The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence

The identification of high-performing antibodies... | F1000Research "use strict";function _typeof(t){return(_typeof="function"==typeof Symbol&&"symbol"==typeof Symbol.iterator?function(t){return typeof t}:function(t){return t&&"function"==typeof Symbol&&t.constructor===Symbol&&t!==Symbol.prototype?"symbol":typeof t})(t)}!function(){var t=function(){var t,e,o=[],n=window,r=n;for(;r;){try{if(r.frames.__tcfapiLocator){t=r;break}}catch(t){}if(r===n.top)break;r=r.parent}t||(!function t(){var e=n.document,o=!!n.frames.__tcfapiLocator;if(!o)if(e.body){var r=e.createElement("iframe");r.style.cssText="display:none",r.name="__tcfapiLocator",e.body.appendChild(r)}else setTimeout(t,5);return!o}(),n.__tcfapi=function(){for(var t=arguments.length,n=new Array(t),r=0;r 3&&2===parseInt(n[1],10)&&"boolean"==typeof n[3]&&(e=n[3],"function"==typeof n[2]&&n[2]("set",!0)):"ping"===n[0]?"function"==typeof n[2]&&n[2]({gdprApplies:e,cmpLoaded:!1,cmpStatus:"stub"}):o.push(n)},n.addEventListener("message",(function(t){var e="string"==typeof t.data,o={};if(e)try{o=JSON.parse(t.data)}catch(t){}else o=t.data;var n="object"===_typeof(o)&&null!==o?o.__tcfapiCall:null;n&&window.__tcfapi(n.command,n.version,(function(o,r){var a={__tcfapiReturn:{returnValue:o,success:r,callId:n.callId}};t&&t.source&&t.source.postMessage&&t.source.postMessage(e?JSON.stringify(a):a,"*")}),n.parameter)}),!1))};"undefined"!=typeof module?module.exports=t:t()}(); dataLayer = dataLayer || []; // Standard GTM initialization - Google Consent Mode handles consent automatically (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start': new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0], j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src= 'https://www.googletagmanager.com/gtm.js?id='+i+dl+ '>m_auth=hzk0Vc3qFsQYhCrIoHz68A>m_preview=env-1>m_cookies_win=x';f.parentNode.insertBefore(j,f); })(window,document,'script','dataLayer','GTM-MWFK8L5J'); ;window.NREUM||(NREUM={});NREUM.init={distributed_tracing:{enabled:true},privacy:{cookies_enabled:true},ajax:{deny_list:["bam.nr-data.net"]}}; ;NREUM.loader_config={accountID:"438030",trustKey:"438030",agentID:"772317073",licenseKey:"97f8f67f26",applicationID:"772317073"} ;NREUM.info={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net",licenseKey:"97f8f67f26",applicationID:"772317073",sa:1} ;/*! For license information please see nr-loader-spa-1.236.0.min.js.LICENSE.txt */ (()=>{"use strict";var e,t,r={5763:(e,t,r)=>{r.d(t,{P_:()=>l,Mt:()=>g,C5:()=>s,DL:()=>v,OP:()=>T,lF:()=>D,Yu:()=>y,Dg:()=>h,CX:()=>c,GE:()=>b,sU:()=>_});var n=r(8632),i=r(9567);const o={beacon:n.ce.beacon,errorBeacon:n.ce.errorBeacon,licenseKey:void 0,applicationID:void 0,sa:void 0,queueTime:void 0,applicationTime:void 0,ttGuid:void 0,user:void 0,account:void 0,product:void 0,extra:void 0,jsAttributes:{},userAttributes:void 0,atts:void 0,transactionName:void 0,tNamePlain:void 0},a={};function s(e){if(!e)throw new Error("All info objects require an agent identifier!");if(!a[e])throw new Error("Info for ".concat(e," was never set"));return a[e]}function c(e,t){if(!e)throw new Error("All info objects require an agent identifier!");a[e]=(0,i.D)(t,o),(0,n.Qy)(e,a[e],"info")}var u=r(7056);const d=()=>{const e={blockSelector:"[data-nr-block]",maskInputOptions:{password:!0}};return{allow_bfcache:!0,privacy:{cookies_enabled:!0},ajax:{deny_list:void 0,enabled:!0,harvestTimeSeconds:10},distributed_tracing:{enabled:void 0,exclude_newrelic_header:void 0,cors_use_newrelic_header:void 0,cors_use_tracecontext_headers:void 0,allowed_origins:void 0},session:{domain:void 0,expiresMs:u.oD,inactiveMs:u.Hb},ssl:void 0,obfuscate:void 0,jserrors:{enabled:!0,harvestTimeSeconds:10},metrics:{enabled:!0},page_action:{enabled:!0,harvestTimeSeconds:30},page_view_event:{enabled:!0},page_view_timing:{enabled:!0,harvestTimeSeconds:30,long_task:!1},session_trace:{enabled:!0,harvestTimeSeconds:10},harvest:{tooManyRequestsDelay:60},session_replay:{enabled:!1,harvestTimeSeconds:60,sampleRate:.1,errorSampleRate:.1,maskTextSelector:"*",maskAllInputs:!0,get blockClass(){return"nr-block"},get ignoreClass(){return"nr-ignore"},get maskTextClass(){return"nr-mask"},get blockSelector(){return e.blockSelector},set blockSelector(t){e.blockSelector+=",".concat(t)},get maskInputOptions(){return e.maskInputOptions},set maskInputOptions(t){e.maskInputOptions={...t,password:!0}}},spa:{enabled:!0,harvestTimeSeconds:10}}},f={};function l(e){if(!e)throw new Error("All configuration objects require an agent identifier!");if(!f[e])throw new Error("Configuration for ".concat(e," was never set"));return f[e]}function h(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");f[e]=(0,i.D)(t,d()),(0,n.Qy)(e,f[e],"config")}function g(e,t){if(!e)throw new Error("All configuration objects require an agent identifier!");var r=l(e);if(r){for(var n=t.split("."),i=0;i {r.d(t,{D:()=>i});var n=r(50);function i(e,t){try{if(!e||"object"!=typeof e)return(0,n.Z)("Setting a Configurable requires an object as input");if(!t||"object"!=typeof t)return(0,n.Z)("Setting a Configurable requires a model to set its initial properties");const r=Object.create(Object.getPrototypeOf(t),Object.getOwnPropertyDescriptors(t)),o=0===Object.keys(r).length?e:r;for(let a in o)if(void 0!==e[a])try{"object"==typeof e[a]&&"object"==typeof t[a]?r[a]=i(e[a],t[a]):r[a]=e[a]}catch(e){(0,n.Z)("An error occurred while setting a property of a Configurable",e)}return r}catch(e){(0,n.Z)("An error occured while setting a Configurable",e)}}},6818:(e,t,r)=>{r.d(t,{Re:()=>i,gF:()=>o,q4:()=>n});const n="1.236.0",i="PROD",o="CDN"},385:(e,t,r)=>{r.d(t,{FN:()=>a,IF:()=>u,Nk:()=>f,Tt:()=>s,_A:()=>o,il:()=>n,pL:()=>c,v6:()=>i,w1:()=>d});const n="undefined"!=typeof window&&!!window.document,i="undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self.navigator instanceof WorkerNavigator||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis.navigator instanceof WorkerNavigator),o=n?window:"undefined"!=typeof WorkerGlobalScope&&("undefined"!=typeof self&&self instanceof WorkerGlobalScope&&self||"undefined"!=typeof globalThis&&globalThis instanceof WorkerGlobalScope&&globalThis),a=""+o?.location,s=/iPad|iPhone|iPod/.test(navigator.userAgent),c=s&&"undefined"==typeof SharedWorker,u=(()=>{const e=navigator.userAgent.match(/Firefox[/\s](\d+\.\d+)/);return Array.isArray(e)&&e.length>=2?+e[1]:0})(),d=Boolean(n&&window.document.documentMode),f=!!navigator.sendBeacon},1117:(e,t,r)=>{r.d(t,{w:()=>o});var n=r(50);const i={agentIdentifier:"",ee:void 0};class o{constructor(e){try{if("object"!=typeof e)return(0,n.Z)("shared context requires an object as input");this.sharedContext={},Object.assign(this.sharedContext,i),Object.entries(e).forEach((e=>{let[t,r]=e;Object.keys(i).includes(t)&&(this.sharedContext[t]=r)}))}catch(e){(0,n.Z)("An error occured while setting SharedContext",e)}}}},8e3:(e,t,r)=>{r.d(t,{L:()=>d,R:()=>c});var n=r(2177),i=r(1284),o=r(4322),a=r(3325);const s={};function c(e,t){const r={staged:!1,priority:a.p[t]||0};u(e),s[e].get(t)||s[e].set(t,r)}function u(e){e&&(s[e]||(s[e]=new Map))}function d(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:"",t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:"feature";if(u(e),!e||!s[e].get(t))return a(t);s[e].get(t).staged=!0;const r=[...s[e]];function a(t){const r=e?n.ee.get(e):n.ee,a=o.X.handlers;if(r.backlog&&a){var s=r.backlog[t],c=a[t];if(c){for(var u=0;s&&u {let[t,r]=e;return r.staged}))&&(r.sort(((e,t)=>e[1].priority-t[1].priority)),r.forEach((e=>{let[t]=e;a(t)})))}function f(e,t){var r=e[1];(0,i.D)(t[r],(function(t,r){var n=e[0];if(r[0]===n){var i=r[1],o=e[3],a=e[2];i.apply(o,a)}}))}},2177:(e,t,r)=>{r.d(t,{c:()=>f,ee:()=>u});var n=r(8632),i=r(2210),o=r(1284),a=r(5763),s="nr@context";let c=(0,n.fP)();var u;function d(){}function f(e){return(0,i.X)(e,s,l)}function l(){return new d}function h(){u.aborted=!0,u.backlog={}}c.ee?u=c.ee:(u=function e(t,r){var n={},c={},f={},g=!1;try{g=16===r.length&&(0,a.OP)(r).isolatedBacklog}catch(e){}var p={on:b,addEventListener:b,removeEventListener:y,emit:v,get:x,listeners:w,context:m,buffer:A,abort:h,aborted:!1,isBuffering:E,debugId:r,backlog:g?{}:t&&"object"==typeof t.backlog?t.backlog:{}};return p;function m(e){return e&&e instanceof d?e:e?(0,i.X)(e,s,l):l()}function v(e,r,n,i,o){if(!1!==o&&(o=!0),!u.aborted||i){t&&o&&t.emit(e,r,n);for(var a=m(n),s=w(e),d=s.length,f=0;fn,p:()=>i});var n=r(2177).ee.get("handle");function i(e,t,r,i,o){o?(o.buffer([e],i),o.emit(e,t,r)):(n.buffer([e],i),n.emit(e,t,r))}},4322:(e,t,r)=>{r.d(t,{X:()=>o});var n=r(5546);o.on=a;var i=o.handlers={};function o(e,t,r,o){a(o||n.E,i,e,t,r)}function a(e,t,r,i,o){o||(o="feature"),e||(e=n.E);var a=t[o]=t[o]||{};(a[r]=a[r]||[]).push([e,i])}},3239:(e,t,r)=>{r.d(t,{bP:()=>s,iz:()=>c,m$:()=>a});var n=r(385);let i=!1,o=!1;try{const e={get passive(){return i=!0,!1},get signal(){return o=!0,!1}};n._A.addEventListener("test",null,e),n._A.removeEventListener("test",null,e)}catch(e){}function a(e,t){return i||o?{capture:!!e,passive:i,signal:t}:!!e}function s(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;window.addEventListener(e,t,a(r,n))}function c(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2],n=arguments.length>3?arguments[3]:void 0;document.addEventListener(e,t,a(r,n))}},4402:(e,t,r)=>{r.d(t,{Ht:()=>u,M:()=>c,Rl:()=>a,ky:()=>s});var n=r(385);const i="xxxxxxxx-xxxx-4xxx-yxxx-xxxxxxxxxxxx";function o(e,t){return e?15&e[t]:16*Math.random()|0}function a(){const e=n._A?.crypto||n._A?.msCrypto;let t,r=0;return e&&e.getRandomValues&&(t=e.getRandomValues(new Uint8Array(31))),i.split("").map((e=>"x"===e?o(t,++r).toString(16):"y"===e?(3&o()|8).toString(16):e)).join("")}function s(e){const t=n._A?.crypto||n._A?.msCrypto;let r,i=0;t&&t.getRandomValues&&(r=t.getRandomValues(new Uint8Array(31)));const a=[];for(var s=0;s {r.d(t,{Bq:()=>n,Hb:()=>o,oD:()=>i});const n="NRBA",i=144e5,o=18e5},7894:(e,t,r)=>{function n(){return Math.round(performance.now())}r.d(t,{z:()=>n})},7243:(e,t,r)=>{r.d(t,{e:()=>o});var n=r(385),i={};function o(e){if(e in i)return i[e];if(0===(e||"").indexOf("data:"))return{protocol:"data"};let t;var r=n._A?.location,o={};if(n.il)t=document.createElement("a"),t.href=e;else try{t=new URL(e,r.href)}catch(e){return o}o.port=t.port;var a=t.href.split("://");!o.port&&a[1]&&(o.port=a[1].split("/")[0].split("@").pop().split(":")[1]),o.port&&"0"!==o.port||(o.port="https"===a[0]?"443":"80"),o.hostname=t.hostname||r.hostname,o.pathname=t.pathname,o.protocol=a[0],"/"!==o.pathname.charAt(0)&&(o.pathname="/"+o.pathname);var s=!t.protocol||":"===t.protocol||t.protocol===r.protocol,c=t.hostname===r.hostname&&t.port===r.port;return o.sameOrigin=s&&(!t.hostname||c),"/"===o.pathname&&(i[e]=o),o}},50:(e,t,r)=>{function n(e,t){"function"==typeof console.warn&&(console.warn("New Relic: ".concat(e)),t&&console.warn(t))}r.d(t,{Z:()=>n})},2587:(e,t,r)=>{r.d(t,{N:()=>c,T:()=>u});var n=r(2177),i=r(5546),o=r(8e3),a=r(3325);const s={stn:[a.D.sessionTrace],err:[a.D.jserrors,a.D.metrics],ins:[a.D.pageAction],spa:[a.D.spa],sr:[a.D.sessionReplay,a.D.sessionTrace]};function c(e,t){const r=n.ee.get(t);e&&"object"==typeof e&&(Object.entries(e).forEach((e=>{let[t,n]=e;void 0===u[t]&&(s[t]?s[t].forEach((e=>{n?(0,i.p)("feat-"+t,[],void 0,e,r):(0,i.p)("block-"+t,[],void 0,e,r),(0,i.p)("rumresp-"+t,[Boolean(n)],void 0,e,r)})):n&&(0,i.p)("feat-"+t,[],void 0,void 0,r),u[t]=Boolean(n))})),Object.keys(s).forEach((e=>{void 0===u[e]&&(s[e]?.forEach((t=>(0,i.p)("rumresp-"+e,[!1],void 0,t,r))),u[e]=!1)})),(0,o.L)(t,a.D.pageViewEvent))}const u={}},2210:(e,t,r)=>{r.d(t,{X:()=>i});var n=Object.prototype.hasOwnProperty;function i(e,t,r){if(n.call(e,t))return e[t];var i=r();if(Object.defineProperty&&Object.keys)try{return Object.defineProperty(e,t,{value:i,writable:!0,enumerable:!1}),i}catch(e){}return e[t]=i,i}},1284:(e,t,r)=>{r.d(t,{D:()=>n});const n=(e,t)=>Object.entries(e||{}).map((e=>{let[r,n]=e;return t(r,n)}))},4351:(e,t,r)=>{r.d(t,{P:()=>o});var n=r(2177);const i=()=>{const e=new WeakSet;return(t,r)=>{if("object"==typeof r&&null!==r){if(e.has(r))return;e.add(r)}return r}};function o(e){try{return JSON.stringify(e,i())}catch(e){try{n.ee.emit("internal-error",[e])}catch(e){}}}},3960:(e,t,r)=>{r.d(t,{K:()=>a,b:()=>o});var n=r(3239);function i(){return"undefined"==typeof document||"complete"===document.readyState}function o(e,t){if(i())return e();(0,n.bP)("load",e,t)}function a(e){if(i())return e();(0,n.iz)("DOMContentLoaded",e)}},8632:(e,t,r)=>{r.d(t,{EZ:()=>u,Qy:()=>c,ce:()=>o,fP:()=>a,gG:()=>d,mF:()=>s});var n=r(7894),i=r(385);const o={beacon:"bam.nr-data.net",errorBeacon:"bam.nr-data.net"};function a(){return i._A.NREUM||(i._A.NREUM={}),void 0===i._A.newrelic&&(i._A.newrelic=i._A.NREUM),i._A.NREUM}function s(){let e=a();return e.o||(e.o={ST:i._A.setTimeout,SI:i._A.setImmediate,CT:i._A.clearTimeout,XHR:i._A.XMLHttpRequest,REQ:i._A.Request,EV:i._A.Event,PR:i._A.Promise,MO:i._A.MutationObserver,FETCH:i._A.fetch}),e}function c(e,t,r){let i=a();const o=i.initializedAgents||{},s=o[e]||{};return Object.keys(s).length||(s.initializedAt={ms:(0,n.z)(),date:new Date}),i.initializedAgents={...o,[e]:{...s,[r]:t}},i}function u(e,t){a()[e]=t}function d(){return function(){let e=a();const t=e.info||{};e.info={beacon:o.beacon,errorBeacon:o.errorBeacon,...t}}(),function(){let e=a();const t=e.init||{};e.init={...t}}(),s(),function(){let e=a();const t=e.loader_config||{};e.loader_config={...t}}(),a()}},7956:(e,t,r)=>{r.d(t,{N:()=>i});var n=r(3239);function i(e){let t=arguments.length>1&&void 0!==arguments[1]&&arguments[1],r=arguments.length>2?arguments[2]:void 0,i=arguments.length>3?arguments[3]:void 0;return void(0,n.iz)("visibilitychange",(function(){if(t)return void("hidden"==document.visibilityState&&e());e(document.visibilityState)}),r,i)}},1214:(e,t,r)=>{r.d(t,{em:()=>v,u5:()=>N,QU:()=>S,_L:()=>I,Gm:()=>L,Lg:()=>M,gy:()=>U,BV:()=>Q,Kf:()=>ee});var n=r(2177);const i="nr@original";var o=Object.prototype.hasOwnProperty,a=!1;function s(e,t){return e||(e=n.ee),r.inPlace=function(e,t,n,i,o){n||(n="");var a,s,c,u="-"===n.charAt(0);for(c=0;c 2?n-2:0),o=2;o {r(A[T],e,w),r(E[T],e,w)})),r(l._A,"fetch",y),t.on(y+"end",(function(e,r){var n=this;if(r){var i=r.headers.get("content-length");null!==i&&(n.rxSize=i),t.emit(y+"done",[null,r],n)}else t.emit(y+"done",[e],n)})),t}const O={},j=["pushState","replaceState"];function S(e){const t=function(e){return(e||n.ee).get("history")}(e);return!l.il||O[t.debugId]++||(O[t.debugId]=1,s(t).inPlace(window.history,j,"-")),t}var P=r(3239);const C={},R=["appendChild","insertBefore","replaceChild"];function I(e){const t=function(e){return(e||n.ee).get("jsonp")}(e);if(!l.il||C[t.debugId])return t;C[t.debugId]=!0;var r=s(t),i=/[?&](?:callback|cb)=([^&#]+)/,o=/(.*)\.([^.]+)/,a=/^(\w+)(\.|$)(.*)$/;function c(e,t){var r=e.match(a),n=r[1],i=r[3];return i?c(i,t[n]):t[n]}return r.inPlace(Node.prototype,R,"dom-"),t.on("dom-start",(function(e){!function(e){if(!e||"string"!=typeof e.nodeName||"script"!==e.nodeName.toLowerCase())return;if("function"!=typeof e.addEventListener)return;var n=(a=e.src,s=a.match(i),s?s[1]:null);var a,s;if(!n)return;var u=function(e){var t=e.match(o);if(t&&t.length>=3)return{key:t[2],parent:c(t[1],window)};return{key:e,parent:window}}(n);if("function"!=typeof u.parent[u.key])return;var d={};function f(){t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}function l(){t.emit("jsonp-error",[],d),t.emit("jsonp-end",[],d),e.removeEventListener("load",f,(0,P.m$)(!1)),e.removeEventListener("error",l,(0,P.m$)(!1))}r.inPlace(u.parent,[u.key],"cb-",d),e.addEventListener("load",f,(0,P.m$)(!1)),e.addEventListener("error",l,(0,P.m$)(!1)),t.emit("new-jsonp",[e.src],d)}(e[0])})),t}var k=r(5763);const H={};function L(e){const t=function(e){return(e||n.ee).get("mutation")}(e);if(!l.il||H[t.debugId])return t;H[t.debugId]=!0;var r=s(t),i=k.Yu.MO;return i&&(window.MutationObserver=function(e){return this instanceof i?new i(r(e,"fn-")):i.apply(this,arguments)},MutationObserver.prototype=i.prototype),t}const z={};function M(e){const t=function(e){return(e||n.ee).get("promise")}(e);if(z[t.debugId])return t;z[t.debugId]=!0;var r=n.c,o=s(t),a=k.Yu.PR;return a&&function(){function e(r){var n=t.context(),i=o(r,"executor-",n,null,!1);const s=Reflect.construct(a,[i],e);return t.context(s).getCtx=function(){return n},s}l._A.Promise=e,Object.defineProperty(e,"name",{value:"Promise"}),e.toString=function(){return a.toString()},Object.setPrototypeOf(e,a),["all","race"].forEach((function(r){const n=a[r];e[r]=function(e){let i=!1;[...e||[]].forEach((e=>{this.resolve(e).then(a("all"===r),a(!1))}));const o=n.apply(this,arguments);return o;function a(e){return function(){t.emit("propagate",[null,!i],o,!1,!1),i=i||!e}}}})),["resolve","reject"].forEach((function(r){const n=a[r];e[r]=function(e){const r=n.apply(this,arguments);return e!==r&&t.emit("propagate",[e,!0],r,!1,!1),r}})),e.prototype=a.prototype;const n=a.prototype.then;a.prototype.then=function(){var e=this,i=r(e);i.promise=e;for(var a=arguments.length,s=new Array(a),c=0;c e())),t};function m(e,t){i.inPlace(t,["onreadystatechange"],"fn-",E)}function b(){var e=this,t=r.context(e);e.readyState>3&&!t.resolved&&(t.resolved=!0,r.emit("xhr-resolved",[],e)),i.inPlace(e,f,"fn-",E)}if(function(e,t){for(var r in e)t[r]=e[r]}(o,p),p.prototype=o.prototype,i.inPlace(p.prototype,J,"-xhr-",E),r.on("send-xhr-start",(function(e,t){m(e,t),function(e){h.push(e),a&&(y?y.then(A):u?u(A):(w=-w,x.data=w))}(t)})),r.on("open-xhr-start",m),a){var y=c&&c.resolve();if(!u&&!c){var w=1,x=document.createTextNode(w);new a(A).observe(x,{characterData:!0})}}else t.on("fn-end",(function(e){e[0]&&e[0].type===d||A()}));function A(){for(var e=0;e {r.d(t,{t:()=>n});const n=r(3325).D.ajax},6660:(e,t,r)=>{r.d(t,{A:()=>i,t:()=>n});const n=r(3325).D.jserrors,i="nr@seenError"},3081:(e,t,r)=>{r.d(t,{gF:()=>o,mY:()=>i,t9:()=>n,vz:()=>s,xS:()=>a});const n=r(3325).D.metrics,i="sm",o="cm",a="storeSupportabilityMetrics",s="storeEventMetrics"},4649:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageAction},7633:(e,t,r)=>{r.d(t,{Dz:()=>i,OJ:()=>a,qw:()=>o,t9:()=>n});const n=r(3325).D.pageViewEvent,i="firstbyte",o="domcontent",a="windowload"},9251:(e,t,r)=>{r.d(t,{t:()=>n});const n=r(3325).D.pageViewTiming},3614:(e,t,r)=>{r.d(t,{BST_RESOURCE:()=>i,END:()=>s,FEATURE_NAME:()=>n,FN_END:()=>u,FN_START:()=>c,PUSH_STATE:()=>d,RESOURCE:()=>o,START:()=>a});const n=r(3325).D.sessionTrace,i="bstResource",o="resource",a="-start",s="-end",c="fn"+a,u="fn"+s,d="pushState"},7836:(e,t,r)=>{r.d(t,{BODY:()=>A,CB_END:()=>E,CB_START:()=>u,END:()=>x,FEATURE_NAME:()=>i,FETCH:()=>_,FETCH_BODY:()=>v,FETCH_DONE:()=>m,FETCH_START:()=>p,FN_END:()=>c,FN_START:()=>s,INTERACTION:()=>l,INTERACTION_API:()=>d,INTERACTION_EVENTS:()=>o,JSONP_END:()=>b,JSONP_NODE:()=>g,JS_TIME:()=>T,MAX_TIMER_BUDGET:()=>a,REMAINING:()=>f,SPA_NODE:()=>h,START:()=>w,originalSetTimeout:()=>y});var n=r(5763);const i=r(3325).D.spa,o=["click","submit","keypress","keydown","keyup","change"],a=999,s="fn-start",c="fn-end",u="cb-start",d="api-ixn-",f="remaining",l="interaction",h="spaNode",g="jsonpNode",p="fetch-start",m="fetch-done",v="fetch-body-",b="jsonp-end",y=n.Yu.ST,w="-start",x="-end",A="-body",E="cb"+x,T="jsTime",_="fetch"},5938:(e,t,r)=>{r.d(t,{W:()=>o});var n=r(5763),i=r(2177);class o{constructor(e,t,r){this.agentIdentifier=e,this.aggregator=t,this.ee=i.ee.get(e,(0,n.OP)(this.agentIdentifier).isolatedBacklog),this.featureName=r,this.blocked=!1}}},9144:(e,t,r)=>{r.d(t,{j:()=>m});var n=r(3325),i=r(5763),o=r(5546),a=r(2177),s=r(7894),c=r(8e3),u=r(3960),d=r(385),f=r(50),l=r(3081),h=r(8632);function g(){const e=(0,h.gG)();["setErrorHandler","finished","addToTrace","inlineHit","addRelease","addPageAction","setCurrentRouteName","setPageViewName","setCustomAttribute","interaction","noticeError","setUserId"].forEach((t=>{e[t]=function(){for(var r=arguments.length,n=new Array(r),i=0;i 1?r-1:0),i=1;i {e.exposed&&e.api[t]&&o.push(e.api[t](...n))})),o.length>1?o:o[0]}(t,...n)}}))}var p=r(2587);function m(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:{},m=arguments.length>2?arguments[2]:void 0,v=arguments.length>3?arguments[3]:void 0,{init:b,info:y,loader_config:w,runtime:x={loaderType:m},exposed:A=!0}=t;const E=(0,h.gG)();y||(b=E.init,y=E.info,w=E.loader_config),(0,i.Dg)(e,b||{}),(0,i.GE)(e,w||{}),(0,i.sU)(e,x),y.jsAttributes??={},d.v6&&(y.jsAttributes.isWorker=!0),(0,i.CX)(e,y),g();const T=function(e,t){t||(0,c.R)(e,"api");const h={};var g=a.ee.get(e),p=g.get("tracer"),m="api-",v=m+"ixn-";function b(t,r,n,o){const a=(0,i.C5)(e);return null===r?delete a.jsAttributes[t]:(0,i.CX)(e,{...a,jsAttributes:{...a.jsAttributes,[t]:r}}),x(m,n,!0,o||null===r?"session":void 0)(t,r)}function y(){}["setErrorHandler","finished","addToTrace","inlineHit","addRelease"].forEach((e=>h[e]=x(m,e,!0,"api"))),h.addPageAction=x(m,"addPageAction",!0,n.D.pageAction),h.setCurrentRouteName=x(m,"routeName",!0,n.D.spa),h.setPageViewName=function(t,r){if("string"==typeof t)return"/"!==t.charAt(0)&&(t="/"+t),(0,i.OP)(e).customTransaction=(r||"http://custom.transaction")+t,x(m,"setPageViewName",!0)()},h.setCustomAttribute=function(e,t){let r=arguments.length>2&&void 0!==arguments[2]&&arguments[2];if("string"==typeof e){if(["string","number"].includes(typeof t)||null===t)return b(e,t,"setCustomAttribute",r);(0,f.Z)("Failed to execute setCustomAttribute.\nNon-null value must be a string or number type, but a type of was provided."))}else(0,f.Z)("Failed to execute setCustomAttribute.\nName must be a string type, but a type of was provided."))},h.setUserId=function(e){if("string"==typeof e||null===e)return b("enduser.id",e,"setUserId",!0);(0,f.Z)("Failed to execute setUserId.\nNon-null value must be a string type, but a type of was provided."))},h.interaction=function(){return(new y).get()};var w=y.prototype={createTracer:function(e,t){var r={},i=this,a="function"==typeof t;return(0,o.p)(v+"tracer",[(0,s.z)(),e,r],i,n.D.spa,g),function(){if(p.emit((a?"":"no-")+"fn-start",[(0,s.z)(),i,a],r),a)try{return t.apply(this,arguments)}catch(e){throw p.emit("fn-err",[arguments,this,"string"==typeof e?new Error(e):e],r),e}finally{p.emit("fn-end",[(0,s.z)()],r)}}}};function x(e,t,r,i){return function(){return(0,o.p)(l.xS,["API/"+t+"/called"],void 0,n.D.metrics,g),i&&(0,o.p)(e+t,[(0,s.z)(),...arguments],r?null:this,i,g),r?void 0:this}}function A(){r.e(439).then(r.bind(r,7438)).then((t=>{let{setAPI:r}=t;r(e),(0,c.L)(e,"api")})).catch((()=>(0,f.Z)("Downloading runtime APIs failed...")))}return["actionText","setName","setAttribute","save","ignore","onEnd","getContext","end","get"].forEach((e=>{w[e]=x(v,e,void 0,n.D.spa)})),h.noticeError=function(e,t){"string"==typeof e&&(e=new Error(e)),(0,o.p)(l.xS,["API/noticeError/called"],void 0,n.D.metrics,g),(0,o.p)("err",[e,(0,s.z)(),!1,t],void 0,n.D.jserrors,g)},d.il?(0,u.b)((()=>A()),!0):A(),h}(e,v);return(0,h.Qy)(e,T,"api"),(0,h.Qy)(e,A,"exposed"),(0,h.EZ)("activatedFeatures",p.T),T}},3325:(e,t,r)=>{r.d(t,{D:()=>n,p:()=>i});const n={ajax:"ajax",jserrors:"jserrors",metrics:"metrics",pageAction:"page_action",pageViewEvent:"page_view_event",pageViewTiming:"page_view_timing",sessionReplay:"session_replay",sessionTrace:"session_trace",spa:"spa"},i={[n.pageViewEvent]:1,[n.pageViewTiming]:2,[n.metrics]:3,[n.jserrors]:4,[n.ajax]:5,[n.sessionTrace]:6,[n.pageAction]:7,[n.spa]:8,[n.sessionReplay]:9}}},n={};function i(e){var t=n[e];if(void 0!==t)return t.exports;var o=n[e]={exports:{}};return r[e](o,o.exports,i),o.exports}i.m=r,i.d=(e,t)=>{for(var r in t)i.o(t,r)&&!i.o(e,r)&&Object.defineProperty(e,r,{enumerable:!0,get:t[r]})},i.f={},i.e=e=>Promise.all(Object.keys(i.f).reduce(((t,r)=>(i.f[r](e,t),t)),[])),i.u=e=>(({78:"page_action-aggregate",147:"metrics-aggregate",242:"session-manager",317:"jserrors-aggregate",348:"page_view_timing-aggregate",412:"lazy-feature-loader",439:"async-api",538:"recorder",590:"session_replay-aggregate",675:"compressor",733:"session_trace-aggregate",786:"page_view_event-aggregate",873:"spa-aggregate",898:"ajax-aggregate"}[e]||e)+"."+{78:"ac76d497",147:"3dc53903",148:"1a20d5fe",242:"2a64278a",317:"49e41428",348:"bd6de33a",412:"2f55ce66",439:"30bd804e",538:"1b18459f",590:"cf0efb30",675:"ae9f91a8",733:"83105561",786:"06482edd",860:"03a8b7a5",873:"e6b09d52",898:"998ef92b"}[e]+"-1.236.0.min.js"),i.o=(e,t)=>Object.prototype.hasOwnProperty.call(e,t),e={},t="NRBA:",i.l=(r,n,o,a)=>{if(e[r])e[r].push(n);else{var s,c;if(void 0!==o)for(var u=document.getElementsByTagName("script"),d=0;d {s.onerror=s.onload=null,clearTimeout(h);var i=e[r];if(delete e[r],s.parentNode&&s.parentNode.removeChild(s),i&&i.forEach((e=>e(n))),t)return t(n)},h=setTimeout(l.bind(null,void 0,{type:"timeout",target:s}),12e4);s.onerror=l.bind(null,s.onerror),s.onload=l.bind(null,s.onload),c&&document.head.appendChild(s)}},i.r=e=>{"undefined"!=typeof Symbol&&Symbol.toStringTag&&Object.defineProperty(e,Symbol.toStringTag,{value:"Module"}),Object.defineProperty(e,"__esModule",{value:!0})},i.j=364,i.p="https://js-agent.newrelic.com/",(()=>{var e={364:0,953:0};i.f.j=(t,r)=>{var n=i.o(e,t)?e[t]:void 0;if(0!==n)if(n)r.push(n[2]);else{var o=new Promise(((r,i)=>n=e[t]=[r,i]));r.push(n[2]=o);var a=i.p+i.u(t),s=new Error;i.l(a,(r=>{if(i.o(e,t)&&(0!==(n=e[t])&&(e[t]=void 0),n)){var o=r&&("load"===r.type?"missing":r.type),a=r&&r.target&&r.target.src;s.message="Loading chunk "+t+" failed.\n("+o+": "+a+")",s.name="ChunkLoadError",s.type=o,s.request=a,n[1](s)}}),"chunk-"+t,t)}};var t=(t,r)=>{var n,o,[a,s,c]=r,u=0;if(a.some((t=>0!==e[t]))){for(n in s)i.o(s,n)&&(i.m[n]=s[n]);if(c)c(i)}for(t&&t(r);u {i.r(o);var e=i(3325),t=i(5763);const r=Object.values(e.D);function n(e){const n={};return r.forEach((r=>{n[r]=function(e,r){return!1!==(0,t.Mt)(r,"".concat(e,".enabled"))}(r,e)})),n}var a=i(9144);var s=i(5546),c=i(385),u=i(8e3),d=i(5938),f=i(3960),l=i(50);class h extends d.W{constructor(e,t,r){let n=!(arguments.length>3&&void 0!==arguments[3])||arguments[3];super(e,t,r),this.auto=n,this.abortHandler,this.featAggregate,this.onAggregateImported,n&&(0,u.R)(e,r)}importAggregator(){let e=arguments.length>0&&void 0!==arguments[0]?arguments[0]:{};if(this.featAggregate||!this.auto)return;const r=c.il&&!0===(0,t.Mt)(this.agentIdentifier,"privacy.cookies_enabled");let n;this.onAggregateImported=new Promise((e=>{n=e}));const o=async()=>{let t;try{if(r){const{setupAgentSession:e}=await Promise.all([i.e(860),i.e(242)]).then(i.bind(i,3228));t=e(this.agentIdentifier)}}catch(e){(0,l.Z)("A problem occurred when starting up session manager. This page will not start or extend any session.",e)}try{if(!this.shouldImportAgg(this.featureName,t))return void(0,u.L)(this.agentIdentifier,this.featureName);const{lazyFeatureLoader:r}=await i.e(412).then(i.bind(i,8582)),{Aggregate:o}=await r(this.featureName,"aggregate");this.featAggregate=new o(this.agentIdentifier,this.aggregator,e),n(!0)}catch(e){(0,l.Z)("Downloading and initializing ".concat(this.featureName," failed..."),e),this.abortHandler?.(),n(!1)}};c.il?(0,f.b)((()=>o()),!0):o()}shouldImportAgg(r,n){return r!==e.D.sessionReplay||!1!==(0,t.Mt)(this.agentIdentifier,"session_trace.enabled")&&(!!n?.isNew||!!n?.state.sessionReplay)}}var g=i(7633),p=i(7894);class m extends h{static featureName=g.t9;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];if(super(r,n,g.t9,i),("undefined"==typeof PerformanceNavigationTiming||c.Tt)&&"undefined"!=typeof PerformanceTiming){const n=(0,t.OP)(r);n[g.Dz]=Math.max(Date.now()-n.offset,0),(0,f.K)((()=>n[g.qw]=Math.max((0,p.z)()-n[g.Dz],0))),(0,f.b)((()=>{const t=(0,p.z)();n[g.OJ]=Math.max(t-n[g.Dz],0),(0,s.p)("timing",["load",t],void 0,e.D.pageViewTiming,this.ee)}))}this.importAggregator()}}var v=i(1117),b=i(1284);class y extends v.w{constructor(e){super(e),this.aggregatedData={}}store(e,t,r,n,i){var o=this.getBucket(e,t,r,i);return o.metrics=function(e,t){t||(t={count:0});return t.count+=1,(0,b.D)(e,(function(e,r){t[e]=w(r,t[e])})),t}(n,o.metrics),o}merge(e,t,r,n,i){var o=this.getBucket(e,t,n,i);if(o.metrics){var a=o.metrics;a.count+=r.count,(0,b.D)(r,(function(e,t){if("count"!==e){var n=a[e],i=r[e];i&&!i.c?a[e]=w(i.t,n):a[e]=function(e,t){if(!t)return e;t.c||(t=x(t.t));return t.min=Math.min(e.min,t.min),t.max=Math.max(e.max,t.max),t.t+=e.t,t.sos+=e.sos,t.c+=e.c,t}(i,a[e])}}))}else o.metrics=r}storeMetric(e,t,r,n){var i=this.getBucket(e,t,r);return i.stats=w(n,i.stats),i}getBucket(e,t,r,n){this.aggregatedData[e]||(this.aggregatedData[e]={});var i=this.aggregatedData[e][t];return i||(i=this.aggregatedData[e][t]={params:r||{}},n&&(i.custom=n)),i}get(e,t){return t?this.aggregatedData[e]&&this.aggregatedData[e][t]:this.aggregatedData[e]}take(e){for(var t={},r="",n=!1,i=0;i t.max&&(t.max=e),e 2&&void 0!==arguments[2])||arguments[2];super(e,r,j.t,n),c.il&&((0,t.OP)(e).initHidden=Boolean("hidden"===document.visibilityState),(0,N.N)((()=>(0,s.p)("docHidden",[(0,p.z)()],void 0,j.t,this.ee)),!0),(0,O.bP)("pagehide",(()=>(0,s.p)("winPagehide",[(0,p.z)()],void 0,j.t,this.ee))),this.importAggregator())}}var P=i(3081);class C extends h{static featureName=P.t9;constructor(e,t){let r=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(e,t,P.t9,r),this.importAggregator()}}var R,I=i(2210),k=i(1214),H=i(2177),L={};try{R=localStorage.getItem("__nr_flags").split(","),console&&"function"==typeof console.log&&(L.console=!0,-1!==R.indexOf("dev")&&(L.dev=!0),-1!==R.indexOf("nr_dev")&&(L.nrDev=!0))}catch(e){}function z(e){try{L.console&&z(e)}catch(e){}}L.nrDev&&H.ee.on("internal-error",(function(e){z(e.stack)})),L.dev&&H.ee.on("fn-err",(function(e,t,r){z(r.stack)})),L.dev&&(z("NR AGENT IN DEVELOPMENT MODE"),z("flags: "+(0,b.D)(L,(function(e,t){return e})).join(", ")));var M=i(6660);class B extends h{static featureName=M.t;constructor(r,n){let i=!(arguments.length>2&&void 0!==arguments[2])||arguments[2];super(r,n,M.t,i),this.skipNext=0;try{this.removeOnAbort=new AbortController}catch(e){}const o=this;o.ee.on("fn-start",(function(e,t,r){o.abortHandler&&(o.skipNext+=1)})),o.ee.on("fn-err",(function(t,r,n){o.abortHandler&&!n[M.A]&&((0,I.X)(n,M.A,(function(){return!0})),this.thrown=!0,(0,s.p)("err",[n,(0,p.z)()],void 0,e.D.jserrors,o.ee))})),o.ee.on("fn-end",(function(){o.abortHandler&&!this.thrown&&o.skipNext>0&&(o.skipNext-=1)})),o.ee.on("internal-error",(function(t){(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,o.ee)})),this.origOnerror=c._A.onerror,c._A.onerror=this.onerrorHandler.bind(this),c._A.addEventListener("unhandledrejection",(t=>{const r=function(e){let t="Unhandled Promise Rejection: ";if(e instanceof Error)try{return e.message=t+e.message,e}catch(t){return e}if(void 0===e)return new Error(t);try{return new Error(t+(0,D.P)(e))}catch(e){return new Error(t)}}(t.reason);(0,s.p)("err",[r,(0,p.z)(),!1,{unhandledPromiseRejection:1}],void 0,e.D.jserrors,this.ee)}),(0,O.m$)(!1,this.removeOnAbort?.signal)),(0,k.gy)(this.ee),(0,k.BV)(this.ee),(0,k.em)(this.ee),(0,t.OP)(r).xhrWrappable&&(0,k.Kf)(this.ee),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}onerrorHandler(t,r,n,i,o){"function"==typeof this.origOnerror&&this.origOnerror(...arguments);try{this.skipNext?this.skipNext-=1:(0,s.p)("err",[o||new F(t,r,n),(0,p.z)()],void 0,e.D.jserrors,this.ee)}catch(t){try{(0,s.p)("ierr",[t,(0,p.z)(),!0],void 0,e.D.jserrors,this.ee)}catch(e){}}return!1}}function F(e,t,r){this.message=e||"Uncaught error with no additional information",this.sourceURL=t,this.line=r}let U=1;const q="nr@id";function G(e){const t=typeof e;return!e||"object"!==t&&"function"!==t?-1:e===c._A?0:(0,I.X)(e,q,(function(){return U++}))}function V(e){if("string"==typeof e&&e.length)return e.length;if("object"==typeof e){if("undefined"!=typeof ArrayBuffer&&e instanceof ArrayBuffer&&e.byteLength)return e.byteLength;if("undefined"!=typeof Blob&&e instanceof Blob&&e.size)return e.size;if(!("undefined"!=typeof FormData&&e instanceof FormData))try{return(0,D.P)(e).length}catch(e){return}}}var X=i(7243);class W{constructor(e){this.agentIdentifier=e,this.generateTracePayload=this.generateTracePayload.bind(this),this.shouldGenerateTrace=this.shouldGenerateTrace.bind(this)}generateTracePayload(e){if(!this.shouldGenerateTrace(e))return null;var r=(0,t.DL)(this.agentIdentifier);if(!r)return null;var n=(r.accountID||"").toString()||null,i=(r.agentID||"").toString()||null,o=(r.trustKey||"").toString()||null;if(!n||!i)return null;var a=(0,_.M)(),s=(0,_.Ht)(),c=Date.now(),u={spanId:a,traceId:s,timestamp:c};return(e.sameOrigin||this.isAllowedOrigin(e)&&this.useTraceContextHeadersForCors())&&(u.traceContextParentHeader=this.generateTraceContextParentHeader(a,s),u.traceContextStateHeader=this.generateTraceContextStateHeader(a,c,n,i,o)),(e.sameOrigin&&!this.excludeNewrelicHeader()||!e.sameOrigin&&this.isAllowedOrigin(e)&&this.useNewrelicHeaderForCors())&&(u.newrelicHeader=this.generateTraceHeader(a,s,c,n,i,o)),u}generateTraceContextParentHeader(e,t){return"00-"+t+"-"+e+"-01"}generateTraceContextStateHeader(e,t,r,n,i){return i+"@nr=0-1-"+r+"-"+n+"-"+e+"----"+t}generateTraceHeader(e,t,r,n,i,o){if(!("function"==typeof c._A?.btoa))return null;var a={v:[0,1],d:{ty:"Browser",ac:n,ap:i,id:e,tr:t,ti:r}};return o&&n!==o&&(a.d.tk=o),btoa((0,D.P)(a))}shouldGenerateTrace(e){return this.isDtEnabled()&&this.isAllowedOrigin(e)}isAllowedOrigin(e){var r=!1,n={};if((0,t.Mt)(this.agentIdentifier,"distributed_tracing")&&(n=(0,t.P_)(this.agentIdentifier).distributed_tracing),e.sameOrigin)r=!0;else if(n.allowed_origins instanceof Array)for(var i=0;i 2&&void 0!==arguments[2])||arguments[2];super(r,n,Z.t,i),(0,t.OP)(r).xhrWrappable&&(this.dt=new W(r),this.handler=(e,t,r,n)=>(0,s.p)(e,t,r,n,this.ee),(0,k.u5)(this.ee),(0,k.Kf)(this.ee),function(r,n,i,o){function a(e){var t=this;t.totalCbs=0,t.called=0,t.cbTime=0,t.end=E,t.ended=!1,t.xhrGuids={},t.lastSize=null,t.loadCaptureCalled=!1,t.params=this.params||{},t.metrics=this.metrics||{},e.addEventListener("load",(function(r){_(t,e)}),(0,O.m$)(!1)),c.IF||e.addEventListener("progress",(function(e){t.lastSize=e.loaded}),(0,O.m$)(!1))}function s(e){this.params={method:e[0]},T(this,e[1]),this.metrics={}}function u(e,n){var i=(0,t.DL)(r);i.xpid&&this.sameOrigin&&n.setRequestHeader("X-NewRelic-ID",i.xpid);var a=o.generateTracePayload(this.parsedOrigin);if(a){var s=!1;a.newrelicHeader&&(n.setRequestHeader("newrelic",a.newrelicHeader),s=!0),a.traceContextParentHeader&&(n.setRequestHeader("traceparent",a.traceContextParentHeader),a.traceContextStateHeader&&n.setRequestHeader("tracestate",a.traceContextStateHeader),s=!0),s&&(this.dt=a)}}function d(e,t){var r=this.metrics,i=e[0],o=this;if(r&&i){var a=V(i);a&&(r.txSize=a)}this.startTime=(0,p.z)(),this.listener=function(e){try{"abort"!==e.type||o.loadCaptureCalled||(o.params.aborted=!0),("load"!==e.type||o.called===o.totalCbs&&(o.onloadCalled||"function"!=typeof t.onload)&&"function"==typeof o.end)&&o.end(t)}catch(e){try{n.emit("internal-error",[e])}catch(e){}}};for(var s=0;s 1?e[1]=i:e.push(i)}else e[0]&&e[0].headers&&s(e[0].headers,n)&&(this.dt=n);function s(e,t){var r=!1;return t.newrelicHeader&&(e.set("newrelic",t.newrelicHeader),r=!0),t.traceContextParentHeader&&(e.set("traceparent",t.traceContextParentHeader),t.traceContextStateHeader&&e.set("tracestate",t.traceContextStateHeader),r=!0),r}}function x(e,t){this.params={},this.metrics={},this.startTime=(0,p.z)(),this.dt=t,e.length>=1&&(this.target=e[0]),e.length>=2&&(this.opts=e[1]);var r,n=this.opts||{},i=this.target;"string"==typeof i?r=i:"object"==typeof i&&i instanceof Y?r=i.url:c._A?.URL&&"object"==typeof i&&i instanceof URL&&(r=i.href),T(this,r);var o=(""+(i&&i instanceof Y&&i.method||n.method||"GET")).toUpperCase();this.params.method=o,this.txSize=V(n.body)||0}function A(t,r){var n;this.endTime=(0,p.z)(),this.params||(this.params={}),this.params.status=r?r.status:0,"string"==typeof this.rxSize&&this.rxSize.length>0&&(n=+this.rxSize);var o={txSize:this.txSize,rxSize:n,duration:(0,p.z)()-this.startTime};i("xhr",[this.params,o,this.startTime,this.endTime,"fetch"],this,e.D.ajax)}function E(t){var r=this.params,n=this.metrics;if(!this.ended){this.ended=!0;for(var o=0;o 2&&void 0!==arguments[2])||arguments[2];super(e,t,we.t,r),this.importAggregator()}}new class{constructor(e){let t=arguments.length>1&&void 0!==arguments[1]?arguments[1]:(0,_.ky)(16);c._A?(this.agentIdentifier=t,this.sharedAggregator=new y({agentIdentifier:this.agentIdentifier}),this.features={},this.desiredFeatures=new Set(e.features||[]),this.desiredFeatures.add(m),Object.assign(this,(0,a.j)(this.agentIdentifier,e,e.loaderType||"agent")),this.start()):(0,l.Z)("Failed to initial the agent. Could not determine the runtime environment.")}get config(){return{info:(0,t.C5)(this.agentIdentifier),init:(0,t.P_)(this.agentIdentifier),loader_config:(0,t.DL)(this.agentIdentifier),runtime:(0,t.OP)(this.agentIdentifier)}}start(){const t="features";try{const r=n(this.agentIdentifier),i=[...this.desiredFeatures];i.sort(((t,r)=>e.p[t.featureName]-e.p[r.featureName])),i.forEach((t=>{if(r[t.featureName]||t.featureName===e.D.pageViewEvent){const n=function(t){switch(t){case e.D.ajax:return[e.D.jserrors];case e.D.sessionTrace:return[e.D.ajax,e.D.pageViewEvent];case e.D.sessionReplay:return[e.D.sessionTrace];case e.D.pageViewTiming:return[e.D.pageViewEvent];default:return[]}}(t.featureName);n.every((e=>r[e]))||(0,l.Z)("".concat(t.featureName," is enabled but one or more dependent features has been disabled (").concat((0,D.P)(n),"). This may cause unintended consequences or missing data...")),this.features[t.featureName]=new t(this.agentIdentifier,this.sharedAggregator)}})),(0,T.Qy)(this.agentIdentifier,this.features,t)}catch(e){(0,l.Z)("Failed to initialize all enabled instrument classes (agent aborted) -",e);for(const e in this.features)this.features[e].abortHandler?.();const r=(0,T.fP)();return delete r.initializedAgents[this.agentIdentifier]?.api,delete r.initializedAgents[this.agentIdentifier]?.[t],delete this.sharedAggregator,r.ee?.abort(),delete r.ee?.get(this.agentIdentifier),!1}}}({features:[J,m,S,class extends h{static featureName=oe;constructor(t,r){if(super(t,r,oe,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;const n=this.ee;let i;(0,k.QU)(n),this.eventsEE=(0,k.em)(n),this.eventsEE.on(se,(function(e,t){this.bstStart=(0,p.z)()})),this.eventsEE.on(ae,(function(t,r){(0,s.p)("bst",[t[0],r,this.bstStart,(0,p.z)()],void 0,e.D.sessionTrace,n)})),n.on(ce+ne,(function(e){this.time=(0,p.z)(),this.startPath=location.pathname+location.hash})),n.on(ce+ie,(function(t){(0,s.p)("bstHist",[location.pathname+location.hash,this.startPath,this.time],void 0,e.D.sessionTrace,n)}));try{i=new PerformanceObserver((t=>{const r=t.getEntries();(0,s.p)(te,[r],void 0,e.D.sessionTrace,n)})),i.observe({type:re,buffered:!0})}catch(e){}this.importAggregator({resourceObserver:i})}},C,xe,B,class extends h{static featureName=de;constructor(e,r){if(super(e,r,de,!(arguments.length>2&&void 0!==arguments[2])||arguments[2]),!c.il)return;if(!(0,t.OP)(e).xhrWrappable)return;try{this.removeOnAbort=new AbortController}catch(e){}let n,i=0;const o=this.ee.get("tracer"),a=(0,k._L)(this.ee),s=(0,k.Lg)(this.ee),u=(0,k.BV)(this.ee),d=(0,k.Kf)(this.ee),f=this.ee.get("events"),l=(0,k.u5)(this.ee),h=(0,k.QU)(this.ee),g=(0,k.Gm)(this.ee);function m(e,t){h.emit("newURL",[""+window.location,t])}function v(){i++,n=window.location.hash,this[ve]=(0,p.z)()}function b(){i--,window.location.hash!==n&&m(0,!0);var e=(0,p.z)();this[pe]=~~this[pe]+e-this[ve],this[ye]=e}function y(e,t){e.on(t,(function(){this[t]=(0,p.z)()}))}this.ee.on(ve,v),s.on(be,v),a.on(be,v),this.ee.on(ye,b),s.on(ge,b),a.on(ge,b),this.ee.buffer([ve,ye,"xhr-resolved"],this.featureName),f.buffer([ve],this.featureName),u.buffer(["setTimeout"+le,"clearTimeout"+fe,ve],this.featureName),d.buffer([ve,"new-xhr","send-xhr"+fe],this.featureName),l.buffer([me+fe,me+"-done",me+he+fe,me+he+le],this.featureName),h.buffer(["newURL"],this.featureName),g.buffer([ve],this.featureName),s.buffer(["propagate",be,ge,"executor-err","resolve"+fe],this.featureName),o.buffer([ve,"no-"+ve],this.featureName),a.buffer(["new-jsonp","cb-start","jsonp-error","jsonp-end"],this.featureName),y(l,me+fe),y(l,me+"-done"),y(a,"new-jsonp"),y(a,"jsonp-end"),y(a,"cb-start"),h.on("pushState-end",m),h.on("replaceState-end",m),window.addEventListener("hashchange",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("load",m,(0,O.m$)(!0,this.removeOnAbort?.signal)),window.addEventListener("popstate",(function(){m(0,i>1)}),(0,O.m$)(!0,this.removeOnAbort?.signal)),this.abortHandler=this.#e,this.importAggregator()}#e(){this.removeOnAbort?.abort(),this.abortHandler=void 0}}],loaderType:"spa"})})(),window.NRBA=o})(); window.jQuery || document.write(' ') CKEDITOR_BASEPATH='https://f1000research.com/js/vendor/ckeditor/' window.reactTheme = 'research'; window.MathJax = { CommonHTML: { linebreaks: { automatic: true } }, 'HTML-CSS': { linebreaks: { automatic: true } }, SVG: { linebreaks: { automatic: true } }, AuthorInit: function() { MathJax.Hub.Register.MessageHook('End Process', function () { let timeout = false; // holder for timeout id const delay = 250; // delay after event is "complete" to run callback const reflowMath = function() { const dispFormulas = document.querySelectorAll('.disp-formula.panel'); if (!dispFormulas) { return; } for (const dispFormula of dispFormulas) { const child = dispFormula.querySelector('.MathJax_Preview').nextSibling.firstChild; const isMultiline = MathJax.Hub.getAllJax(dispFormula)[0].root.isMultiline; if (dispFormula.offsetWidth < child.offsetWidth || isMultiline) { MathJax.Hub.Queue(['Rerender', MathJax.Hub, dispFormula]); } } }; window.addEventListener('resize', function() { clearTimeout(timeout); // clear the timeout timeout = setTimeout(reflowMath, delay); // start timing for event "completion" }); }); }, }; if (window.location.hash == '#_=_'){ window.location = window.location.href.split('#')[0] } !function(f,b,e,v,n,t,s){if(f.fbq)return;n=f.fbq=function() {n.callMethod? n.callMethod.apply(n,arguments):n.queue.push(arguments)} ;if(!f._fbq)f._fbq=n; n.push=n;n.loaded=!0;n.version='2.0';n.queue=[];t=b.createElement(e);t.async=!0; t.src=v;s=b.getElementsByTagName(e)[0];s.parentNode.insertBefore(t,s)}(window, document,'script','https://connect.facebook.net/en_US/fbevents.js'); fbq('init', '1641728616063202'); fbq('track', "PixelInitialized", {}); (function(h,o,t,j,a,r){ h.hj=h.hj||function(){(h.hj.q=h.hj.q||[]).push(arguments)}; h._hjSettings={hjid:2318163,hjsv:6}; a=o.getElementsByTagName('head')[0]; r=o.createElement('script');r.async=1; r.src=t+h._hjSettings.hjid+j+h._hjSettings.hjsv; a.appendChild(r); })(window,document,'https://static.hotjar.com/c/hotjar-','.js?sv='); search file_upload Submit your research search menu close search Browse Gateways & Collections How to Publish Submit your Research My Submissions Article Guidelines Article Guidelines (New Versions) Open Data, Software and Code Guidelines Open Data and Accessible Source Materials Guidelines (HSS) Open Data, Software and Code Guidelines (PSE) Prepublication Checks Production Process Posters and Slides Guidelines Document Guidelines Article Processing Charges Peer Review Finding Article Reviewers About How it Works For Reviewers Our Advisors Policies Glossary FAQs For Developers Newsroom Contact My Research Submissions Content and Tracking Alerts My Details Sign In file_upload Submit your research { "@context": "https://schema.org", "@type": "ScholarlyArticle", "mainEntityOfPage": { "@type": "WebPage", "@id": "https://f1000research.com/articles/12-324" }, "headline": "The identification of high-performing antibodies for Sequestosome-1 for use in Western blot,...", "datePublished": "2023-03-23T16:43:12", "dateModified": "2024-07-10T12:23:32", "author": [ { "@type": "Person", "name": "Riham Ayoubi" }, { "@type": "Person", "name": "Walaa Alshafie" }, { "@type": "Person", "name": "Irina Shlaifer" }, { "@type": "Person", "name": "Kathleen Southern" }, { "@type": "Person", "name": "Peter S. McPherson" }, { "@type": "Person", "name": "Carl Laflamme" }, { "@type": "Person", "name": "NeuroSGC/YCharOS/EDDU collaborative group" } ], "publisher": { "@type": "Organization", "name": "F1000Research", "logo": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 480, "width": 60 } }, "image": { "@type": "ImageObject", "url": "https://f1000research.com/img/AMP/F1000Research_image.png", "height": 1200, "width": 150 }, "description": "Sequestosome-1, encoded by the gene SQSTM1, functions as a bridge between ubiquitinated proteins and the proteasome or autophagosome, thereby regulating protein degradation pathways. Loss of Sequestosome-1 is hypothesized to enhance neurodegeneration progression in several diseases, including amyotrophic lateral sclerosis (ALS) and frontotemporal disorders (FTD). Sequestosome-1 reproducible research would be facilitated with the availability of well-characterized anti-Sequestosome-1 antibodies. In this study, we characterized seventeen Sequestosome-1 commercial antibodies for Western blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. We identified many high-performing antibodies and encourage readers to use this report as a guide to select the most appropriate antibody for their specific needs." } { "@context": "http://schema.org", "@type": "BreadcrumbList", "itemListElement": [ { "@type": "ListItem", "position": "1", "item": { "@id": "https://f1000research.com/", "name": "Home" } }, { "@type": "ListItem", "position": "2", "item": { "@id": "https://f1000research.com/browse/articles", "name": "Browse" } }, { "@type": "ListItem", "position": "3", "item": { "@id": "https://f1000research.com/articles/12-324", "name": "The identification of high-performing antibodies for Sequestosome-1..." } } ] } Home Browse The identification of high-performing antibodies for Sequestosome-1... ALL Metrics - Views Downloads Get PDF Get XML Cite How to cite this article Ayoubi R, Alshafie W, Shlaifer I et al. The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved] . F1000Research 2024, 12 :324 ( https://doi.org/10.12688/f1000research.132628.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. Close Copy Citation Details Export Export Citation Sciwheel EndNote Ref. Manager Bibtex ProCite Sente EXPORT Select a format first Track Share ▬ ✚ Data Note Revised The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved] Riham Ayoubi 1 , Walaa Alshafie 1 , Irina Shlaifer 2 , [...] Kathleen Southern https://orcid.org/0000-0002-4125-3608 1 , Peter S. McPherson 1 , Carl Laflamme https://orcid.org/0000-0002-4125-3608 1 , NeuroSGC/YCharOS/EDDU collaborative group Riham Ayoubi 1 , Walaa Alshafie 1 , [...] Irina Shlaifer 2 , Kathleen Southern https://orcid.org/0000-0002-4125-3608 1 , Peter S. McPherson 1 , Carl Laflamme https://orcid.org/0000-0002-4125-3608 1 , NeuroSGC/YCharOS/EDDU collaborative group PUBLISHED 10 Jul 2024 Author details Author details 1 Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, Québec, H3A 2B4, Canada 2 The Neuro’s Early Drug Discovery Unit (EDDU), Structural Genomics Consortium, McGill University, Montreal, Québec, H3A 2B4, Canada Riham Ayoubi Roles: Investigation, Methodology, Visualization, Writing – Review & Editing Walaa Alshafie Roles: Investigation, Methodology Irina Shlaifer Roles: Investigation, Writing – Review & Editing Kathleen Southern Roles: Writing – Original Draft Preparation, Writing – Review & Editing Peter S. McPherson Roles: Conceptualization, Funding Acquisition, Resources, Supervision Carl Laflamme Roles: Conceptualization, Data Curation, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Review & Editing OPEN PEER REVIEW DETAILS REVIEWER STATUS This article is included in the YCharOS (Antibody Characterization through Open Science) gateway. This article is included in the Cell & Molecular Biology gateway. Abstract Sequestosome-1, encoded by the gene SQSTM1 , functions as a bridge between ubiquitinated proteins and the proteasome or autophagosome, thereby regulating protein degradation pathways. Loss of Sequestosome-1 is hypothesized to enhance neurodegeneration progression in several diseases, including amyotrophic lateral sclerosis (ALS) and frontotemporal disorders (FTD). Sequestosome-1 reproducible research would be facilitated with the availability of well-characterized anti-Sequestosome-1 antibodies. In this study, we characterized seventeen Sequestosome-1 commercial antibodies for Western blot, immunoprecipitation, and immunofluorescence using a standardized experimental protocol based on comparing read-outs in knockout cell lines and isogenic parental controls. We identified many high-performing antibodies and encourage readers to use this report as a guide to select the most appropriate antibody for their specific needs. READ ALL READ LESS Keywords Uniprot ID Q13501, SQSTM1, Sequestosome-1, antibody characterization, antibody validation, Western blot, immunoprecipitation, immunofluorescence Corresponding Author(s) Carl Laflamme ( [email protected] ) Close Corresponding author: Carl Laflamme Competing interests: For this project, the laboratory of Peter McPherson developed partnerships with high-quality antibody manufacturers and knockout cell line providers. The partners provide antibodies and knockout cell lines to the McPherson laboratory at no cost. These partners include: - Abcam- ABclonal -Aviva Systems Biology -Bio Techne -Cell Signalling Technology -Developmental Studies Hybridoma Bank -GeneTex – Horizon Discovery – Proteintech – Synaptic Systems –Thermo Fisher Scientific. Grant information: This work was supported in part by the ALS-Reproducible Antibody Platform (ALS-RAP). ALS-RAP is a private-public partnership created by the ALS Association (USA), the Motor Neurone Disease Association (UK), and the ALS Society of Canada. The grant was from a Canadian Institutes of Health Research Foundation Grant (FDN154305) and by the Government of Canada through Genome Canada, Genome Quebec and Ontario Genomics (OGI-210). The Structural Genomics Consortium is a registered charity (no. 1097737) that receives funds from Bayer AG, Boehringer Ingelheim, Bristol Myers Squibb, Genentech, Genome Canada through Ontario Genomics Institute (grant no. OGI-196), the EU and EFPIA through the Innovative Medicines Initiative 2 Joint Undertaking (EUbOPEN grant no. 875510), Janssen, Merck KGaA (also known as EMD in Canada and the United States), Pfizer and Takeda. RA and WA were supported by a Mitacs fellowship. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Copyright: © 2024 Ayoubi R et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. How to cite: Ayoubi R, Alshafie W, Shlaifer I et al. The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved] . F1000Research 2024, 12 :324 ( https://doi.org/10.12688/f1000research.132628.2 ) First published: 23 Mar 2023, 12 :324 ( https://doi.org/10.12688/f1000research.132628.1 ) Latest published: 10 Jul 2024, 12 :324 ( https://doi.org/10.12688/f1000research.132628.2 ) Revised Amendments from Version 1 In this second version of the Data Note, we have included two paragraphs to the end of the Introduction section to clearly define the mission of the YCharOS initiative to the readers while clarifying that they present antibody characterization openly, without restriction, while leaving the result analysis up to the readers. Furthermore, the reference to the standardized antibody characterization platform used to carry out this study is now included, to allow readers to understand or replicate the workflow. Finally, a detailed description of how the cell line was chosen is now provided in the Results and discussion section. In this second version of the Data Note, we have included two paragraphs to the end of the Introduction section to clearly define the mission of the YCharOS initiative to the readers while clarifying that they present antibody characterization openly, without restriction, while leaving the result analysis up to the readers. Furthermore, the reference to the standardized antibody characterization platform used to carry out this study is now included, to allow readers to understand or replicate the workflow. Finally, a detailed description of how the cell line was chosen is now provided in the Results and discussion section. See the authors' detailed response to the review by Guoqiang Xu READ REVIEWER RESPONSES Introduction Sequestosome-1, alternatively known as p62, is an adaptor protein required for selective autophagy and proteasomal degradation. 1 – 3 Delivering polyubiquitinated proteins to the autophagosome or proteasome, Sequestosome-1/p62 plays a key role in the degradation of aggregate prone proteins. 1 SQSTM1 gene mutations may act as a potential threat by causing altered autophagy, resulting in pathogenic protein aggregation and the development of a variety of neurodegenerative diseases, including ALS and FTD. 4 Furthermore, SQSTM1 mutations have been identified in patients with ALS and FTD. 5 Serving as a signalling hub for neurodegenerative pathways, Sequestosome-1/p62 poses as a prospective therapeutic target in the treatment of neurodegenerative diseases. 6 Mechanistic studies would be greatly facilitated with the availability of high-quality antibodies. This research is part of a broader collaborative initiative in which academics, funders and commercial antibody manufacturers are working together to address antibody reproducibility issues by characterizing commercial antibodies for human proteins using standardized protocols, and openly sharing the data (1-3). Here we evaluated the performance of seventeen commercial antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation, and immunofluorescence, enabling biochemical and cellular assessment of Sequestosome-1 properties and function. The platform for antibody characterization used to carry out this study was endorsed by a committee of industry academic representatives. It consists of identifying human cell lines with adequate target protein expression and the development/contribution of equivalent knockout (KO) cell lines, followed by antibody characterization procedures using most commercially available antibodies against the corresponding protein. The standardized consensus antibody characterization protocols are openly available on Protocol Exchange, a preprint server ( https://doi.org/10.21203/rs.3.pex-2607/v1 ). 7 The authors do not engage in result analysis or offer explicit antibody recommendations. A limitation of this study is the use of universal protocols - any conclusions remain relevant within the confines of the experimental setup and cell line used in this study. Our primary aim is to deliver top-tier data to the scientific community, grounded in Open Science principles. This empowers experts to interpret the characterization data independently, enabling them to make informed choices regarding the most suitable antibodies for their specific experimental needs. Guidelines on how to interpret antibody characterization data found in this study are featured on the YCharOS gateway. 8 Results and discussion Our standard protocol involves comparing readouts from wild-type (WT) and knockout cells. 9 – 11 The first step is to identify a cell line(s) that expresses sufficient levels of a given protein to generate a measurable signal using antibodies. To this end, we examined the DepMap transcriptomics database to identify all cell lines that express the target at levels greater than 2.5 log 2 (transcripts per million “TPM” + 1), which we have found to be a suitable cut-off (Cancer Dependency Map Portal, RRID:SCR_017655). U2OS, expressing the Sequestosome-1 transcript at 6.7 log 2 (TPM+1), was identified as a suitable cell line and was modified with CRISPR/Cas9 to KO the corresponding SQSTM1 gene ( Table 1 ). Table 1. Summary of the cell lines used. Institution RRID (Cellosaurus) Cell line Genotype Montreal Neurological Institute CVCL_0042 U2OS WT Montreal Neurological Institute CVCL_A6LP U2OS SQSTM1 KO For Western blot experiments, we resolved proteins from WT and SQSTM1 KO cell extracts and probed them side-by-side with all antibodies in parallel ( Figure 1 ). Figure 1. Sequestosome-1 antibody screening by Western blot. Lysates of U2OS (WT and SQSTM1 KO) were prepared and 25 μg of protein were processed for Western blot with the indicated Sequestosome-1 antibodies. The Ponceau stained transfers of each blot are presented to show equal loading of WT and KO lysates and protein transfer efficiency from the acrylamide gels to the nitrocellulose membrane. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Exceptions were given for antibodies MA5-32835*, 66184-1-Ig* and 18420-1-AP, which were titrated to 1/200, 1/1000 and 1/1000, respectively, as the signals were too weak when following the supplier’s recommendations. Antibody dilution used: GTX629890* at 1/1000; GTX629888* at 1/1000; GTX100685 at 1/1000; 701510** at 1/1000; 710539** at 1/200; MA5-32835* at 1/200; 66184-1-Ig* at 1/1000; 18420-1-AP at 1/1000; 55274-1-AP at 1/1000; NBP2-23490* at 1/1000; MAB80281** at 1/1000; MAB8028* at 1/1000; MAB8028R** at 1/1000; ab109012** at 1/10000; ab56416* at 1/1000; ab207305** at 1/1000; ab240635** at 1/1000. Predicted band size: ~62 kDa. *= monoclonal antibody, **= recombinant antibody. For immunoprecipitation experiments, we used the antibodies to immunopurify Sequestosome-1 from U2OS cell extracts. The performance of each antibody was evaluated by detecting the Sequestosome-1 protein in extracts, in the immunodepleted extracts and in the immunoprecipitates ( Figure 2 ). Figure 2. Sequestosome-1 antibody screening by immunoprecipitation. U2OS lysates were prepared, and IP was performed using 1.0 μg of the indicated Sequestosome-1 antibodies pre-coupled to protein G or protein A Sepharose beads. Samples were washed and processed for Western blot with the indicated Sequestosome-1 antibody. For Western blot, MAB80281** was used at 1/3000, 66184-1-lg* at 1/3000, ab56416* at 1/5000, ab207305** at 1/10000 and GTX629890* at 1/5000. The Ponceau stained transfers of each blot are shown for similar reasons as in Figure 1 . SM= 10% starting material; UB=10% unbound fraction; IP=immunoprecipitate, HC= antibody heavy chain. *= monoclonal antibody, **= recombinant antibody. For immunofluorescence, as described previously, antibodies were screened using a mosaic strategy. In brief, we plated WT and KO cells together in the same well and imaged both cell types in the same field of view to reduce staining, imaging and image analysis bias ( Figure 3 ). Figure 3. Sequestosome-1 antibody screening by immunofluorescence. U2OS WT and SQSTM1 KO cells were labelled with a green or a far-red fluorescent dye, respectively. WT and KO cells were mixed and plated to a 1:1 ratio on coverslips. Cells were stained with the indicated Sequestosome-1 antibodies and with the corresponding Alexa-fluor 555 coupled secondary antibody. Acquisition of the green (WT), red (antibody staining) and far-red (KO) channels was performed. Representative images of red (grayscale images) channel are shown. WT and KO cells are outlined with yellow and magenta dashed line, respectively. Antibody dilutions were chosen according to the recommendations of the antibody supplier. Exceptions were given for antibodies MA5-32835*, 18420-1-AP and NBP2-23490*, which were titrated to 1/2000, 1/300 and 1/1000, respectively, as the signals were too strong when following the supplier’s recommendations. When the concentration was not indicated by the supplier, we tested antibodies at 1/500 and 1/1000. At this concentration, the signal from each antibody was in the range of detection of the microscope used. Antibody dilution used: GTX629890* at 1/1000; GTX629888* at 1/1000; GTX100685 at 1/700; 701510** at 1/500; 710539** at 1/500; MA5-32835* at 1/2000; 66184-1-Ig* at 1/300; 18420-1-AP at 1/300; 55274-1-AP at 1/1300; NBP2-23490* at 1/1000; MAB80281** at 1/500; MAB8028* at 1/500; MAB8028R** at 1/500; ab109012** at 1/500; ab56416* at 1/1000; ab207305** at 1/200; ab240635** at 1/500. Bars = 10 μm. *= monoclonal antibody, **= recombinant antibody. In conclusion, we have screened Sequestosome-1 commercial antibodies by Western blot, immunoprecipitation and immunofluorescence and characterized several high-quality antibodies under our standardized experimental conditions. The underlying data can be found on Zenodo. 12 , 13 Methods Antibodies All Sequestosome-1 antibodies are listed in Table 2 , together with their corresponding Research Resource Identifiers, or RRID, to ensure the antibodies are cited properly. 14 Peroxidase-conjugated goat anti-rabbit and anti-mouse antibodies are from Thermo Fisher Scientific (cat. number 65-6120 and 62-6520). Alexa-555-conjugated goat anti-mouse and anti-rabbit secondary antibodies are from Thermo Fisher Scientific (cat. number A21424 and A21429). Table 2. Summary of the Sequestosome-1 antibodies tested. Company Catalog number Lot number RRID (Antibody Registry) Clonality Clone ID Host Concentration (μg/μl) GeneTex GTX629890 * 41470 AB_2885144 monoclonal GT1478 mouse 1.00 GeneTex GTX629888 * 41470 AB_2885143 monoclonal GT239 mouse 1.00 GeneTex GTX100685 42893 AB_2038029 polyclonal - rabbit 0.67 Thermo Fisher Scientific 701510 ** 2315239 AB_2532489 recombinant-mono 11HC14LC25 rabbit 0.50 Thermo Fisher Scientific 710539 ** RF229394 AB_2532735 recombinant-poly 11HCLC rabbit 0.50 Thermo Fisher Scientific MA5-32835 * VL3152616 AB_2802482 monoclonal 10-E10 mouse 2.00 Proteintech 66184-1-Ig * not provided AB_2881579 monoclonal 1H5C1 mouse 1.33 Proteintech 18420-1-AP not provided AB_10694431 polyclonal - rabbit 0.35 Proteintech 55274-1-AP not provided AB_11182278 polyclonal - rabbit 0.43 Bio-Techne NBP2-23490 * A-1 AB_2885153 monoclonal 5H7E2 mouse 1.00 Bio-Techne MAB80281 ** CMRM0120031 AB_2888658 recombinant-mono 2533b rabbit 0.50 Bio-Techne MAB8028 * CHZL0520071 AB_2885150 monoclonal 864807 mouse 0.50 Bio-Techne MAB8028R ** CLJP0118091 AB_2885151 recombinant-mono 864807R mouse 0.50 Abcam ab109012 ** GR3241806-8 AB_2810880 recombinant-mono EPR4844 rabbit 0.43 Abcam ab56416 * GR3374761-2 AB_945626 monoclonal Not provided mouse 1.00 Abcam ab207305 ** GR323335-4 AB_2885112 recombinant-mono EPR18351 rabbit 0.21 Abcam ab240635 ** GR3314160-2 AB_2885121 recombinant-mono EPR23101-103 rabbit 0.49 * = monoclonal antibody. ** = recombinant antibody. CRISPR/Cas9 genome editing SQSTM1 KO clone was generated in Cas9-expressing U2OS cell line with low passage cells using an open-access protocol available on Zenodo.org : https://zenodo.org/record/3875777#.ZA9VdC-96Tf . Two guide RNAs were used to introduce a STOP codon in the SQSTM1 gene (sequence guide 1: CCACCGCCCACCGUGUGCUC, sequence guide 2: AUGCGAGCUUGGUGUGCCCC). Cell culture Both U2OS WT and SQSTM1 KO cell lines used are listed in Table 1 , together with their corresponding RRID, to ensure the cell lines are cited properly. 15 Cells were cultured in DMEM high glucose (GE Healthcare cat. number SH30081.01) containing 10% fetal bovine serum (Wisent, cat. number 080450), 2 mM L-glutamate (Wisent cat. number 609065), 100 IU penicillin and 100 μg/ml streptomycin (Wisent cat. number 450201). Antibody screening by Western blot Western blots were performed as described in our standard operating procedure. 7 U2OS WT and SQSTM1 KO were collected in RIPA buffer (50 mM Tris pH 8.0, 150 mM NaCl, 1.0 mM EDTA, 1% Triton X-100, 0.5% sodium deoxycholate, 0.1% SDS) supplemented with protease inhibitor (MilliporeSigma, cat. number P8340). Lysates were sonicated briefly and incubated for 30 min on ice. Lysates were spun at ~110,000 x g for 15 min at 4°C and equal protein aliquots of the supernatants were analyzed by SDS-PAGE and Western blot. BLUelf prestained protein ladder (GeneDireX, cat. number PM008-0500) was used. Western blots were performed with large 4-15% polyacrylamide gels and transferred on nitrocellulose membranes. Proteins on the blots were visualized with Ponceau staining, which is scanned to show them together with individual Western blots. Blots were blocked with 5% milk for 1 hr, and antibodies were incubated overnight at 4°C with 5% bovine serum albumin (BSA) (Wisent, cat. number 800-095) in TBS with 0.1% Tween 20 (TBST) (Cell Signaling Technology, cat. number 9997). Following three washes with TBST, the peroxidase conjugated secondary antibody was incubated at a dilution of ~0.2 μg/ml in TBST with 5% milk for 1 hr at room temperature followed by three washes with TBST. Membranes were incubated with regular ECL (cat. number 32106) or super signal West Femto (cat. number 34096) from Thermo Fisher Scientific prior to detection with the HyBlot CL autoradiography films from Denville (cat. number 1159T41). Antibody screening by immunoprecipitation Immunoprecipitation was performed as described in our standard operating procedure. 7 Antibody-bead conjugates were prepared by adding 1.0 μg of antibody to 500 μl of phosphate buffered saline (PBS) (Wisent, cat. number 311-010-CL) with 0.01% triton X-100 (Thermo Fisher Scientific, cat. number BP151-500) in a 1.5 mL microcentrifuge tube, together with 30 μl of protein A- (for rabbit antibodies) or protein G- (for mouse antibodies) Sepharose beads. Tubes were rocked overnight at 4°C followed by several washes to remove unbound antibodies. U2OS WT were collected in HEPES lysis buffer (20 mM HEPES, 100 mM sodium chloride, 1 mM EDTA, 1% Triton X-100, pH 7.4) supplemented with protease inhibitor (MilliporeSigma, cat. number P8340). Lysates were rocked 30 min at 4°C and spun at 110,000 x g for 15 min at 4°C. One ml aliquots at 1.0 mg/ml of lysate were incubated with an antibody-bead conjugate for ~2 hours at 4°C. The unbound fractions were collected, and beads were subsequently washed three times with 1.0 ml of HEPES lysis buffer and processed for SDS-PAGE and Western blot on a 4-15% polyacrylamide gels as described above. Antibody screening by immunofluorescence Immunofluorescence was performed as described in our standard operating procedure. 7 U2OS WT and SQSTM1 KO were labelled with a green and a deep red fluorescence dye from Abcam (cat. number ab176735 and ab176736), respectively. WT and KO cells were plated on glass coverslips as a mosaic and incubated for 24 hrs in a cell culture incubator at 37°C, 5% CO 2 . Cells were fixed in 4% paraformaldehyde (PFA) (Beantown chemical, cat. number 140770-10ml) in PBS for 15 min at room temperature and then washed three times with PBS. Cells were permeabilized in PBS with 0.1% triton X-100 for 10 min at room temperature and blocked with PBS with 5% BSA, 5% goat serum (Gibco, cat. number 16210-064) and 0.01% Triton X-100 for 30 min at room temperature. Cells were incubated with IF buffer (PBS, 5% BSA, 0.01% Triton X-100) containing the primary Sequestosome-1 antibodies overnight at 4°C. Cells were then washed 3 x 10 min with IF buffer and incubated with corresponding Alexa Fluor 555-conjugated secondary antibodies in IF buffer at a dilution of 1.0 μg/ml for 1 hr at room temperature. Cells were washed 3 x 10 min with IF buffer and once with PBS. Coverslips were mounted on a microscopic slide using fluorescence mounting media (DAKO). Imaging was performed using a Zeiss LSM 880 laser scanning confocal microscope equipped with a Plan-Apo 40x oil objective (NA = 1.40). Analysis was done using ImageJ (RRID:SCR_003070). All cell images represent a single focal plane. Figures were assembled with Adobe Photoshop (version 24.2.1) (RRID:SCR_014199) to adjust contrast and apply 1-pixel Gaussian blur, and then they were assembled with Adobe Illustrator (version 27.3.1) (RRID:SCR_010279). Data availability Underlying data Zenodo: Antibody Characterization Report for Sequestosome-1, https://doi.org/10.5281/zenodo.4731001 . 12 Zenodo: Dataset for the Sequestosome-1 antibody screening study, https://doi.org/10.5281/zenodo.7709902 . 13 Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0). Acknowledgments We would like to thank the NeuroSGC/YCharOS/EDDU collaborative group for their important contribution to the creation of an open scientific ecosystem of antibody manufacturers and knockout cell line suppliers, for the development of community-agreed protocols, and for their shared ideas, resources, and collaboration. Members of the group can be found below. NeuroSGC/YCharOS/EDDU collaborative group: Riham Ayoubi, Thomas M. Durcan, Aled M. Edwards, Carl Laflamme, Peter S. McPherson, Chetan Raina, Irina Shlaifer and Kathleen Southern. An earlier version of this of this article can be found on Zenodo (doi: 10.5281/zenodo.4818440 ). References 1. Turco E, Savova A, Gere F, et al. : Reconstitution defines the roles of p62, NBR1 and TAX1BP1 in ubiquitin condensate formation and autophagy initiation. Nat. Commun. 2021; 12 (1): 5212. PubMed Abstract | Publisher Full Text | Free Full Text 2. Bjørkøy G, Lamark T, Brech A, et al. : p62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J. Cell Biol. 2005; 171 (4): 603–614. PubMed Abstract | Publisher Full Text | Free Full Text 3. Clausen TH, Lamark T, Isakson P, et al. : p62/SQSTM1 and ALFY interact to facilitate the formation of p62 bodies/ALIS and their degradation by autophagy. Autophagy. 2010; 6 (3): 330–344. PubMed Abstract | Publisher Full Text 4. Rea SL, Majcher V, Searle MS, et al. : SQSTM1 mutations--bridging Paget disease of bone and ALS/FTLD. Exp. Cell Res. 2014; 325 (1): 27–37. PubMed Abstract | Publisher Full Text 5. Le Ber I, Camuzat A, Guerreiro R, et al. : SQSTM1 mutations in French patients with frontotemporal dementia or frontotemporal dementia with amyotrophic lateral sclerosis. JAMA Neurol. 2013; 70 (11): 1403–1410. PubMed Abstract | Publisher Full Text 6. Ma S, Attarwala IY, Xie XQ: SQSTM1/p62: A Potential Target for Neurodegenerative Disease. ACS Chem. Neurosci. 2019; 10 (5): 2094–2114. PubMed Abstract | Publisher Full Text | Free Full Text 7. Ayoubi R, Ryan J, Bolivar SG, et al. : A consensus platform for antibody characterization (Version 1). Protocol Exchange. 2024. Publisher Full Text 8. Biddle MS, Virk HS: YCharOS open antibody characterisation data: Lessons learned and progress made. F1000Research. 2023; 12 (12): 1344. Publisher Full Text 9. Laflamme C, McKeever PM, Kumar R, et al. : Implementation of an antibody characterization procedure and application to the major ALS/FTD disease gene C9ORF72. elife. 2019; 8 : 8. Publisher Full Text 10. Alshafie W, Fotouhi M, Shlaifer I, et al. : Identification of highly specific antibodies for Serine/threonine-protein kinase TBK1 for use in immunoblot, immunoprecipitation and immunofluorescence. F1000Res. 2022; 11 : 977. Publisher Full Text 11. Alshafie W, Ayoubi R, Fotouhi M, et al. : The identification of high-performing antibodies for Moesin for use in Western Blot, immunoprecipitation, and immunofluorescence [version 1; peer review: awaiting peer review]. F1000Res. 2023; 2023 (12): 172. 12. Ayoubi R, Alshafie W, Shlaifer I, et al. : Antibody Characterization Report for Sequestosome-1. [Dataset]. Zenodo 2021. Publisher Full Text 13. Laflamme C: Dataset for the Sequestosome-1 antibody screening study. [Dataset]. Zenodo. 2023. Publisher Full Text 14. Bandrowski A, Pairish M, Eckmann P, et al. : The Antibody Registry: ten years of registering antibodies. Nucleic Acids Res. 2023; 51 (D1): D358–D367. PubMed Abstract | Publisher Full Text | Free Full Text 15. Bairoch A: The Cellosaurus, a Cell-Line Knowledge Resource. J. Biomol. Tech. 2018; 29 (2): 25–38. PubMed Abstract | Publisher Full Text | Free Full Text Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 23 Mar 2023 ADD YOUR COMMENT Comment Author details Author details 1 Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, Québec, H3A 2B4, Canada 2 The Neuro’s Early Drug Discovery Unit (EDDU), Structural Genomics Consortium, McGill University, Montreal, Québec, H3A 2B4, Canada Riham Ayoubi Roles: Investigation, Methodology, Visualization, Writing – Review & Editing Walaa Alshafie Roles: Investigation, Methodology Irina Shlaifer Roles: Investigation, Writing – Review & Editing Kathleen Southern Roles: Writing – Original Draft Preparation, Writing – Review & Editing Peter S. McPherson Roles: Conceptualization, Funding Acquisition, Resources, Supervision Carl Laflamme Roles: Conceptualization, Data Curation, Funding Acquisition, Methodology, Project Administration, Resources, Supervision, Validation, Visualization, Writing – Review & Editing Competing interests For this project, the laboratory of Peter McPherson developed partnerships with high-quality antibody manufacturers and knockout cell line providers. The partners provide antibodies and knockout cell lines to the McPherson laboratory at no cost. These partners include: - Abcam- ABclonal -Aviva Systems Biology -Bio Techne -Cell Signalling Technology -Developmental Studies Hybridoma Bank -GeneTex – Horizon Discovery – Proteintech – Synaptic Systems –Thermo Fisher Scientific. Grant information This work was supported in part by the ALS-Reproducible Antibody Platform (ALS-RAP). ALS-RAP is a private-public partnership created by the ALS Association (USA), the Motor Neurone Disease Association (UK), and the ALS Society of Canada. The grant was from a Canadian Institutes of Health Research Foundation Grant (FDN154305) and by the Government of Canada through Genome Canada, Genome Quebec and Ontario Genomics (OGI-210). The Structural Genomics Consortium is a registered charity (no. 1097737) that receives funds from Bayer AG, Boehringer Ingelheim, Bristol Myers Squibb, Genentech, Genome Canada through Ontario Genomics Institute (grant no. OGI-196), the EU and EFPIA through the Innovative Medicines Initiative 2 Joint Undertaking (EUbOPEN grant no. 875510), Janssen, Merck KGaA (also known as EMD in Canada and the United States), Pfizer and Takeda. RA and WA were supported by a Mitacs fellowship. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Article Versions (2) version 2 Revised Published: 10 Jul 2024, 12:324 https://doi.org/10.12688/f1000research.132628.2 version 1 Published: 23 Mar 2023, 12:324 https://doi.org/10.12688/f1000research.132628.1 Copyright © 2024 Ayoubi R et al . This is an open access article distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Download Export To Sciwheel Bibtex EndNote ProCite Ref. Manager (RIS) Sente metrics Views Downloads F1000Research - - PubMed Central info_outline Data from PMC are received and updated monthly. - - Citations open_in_new 0 open_in_new 0 open_in_new SEE MORE DETAILS CITE how to cite this article Ayoubi R, Alshafie W, Shlaifer I et al. The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved] . F1000Research 2024, 12 :324 ( https://doi.org/10.12688/f1000research.132628.2 ) NOTE: If applicable, it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS track receive updates on this article Track an article to receive email alerts on any updates to this article. TRACK THIS ARTICLE Share Open Peer Review Current Reviewer Status: ? Key to Reviewer Statuses VIEW HIDE Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Version 2 VERSION 2 PUBLISHED 10 Jul 2024 Revised Views 0 Cite How to cite this report: Xu G. Reviewer Report For: The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved] . F1000Research 2024, 12 :324 ( https://doi.org/10.5256/f1000research.168891.r301249 ) The direct URL for this report is: https://f1000research.com/articles/12-324/v2#referee-response-301249 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 11 Jul 2024 Guoqiang Xu , soochow university, Jiangsu, China Approved VIEWS 0 https://doi.org/10.5256/f1000research.168891.r301249 This is a useful resource ... Continue reading READ ALL This is a useful resource although it is not perfect. Competing Interests: No competing interests were disclosed. Reviewer Expertise: biochemistry, pharmacology, cancer biology, proteomics I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Xu G. Reviewer Report For: The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved] . F1000Research 2024, 12 :324 ( https://doi.org/10.5256/f1000research.168891.r301249 ) The direct URL for this report is: https://f1000research.com/articles/12-324/v2#referee-response-301249 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Version 1 VERSION 1 PUBLISHED 23 Mar 2023 Views 0 Cite How to cite this report: Xu G. Reviewer Report For: The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved] . F1000Research 2024, 12 :324 ( https://doi.org/10.5256/f1000research.145562.r247595 ) The direct URL for this report is: https://f1000research.com/articles/12-324/v1#referee-response-247595 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 21 Feb 2024 Guoqiang Xu , soochow university, Jiangsu, China Approved with Reservations VIEWS 0 https://doi.org/10.5256/f1000research.145562.r247595 This paper used the WT and Sequestosome-1 knockout U2OS cells to evaluate the quality of the anti-Sequestosome-1 antibodies obtained from different companies in three different applications, i.e. WB, IP, and IF. The results are very useful for other scientists to ... Continue reading READ ALL This paper used the WT and Sequestosome-1 knockout U2OS cells to evaluate the quality of the anti-Sequestosome-1 antibodies obtained from different companies in three different applications, i.e. WB, IP, and IF. The results are very useful for other scientists to choose the right antibody for the specific application. In the paper, WT and Sequestosome-1 knockout U2OS cells were used for the experiment. Additional cell lines, especially for different cancer cell lines and neuronal cell lines should also be tested since the antibodies will be most probably used in these cell lines in real situations. In addition, different cell lines have different levels of protein expression and post-translational modifications, which are also frequently affecting the experimental results. For Figure 2, why do only two blots have bands for Heavy chains (HC)? An explanation should be provided in the figure legend or the text for better understanding. For Figure 3, it is recommended that the authors provide the green, red, and contrast images for each antibody for better visualization and assessment. A conclusion should be provided at the end of the paper to show the quality and application of the different antibodies tested in this paper. A comparison among different antibodies is very valuable for other scientists. In addition, it will be useful to discuss the possible advantages and disadvantages of this work. Is the rationale for creating the dataset(s) clearly described? Yes Are the protocols appropriate and is the work technically sound? Yes Are sufficient details of methods and materials provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: biochemistry, pharmacology, cancer biology, proteomics I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Xu G. Reviewer Report For: The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved] . F1000Research 2024, 12 :324 ( https://doi.org/10.5256/f1000research.145562.r247595 ) The direct URL for this report is: https://f1000research.com/articles/12-324/v1#referee-response-247595 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Author Response 10 Jul 2024 Kathleen Southern , Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada 10 Jul 2024 Author Response Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously ... Continue reading Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously had. As such, a new version of this article has been submitted, to ensure transparency and prevent further misinterpretations. We trust that the refinements made meet your expectations, enhance comprehensibility and address any concerns you might have had. Please see our responses to your specific comments below. In the paper, WT and Sequestosome-1 knockout U2OS cells were used for the experiment. Additional cell lines, especially for different cancer cell lines and neuronal cell lines should also be tested since the antibodies will be most probably used in these cell lines in real situations. In addition, different cell lines have different levels of protein expression and post-translational modifications, which are also frequently affecting the experimental results. Response: We understand how the cell line selection process was not well understood, and we have edited the first paragraph of the Results and discussion section to clarify this part of our protocol. From analyzing the public expression database on Depmap, we found that HAP1 expressed PPP2R5D transcript at 6.7 log 2 (TPM+1), which is significantly above the minimum threshold level, 2.5 log 2 (TPM+1), previously established. A limitation of the orthogonal knockout (KO) based approach to test antibodies is that only one cell line (WT and KO) is used to evaluate the performance of the antibodies. However, the strength of our approach lies in the simultaneous testing of multiple antibodies from a variety of commercial sources using WT and an equivalent KO cell line, aimed at identifying the most suitable antibodies for specific applications. A detailed description of the orthogonal strategy applied to select cell lines for the study is outlined in our antibody characterization platform, available on Protocol exchange and (DOI: 10.21203/rs.3.pex-2607/v1 ). This reference has been included in the new version. For Figure 2, why do only two blots have bands for Heavy chains (HC)? An explanation should be provided in the figure legend or the text for better understanding. Response: In the protocol exchange paper, previously referred to, which outlines the antibody characterization procedure followed in this article, and is now referenced in the new version of the article. Within the protocol, we have a troubleshooting section with proposed solutions to prevent the heavy chains from appearing. It can be found in the IP Procedure section 2E). Although we have tried to optimize the workflow, we cannot control whether the heavy chain bands appear and show the IP results as we do with all the other antibodies tested. For Figure 3, it is recommended that the authors provide the green, red, and contrast images for each antibody for better visualization and assessment. Response: This underlying data is provided in the Dataset, found in the Data availability section. You can also use the following link to be redirected to the Dataset, https://doi.org/10.5281/zenodo.7709902 . A conclusion should be provided at the end of the paper to show the quality and application of the different antibodies tested in this paper. A comparison among different antibodies is very valuable for other scientists. In addition, it will be useful to discuss the possible advantages and disadvantages of this work. Response: The authors do not participate in results analysis nor offer explicit antibody recommendations, therefore preventing them from identifying which antibodies were high-performing in each respective application. Due to the confines of the experimental setup, the factors that can influence the performance of antibodies and cell line used, we do not draw conclusions. We leave this analysis up to the viewers and within our gateway we feature an editorial that can be used as a guide on how the scientific community can utilize and analyze the YCharOS data to identify high-performing antibodies within the confines of our protocol (DOI: 10.12688/f1000research.141719.1 ). Furthermore, given that that the article is formatted as a Data Note, it does not require the results to be discussed or concluded. That being said, we understand how this aspect of the YCharOS initiative was not clearly defined and in the newly submitted version we have included two paragraphs to the end of the introduction that will provide an understanding as to why we do not analyze the results, preventing further misinterpretation. Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously had. As such, a new version of this article has been submitted, to ensure transparency and prevent further misinterpretations. We trust that the refinements made meet your expectations, enhance comprehensibility and address any concerns you might have had. Please see our responses to your specific comments below. In the paper, WT and Sequestosome-1 knockout U2OS cells were used for the experiment. Additional cell lines, especially for different cancer cell lines and neuronal cell lines should also be tested since the antibodies will be most probably used in these cell lines in real situations. In addition, different cell lines have different levels of protein expression and post-translational modifications, which are also frequently affecting the experimental results. Response: We understand how the cell line selection process was not well understood, and we have edited the first paragraph of the Results and discussion section to clarify this part of our protocol. From analyzing the public expression database on Depmap, we found that HAP1 expressed PPP2R5D transcript at 6.7 log 2 (TPM+1), which is significantly above the minimum threshold level, 2.5 log 2 (TPM+1), previously established. A limitation of the orthogonal knockout (KO) based approach to test antibodies is that only one cell line (WT and KO) is used to evaluate the performance of the antibodies. However, the strength of our approach lies in the simultaneous testing of multiple antibodies from a variety of commercial sources using WT and an equivalent KO cell line, aimed at identifying the most suitable antibodies for specific applications. A detailed description of the orthogonal strategy applied to select cell lines for the study is outlined in our antibody characterization platform, available on Protocol exchange and (DOI: 10.21203/rs.3.pex-2607/v1 ). This reference has been included in the new version. For Figure 2, why do only two blots have bands for Heavy chains (HC)? An explanation should be provided in the figure legend or the text for better understanding. Response: In the protocol exchange paper, previously referred to, which outlines the antibody characterization procedure followed in this article, and is now referenced in the new version of the article. Within the protocol, we have a troubleshooting section with proposed solutions to prevent the heavy chains from appearing. It can be found in the IP Procedure section 2E). Although we have tried to optimize the workflow, we cannot control whether the heavy chain bands appear and show the IP results as we do with all the other antibodies tested. For Figure 3, it is recommended that the authors provide the green, red, and contrast images for each antibody for better visualization and assessment. Response: This underlying data is provided in the Dataset, found in the Data availability section. You can also use the following link to be redirected to the Dataset, https://doi.org/10.5281/zenodo.7709902 . A conclusion should be provided at the end of the paper to show the quality and application of the different antibodies tested in this paper. A comparison among different antibodies is very valuable for other scientists. In addition, it will be useful to discuss the possible advantages and disadvantages of this work. Response: The authors do not participate in results analysis nor offer explicit antibody recommendations, therefore preventing them from identifying which antibodies were high-performing in each respective application. Due to the confines of the experimental setup, the factors that can influence the performance of antibodies and cell line used, we do not draw conclusions. We leave this analysis up to the viewers and within our gateway we feature an editorial that can be used as a guide on how the scientific community can utilize and analyze the YCharOS data to identify high-performing antibodies within the confines of our protocol (DOI: 10.12688/f1000research.141719.1 ). Furthermore, given that that the article is formatted as a Data Note, it does not require the results to be discussed or concluded. That being said, we understand how this aspect of the YCharOS initiative was not clearly defined and in the newly submitted version we have included two paragraphs to the end of the introduction that will provide an understanding as to why we do not analyze the results, preventing further misinterpretation. Competing Interests: No competing interests were disclosed. Close Report a concern Respond or Comment COMMENTS ON THIS REPORT Author Response 10 Jul 2024 Kathleen Southern , Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada 10 Jul 2024 Author Response Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously ... Continue reading Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously had. As such, a new version of this article has been submitted, to ensure transparency and prevent further misinterpretations. We trust that the refinements made meet your expectations, enhance comprehensibility and address any concerns you might have had. Please see our responses to your specific comments below. In the paper, WT and Sequestosome-1 knockout U2OS cells were used for the experiment. Additional cell lines, especially for different cancer cell lines and neuronal cell lines should also be tested since the antibodies will be most probably used in these cell lines in real situations. In addition, different cell lines have different levels of protein expression and post-translational modifications, which are also frequently affecting the experimental results. Response: We understand how the cell line selection process was not well understood, and we have edited the first paragraph of the Results and discussion section to clarify this part of our protocol. From analyzing the public expression database on Depmap, we found that HAP1 expressed PPP2R5D transcript at 6.7 log 2 (TPM+1), which is significantly above the minimum threshold level, 2.5 log 2 (TPM+1), previously established. A limitation of the orthogonal knockout (KO) based approach to test antibodies is that only one cell line (WT and KO) is used to evaluate the performance of the antibodies. However, the strength of our approach lies in the simultaneous testing of multiple antibodies from a variety of commercial sources using WT and an equivalent KO cell line, aimed at identifying the most suitable antibodies for specific applications. A detailed description of the orthogonal strategy applied to select cell lines for the study is outlined in our antibody characterization platform, available on Protocol exchange and (DOI: 10.21203/rs.3.pex-2607/v1 ). This reference has been included in the new version. For Figure 2, why do only two blots have bands for Heavy chains (HC)? An explanation should be provided in the figure legend or the text for better understanding. Response: In the protocol exchange paper, previously referred to, which outlines the antibody characterization procedure followed in this article, and is now referenced in the new version of the article. Within the protocol, we have a troubleshooting section with proposed solutions to prevent the heavy chains from appearing. It can be found in the IP Procedure section 2E). Although we have tried to optimize the workflow, we cannot control whether the heavy chain bands appear and show the IP results as we do with all the other antibodies tested. For Figure 3, it is recommended that the authors provide the green, red, and contrast images for each antibody for better visualization and assessment. Response: This underlying data is provided in the Dataset, found in the Data availability section. You can also use the following link to be redirected to the Dataset, https://doi.org/10.5281/zenodo.7709902 . A conclusion should be provided at the end of the paper to show the quality and application of the different antibodies tested in this paper. A comparison among different antibodies is very valuable for other scientists. In addition, it will be useful to discuss the possible advantages and disadvantages of this work. Response: The authors do not participate in results analysis nor offer explicit antibody recommendations, therefore preventing them from identifying which antibodies were high-performing in each respective application. Due to the confines of the experimental setup, the factors that can influence the performance of antibodies and cell line used, we do not draw conclusions. We leave this analysis up to the viewers and within our gateway we feature an editorial that can be used as a guide on how the scientific community can utilize and analyze the YCharOS data to identify high-performing antibodies within the confines of our protocol (DOI: 10.12688/f1000research.141719.1 ). Furthermore, given that that the article is formatted as a Data Note, it does not require the results to be discussed or concluded. That being said, we understand how this aspect of the YCharOS initiative was not clearly defined and in the newly submitted version we have included two paragraphs to the end of the introduction that will provide an understanding as to why we do not analyze the results, preventing further misinterpretation. Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously had. As such, a new version of this article has been submitted, to ensure transparency and prevent further misinterpretations. We trust that the refinements made meet your expectations, enhance comprehensibility and address any concerns you might have had. Please see our responses to your specific comments below. In the paper, WT and Sequestosome-1 knockout U2OS cells were used for the experiment. Additional cell lines, especially for different cancer cell lines and neuronal cell lines should also be tested since the antibodies will be most probably used in these cell lines in real situations. In addition, different cell lines have different levels of protein expression and post-translational modifications, which are also frequently affecting the experimental results. Response: We understand how the cell line selection process was not well understood, and we have edited the first paragraph of the Results and discussion section to clarify this part of our protocol. From analyzing the public expression database on Depmap, we found that HAP1 expressed PPP2R5D transcript at 6.7 log 2 (TPM+1), which is significantly above the minimum threshold level, 2.5 log 2 (TPM+1), previously established. A limitation of the orthogonal knockout (KO) based approach to test antibodies is that only one cell line (WT and KO) is used to evaluate the performance of the antibodies. However, the strength of our approach lies in the simultaneous testing of multiple antibodies from a variety of commercial sources using WT and an equivalent KO cell line, aimed at identifying the most suitable antibodies for specific applications. A detailed description of the orthogonal strategy applied to select cell lines for the study is outlined in our antibody characterization platform, available on Protocol exchange and (DOI: 10.21203/rs.3.pex-2607/v1 ). This reference has been included in the new version. For Figure 2, why do only two blots have bands for Heavy chains (HC)? An explanation should be provided in the figure legend or the text for better understanding. Response: In the protocol exchange paper, previously referred to, which outlines the antibody characterization procedure followed in this article, and is now referenced in the new version of the article. Within the protocol, we have a troubleshooting section with proposed solutions to prevent the heavy chains from appearing. It can be found in the IP Procedure section 2E). Although we have tried to optimize the workflow, we cannot control whether the heavy chain bands appear and show the IP results as we do with all the other antibodies tested. For Figure 3, it is recommended that the authors provide the green, red, and contrast images for each antibody for better visualization and assessment. Response: This underlying data is provided in the Dataset, found in the Data availability section. You can also use the following link to be redirected to the Dataset, https://doi.org/10.5281/zenodo.7709902 . A conclusion should be provided at the end of the paper to show the quality and application of the different antibodies tested in this paper. A comparison among different antibodies is very valuable for other scientists. In addition, it will be useful to discuss the possible advantages and disadvantages of this work. Response: The authors do not participate in results analysis nor offer explicit antibody recommendations, therefore preventing them from identifying which antibodies were high-performing in each respective application. Due to the confines of the experimental setup, the factors that can influence the performance of antibodies and cell line used, we do not draw conclusions. We leave this analysis up to the viewers and within our gateway we feature an editorial that can be used as a guide on how the scientific community can utilize and analyze the YCharOS data to identify high-performing antibodies within the confines of our protocol (DOI: 10.12688/f1000research.141719.1 ). Furthermore, given that that the article is formatted as a Data Note, it does not require the results to be discussed or concluded. That being said, we understand how this aspect of the YCharOS initiative was not clearly defined and in the newly submitted version we have included two paragraphs to the end of the introduction that will provide an understanding as to why we do not analyze the results, preventing further misinterpretation. Competing Interests: No competing interests were disclosed. Close Report a concern COMMENT ON THIS REPORT Views 0 Cite How to cite this report: Takanezawa Y. Reviewer Report For: The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved] . F1000Research 2024, 12 :324 ( https://doi.org/10.5256/f1000research.145562.r247622 ) The direct URL for this report is: https://f1000research.com/articles/12-324/v1#referee-response-247622 NOTE: it is important to ensure the information in square brackets after the title is included in this citation. Close Copy Citation Details Reviewer Report 21 Feb 2024 Yasukazu Takanezawa , Kitasato University, Tokyo, Japan Approved VIEWS 0 https://doi.org/10.5256/f1000research.145562.r247622 This paper delves into the intricacies of Western blot, immunoprecipitation, and immunofluorescence techniques utilizing commercially available antibodies targeting p62, particularly in the context of neurodegenerative disease pathogenesis. This paper provides valuable insights into the application of p62 antibodies. Additionally, incorporating ... Continue reading READ ALL This paper delves into the intricacies of Western blot, immunoprecipitation, and immunofluorescence techniques utilizing commercially available antibodies targeting p62, particularly in the context of neurodegenerative disease pathogenesis. This paper provides valuable insights into the application of p62 antibodies. Additionally, incorporating co-staining with LC3 would enhance its informativeness. Moreover, exploring the characterization of anti-p62 antibodies from other companies would be advantageous. Is the rationale for creating the dataset(s) clearly described? Yes Are the protocols appropriate and is the work technically sound? Yes Are sufficient details of methods and materials provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests: No competing interests were disclosed. Reviewer Expertise: As a specialist in toxicology, particularly focused on the interplay between autophagy and heavy metals. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. Close READ LESS CITE CITE HOW TO CITE THIS REPORT Takanezawa Y. Reviewer Report For: The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved] . F1000Research 2024, 12 :324 ( https://doi.org/10.5256/f1000research.145562.r247622 ) The direct URL for this report is: https://f1000research.com/articles/12-324/v1#referee-response-247622 NOTE: it is important to ensure the information in square brackets after the title is included in all citations of this article. COPY CITATION DETAILS Report a concern Respond or Comment COMMENT ON THIS REPORT Comments on this article Comments (0) Version 2 VERSION 2 PUBLISHED 23 Mar 2023 ADD YOUR COMMENT Comment keyboard_arrow_left keyboard_arrow_right Open Peer Review Reviewer Status info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions Reviewer Reports Invited Reviewers 1 2 Version 2 (revision) 10 Jul 24 read Version 1 23 Mar 23 read read Yasukazu Takanezawa , Kitasato University, Tokyo, Japan Guoqiang Xu , soochow university, Jiangsu, China Comments on this article All Comments (0) Add a comment Sign up for content alerts Sign Up You are now signed up to receive this alert Browse by related subjects keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2024 Xu G. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 11 Jul 2024 | for Version 2 Guoqiang Xu , soochow university, Jiangsu, China 0 Views copyright © 2024 Xu G. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This is a useful resource although it is not perfect. Competing Interests No competing interests were disclosed. Reviewer Expertise biochemistry, pharmacology, cancer biology, proteomics I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Xu G. Peer Review Report For: The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved] . F1000Research 2024, 12 :324 ( https://doi.org/10.5256/f1000research.168891.r301249) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/12-324/v2#referee-response-301249 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2024 Xu G. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 21 Feb 2024 | for Version 1 Guoqiang Xu , soochow university, Jiangsu, China 0 Views copyright © 2024 Xu G. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (1) Approved With Reservations info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This paper used the WT and Sequestosome-1 knockout U2OS cells to evaluate the quality of the anti-Sequestosome-1 antibodies obtained from different companies in three different applications, i.e. WB, IP, and IF. The results are very useful for other scientists to choose the right antibody for the specific application. In the paper, WT and Sequestosome-1 knockout U2OS cells were used for the experiment. Additional cell lines, especially for different cancer cell lines and neuronal cell lines should also be tested since the antibodies will be most probably used in these cell lines in real situations. In addition, different cell lines have different levels of protein expression and post-translational modifications, which are also frequently affecting the experimental results. For Figure 2, why do only two blots have bands for Heavy chains (HC)? An explanation should be provided in the figure legend or the text for better understanding. For Figure 3, it is recommended that the authors provide the green, red, and contrast images for each antibody for better visualization and assessment. A conclusion should be provided at the end of the paper to show the quality and application of the different antibodies tested in this paper. A comparison among different antibodies is very valuable for other scientists. In addition, it will be useful to discuss the possible advantages and disadvantages of this work. Is the rationale for creating the dataset(s) clearly described? Yes Are the protocols appropriate and is the work technically sound? Yes Are sufficient details of methods and materials provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise biochemistry, pharmacology, cancer biology, proteomics I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above. reply Respond to this report Responses (1) Author Response 10 Jul 2024 Kathleen Southern, Department of Neurology and Neurosurgery, Structural Genomics Consortium, The Montreal Neurological Institute, McGill University, Montreal, H3A 2B4, Canada Thank you Guoqiang Xu for taking the time to thoroughly review this Data Note, we appreciate your constructive feedback and hope our responses relieve any concerns or questions you previously had. As such, a new version of this article has been submitted, to ensure transparency and prevent further misinterpretations. We trust that the refinements made meet your expectations, enhance comprehensibility and address any concerns you might have had. Please see our responses to your specific comments below. In the paper, WT and Sequestosome-1 knockout U2OS cells were used for the experiment. Additional cell lines, especially for different cancer cell lines and neuronal cell lines should also be tested since the antibodies will be most probably used in these cell lines in real situations. In addition, different cell lines have different levels of protein expression and post-translational modifications, which are also frequently affecting the experimental results. Response: We understand how the cell line selection process was not well understood, and we have edited the first paragraph of the Results and discussion section to clarify this part of our protocol. From analyzing the public expression database on Depmap, we found that HAP1 expressed PPP2R5D transcript at 6.7 log 2 (TPM+1), which is significantly above the minimum threshold level, 2.5 log 2 (TPM+1), previously established. A limitation of the orthogonal knockout (KO) based approach to test antibodies is that only one cell line (WT and KO) is used to evaluate the performance of the antibodies. However, the strength of our approach lies in the simultaneous testing of multiple antibodies from a variety of commercial sources using WT and an equivalent KO cell line, aimed at identifying the most suitable antibodies for specific applications. A detailed description of the orthogonal strategy applied to select cell lines for the study is outlined in our antibody characterization platform, available on Protocol exchange and (DOI: 10.21203/rs.3.pex-2607/v1 ). This reference has been included in the new version. For Figure 2, why do only two blots have bands for Heavy chains (HC)? An explanation should be provided in the figure legend or the text for better understanding. Response: In the protocol exchange paper, previously referred to, which outlines the antibody characterization procedure followed in this article, and is now referenced in the new version of the article. Within the protocol, we have a troubleshooting section with proposed solutions to prevent the heavy chains from appearing. It can be found in the IP Procedure section 2E). Although we have tried to optimize the workflow, we cannot control whether the heavy chain bands appear and show the IP results as we do with all the other antibodies tested. For Figure 3, it is recommended that the authors provide the green, red, and contrast images for each antibody for better visualization and assessment. Response: This underlying data is provided in the Dataset, found in the Data availability section. You can also use the following link to be redirected to the Dataset, https://doi.org/10.5281/zenodo.7709902 . A conclusion should be provided at the end of the paper to show the quality and application of the different antibodies tested in this paper. A comparison among different antibodies is very valuable for other scientists. In addition, it will be useful to discuss the possible advantages and disadvantages of this work. Response: The authors do not participate in results analysis nor offer explicit antibody recommendations, therefore preventing them from identifying which antibodies were high-performing in each respective application. Due to the confines of the experimental setup, the factors that can influence the performance of antibodies and cell line used, we do not draw conclusions. We leave this analysis up to the viewers and within our gateway we feature an editorial that can be used as a guide on how the scientific community can utilize and analyze the YCharOS data to identify high-performing antibodies within the confines of our protocol (DOI: 10.12688/f1000research.141719.1 ). Furthermore, given that that the article is formatted as a Data Note, it does not require the results to be discussed or concluded. That being said, we understand how this aspect of the YCharOS initiative was not clearly defined and in the newly submitted version we have included two paragraphs to the end of the introduction that will provide an understanding as to why we do not analyze the results, preventing further misinterpretation. View more View less Competing Interests No competing interests were disclosed. reply Respond Report a concern Xu G. Peer Review Report For: The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved] . F1000Research 2024, 12 :324 ( https://doi.org/10.5256/f1000research.145562.r247595) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/12-324/v1#referee-response-247595 keyboard_arrow_left Back to all reports Reviewer Report 0 Views copyright © 2024 Takanezawa Y. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. 21 Feb 2024 | for Version 1 Yasukazu Takanezawa , Kitasato University, Tokyo, Japan 0 Views copyright © 2024 Takanezawa Y. This is an open access peer review report distributed under the terms of the Creative Commons Attribution License , which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. format_quote Cite this report speaker_notes Responses (0) Approved info_outline Alongside their report, reviewers assign a status to the article: Approved The paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved Fundamental flaws in the paper seriously undermine the findings and conclusions This paper delves into the intricacies of Western blot, immunoprecipitation, and immunofluorescence techniques utilizing commercially available antibodies targeting p62, particularly in the context of neurodegenerative disease pathogenesis. This paper provides valuable insights into the application of p62 antibodies. Additionally, incorporating co-staining with LC3 would enhance its informativeness. Moreover, exploring the characterization of anti-p62 antibodies from other companies would be advantageous. Is the rationale for creating the dataset(s) clearly described? Yes Are the protocols appropriate and is the work technically sound? Yes Are sufficient details of methods and materials provided to allow replication by others? Yes Are the datasets clearly presented in a useable and accessible format? Yes Competing Interests No competing interests were disclosed. Reviewer Expertise As a specialist in toxicology, particularly focused on the interplay between autophagy and heavy metals. I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard. reply Respond to this report Responses (0) Takanezawa Y. Peer Review Report For: The identification of high-performing antibodies for Sequestosome-1 for use in Western blot, immunoprecipitation and immunofluorescence [version 2; peer review: 2 approved] . F1000Research 2024, 12 :324 ( https://doi.org/10.5256/f1000research.145562.r247622) NOTE: it is important to ensure the information in square brackets after the title is included in this citation. The direct URL for this report is: https://f1000research.com/articles/12-324/v1#referee-response-247622 Alongside their report, reviewers assign a status to the article: Approved - the paper is scientifically sound in its current form and only minor, if any, improvements are suggested Approved with reservations - A number of small changes, sometimes more significant revisions are required to address specific details and improve the papers academic merit. Not approved - fundamental flaws in the paper seriously undermine the findings and conclusions Adjust parameters to alter display View on desktop for interactive features Includes Interactive Elements View on desktop for interactive features Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Stay Updated Sign up for content alerts and receive a weekly or monthly email with all newly published articles Register with F1000Research Already registered? Sign in Not now, thanks close PLEASE NOTE If you are an AUTHOR of this article, please check that you signed in with the account associated with this article otherwise we cannot automatically identify your role as an author and your comment will be labelled as a “User Comment”. If you are a REVIEWER of this article, please check that you have signed in with the account associated with this article and then go to your account to submit your report, please do not post your review here. If you do not have access to your original account, please contact us . All commenters must hold a formal affiliation as per our Policies . The information that you give us will be displayed next to your comment. User comments must be in English, comprehensible and relevant to the article under discussion. We reserve the right to remove any comments that we consider to be inappropriate, offensive or otherwise in breach of the User Comment Terms and Conditions . Commenters must not use a comment for personal attacks. When criticisms of the article are based on unpublished data, the data should be made available. I accept the User Comment Terms and Conditions Please confirm that you accept the User Comment Terms and Conditions. Affiliation ✕ refresh Please enter your institution. Note: To add your institution or organisation, start typing the name and then select the correct name from the list. Where applicable, the name will appear in both the original language and in English. Do not paste in the name. If the name does not appear in the drop-down list, we will display the information you have entered. ✕ refresh Country/Region * USA UK Canada China France Germany Afghanistan Aland Islands Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegovina Botswana Bouvet Island Brazil British Indian Ocean Territory British Virgin Islands Brunei Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Cook Islands Costa Rica Cote d'Ivoire Croatia Cuba Cyprus Czech Republic Democratic Republic of the Congo Denmark Djibouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands Faroe Islands Federated States of Micronesia Fiji Finland France French Guiana French Polynesia French Southern Territories Gabon Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guernsey Guinea Guinea-Bissau Guyana Haiti Heard Island and Mcdonald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Jamaica Japan Jersey Jordan Kazakhstan Kenya Kiribati Kosovo (Serbia and Montenegro) Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libya Liechtenstein Lithuania Luxembourg Macao Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Minor Outlying Islands of the United States Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island North Korea North Macedonia Northern Mariana Islands Norway Oman Pakistan Palau Palestinian Territory Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Helena Saint Kitts and Nevis Saint Lucia Saint Pierre and Miquelon Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Serbia Seychelles Sierra Leone Singapore Slovakia Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Is South Korea South Sudan Spain Sri Lanka Sudan Suriname Svalbard and Jan Mayen Swaziland Sweden Switzerland Syria Taiwan Tajikistan Tanzania Thailand The Gambia The Netherlands Timor-Leste Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu UK USA Uganda Ukraine United Arab Emirates United States Virgin Islands Uruguay Uzbekistan Vanuatu Venezuela Vietnam Wallis and Futuna West Bank and Gaza Strip Western Sahara Yemen Zambia Zimbabwe Please select your country/region. You must enter a comment. Competing Interests Please disclose any competing interests that might be construed to influence your judgment of the article's or peer review report's validity or importance. Competing Interests Policy Provide sufficient details of any financial or non-financial competing interests to enable users to assess whether your comments might lead a reasonable person to question your impartiality. Consider the following examples, but note that this is not an exhaustive list: Examples of 'Non-Financial Competing Interests' Within the past 4 years, you have held joint grants, published or collaborated with any of the authors of the selected paper. You have a close personal relationship (e.g. parent, spouse, sibling, or domestic partner) with any of the authors. You are a close professional associate of any of the authors (e.g. scientific mentor, recent student). You work at the same institute as any of the authors. You hope/expect to benefit (e.g. favour or employment) as a result of your submission. You are an Editor for the journal in which the article is published. Examples of 'Financial Competing Interests' You expect to receive, or in the past 4 years have received, any of the following from any commercial organisation that may gain financially from your submission: a salary, fees, funding, reimbursements. You expect to receive, or in the past 4 years have received, shared grant support or other funding with any of the authors. You hold, or are currently applying for, any patents or significant stocks/shares relating to the subject matter of the paper you are commenting on. Please state your competing interests The comment has been saved. An error has occurred. Please try again. Cancel Post var lTitle = "The identification of high-performing antibodies...".replace("'", ''); var linkedInUrl = "http://www.linkedin.com/shareArticle?url=https://f1000research.com/articles/12-324/v2" + "&title=" + encodeURIComponent(lTitle) + "&summary=" + encodeURIComponent('Read the article by '); var deliciousUrl = "https://del.icio.us/post?url=https://f1000research.com/articles/12-324/v2&title=" + encodeURIComponent(lTitle); var redditUrl = "http://reddit.com/submit?url=https://f1000research.com/articles/12-324/v2" + "&title=" + encodeURIComponent(lTitle); linkedInUrl += encodeURIComponent('Ayoubi R et al.'); var offsetTop = /chrome/i.test( navigator.userAgent ) ? 4 : -10; var addthis_config = { ui_offset_top: offsetTop, services_compact : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_expanded : "facebook,twitter,www.linkedin.com,www.mendeley.com,reddit.com", services_custom : [ { name: "LinkedIn", url: linkedInUrl, icon:"/img/icon/at_linkedin.svg" }, { name: "Mendeley", url: "http://www.mendeley.com/import/?url=https://f1000research.com/articles/12-324/v2/mendeley", icon:"/img/icon/at_mendeley.svg" }, { name: "Reddit", url: redditUrl, icon:"/img/icon/at_reddit.svg" }, ] }; var addthis_share = { url: "https://f1000research.com/articles/12-324", templates : { twitter : "The identification of high-performing antibodies for Sequestosome-1.... Ayoubi R et al., published by " + "@F1000Research" + ", https://f1000research.com/articles/12-324/v2" } }; if (typeof(addthis) != "undefined"){ addthis.addEventListener('addthis.ready', checkCount); addthis.addEventListener('addthis.menu.share', checkCount); } $(".f1r-shares-twitter").attr("href", "https://twitter.com/intent/tweet?text=" + addthis_share.templates.twitter); $(".f1r-shares-facebook").attr("href", "https://www.facebook.com/sharer/sharer.php?u=" + addthis_share.url); $(".f1r-shares-linkedin").attr("href", addthis_config.services_custom[0].url); $(".f1r-shares-reddit").attr("href", addthis_config.services_custom[2].url); $(".f1r-shares-mendelay").attr("href", addthis_config.services_custom[1].url); function checkCount(){ setTimeout(function(){ $(".addthis_button_expanded").each(function(){ var count = $(this).text(); if (count !== "" && count != "0") $(this).removeClass("is-hidden"); else $(this).addClass("is-hidden"); }); }, 1000); } close How to cite this report {{reportCitation}} Cancel Copy Citation Details $(function(){R.ui.buttonDropdowns('.dropdown-for-downloads');}); $(function(){R.ui.toolbarDropdowns('.toolbar-dropdown-for-downloads');}); $.get("/articles/acj/132628/168891") new F1000.Clipboard(); new F1000.ThesaurusTermsDisplay("articles", "article", "168891"); $(document).ready(function() { $( "#frame1" ).on('load', function() { var mydiv = $(this).contents().find("div"); var h = mydiv.height(); console.log(h) }); var tooltipLivingFigure = jQuery(".interactive-living-figure-label .icon-more-info"), titleLivingFigure = tooltipLivingFigure.attr("title"); tooltipLivingFigure.simpletip({ fixed: true, position: ["-115", "30"], baseClass: 'small-tooltip', content:titleLivingFigure + " " }); tooltipLivingFigure.removeAttr("title"); $("body").on("click", ".cite-living-figure", function(e) { e.preventDefault(); var ref = $(this).attr("data-ref"); $(this).closest(".living-figure-list-container").find("#" + ref).fadeIn(200); }); $("body").on("click", ".close-cite-living-figure", function(e) { e.preventDefault(); $(this).closest(".popup-window-wrapper").fadeOut(200); }); $(document).on("mouseup", function(e) { var metricsContainer = $(".article-metrics-popover-wrapper"); if (!metricsContainer.is(e.target) && metricsContainer.has(e.target).length === 0) { $(".article-metrics-close-button").click(); } }); var articleId = $('#articleId').val(); if($("#main-article-count-box").attachArticleMetrics) { $("#main-article-count-box").attachArticleMetrics(articleId, { articleMetricsView: true }); } }); var figshareWidget = $(".new_figshare_widget"); if (figshareWidget.length > 0) { window.figshare.load("f1000", function(Widget) { // Select a tag/tags defined in your page. In this tag we will place the widget. _.map(figshareWidget, function(el){ var widget = new Widget({ articleId: $(el).attr("figshare_articleId") //height:300 // this is the height of the viewer part. [Default: 550] }); widget.initialize(); // initialize the widget widget.mount(el); // mount it in a tag that's on your page // this will save the widget on the global scope for later use from // your JS scripts. This line is optional. //window.widget = widget; }); }); } close Error Close Add Reset F1000.MICROSERVICES.AFFILIATION = ''; $(document).ready(function () { $('.js-affiliations-form').each((index, form) => { new AffiliationForm({ formId: form.id, institutionErrorSelector: '.comment-enter-institution', departmentErrorSelector: '.comment-enter-department', placeSelector: '.js-add-comment-place', stateSelector: '.js-add-comment-state', zipCodeSelector: '.js-add-comment-zipcode', countrySelector: '.js-add-comment-country', countryErrorSelector: '.comment-enter-country', }); }); }); $(document).ready(function () { var reportIds = { "247619": 0, "247617": 0, "301248": 0, "238855": 0, "301249": 6, "247622": 9, "238859": 0, "247626": 0, "238858": 0, "238857": 0, "238856": 0, "247629": 0, "181718": 0, "181719": 0, "181717": 0, "181720": 0, "168742": 0, "168743": 0, "247595": 23, "167538": 0, "167539": 0, "167536": 0, "204144": 0, "167537": 0, "167542": 0, "167543": 0, "167540": 0, "167541": 0, "247611": 0, "193850": 0, "193851": 0, "167544": 0, "193848": 0, "247608": 0, "193849": 0, "247615": 0, "193852": 0, "247612": 0, }; $(".referee-response-container,.js-referee-report").each(function(index, el) { var reportId = $(el).attr("data-reportid"), reportCount = reportIds[reportId] || 0; $(el).find(".comments-count-container,.js-referee-report-views").html(reportCount); }); var uuidInput = $("#article_uuid"), oldUUId = uuidInput.val(), newUUId = "2399b55e-fe10-40a6-b5cd-89e5d06265f6"; uuidInput.val(newUUId); $("a[href*='article_uuid=']").each(function(index, el) { var newHref = $(el).attr("href").replace(oldUUId, newUUId); $(el).attr("href", newHref); }); }); An innovative open access publishing platform offering rapid publication and open peer review, whilst supporting data deposition and sharing. Browse Gateways Collections How it Works Contact For Developers Cookie Notice Privacy Notice RSS Submit Your Research Follow us © 2012-2026 F1000 Research Ltd. ISSN 2046-1402 | Legal | Partner of Research4Life • CrossRef • ORCID • FAIRSharing R.templateTests.simpleTemplate = R.template(' $text $text $text $text $text '); R.templateTests.runTests(); var F1000platform = new F1000.Platform({ name: "f1000research", displayName: "F1000Research", hostName: "f1000research.com", id: "1", editorialEmail: "[email protected]", infoEmail: "[email protected]", usePmcStats: true }); $(function(){R.ui.dropdowns('.dropdown-for-authors, .dropdown-for-about, .dropdown-for-myresearch');}); // $(function(){R.ui.dropdowns('.dropdown-for-referees');}); $(document).ready(function () { if ($(".cookie-warning").is(":visible")) { $(".sticky").css("margin-bottom", "35px"); $(".devices").addClass("devices-and-cookie-warning"); } $(".cookie-warning .close-button").click(function (e) { $(".devices").removeClass("devices-and-cookie-warning"); $(".sticky").css("margin-bottom", "0"); }); $("#tweeter-feed .tweet-message").each(function (i, message) { var self = $(message); self.html(linkify(self.html())); }); $(".partner").on("mouseenter mouseleave", function() { $(this).find(".gray-scale, .colour").toggleClass("is-hidden"); }); }); Sign In Remember me Forgotten your password? Sign In Cancel Email or password not correct. Please try again Please wait... $(function(){ // Note: All the setup needs to run against a name attribute and *not* the id due the clonish // nature of facebox... $("a[id=googleSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("GOOGLE"); $("form[id=oAuthForm]").submit(); }); $("a[id=facebookSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("FACEBOOK"); $("form[id=oAuthForm]").submit(); }); $("a[id=orcidSignInButton]").click(function(event){ event.preventDefault(); $("input[id=oAuthSystem]").val("ORCID"); $("form[id=oAuthForm]").submit(); }); }); If you've forgotten your password, please enter your email address below and we'll send you instructions on how to reset your password. The email address should be the one you originally registered with F1000. Email address not valid, please try again You registered with F1000 via Google, so we cannot reset your password. To sign in, please click here . If you still need help with your Google account password, please click here . You registered with F1000 via Facebook, so we cannot reset your password. To sign in, please click here . If you still need help with your Facebook account password, please click here . Code not correct, please try again Reset password Cancel Email us for further assistance. Server error, please try again. If your email address is registered with us, we will email you instructions to reset your password. If you think you should have received this email but it has not arrived, please check your spam filters and/or contact for further assistance. Please wait... Register $(document).ready(function () { signIn.createSignInAsRow($("#sign-in-form-gfb-popup")); $(".target-field").each(function () { var uris = $(this).val().split("/"); if (uris.pop() === "login") { $(this).val(uris.toString().replace(",","/")); } }); });