of cytokines and chemokines: targets for analgesic drug development? Pharmacol. Ther. \u003cstrong\u003e112\u003c/strong\u003e, 116\u0026ndash;138 (2006).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eJi, R-R. \u0026amp; Suter, M. R. p38 MAPK, microglial signaling, and neuropathic pain. Mol. Pain. \u003cstrong\u003e3\u003c/strong\u003e, 1\u0026ndash;9 (2007).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eShefer, G., Oron, U., Irintchev, A., Wernig, A. \u0026amp; Halevy, O. Skeletal muscle cell activation by low-energy laser irradiation: a role for the MAPK/ERK pathway. J. Cell Physiol. \u003cstrong\u003e187\u003c/strong\u003e, 73\u0026ndash;80 (2001).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eAleksic, V., \u003cem\u003eet al\u003c/em\u003e. Low-level Er: YAG laser irradiation enhances osteoblast proliferation through activation of MAPK/ERK. Lasers Med. Sci. \u003cstrong\u003e25\u003c/strong\u003e, 559\u0026ndash;569 (2010).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eZhai, K., Liskova, A., Kubatka, P. \u0026amp; B\u0026uuml;sselberg, D. Calcium entry through TRPV1: A potential target for the regulation of proliferation and apoptosis in cancerous and healthy cells. Int. J. Mol. Sci. \u003cstrong\u003e21\u003c/strong\u003e, 4177 (2020).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eStory, G. M., \u003cem\u003eet al\u003c/em\u003e. ANKTM1, a TRP-like channel expressed in nociceptive neurons, is activated by cold temperatures. Cell. \u003cstrong\u003e112\u003c/strong\u003e, 819\u0026ndash;829 (2003).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLee, Y. M. \u003cem\u003eet al\u003c/em\u003e. A novel role for the TRPV1 channel in UV-induced matrix metalloproteinase (MMP)-1 expression in HaCaT cells. J. Cell Physiol. \u003cstrong\u003e219\u003c/strong\u003e, 766\u0026ndash;775 (2009).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eWang, Y., Huang, Y-Y., Wang, Y., Lyu, P. \u0026amp; Hamblin, M. R. Photobiomodulation of human adipose-derived stem cells using 810 nm and 980 nm lasers operates via different mechanisms of action. Biochim. Biophys. Acta Gen. Subj. \u003cstrong\u003e1861\u003c/strong\u003e, 441\u0026ndash;449 (2017).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eBradford, M. M. A rapid and sensitive method for the quantitation microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. \u003cstrong\u003e72\u003c/strong\u003e, 248\u0026ndash;254 (1976).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eVandesompele, J., \u003cem\u003eet al\u003c/em\u003e. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. \u003cstrong\u003e3\u003c/strong\u003e, 1\u0026ndash;12 (2002).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eLinhart, O., Obreja, O. \u0026amp; Kress, M. The inflammatory mediators serotonin, prostaglandin E2 and bradykinin evoke calcium influx in rat sensory neurons. Neuroscience. \u003cstrong\u003e118\u003c/strong\u003e, 69\u0026ndash;74 (2003).\u003c/span\u003e\u003c/li\u003e\n \u003cli\u003e\u003cspan\u003eManzo, L. P., \u003cem\u003eet al\u003c/em\u003e. Magnetic, but not non-magnetic, reduced graphene oxide in spinal cord increases nociceptive neuronal responsiveness. Nanomedicine. \u003cstrong\u003e13\u003c/strong\u003e, 1841\u0026ndash;1851 (2017).\u003c/span\u003e\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"photophysical and photochemical therapy, low-level laser, gallium-arsenide, CatWalk system, dorsal root ganglion","lastPublishedDoi":"10.21203/rs.3.rs-1612307/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-1612307/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eSeveral recent studies have established the efficacy of photobiomodulation therapy (PBMT) in painful clinical conditions. Diabetic neuropathy (DN) can be related to activating mitogen-activated protein kinases (MAPK), such as p38, in the peripheral nerve. MAPK pathway is activated in response to extracellular stimuli, including interleukins TNF-α and IL-1β. We verified the pain relief potential of PBMT in streptozotocin (STZ)-induced diabetic neuropathic rats and its influence on the MAPK pathway regulation and calcium (Ca\u003csup\u003e2+\u003c/sup\u003e) dynamics. We then observed that PBMT applied to the L4-L5 dorsal root ganglion (DRG) region reduced the intensity of hyperalgesia, decreased TNF-α and IL-1β levels, and p38-MAPK mRNA expression in DRG of diabetic neuropathic rats. DN induced the activation of phosphorylated p38 (p-38) MAPK co-localized with TRPV1\u003csup\u003e+\u003c/sup\u003e neurons; PBMT partially prevented p-38 activation. DN was related to an increase of p38-MAPK expression due to proinflammatory interleukins, and the PBMT (904 nm) treatment counteracted this condition. Also, the sensitization of DRG-neurons by the hyperglycemic condition demonstrated during the Ca\u003csup\u003e2+\u003c/sup\u003e dynamics was reduced by PBMT, contributing to its anti-hyperalgesic effects.\u003c/p\u003e","manuscriptTitle":"Anti-hyperalgesic effects of photobiomodulation therapy (904 nm) on streptozotocin-induced diabetic neuropathy: A role for MAPK pathway and calcium dynamics","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2022-05-11 17:04:19","doi":"10.21203/rs.3.rs-1612307/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2022-08-22T12:40:28+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-08-20T03:00:17+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2022-06-03T19:35:23+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"857f9084-f837-4418-9a68-813bd62ac78a","date":"2022-05-12T13:06:16+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2022-05-12T13:01:47+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2022-05-09T00:08:18+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2022-05-06T02:01:48+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2022-05-06T01:57:36+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2022-04-30T18:12:40+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"3d56071f-fa25-45de-aa50-b727b0209b84","owner":[],"postedDate":"May 11th, 2022","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2022-09-06T20:44:20+00:00","versionOfRecord":[],"versionCreatedAt":"2022-05-11 17:04:19","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-1612307","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-1612307","identity":"rs-1612307","version":["v1"]},"buildId":"-HB7Z8yhvgn0wM9Nzuekk","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}