Pregnancy induces intestinal epithelial elongation and estriol- associated activation of the Hippo signaling pathway in a mouse model

Pregnancy induces intestinal epithelial elongation and estriol- associated activation of the Hippo signaling pathway in a mouse model | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Pregnancy induces intestinal epithelial elongation and estriol- associated activation of the Hippo signaling pathway in a mouse model Niklas Franz Gängler, Cathrine Knoblauch, Franziska Hill, Bastian Lukas Zeeb, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6556923/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 11 Aug, 2025 Read the published version in Pflügers Archiv - European Journal of Physiology → Version 1 posted 10 You are reading this latest preprint version Abstract During pregnancy and weaning, the intestinal tract undergoes adaptations on different levels, including altered immune cell frequencies and epithelial changes. We could show in a mouse model, that the overall area (crypt-villus axis length and total length) of the small intestine increased during this period of higher maternal nutrient need and that the increased area correlated with maternal weight. Quantification of cell proliferation and cell death showed an increased proliferation of epithelial cells in the lower and middle crypt. In cell culture, estrogen maintained epithelial cell proliferation, progesterone inhibited proliferation. Further, Hippo signaling is a well known pro- proliferative pathway which integrates several upstream signals and ultimately leads to nuclear translocation of the transcription factor YAP. In the small intestine, YAP is expressed in epithelial cells, immune cells and fibroblasts. During pregnancy and weaning, epithelial and stroma cells exhibit strong nuclear staining of YAP. Interestingly, estrogen led to upregulation and increased nuclear shuttling of YAP in intestinal epithelial cell monolayers. This effect appears to be specific to the estriol treatment since the established pro-proliferative cytokine GLP-2 did not lead to increased nuclear shuttling of YAP. Pregnancy intestinal epithelium estriol YAP Hippo Signaling Figures Figure 1 Figure 2 Figure 3 Figure 4 Introduction During pregnancy and weaning in mammals, the maternal body undergoes numerous physiological changes, evolutionary developed for optimal prosperity of the offspring. Besides the genital organs, the intestinal tract is likely to be a hotspot of pregnancy-associated adaptations: 1) The need for nutrient resorption increases 2) the maternal metabolism adapts and 3) systemic immune cell frequencies change- all these processes are physiologically linked to the intestinal tract. However, the remodeling of the intestinal epithelium during pregnancy and weaning is still poorly understood. The intestinal epithelium is characterized by crypts and, in the small intestine, villi, and this secondary structure enlarges the surface area, enabling increased resorptive capacity. Intestinal stem cells (ISC) at the base of the crypts are crucial for he structural integrity and functionality of the intestinal epithelium [ 3 ]. ISC regulate the constant self-renewal of the epithelium and the differentiation in specific cell types. It has been shown that nutrients and metabolic pathways regulate ISC function [ 10 ]. During pregnancy and lactation, the intestinal epithelium undergoes an elongation [ 1 ] and villous transformation [ 8 ], however the underlying pathways are still poorly understood. The steroid hormones estriol and progesterone are the major pregnancy hormones. Intestinal epithelial cells express estrogen receptor (ER) [ 14 ] and ER signaling is important for the physiological architecture of the intestinal epithelium [ 16 ]. Estrogen enhances female mouse intestinal organoid regeneration via the receptor ERβ [ 6 ]. The progesterone receptor, however, is only weakly expressed in the intestinal epithelium under physiological conditions, most likely limited to mesenchymal cells [ 5 ]. The Hippo signaling pathway is an evolutionary conserved pro-proliferative pathway integrating several different upstream signals. The pathway consists of a kinase cascade involving Large tumor suppressor kinase 1 (LATS1) and macrophage-stimulating 1 (MST1) ultimately regulating the nuclear translocation of the transcription factors Yes associated transcriptional regulator (YAP) and WW Domain Containing Transcription Regulator (TAZ). YAP and/or TAZ are essential for stem cell self-renewal and regeneration in various tissues [ 10 ]. In the intestine, YAP is predominantly expressed in the crypts and interacts with Krüppel‐like factor 4, Epidermal Growth Factor (EGF) and Neurogenic locus notch homolog protein (NOTCH) to promote stem cell differentiation [ 10 ]. Interestingly, hormone related expression and functional activity of YAP as been shown in endometrial epithelium [ 7 ]. The major goal of our study was to scrutinize epithelial adaptation during pregnancy and lactation. Specifically, we asked the questions: Which association of histopathological changes of small intestine and colon with weight can be tackled in a mouse model? How do the pregnancy hormones estriol and progesterone affect intestinal epithelial cell proliferation? Do we see associations of estriol effects and Hippo pathway activity? Methods Mice Female C57BL6 mice were bred according to the guidelines of animal welfare. The animal experiments were approved prior to the study by the committee for animal welfare of the state of Schleswig-Holstein (V242-7224.121-33). After sacrifice, organs were harvested and the length of the colon and small intestine were measured. The timepoints third trimester (T3) and after pregnancy/ after weaning refer to sacrifice in the first trimester respectively 4 weeks after childbirth. Histological analysis For histological analysis, the dissected mouse intestines were rolled inside out and fixed in 4% paraformaldehyde overnight at 4°C, dehydrated and embedded in paraffin. 2 µm paraffin-sections were deparaffinized by xylene substitute (Thermo Fisher Scientific, Shandon) and rehydrated. Rehydrated sections were stained with H&E for morphological assessment. The lengths of the crypt-villus axis were measured using a microscope (Image Z1, Zeiss, Jena, Germany) and Zeiss Zen 3.7 software (Zeiss, Jena, Germany). Proliferating and apoptotic cells were identified in the sections via staining of ki-67 (anti-Ki-67, 556003, BD Biosciences, Franklin Lakes, USA) respectively TUNEL staining (ApopTag® Plus Peroxidase In Situ Apoptosis Kit, S7101, Merck Millipore, Burlington, USA). For quantitation of ki-67 and TUNEL positive cells, four distinct, non-overlapping fields were selected at 12, 3, 6 and 9 o´clock with three layers of intestine, cut lengthwise, each. Furthermore, the crypts were divided into an apical, a middle and a basal region. For the TUNEL staining, all positive cells in the fields of view were counted and for the Ki-67, ten whole crypts were counted from basal to apical compartment. The observer was blinded, without knowledge of the group of the animal, during counting the cells. Cell culture Mouse Mode K intestinal epithelial cells were cultured in complete growth medium consisting of DMEM (Sigma-Aldrich, St. Louis, USA) + 10% FCS (Biochrome) + 1% Penicillin-Streptomycin Solution plus, if indicated, estriol, progesterone or GLP-2 (all from Sigma Aldrich). Scratch assay Mode K cells were seeded out on a 6-well plate for the scratch assay. To create an epithelial wound, the medium was removed and a scratch in the form of a # was made with a P100 pipette. The cells were then stimulated with medium, estriol (0,01µM – 1µM), progesterone (0,1µM – 10µM) or estriol (0,1µM) + progesterone (1µM) and the wound healing progress was assessed by imaging every 24h via microscope (Zeiss, Jena, Germany) until fully closed. Measurements were made at a virtual growth front in each corner using Image J (version 1.51, [ 9 ]). The average growth was analyzed. Viability assay For measurement of viability and proliferation, a 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay was used (Promega, Fitchburg, USA). To this end, cells were seeded out on 96-well plates, cultured for 24h with medium and stimulated for another 24h with fresh medium, estriol (0,1µM), progesterone (1µM) or estriol (0,1µM) + progesterone (1µM). Afterwards, the MTS assay was adhering to the protocol of the manufacturer. In detail, a 20:1 mixture of MTS and phenazine methosulfate (PMS) were added to the cells and metabolized by them, thus resulting in a color change. The absorbance of the samples was measured at 490nm every 30 minutes with the microplate reader Infinite M200 Pro (Tecan, Männerdorf, Switzerland). Immunofluorescence For the staining, cells were grown on coverslips and fixed for 10 min at 37°C in 4% paraformaldehyde in phosphate buffered saline (PBS) after 24 h stimulation as described above. Cells were blocked at room temperature for 15 min with normal goat serum in 0.1% Triton-X-100 (Sigma Aldrich) buffered in PBS, followed by 1 h in 2% BSA in PBS. Staining was performed using YAP/TAZ antibody (1:100 in 0.1% BSA, 8418S, CST) for 1.5 h at room temperature. Next, cells were washed in PBS. Followed by secondary antibody, nuclear stain and cytoskeletal stain with Alexa Fluor 488 labeled goat anti rabbit IgG diluted 1:500 in 0.1% BSA (ThermoFischer, A11034) with DAPI (1:40000, in PBS, D9542, Sigma Aldrich) and Rhodamine Phalloidin (1:400, T1162, Sigma Aldrich) for 45 min at room temperature. Cells were then mounted using antifade mounting media (DAKO, Hovedstaden, Denmark). Images were required using imager Z1 microscope (Zeiss, Jena, Germany) and analyzed with ImageJ2 Open Source processing software (Version 2.14.0/ 1.54f). RNA-Isolation, cDNA-Synthesis and qPCR Cells were directly lysed on 350 µL RLT buffer supplemented with 1% β-mercaptoethanol. RNA was isolated with RNeasy Mini Kit including DNAse digestion using the RNAse-free DNAse set (all from Qiagen, Hilden, Germany) following the manufacturer’s recommendations. RNA was quantified using NanoDrop ND-2000 and reverse-transcribed with Maxima H minus First Strand cDNA synthesis kit (ThermoFisher Scientific, Waltham, MA, USA). RT-qPCR was performed using TaqMan Gene Expression Master Mix and TaqMan® probes (Applied Biosystems, Darmstadt, Germany) in a VIIA 7 PCR system (ThermoFisher Scientific). Gene expression was obtained after relative -ΔCt quantification with ACTNB as a reference gene (housekeeping gene). Each sample was analyzed in duplicate. The primers were designed with NCBI Primer Blast as follows: (5´-> 3´): YAP, forward - CCCTCGTTTTGCCATGAACC; YAP, reverse - GTTGCTGCTGGTTGGAGTTG; TAZ, forward – CACGAGCTAGGCTTCGGATT; TAZ, reverse – TGGCTCGGGCTGAACTTCTT; LATS, forward – TGGTGTTAAGGGGAGAGCCA; LATS, reverse – TCCCAGCAACCCCAAGTATC; MST, forward – TTCTGTCAGCTGCATACCAGT; MST, reverse – ACCTAAGGGGACAATAAATAGCC. Data analysis Graphs were visualized and statistical analysis were performed employing the GraphPad Prism 10 software package (GraphPad Software, San Diego, USA). The specific statistical test employed is given in the figure caption. P-values smaller than 0.05 were considered as statistically significant, correction for multiple testing was not performed based on the small number of pre- planned comparisons. Results Pregnancy-associated weight gain correlates with an increased intestinal surface area In order to examine the pregnancy-associated changes in intestinal physiology, we employed a mouse model of female mice with pregnancy and age-matched controls. In the first place, we analyzed the length of small intestine (SI) and colon and found, that both SI and colon were significantly longer after pregnancy than in age-matched control mice (Fig. 1 A + B). The mean SI length was 26.6% longer and the mean colon length 16.5% longer after a pregnancy than in control. Besides the total length of the segment, the length of the crypt-villus axis is a crucial determinant of resorption area. Thus, we measured the mean SI and colon crypt- villus axis length in each of the mice and found out, that the difference in length was 7.2% in SI (Fig. 1 C) and 16.6.% in colon (Fig. 1 D). There was no clear association of crypt villus length and total length of the segment of each individual animal (Fig. 1 E and 1 F). The capacity of nutrient resorption of the intestine relies on the resorption area and can be modified by endocrine and metabolic adaptation. In our study, the product of total length and crypt villus axis of the colon correlated with the post-pregnancy weight of the animals while the correlation for SI was not statistically significant (Fig. 1 G and 1 H, slope SI pregnancy/ control = 0.784; slope colon pregnancy/ control = 1.522). Pregnancy increases proliferation in the apical crypt-villus compartment Next, we wanted to find out, whether the changes in crypt-villus length were associated with increased proliferation or decreased regulated cell death in the intestinal epithelium. Further, we intended to examine, whether the observed elongation effect occurred during pregnancy or during weaning. To his end, histological stainings with the proliferation marker ki67 of samples from third trimester pregnancy and after weaning mice was performed (Figs. 2 A and 2 B). Quantification of ki67 positive crypt cells revealed significantly increased proliferation during pregnancy (Fig. 2 C) and normalizing after pregnancy (Fig. 2 D). Physiologically, most of the proliferation occurs at the base and lower parts of the crypts. During third trimester (T3), most of the proliferating cells were located at the basal and middle part of the crypt (Fig. 2 A), similar to control animals. Anyways, pregnant animals had many ki67 positive, proliferating cells in the apical compartment of the crypt (Fig. 2 A), adding up to 2.3 times more apical, 1.1 times more middle and 1.2 times more basal ki67 positive cells than control animals (Fig. 2 E). After pregnancy, the proliferation gradually went down to 0.96 times basal, 0.95 middle and 2.1 times apical ki67 positive cells in SI (Fig. 2 F). In parallel to the basal physiological proliferation zone in SI, most of the ki67 positive cells in colon samples from mice with or after pregnancy or control were located at the base of the crypt (Fig. 2 B). The total number of proliferating cells was unchanged during (Fig. 2 G) or after pregnancy (Fig. 2 H). Regarding cell death, which is also a physiological mechanism in intestinal epithelial hemostasis, there were no differences between the groups (Figs. 2 I- 2 L; Supplementary Fig. 1). Estriol supports intestinal epithelial cell proliferation while progesterone exerts an inhibitory effect So far, we could show that pregnancy, childbirth and weaning go along with adaptation of the intestinal epithelium. Specifically, this effect seems to rely on increased proliferation in the apical compartment of the crypts (Fig. 3 A). In vivo , pregnancy goes along with many physiological changes such as increase pregnancy hormones, altered blood circulation, regulation of the immune system and microbiome etc.. In order to disentangle the effects, we established an in vitro cell culture model and focused on the effect of the hormones estrogen and progesterone on intestinal epithelial cell proliferation and signaling. For example, during pregnancy, estriol rises 500 times, progesterone 10–20 times higher than in healthy controls. A scratch assay was performed for optical quantification of the hormonal effect on wound healing and cell proliferation. Estrogen- treated cells proliferated and/ or migrated well 24h after scratch application (Fig. 3 B). In comparison, progesterone- treated cells appeared to proliferate with a more dense pattern, but moved less far into the wound corridor (Fig. 3 B). The total distance grown was not significantly increased in estrogen- treated cells, but significantly decreased by progesterone or a combination of both (Fig. 3 C). Further, the proliferation respectively metabolic activity of epithelial cells during hormone exposition was determined with a proliferation assay (Fig. 3 D), which confirmed the slight but non-significant increase of proliferation by estrogen but inhibition by progesterone. Intestinal epithelial Hippo signaling is increased during pregnancy and activated by estrogen Based on the results presented above, estrogen might contribute to intestinal adaptation during pregnancy in vivo . It has been shown, that estriol- dependent regulation of the Hippo signaling pathway contributes to breast epithelial cell fate, proliferation and cancerogenesis. Thus, in a next step, we aimed to tackle the regulation of the Hippo signaling pathway during pregnancy- related epithelial adaptation. Scrutinizing histological staining of the Hippo pathway transcription factor Yap in intestinal epithelial samples, we observed that epithelial cells and stroma cells show a strong nuclear staining of Yap during and after pregnancy (Figs. 4 A- 4 C). While the crypt cells exhibited both nuclear and cytoplasmic positivity of Yap, more apically localized epithelial cells exhibit predominantly nuclear Yap (Figs. 4 B- 4 C). In cell culture, confluent intestinal epithelial cells showed predominantly cytoplasmic staining of Yap (Fig. 4 D). Treatment with estriol lead to lateral expansion of the cells and visually more cytoskeletal staining at the cell margins, going along with increased nuclear Yap (Fig. 4 E). Progesterone, in contrast, did not lead to increased nuclear Yap (Fig. 4 F). Since Glucagon-like peptide 2 (GLP-2) is a hormone with proven pro-proliferative effect on the intestinal epithelium, we included GLP-2 stimulation in our analyses and found out, that increased nuclear localization of Yap is not involved in GLP-2- driven proliferation (Fig. 4 G). In parallel with the immunofluorescence results, estriol increased the mRNA expression of the Hippo pathway components YAP , TAZ , LATS1 and MST1 (Fig. 4 H- 4 K). Discussion Although intestinal epithelial remodeling might, from the evolutionary perspective of securing adequate nutrient supply for the offspring, be a hallmark of systemic adaptation during pregnancy, there have been only few studies in mammals addressing this issue. Despite indirect evidence of remodeling such as altered metabolism and modified pro-inflammatory propensity of the intestinal epithelium, human studies on SI and colon histological architecture during pregnancy are lacking. The finding of increased intestinal total and crypt-villus length parallels two recently and prominently published studies [ 1 ][ 8 ] However, our study was the first to address the physiological implications: Interestingly, both SI and colon approximated area appear positively correlated with weight in our mouse model. Besides the resorption area, gut microbiome composition and metabolic regulation might impact the nutrient resorption and weight gain. The intestinal epithelium has the capacity of nutrient sensing and mediates metabolic adaptations [ 12 ] and the gut resorptive capacity is positively regulated by increased nutrient supply [ 11 ]. Unfortunately, this study was not designed to determine whether an increased nutrient intake in the first place might have caused the epithelial expansion. Our cell culture experiments with pregnancy hormones demonstrate that estriol but not progesterone induced visual proliferation and migration of intestinal epithelial cells in a wound healing assay, activation of the pro-proliferative Hippo signaling pathway and increased nuclear abundance of Yap. Estriol might not alone measure up for the in vivo effect, but contribute to the physiological adaptations. Onji et al., who also observed a pregnancy and lactation associated gut epithelial remodeling demonstrated that this effect was at least partly explained with Receptor activator of nuclear factor-κΒ (RANK) signaling in ISC [ 8 ]. Hippo signaling and RANK downstream signals can be interconnected via Ras associated domain proteins (RASSF), which are robustly expressed in the intestinal tract [ 15 ]. Further, Hippo signaling interacts with EGF, NOTCH and BMP signaling to balance proliferative and differentiation- inducing pathways [ 10 ]. The identification of molecular pathways during intestinal adaptation may on one hand facilitate treatment of abdominal symptoms and metabolic changes during pregnancy and on the other hand help to develop therapeutic approaches in situations with pathologically decreased resorptive capacity, e.g. during short bowel syndrome. Based on previous studies proving that Yap/ Taz are indispensable during the development of the intestinal epithelium [ 4 ], Yap induces regeneration of ISC [ 2 ] and Yap is involved in regeneration of intestinal inflammation [ 13 ], targeting female sex hormone dependent regulation and the Hippo signaling pathway in intestinal epithelial regeneration might promising. Declarations Acknowledgements: The authors thank Stefanie Rentzow, Tanja Klostermeier and Sabine Kock for excellent technical help. Author Contributions: All authors have substantially contributed to the manuscript. Conceptualization, L.K.S.; investigation, N.F.G., C.K., F.H., M.F.-P.; data curation, L.K.S. and N.G.; writing—original draft preparation, L.K.S.; writing—review and editing, all authors; visualization, N.G., C.K. and L.K.S.. All authors have read and agreed to the published version of the manuscript. Data Availability Statement: All data is contained within the article. Funding: The work was supported by German Research Foundation (Deutsche Forschungsgemeinschaft; DFG) to L.K.S.: SI 2737/1-1 and DFG Research Unit miTarget 5042 to P.R.. Institutional Review Board Statement: The animal experiment was registered and approved by the local authorities. Mice were bred, handled and sacrificed according to the guidelines of animal welfare. The study was designed in accordance to the 3R principles and the ARRIVE guideline. Conflicts of Interest: The authors declare no conflicts of interest. References Ameku T, Laddach A, Beckwith H et al (2025) Growth of the maternal intestine during reproduction. Cell:S0092867425002004. https://doi.org/10.1016/j.cell.2025.02.015 Cheung P, Xiol J, Dill MT et al (2020) Regenerative Reprogramming of the Intestinal Stem Cell State via Hippo Signaling Suppresses Metastatic Colorectal Cancer. Cell Stem Cell 27:590–604.e9. https://doi.org/10.1016/j.stem.2020.07.003 Choi J, Augenlicht LH (2024) Intestinal stem cells: guardians of homeostasis in health and aging amid environmental challenges. Exp Mol Med 56:495–500. https://doi.org/10.1038/s12276-024-01179-1 Cotton JL, Li Q, Ma L et al (2017) YAP/TAZ and Hedgehog Coordinate Growth and Patterning in Gastrointestinal Mesenchyme. Developmental Cell 43:35–47.e4. https://doi.org/10.1016/j.devcel.2017.08.019 Heijmans J, Muncan V, Jacobs RJ et al (2011) Intestinal Tumorigenesis Is Not Affected by Progesterone Signaling in Rodent Models. PLoS ONE 6:e22620. https://doi.org/10.1371/journal.pone.0022620 Lee GS, Cody AS, Johnson KC et al (2019) Estrogen enhances female small intestine epithelial organoid regeneration. J Bio-X Res 02:9–15. https://doi.org/10.1097/JBR.0000000000000029 Moon S, Lee O-H, Kim B et al (2022) Estrogen Regulates the Expression and Localization of YAP in the Uterus of Mice. IJMS 23:9772. https://doi.org/10.3390/ijms23179772 Onji M, Sigl V, Lendl T et al (2025) RANK drives structured intestinal epithelial expansion during pregnancy. Nature 637:156–166. https://doi.org/10.1038/s41586-024-08284-1 Schneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9:671–675. https://doi.org/10.1038/nmeth.2089 Shi R, Wang B (2024) Nutrient metabolism in regulating intestinal stem cell homeostasis. Cell Prolif 57:e13602. https://doi.org/10.1111/cpr.13602 Stojanović O, Altirriba J, Rigo D et al (2021) Dietary excess regulates absorption and surface of gut epithelium through intestinal PPARα. Nat Commun 12:7031. https://doi.org/10.1038/s41467-021-27133-7 Sundaram S, Borthakur A (2021) Altered intestinal epithelial nutrient transport: an underappreciated factor in obesity modulated by diet and microbiota. Biochemical Journal 478:975–995. https://doi.org/10.1042/BCJ20200902 Taniguchi K, Wu L-W, Grivennikov SI et al (2015) A gp130–Src–YAP module links inflammation to epithelial regeneration. Nature 519:57–62. https://doi.org/10.1038/nature14228 Thomas ML, Xu X, Norfleet AM, Watson CS (1993) The presence of functional estrogen receptors in intestinal epithelial cells. Endocrinology 132:426–430. https://doi.org/10.1210/endo.132.1.8419141 Uhlén M, Fagerberg L, Hallström BM et al (2015) Tissue-based map of the human proteome. Science 347:1260419. https://doi.org/10.1126/science.1260419 Wada-Hiraike O, Imamov O, Hiraike H et al (2006) Role of estrogen receptor β in colonic epithelium. Proc Natl Acad Sci USA 103:2959–2964. https://doi.org/10.1073/pnas.0511271103 Additional Declarations No competing interests reported. Supplementary Files GaenglerManuscriptYapestrogenSupplFig1.jpeg Cite Share Download PDF Status: Published Journal Publication published 11 Aug, 2025 Read the published version in Pflügers Archiv - European Journal of Physiology → Version 1 posted Editorial decision: Revision requested 13 Jun, 2025 Reviews received at journal 12 Jun, 2025 Reviewers agreed at journal 03 Jun, 2025 Reviewers agreed at journal 29 May, 2025 Reviews received at journal 24 May, 2025 Reviewers agreed at journal 13 May, 2025 Reviewers invited by journal 02 May, 2025 Editor assigned by journal 01 May, 2025 Submission checks completed at journal 01 May, 2025 First submitted to journal 29 Apr, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6556923","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":451065422,"identity":"30f0ba16-9b93-4b43-a8ad-2fbf43953c94","order_by":0,"name":"Niklas Franz Gängler","email":"","orcid":"","institution":"Christian Albrechts University and University Hospital Schleswig-Holstein","correspondingAuthor":false,"prefix":"","firstName":"Niklas","middleName":"Franz","lastName":"Gängler","suffix":""},{"id":451065423,"identity":"93ec05a4-865d-4bf1-9734-a75917cf448d","order_by":1,"name":"Cathrine Knoblauch","email":"","orcid":"","institution":"Christian Albrechts University and University Hospital Schleswig-Holstein","correspondingAuthor":false,"prefix":"","firstName":"Cathrine","middleName":"","lastName":"Knoblauch","suffix":""},{"id":451065424,"identity":"ab1875d2-c6ab-4c5e-b648-a893bac2876e","order_by":2,"name":"Franziska Hill","email":"","orcid":"","institution":"Christian Albrechts University and University Hospital Schleswig-Holstein","correspondingAuthor":false,"prefix":"","firstName":"Franziska","middleName":"","lastName":"Hill","suffix":""},{"id":451065425,"identity":"8ac1da7e-9c3e-4175-97c4-07ad2235529e","order_by":3,"name":"Bastian Lukas Zeeb","email":"","orcid":"","institution":"Christian Albrechts University and University Hospital Schleswig-Holstein","correspondingAuthor":false,"prefix":"","firstName":"Bastian","middleName":"Lukas","lastName":"Zeeb","suffix":""},{"id":451065426,"identity":"44c8326c-83cf-4aa1-b0a6-93efca14ee35","order_by":4,"name":"Maren Falk-Paulsen","email":"","orcid":"","institution":"Christian Albrechts University and University Hospital Schleswig-Holstein","correspondingAuthor":false,"prefix":"","firstName":"Maren","middleName":"","lastName":"Falk-Paulsen","suffix":""},{"id":451065427,"identity":"b6eb4279-c3f6-4e1d-ac68-d26fd013f6a9","order_by":5,"name":"Philip Rosenstiel","email":"","orcid":"","institution":"Christian Albrechts University and University Hospital Schleswig-Holstein","correspondingAuthor":false,"prefix":"","firstName":"Philip","middleName":"","lastName":"Rosenstiel","suffix":""},{"id":451065428,"identity":"6bfdeda5-2f2d-4b5f-ada0-3681ce35fb27","order_by":6,"name":"Laura Katharina Sievers","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABOklEQVRIie3QsUrDQBjA8S8E0uXarF9A6StcCShCaV6lIZAuQQSXgkWTJS5F14aWPoPgC6QE4nI1a6CLImTKEBFEIRRP66BJRUeH+3NcOI7fXRIAkegf1vqYQwC6eQAom40uIBB4H9WUT4JVYv+NfC36mTTYXvHCeqf7jeV9dDQCo9UYdx6GZWIGl8sQ8mGdEEcPxqmFB+MBjSYxmD5hemfpr8wpHvalGdvyYo4OpJCRhjZERIG+gratee7KnCOhctOvEzXXpbI4Q5pknKzBUNrZ4NUtb825yjhZ1wk6ukzSCGnKb+FnSj7KseQqoTkFhxN3C8mO5R12o12l/JbmBfJvsSLN8y09mDh0MYtrRFWtaymPT1Sa2PITee4a7fOF9+iWvd1Jwjp3+aj+lyvh92X4KxCJRCLRtt4AL9RoqkcPIKcAAAAASUVORK5CYII=","orcid":"","institution":"Christian Albrechts University and University Hospital Schleswig-Holstein","correspondingAuthor":true,"prefix":"","firstName":"Laura","middleName":"Katharina","lastName":"Sievers","suffix":""}],"badges":[],"createdAt":"2025-04-29 13:28:28","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6556923/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6556923/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00424-025-03107-2","type":"published","date":"2025-08-11T15:57:39+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":82168735,"identity":"a228c303-ba0b-4543-9fcb-d9c28caaaec2","added_by":"auto","created_at":"2025-05-07 09:33:23","extension":"jpeg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":124733,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSI and Colon length are increased during and after pregnancy\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA-B) \u003c/strong\u003eThe length of the small intestine (SI; A) and colon (B) was measured as total length of the segment after sacrifice in mice four weeks after childbirth and in age-matched controls.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC-D)\u003c/strong\u003e The median SI (C) and colon (D) crypt- villus axis length was determined in histological measurements and is given as per animal mean.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eE-F)\u003c/strong\u003e For each individual animal, total SI (E) and colon (F) length and crypt- villus- length are visualized.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eG-H) \u003c/strong\u003eThe arithmetic product of SI (G) and colon (H) crypt- villus and total length was associated with the weight of the animal.\u003c/p\u003e\n\u003cp\u003eEach single dot denotes data from one animal. statistical test: two-tailed t-test,**** p\u0026lt;0.0001, *** p\u0026lt;0.001, * p\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"GaenglerManuscriptYapestrogenFig1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6556923/v1/22be9af26ed2d9bbbd2589a4.jpeg"},{"id":82168282,"identity":"db972377-8d42-4727-9f24-68554cd79a14","added_by":"auto","created_at":"2025-05-07 09:25:23","extension":"jpeg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":913009,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eKi67 positive proliferating cells are increased in the apical crypt\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA-B) \u003c/strong\u003eStaining of SI (A) and colon (B) from mice in the third trimester of pregnancy, after weaning or age-matched controls with the proliferation marker ki67.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eC-D) \u003c/strong\u003e\u0026nbsp;Count of ki67 positive cells per ten SI crypts per animal in third trimester versus age-matched control (C) and after weaning versus age-matched control (D).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eE-F)\u003c/strong\u003e Ratio third trimester/ control (E) and after weaning/ control (F) of the number of ki67 positive cells in ten SI crypts from the basal, middle or apical compartment of the crypt.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eG-H) \u003c/strong\u003e\u0026nbsp;Count of ki67 positive cells per ten colon crypts per animal in third trimester versus age-matched control (G) and after weaning versus age-matched control (H).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eI-J)\u003c/strong\u003e Count of TUNEL positive cells per 40 SI crypts per animal in third trimester versus age-matched control (I) and after weaning versus age-matched control (J).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eK-L)\u003c/strong\u003e Count of TUNEL positive cells per 40 colon crypts per animal in third trimester versus age-matched control (K) and after weaning versus age-matched control (L).\u003c/p\u003e\n\u003cp\u003eEach single dot denotes data from one animal. statistical test: two-tailed t-test,*** p\u0026lt;0.001, ** p\u0026lt;0.005, * p\u0026lt;0.05.\u003c/p\u003e","description":"","filename":"GaenglerManuscriptYapestrogenFig2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6556923/v1/9f92485337a7004b2884cf85.jpeg"},{"id":82169788,"identity":"038f52fd-7c10-4cb2-bb8d-83136195c08d","added_by":"auto","created_at":"2025-05-07 09:49:23","extension":"jpeg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":194066,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEstriol maintains the epithelial wound-healing and proliferation while progesterone has an inhibitory effect.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA) Schematic overview of the observed intestinal epithelial adaptations during pregnancy.\u003c/p\u003e\n\u003cp\u003eB) Representative light microscopy images from Mode K cell wound healing assay 24h after scratch with 100µl pipette tip.\u003c/p\u003e\n\u003cp\u003eC) Quantification results from scratch assay are presented with distance of growth in µm on y axis (n=16).\u003c/p\u003e\n\u003cp\u003eD) Further, an MTS proliferation assay where 490nm absorbance correlates with metabolic activity was performed in Mode K cells in presence or absence of estriol and progesterone (n=8).\u003c/p\u003e","description":"","filename":"GaenglerManuscriptYapestrogenFig3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6556923/v1/74793c943e74cccf22f21f00.jpeg"},{"id":82168276,"identity":"79eba502-866c-4356-b045-3a069c004139","added_by":"auto","created_at":"2025-05-07 09:25:23","extension":"jpeg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1293017,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIntestinal epithelial cell hippo signaling is activated during pregnancy and by estriol.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eA-C)\u003c/strong\u003e Immunohistochemistry staining with anti- YAP in small intestine (SI) of control animals (A), during the third trimester of pregnancy (B) and after pregnancy and weaning (C).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eD-G) \u003c/strong\u003e\u0026nbsp;Immunofluorescence staining of Mode K cells with anti- YAP (green), phalloidin (red) and DAPI (blue) under control conditions (D), after 24h of 0,1µM estriol treatment (E), after 24h of 1µM progesterone treatment (F) and after 24h of 2ng/ml Glucagon Like Peptide 2 (GLP-2) treatment (G).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eH-K) \u003c/strong\u003e\u0026nbsp;qRT PCR of \u003cem\u003eYap \u003c/em\u003e(H)\u003cem\u003e, Taz \u003c/em\u003e(I)\u003cem\u003e, Lats1 \u003c/em\u003e(J)\u003cem\u003e and Mst1 \u003c/em\u003e(K) during indicated treatment with estriol 0,1µM, progesterone 1µM or Glucagon Like Peptide 2 (GLP-2) 2-4ng/ml for 24h.\u003c/p\u003e","description":"","filename":"GaenglerManuscriptYapestrogenFig4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6556923/v1/4a2018aa2d4c544a8fd607b4.jpeg"},{"id":89311074,"identity":"0d57587b-b572-4c2f-b666-5efdd6c44cea","added_by":"auto","created_at":"2025-08-18 16:10:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3324592,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6556923/v1/55051cdb-ae1d-4bbf-bb57-43f05a603d06.pdf"},{"id":82168274,"identity":"4417ad0c-9ca5-487f-ac12-3ad9986e5f7a","added_by":"auto","created_at":"2025-05-07 09:25:23","extension":"jpeg","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1247690,"visible":true,"origin":"","legend":"","description":"","filename":"GaenglerManuscriptYapestrogenSupplFig1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-6556923/v1/d804e506d0a75a93ae3cce9f.jpeg"}],"financialInterests":"No competing interests reported.","formattedTitle":"Pregnancy induces intestinal epithelial elongation and estriol- associated activation of the Hippo signaling pathway in a mouse model","fulltext":[{"header":"Introduction","content":"\u003cp\u003eDuring pregnancy and weaning in mammals, the maternal body undergoes numerous physiological changes, evolutionary developed for optimal prosperity of the offspring. Besides the genital organs, the intestinal tract is likely to be a hotspot of pregnancy-associated adaptations: 1) The need for nutrient resorption increases 2) the maternal metabolism adapts and 3) systemic immune cell frequencies change- all these processes are physiologically linked to the intestinal tract. However, the remodeling of the intestinal epithelium during pregnancy and weaning is still poorly understood.\u003c/p\u003e \u003cp\u003eThe intestinal epithelium is characterized by crypts and, in the small intestine, villi, and this secondary structure enlarges the surface area, enabling increased resorptive capacity. Intestinal stem cells (ISC) at the base of the crypts are crucial for he structural integrity and functionality of the intestinal epithelium [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. ISC regulate the constant self-renewal of the epithelium and the differentiation in specific cell types. It has been shown that nutrients and metabolic pathways regulate ISC function [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. During pregnancy and lactation, the intestinal epithelium undergoes an elongation [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] and villous transformation [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], however the underlying pathways are still poorly understood.\u003c/p\u003e \u003cp\u003eThe steroid hormones estriol and progesterone are the major pregnancy hormones. Intestinal epithelial cells express estrogen receptor (ER) [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e] and ER signaling is important for the physiological architecture of the intestinal epithelium [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Estrogen enhances female mouse intestinal organoid regeneration via the receptor ERβ [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. The progesterone receptor, however, is only weakly expressed in the intestinal epithelium under physiological conditions, most likely limited to mesenchymal cells [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe Hippo signaling pathway is an evolutionary conserved pro-proliferative pathway integrating several different upstream signals. The pathway consists of a kinase cascade involving Large tumor suppressor kinase 1 (LATS1) and macrophage-stimulating 1 (MST1) ultimately regulating the nuclear translocation of the transcription factors Yes associated transcriptional regulator (YAP) and WW Domain Containing Transcription Regulator (TAZ). YAP and/or TAZ are essential for stem cell self-renewal and regeneration in various tissues [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In the intestine, YAP is predominantly expressed in the crypts and interacts with Kr\u0026uuml;ppel‐like factor 4, Epidermal Growth Factor (EGF) and Neurogenic locus notch homolog protein (NOTCH) to promote stem cell differentiation [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Interestingly, hormone related expression and functional activity of YAP as been shown in endometrial epithelium [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe major goal of our study was to scrutinize epithelial adaptation during pregnancy and lactation. Specifically, we asked the questions: Which association of histopathological changes of small intestine and colon with weight can be tackled in a mouse model? How do the pregnancy hormones estriol and progesterone affect intestinal epithelial cell proliferation? Do we see associations of estriol effects and Hippo pathway activity?\u003c/p\u003e"},{"header":"Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMice\u003c/h2\u003e \u003cp\u003eFemale C57BL6 mice were bred according to the guidelines of animal welfare. The animal experiments were approved prior to the study by the committee for animal welfare of the state of Schleswig-Holstein (V242-7224.121-33). After sacrifice, organs were harvested and the length of the colon and small intestine were measured. The timepoints third trimester (T3) and after pregnancy/ after weaning refer to sacrifice in the first trimester respectively 4 weeks after childbirth.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eHistological analysis\u003c/h3\u003e\n\u003cp\u003eFor histological analysis, the dissected mouse intestines were rolled inside out and fixed in 4% paraformaldehyde overnight at 4\u0026deg;C, dehydrated and embedded in paraffin. 2 \u0026micro;m paraffin-sections were deparaffinized by xylene substitute (Thermo Fisher Scientific, Shandon) and rehydrated. Rehydrated sections were stained with H\u0026amp;E for morphological assessment. The lengths of the crypt-villus axis were measured using a microscope (Image Z1, Zeiss, Jena, Germany) and Zeiss Zen 3.7 software (Zeiss, Jena, Germany).\u003c/p\u003e \u003cp\u003eProliferating and apoptotic cells were identified in the sections via staining of ki-67 (anti-Ki-67, 556003, BD Biosciences, Franklin Lakes, USA) respectively TUNEL staining (ApopTag\u0026reg; Plus Peroxidase In Situ Apoptosis Kit, S7101, Merck Millipore, Burlington, USA).\u003c/p\u003e \u003cp\u003eFor quantitation of ki-67 and TUNEL positive cells, four distinct, non-overlapping fields were selected at 12, 3, 6 and 9 o\u0026acute;clock with three layers of intestine, cut lengthwise, each. Furthermore, the crypts were divided into an apical, a middle and a basal region. For the TUNEL staining, all positive cells in the fields of view were counted and for the Ki-67, ten whole crypts were counted from basal to apical compartment. The observer was blinded, without knowledge of the group of the animal, during counting the cells.\u003c/p\u003e \u003cp\u003eCell culture\u003c/p\u003e \u003cp\u003eMouse Mode K intestinal epithelial cells were cultured in complete growth medium consisting of DMEM (Sigma-Aldrich, St. Louis, USA)\u0026thinsp;+\u0026thinsp;10% FCS (Biochrome)\u0026thinsp;+\u0026thinsp;1% Penicillin-Streptomycin Solution plus, if indicated, estriol, progesterone or GLP-2 (all from Sigma Aldrich).\u003c/p\u003e\n\u003ch3\u003eScratch assay\u003c/h3\u003e\n\u003cp\u003eMode K cells were seeded out on a 6-well plate for the scratch assay. To create an epithelial wound, the medium was removed and a scratch in the form of a # was made with a P100 pipette. The cells were then stimulated with medium, estriol (0,01\u0026micro;M \u0026ndash; 1\u0026micro;M), progesterone (0,1\u0026micro;M \u0026ndash; 10\u0026micro;M) or estriol (0,1\u0026micro;M)\u0026thinsp;+\u0026thinsp;progesterone (1\u0026micro;M) and the wound healing progress was assessed by imaging every 24h via microscope (Zeiss, Jena, Germany) until fully closed. Measurements were made at a virtual growth front in each corner using Image J (version 1.51, [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]). The average growth was analyzed.\u003c/p\u003e\n\u003ch3\u003eViability assay\u003c/h3\u003e\n\u003cp\u003eFor measurement of viability and proliferation, a 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assay was used (Promega, Fitchburg, USA). To this end, cells were seeded out on 96-well plates, cultured for 24h with medium and stimulated for another 24h with fresh medium, estriol (0,1\u0026micro;M), progesterone (1\u0026micro;M) or estriol (0,1\u0026micro;M)\u0026thinsp;+\u0026thinsp;progesterone (1\u0026micro;M). Afterwards, the MTS assay was adhering to the protocol of the manufacturer. In detail, a 20:1 mixture of MTS and phenazine methosulfate (PMS) were added to the cells and metabolized by them, thus resulting in a color change. The absorbance of the samples was measured at 490nm every 30 minutes with the microplate reader Infinite M200 Pro (Tecan, M\u0026auml;nnerdorf, Switzerland).\u003c/p\u003e\n\u003ch3\u003eImmunofluorescence\u003c/h3\u003e\n\u003cp\u003eFor the staining, cells were grown on coverslips and fixed for 10 min at 37\u0026deg;C in 4% paraformaldehyde in phosphate buffered saline (PBS) after 24 h stimulation as described above. Cells were blocked at room temperature for 15 min with normal goat serum in 0.1% Triton-X-100 (Sigma Aldrich) buffered in PBS, followed by 1 h in 2% BSA in PBS. Staining was performed using YAP/TAZ antibody (1:100 in 0.1% BSA, 8418S, CST) for 1.5 h at room temperature. Next, cells were washed in PBS. Followed by secondary antibody, nuclear stain and cytoskeletal stain with Alexa Fluor 488 labeled goat anti rabbit IgG diluted 1:500 in 0.1% BSA (ThermoFischer, A11034) with DAPI (1:40000, in PBS, D9542, Sigma Aldrich) and Rhodamine Phalloidin (1:400, T1162, Sigma Aldrich) for 45 min at room temperature. Cells were then mounted using antifade mounting media (DAKO, Hovedstaden, Denmark). Images were required using imager Z1 microscope (Zeiss, Jena, Germany) and analyzed with ImageJ2 Open Source processing software (Version 2.14.0/ 1.54f).\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eRNA-Isolation, cDNA-Synthesis and qPCR\u003c/h2\u003e \u003cp\u003eCells were directly lysed on 350 \u0026micro;L RLT buffer supplemented with 1% β-mercaptoethanol. RNA was isolated with RNeasy Mini Kit including DNAse digestion using the RNAse-free DNAse set (all from Qiagen, Hilden, Germany) following the manufacturer\u0026rsquo;s recommendations. RNA was quantified using NanoDrop ND-2000 and reverse-transcribed with Maxima H minus First Strand cDNA synthesis kit (ThermoFisher Scientific, Waltham, MA, USA). RT-qPCR was performed using TaqMan Gene Expression Master Mix and TaqMan\u0026reg; probes (Applied Biosystems, Darmstadt, Germany) in a VIIA 7 PCR system (ThermoFisher Scientific). Gene expression was obtained after relative -ΔCt quantification with ACTNB as a reference gene (housekeeping gene). Each sample was analyzed in duplicate. The primers were designed with NCBI Primer Blast as follows: (5\u0026acute;-\u0026gt; 3\u0026acute;):\u003c/p\u003e \u003cp\u003eYAP, forward - CCCTCGTTTTGCCATGAACC;\u003c/p\u003e \u003cp\u003eYAP, reverse - GTTGCTGCTGGTTGGAGTTG;\u003c/p\u003e \u003cp\u003eTAZ, forward \u0026ndash; CACGAGCTAGGCTTCGGATT;\u003c/p\u003e \u003cp\u003eTAZ, reverse \u0026ndash; TGGCTCGGGCTGAACTTCTT;\u003c/p\u003e \u003cp\u003eLATS, forward \u0026ndash; TGGTGTTAAGGGGAGAGCCA;\u003c/p\u003e \u003cp\u003eLATS, reverse \u0026ndash; TCCCAGCAACCCCAAGTATC;\u003c/p\u003e \u003cp\u003eMST, forward \u0026ndash; TTCTGTCAGCTGCATACCAGT;\u003c/p\u003e \u003cp\u003eMST, reverse \u0026ndash; ACCTAAGGGGACAATAAATAGCC.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eData analysis\u003c/h2\u003e \u003cp\u003eGraphs were visualized and statistical analysis were performed employing the GraphPad Prism 10 software package (GraphPad Software, San Diego, USA). The specific statistical test employed is given in the figure caption. P-values smaller than 0.05 were considered as statistically significant, correction for multiple testing was not performed based on the small number of pre- planned comparisons.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003ePregnancy-associated weight gain correlates with an increased intestinal surface area\u003c/h2\u003e \u003cp\u003eIn order to examine the pregnancy-associated changes in intestinal physiology, we employed a mouse model of female mice with pregnancy and age-matched controls. In the first place, we analyzed the length of small intestine (SI) and colon and found, that both SI and colon were significantly longer after pregnancy than in age-matched control mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA\u0026thinsp;+\u0026thinsp;B). The mean SI length was 26.6% longer and the mean colon length 16.5% longer after a pregnancy than in control. Besides the total length of the segment, the length of the crypt-villus axis is a crucial determinant of resorption area. Thus, we measured the mean SI and colon crypt- villus axis length in each of the mice and found out, that the difference in length was 7.2% in SI (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC) and 16.6.% in colon (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD). There was no clear association of crypt villus length and total length of the segment of each individual animal (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). The capacity of nutrient resorption of the intestine relies on the resorption area and can be modified by endocrine and metabolic adaptation. In our study, the product of total length and crypt villus axis of the colon correlated with the post-pregnancy weight of the animals while the correlation for SI was not statistically significant (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG and \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eH, slope SI pregnancy/ control\u0026thinsp;=\u0026thinsp;0.784; slope colon pregnancy/ control\u0026thinsp;=\u0026thinsp;1.522).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003ePregnancy increases proliferation in the apical crypt-villus compartment\u003c/h2\u003e \u003cp\u003eNext, we wanted to find out, whether the changes in crypt-villus length were associated with increased proliferation or decreased regulated cell death in the intestinal epithelium. Further, we intended to examine, whether the observed elongation effect occurred during pregnancy or during weaning. To his end, histological stainings with the proliferation marker ki67 of samples from third trimester pregnancy and after weaning mice was performed (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Quantification of ki67 positive crypt cells revealed significantly increased proliferation during pregnancy (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC) and normalizing after pregnancy (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). Physiologically, most of the proliferation occurs at the base and lower parts of the crypts. During third trimester (T3), most of the proliferating cells were located at the basal and middle part of the crypt (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), similar to control animals. Anyways, pregnant animals had many ki67 positive, proliferating cells in the apical compartment of the crypt (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA), adding up to 2.3 times more apical, 1.1 times more middle and 1.2 times more basal ki67 positive cells than control animals (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). After pregnancy, the proliferation gradually went down to 0.96 times basal, 0.95 middle and 2.1 times apical ki67 positive cells in SI (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). In parallel to the basal physiological proliferation zone in SI, most of the ki67 positive cells in colon samples from mice with or after pregnancy or control were located at the base of the crypt (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The total number of proliferating cells was unchanged during (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eG) or after pregnancy (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eH). Regarding cell death, which is also a physiological mechanism in intestinal epithelial hemostasis, there were no differences between the groups (Figs.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eI- \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eL; Supplementary Fig.\u0026nbsp;1).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eEstriol supports intestinal epithelial cell proliferation while progesterone exerts an inhibitory effect\u003c/h2\u003e \u003cp\u003eSo far, we could show that pregnancy, childbirth and weaning go along with adaptation of the intestinal epithelium. Specifically, this effect seems to rely on increased proliferation in the apical compartment of the crypts (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). \u003cem\u003eIn vivo\u003c/em\u003e, pregnancy goes along with many physiological changes such as increase pregnancy hormones, altered blood circulation, regulation of the immune system and microbiome etc.. In order to disentangle the effects, we established an \u003cem\u003ein vitro\u003c/em\u003e cell culture model and focused on the effect of the hormones estrogen and progesterone on intestinal epithelial cell proliferation and signaling. For example, during pregnancy, estriol rises 500 times, progesterone 10\u0026ndash;20 times higher than in healthy controls. A scratch assay was performed for optical quantification of the hormonal effect on wound healing and cell proliferation. Estrogen- treated cells proliferated and/ or migrated well 24h after scratch application (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). In comparison, progesterone- treated cells appeared to proliferate with a more dense pattern, but moved less far into the wound corridor (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The total distance grown was not significantly increased in estrogen- treated cells, but significantly decreased by progesterone or a combination of both (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Further, the proliferation respectively metabolic activity of epithelial cells during hormone exposition was determined with a proliferation assay (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD), which confirmed the slight but non-significant increase of proliferation by estrogen but inhibition by progesterone.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eIntestinal epithelial Hippo signaling is increased during pregnancy and activated by estrogen\u003c/h2\u003e \u003cp\u003eBased on the results presented above, estrogen might contribute to intestinal adaptation during pregnancy \u003cem\u003ein vivo\u003c/em\u003e. It has been shown, that estriol- dependent regulation of the Hippo signaling pathway contributes to breast epithelial cell fate, proliferation and cancerogenesis. Thus, in a next step, we aimed to tackle the regulation of the Hippo signaling pathway during pregnancy- related epithelial adaptation. Scrutinizing histological staining of the Hippo pathway transcription factor Yap in intestinal epithelial samples, we observed that epithelial cells and stroma cells show a strong nuclear staining of Yap during and after pregnancy (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA- \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). While the crypt cells exhibited both nuclear and cytoplasmic positivity of Yap, more apically localized epithelial cells exhibit predominantly nuclear Yap (Figs.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). In cell culture, confluent intestinal epithelial cells showed predominantly cytoplasmic staining of Yap (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). Treatment with estriol lead to lateral expansion of the cells and visually more cytoskeletal staining at the cell margins, going along with increased nuclear Yap (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). Progesterone, in contrast, did not lead to increased nuclear Yap (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Since Glucagon-like peptide 2 (GLP-2) is a hormone with proven pro-proliferative effect on the intestinal epithelium, we included GLP-2 stimulation in our analyses and found out, that increased nuclear localization of Yap is not involved in GLP-2- driven proliferation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). In parallel with the immunofluorescence results, estriol increased the mRNA expression of the Hippo pathway components \u003cem\u003eYAP\u003c/em\u003e, \u003cem\u003eTAZ\u003c/em\u003e, \u003cem\u003eLATS1\u003c/em\u003e and \u003cem\u003eMST1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH- \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eK).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eAlthough intestinal epithelial remodeling might, from the evolutionary perspective of securing adequate nutrient supply for the offspring, be a hallmark of systemic adaptation during pregnancy, there have been only few studies in mammals addressing this issue. Despite indirect evidence of remodeling such as altered metabolism and modified pro-inflammatory propensity of the intestinal epithelium, human studies on SI and colon histological architecture during pregnancy are lacking.\u003c/p\u003e \u003cp\u003eThe finding of increased intestinal total and crypt-villus length parallels two recently and prominently published studies [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e][\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] However, our study was the first to address the physiological implications: Interestingly, both SI and colon approximated area appear positively correlated with weight in our mouse model. Besides the resorption area, gut microbiome composition and metabolic regulation might impact the nutrient resorption and weight gain. The intestinal epithelium has the capacity of nutrient sensing and mediates metabolic adaptations [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e] and the gut resorptive capacity is positively regulated by increased nutrient supply [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Unfortunately, this study was not designed to determine whether an increased nutrient intake in the first place might have caused the epithelial expansion.\u003c/p\u003e \u003cp\u003eOur cell culture experiments with pregnancy hormones demonstrate that estriol but not progesterone induced visual proliferation and migration of intestinal epithelial cells in a wound healing assay, activation of the pro-proliferative Hippo signaling pathway and increased nuclear abundance of Yap. Estriol might not alone measure up for the in vivo effect, but contribute to the physiological adaptations. Onji et al., who also observed a pregnancy and lactation associated gut epithelial remodeling demonstrated that this effect was at least partly explained with Receptor activator of nuclear factor-κΒ (RANK) signaling in ISC [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Hippo signaling and RANK downstream signals can be interconnected via Ras associated domain proteins (RASSF), which are robustly expressed in the intestinal tract [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Further, Hippo signaling interacts with EGF, NOTCH and BMP signaling to balance proliferative and differentiation- inducing pathways [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe identification of molecular pathways during intestinal adaptation may on one hand facilitate treatment of abdominal symptoms and metabolic changes during pregnancy and on the other hand help to develop therapeutic approaches in situations with pathologically decreased resorptive capacity, e.g. during short bowel syndrome. Based on previous studies proving that Yap/ Taz are indispensable during the development of the intestinal epithelium [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], Yap induces regeneration of ISC [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e] and Yap is involved in regeneration of intestinal inflammation [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], targeting female sex hormone dependent regulation and the Hippo signaling pathway in intestinal epithelial regeneration might promising.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements:\u0026nbsp;\u003c/strong\u003eThe authors thank Stefanie Rentzow, Tanja Klostermeier and Sabine Kock for excellent technical help.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u0026nbsp;\u003c/strong\u003eAll authors have substantially contributed to the manuscript. Conceptualization, L.K.S.; investigation, N.F.G., C.K., F.H., M.F.-P.; data curation, L.K.S. and N.G.; writing—original draft preparation, L.K.S.; writing—review and editing, all authors; visualization, N.G., C.K. and L.K.S.. All authors have read and agreed to the published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement:\u0026nbsp;\u003c/strong\u003eAll data is contained within the article.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u0026nbsp;\u003c/strong\u003eThe work was supported by German Research Foundation (Deutsche Forschungsgemeinschaft; DFG) to L.K.S.: SI 2737/1-1 and DFG Research Unit \u003cem\u003emiTarget\u003c/em\u003e 5042 to P.R..\u003c/p\u003e\n\u003cp\u003eInstitutional Review Board Statement: The animal experiment was registered and approved by the local authorities. Mice were bred, handled and sacrificed according to the guidelines of animal welfare. The study was designed in accordance to the 3R principles and the ARRIVE guideline.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest:\u0026nbsp;\u003c/strong\u003eThe authors declare no conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAmeku T, Laddach A, Beckwith H et al (2025) Growth of the maternal intestine during reproduction. Cell:S0092867425002004. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2025.02.015\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2025.02.015\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCheung P, Xiol J, Dill MT et al (2020) Regenerative Reprogramming of the Intestinal Stem Cell State via Hippo Signaling Suppresses Metastatic Colorectal Cancer. Cell Stem Cell 27:590\u0026ndash;604.e9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.stem.2020.07.003\u003c/span\u003e\u003cspan address=\"10.1016/j.stem.2020.07.003\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChoi J, Augenlicht LH (2024) Intestinal stem cells: guardians of homeostasis in health and aging amid environmental challenges. Exp Mol Med 56:495\u0026ndash;500. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s12276-024-01179-1\u003c/span\u003e\u003cspan address=\"10.1038/s12276-024-01179-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCotton JL, Li Q, Ma L et al (2017) YAP/TAZ and Hedgehog Coordinate Growth and Patterning in Gastrointestinal Mesenchyme. Developmental Cell 43:35\u0026ndash;47.e4. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.devcel.2017.08.019\u003c/span\u003e\u003cspan address=\"10.1016/j.devcel.2017.08.019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeijmans J, Muncan V, Jacobs RJ et al (2011) Intestinal Tumorigenesis Is Not Affected by Progesterone Signaling in Rodent Models. PLoS ONE 6:e22620. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0022620\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0022620\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee GS, Cody AS, Johnson KC et al (2019) Estrogen enhances female small intestine epithelial organoid regeneration. J Bio-X Res 02:9\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1097/JBR.0000000000000029\u003c/span\u003e\u003cspan address=\"10.1097/JBR.0000000000000029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMoon S, Lee O-H, Kim B et al (2022) Estrogen Regulates the Expression and Localization of YAP in the Uterus of Mice. IJMS 23:9772. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/ijms23179772\u003c/span\u003e\u003cspan address=\"10.3390/ijms23179772\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eOnji M, Sigl V, Lendl T et al (2025) RANK drives structured intestinal epithelial expansion during pregnancy. Nature 637:156\u0026ndash;166. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41586-024-08284-1\u003c/span\u003e\u003cspan address=\"10.1038/s41586-024-08284-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchneider CA, Rasband WS, Eliceiri KW (2012) NIH Image to ImageJ: 25 years of image analysis. Nat Methods 9:671\u0026ndash;675. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nmeth.2089\u003c/span\u003e\u003cspan address=\"10.1038/nmeth.2089\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShi R, Wang B (2024) Nutrient metabolism in regulating intestinal stem cell homeostasis. Cell Prolif 57:e13602. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/cpr.13602\u003c/span\u003e\u003cspan address=\"10.1111/cpr.13602\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eStojanović O, Altirriba J, Rigo D et al (2021) Dietary excess regulates absorption and surface of gut epithelium through intestinal PPARα. Nat Commun 12:7031. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41467-021-27133-7\u003c/span\u003e\u003cspan address=\"10.1038/s41467-021-27133-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSundaram S, Borthakur A (2021) Altered intestinal epithelial nutrient transport: an underappreciated factor in obesity modulated by diet and microbiota. Biochemical Journal 478:975\u0026ndash;995. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1042/BCJ20200902\u003c/span\u003e\u003cspan address=\"10.1042/BCJ20200902\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTaniguchi K, Wu L-W, Grivennikov SI et al (2015) A gp130\u0026ndash;Src\u0026ndash;YAP module links inflammation to epithelial regeneration. Nature 519:57\u0026ndash;62. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nature14228\u003c/span\u003e\u003cspan address=\"10.1038/nature14228\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eThomas ML, Xu X, Norfleet AM, Watson CS (1993) The presence of functional estrogen receptors in intestinal epithelial cells. Endocrinology 132:426\u0026ndash;430. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1210/endo.132.1.8419141\u003c/span\u003e\u003cspan address=\"10.1210/endo.132.1.8419141\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUhl\u0026eacute;n M, Fagerberg L, Hallstr\u0026ouml;m BM et al (2015) Tissue-based map of the human proteome. Science 347:1260419. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.1260419\u003c/span\u003e\u003cspan address=\"10.1126/science.1260419\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWada-Hiraike O, Imamov O, Hiraike H et al (2006) Role of estrogen receptor β in colonic epithelium. Proc Natl Acad Sci USA 103:2959\u0026ndash;2964. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.0511271103\u003c/span\u003e\u003cspan address=\"10.1073/pnas.0511271103\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"pflugers-archiv-european-journal-of-physiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"paej","sideBox":"Learn more about [Pflügers Archiv - European Journal of Physiology](http://link.springer.com/journal/424)","snPcode":"424","submissionUrl":"https://submission.nature.com/new-submission/424/3","title":"Pflügers Archiv - European Journal of Physiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"Pregnancy, intestinal epithelium, estriol, YAP, Hippo Signaling","lastPublishedDoi":"10.21203/rs.3.rs-6556923/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6556923/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eDuring pregnancy and weaning, the intestinal tract undergoes adaptations on different levels, including altered immune cell frequencies and epithelial changes. We could show in a mouse model, that the overall area (crypt-villus axis length and total length) of the small intestine increased during this period of higher maternal nutrient need and that the increased area correlated with maternal weight. Quantification of cell proliferation and cell death showed an increased proliferation of epithelial cells in the lower and middle crypt. In cell culture, estrogen maintained epithelial cell proliferation, progesterone inhibited proliferation. Further, Hippo signaling is a well known pro- proliferative pathway which integrates several upstream signals and ultimately leads to nuclear translocation of the transcription factor YAP. In the small intestine, YAP is expressed in epithelial cells, immune cells and fibroblasts. During pregnancy and weaning, epithelial and stroma cells exhibit strong nuclear staining of YAP. Interestingly, estrogen led to upregulation and increased nuclear shuttling of YAP in intestinal epithelial cell monolayers. This effect appears to be specific to the estriol treatment since the established pro-proliferative cytokine GLP-2 did not lead to increased nuclear shuttling of YAP.\u003c/p\u003e","manuscriptTitle":"Pregnancy induces intestinal epithelial elongation and estriol- associated activation of the Hippo signaling pathway in a mouse model","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-07 09:25:17","doi":"10.21203/rs.3.rs-6556923/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-06-13T05:36:09+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-06-12T23:17:40+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"338483539837839406162898320753926850728","date":"2025-06-03T15:52:34+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"112050065740783731404040869596046165985","date":"2025-05-29T19:01:15+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-05-24T13:21:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"288045442996606718903930608789188652205","date":"2025-05-13T12:22:00+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-05-02T11:28:16+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-05-02T01:48:43+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-05-02T01:48:40+00:00","index":"","fulltext":""},{"type":"submitted","content":"Pflügers Archiv - European Journal of Physiology","date":"2025-04-29T13:21:29+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"pflugers-archiv-european-journal-of-physiology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"paej","sideBox":"Learn more about [Pflügers Archiv - European Journal of Physiology](http://link.springer.com/journal/424)","snPcode":"424","submissionUrl":"https://submission.nature.com/new-submission/424/3","title":"Pflügers Archiv - European Journal of Physiology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"4c77d34f-fafc-4e48-8be7-536f05df9d30","owner":[],"postedDate":"May 7th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-08-18T16:08:10+00:00","versionOfRecord":{"articleIdentity":"rs-6556923","link":"https://doi.org/10.1007/s00424-025-03107-2","journal":{"identity":"pflugers-archiv-european-journal-of-physiology","isVorOnly":false,"title":"Pflügers Archiv - European Journal of Physiology"},"publishedOn":"2025-08-11 15:57:39","publishedOnDateReadable":"August 11th, 2025"},"versionCreatedAt":"2025-05-07 09:25:17","video":"","vorDoi":"10.1007/s00424-025-03107-2","vorDoiUrl":"https://doi.org/10.1007/s00424-025-03107-2","workflowStages":[]},"version":"v1","identity":"rs-6556923","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6556923","identity":"rs-6556923","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}