Identification of bacterial pathogens in patients with chronic obstructive pulmonary disease (COPD) with special reference to Mycoplasma pneumoniae, Chlamydia pneumoniae and Legionella pneumophila | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Identification of bacterial pathogens in patients with chronic obstructive pulmonary disease (COPD) with special reference to Mycoplasma pneumoniae, Chlamydia pneumoniae and Legionella pneumophila Tonushyam Sonowal, Malini Shariff, Kalaivani Mani This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6062069/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Background Chronic obstructive pulmonary disease (COPD) is a major cause of morbidity and mortality throughout the world. COPD is often accompanied by acute exacerbations [AECOPD] where 70% of it is caused by aerobic bacteria, 30% due to viruses and 5-10 % by atypical bacteria,most commonly Mycoplasma pneumoniae ( M. pneumoniae ), Chlamydia pneumoniae ( C. pneumoniae ) and Legionella pneumophila ( L.pneumophila ). Isolation and identification of these atypical microorganisms are challenging. However, the sensitivity in detecting these pathogens has improved with the availability of newer molecular diagnostic techniques. The present prospective study was undertaken to determine the predominant bacterial pathogens with special reference to atypical pathogens in patients with COPD using all three detection approaches in combination (serology, culture, PCR and RT-PCR). Methodology One hundred and ninety-six hospitalized patients, categorized into different stages of COPD and AECOPD using GOLD and Anthonisen criteria, were included in the study. Clinical samples such as throat swabs, nasopharyngeal swabs, sputum, urine and 10 ml of both acute and convalescent serum were collected. Isolation and identification of bacteria were done using standard methods. Atypical bacteria were identified by using phenotypic molecular methods. Antibody levels were detected in the serum using commercially available kits. Results Out of 196 patients, 39.8% patients were in the severe stage of COPD and 49.7% showed mild exacerbations. 102/196 (52.04%) patients of COPD yielded organisms in culture, of which 101 had exacerbations of varying degrees. None of the samples were positive for L.pneumophila in culture. PCR was found to be positive in 11 and 22 numbers for M. pneumoniae and L.pneumophila respectively. Serology was positive in 19.89 % of M. pneumoniae , 17.3 % of C. pneumoniae and 8.67 % of L. pneumophila . Conclusions The present study found bacterial pathogens, including atypical bacteria, in 60.10 % of cases. 30.6% were atypical bacteria. Hence, the antibiotic regimen recommended for AECOPD should include an antibiotic directed at atypical bacteria. No one method is suitable for the detection of atypical bacteria. Therefore, atypical pathogens should be diagnosed using a combination of tests for better sensitivity. Chronic obstructive disease Atypical bacteria Mycoplasma pneumoniae Legionella pneumophila Chlamydia pneumoniae Figures Figure 1 Figure 2 Introduction Chronic obstructive pulmonary disease (COPD) represents an important public health challenge and is a major cause of morbidity and mortality throughout the world. COPD is currently the 4th leading cause of death in the world [ 1 ] but is projected to be the 3rd leading cause of death by 2020. COPD is often accompanied by acute exacerbations of COPD [AECOPD]), due to mainly increased inflammation. The etiology remains unclear in nearly 30% of AECOPD cases, whereas the remaining cases are due to a respiratory tract infection (50–60%), or environmental factors (10%) [ 1 ]. The role of microorganisms, especially bacteria, in the pathogenesis of COPD, has been well documented. About 70% of exacerbations are caused by infection due to aerobic bacteria, 30% due to viruses and 5–10% by atypical bacteria [ 2 ]. The term atypical pathogens‘‘ refers to Mycoplasma pneumoniae (M. pneumoniae) , Chlamydia pneumoniae ( C. pneumoniae ) and Legionella pneumophila ( L.pneumophila ). The role of these bacteria in AECOPD remains unclear. The isolation of atypical pathogens in culture is very demanding and the sensitivity is very low. Serological studies suggest that these atypical pathogens may play an important role in AECOPD [ 3 ]. However, the interpretation of the role of these atypical pathogens in AECOPD is not easy, since these organisms are difficult to cultivate from respiratory tract specimens. Also, variability among authors exists in the reliability and interpretation of the results of serological assays. Molecular diagnostic techniques, such as PCR, have become useful tools for the aetiological diagnosis of lower respiratory tract infections [ 4 ]. PCR can detect minute amounts of nucleic acids from potentially all PPMO (potential pathogenic microorganisms); it does not depend on the viability of the target microbe; it is probably less affected by previous antimicrobial therapy than culture-based methods and can provide results quickly. For patients with pneumonia, molecular techniques offer distinct advantages over conventional tests for the detection of atypical pathogens. [ 4 ]. Atypical bacteria play an important role in COPD patients and the active presence of these organisms in COPD patients helps in the progression to AECOPD. The isolation of atypical pathogens in culture is very demanding and the sensitivity is very low. However, with the availability of newer molecular diagnostic techniques such as PCR and Real-time PCR (RT-PCR), the sensitivity in detecting these pathogens has improved and can be tested simultaneously. Reports have shown the association between AECOPD and the presence of bacterial, atypical, or viral pathogens; in most cases, a single procedure has been used (serology, single detection with culture, or PCR), and studies with all these techniques are extremely scarce. The present prospective study was undertaken to determine the predominant bacterial pathogens with special reference to atypical pathogens in patients with COPD using all three detection approaches in combination (serology, culture, PCR). Materials and Methods This is a prospective study cleared by the Institutional Human Ethics Committee. It follows the norms set by the Indian Council of Medical Research for National ethical guidelines for Biomedical and health research involving Human participants which is in line with the declaration of Helsinki. Written informed consent was taken from all patients. Confidentiality of data has been maintained and there are no conflicts of interest. 196 adult patients with COPD attending Viswanathan Chest Hospital were included in the study. Staging of COPD was done using GOLD criteria [ 5 ]. Patients with exacerbations were also noted using the Anthonisen criteria [ 6 ]. Clinical details regarding coughing with or without production of sputum, dyspnea, history of smoking patient, risk factors for infection, exposure to antibiotics, fever, and history of prior hospitalization were assessed. Spirometry findings were also included for the staging of COPD and AECOPD. Subjects not willing to participate in the study were excluded. Clinical details regarding cough with or without sputum production, dyspnea, history of smoking patient, risk factors for infection, exposure to antibiotics, fever, and history of prior hospitalization were recorded. Sample collection Clinical samples such as sputum, nasopharyngeal swabs, throat swabs and urine, were collected from patients included in the study.10 ml of paired blood samples for serum were collected at the time of admission and 4 weeks later wherever possible. The specimens were subjected to appropriate laboratory investigations for bacterial pathogens including atypical bacterial pathogens ( Mycoplasma, Legionella and Chlamydia ). Isolation and identification The clinical samples were processed by standard microbiological methods [ 7 ]. However, for sputum and urine, a semiquantitative method was used. More than or equal to 10 5 cfu/ml for sputum and urine was considered significant. Sputum and other respiratory samples were inoculated onto blood agar and McConkey agar. Urine samples were inoculated on CLED (cysteine lactose electrolyte-deficient) agar and McConkey agar and significant bacterial growth was further identified using the standard techniques. In addition, Buffered charcoal yeast extract (BCYE) agar plates containing BMPA-ALPHA (Buffer, cefamandole, Polymyxin, Anisomycin alpha-ketoglutarate) selective supplement for isolation of L. pneumophila , PPLO broth and PPLO agar for M. pneumoniae were used. The inoculated media were incubated overnight at 37°C in ambient air. Blood agar plates and BCYE agar plates were incubated in 5% CO2. PPLO broth was incubated at 37°C under 5% CO2 for 4–5 weeks. The colour change from slightly orange to yellow indicated the growth of M. pneumoniae. Further confirmation was done by subculturing from PPLO broth to PPLO agar media and observing tiny yellowish-white fried egg colonies under the microscope. Diene's stain was also performed to confirm the growth of M.pneumoniae colonies (Fig. 1 ). The isolates were identified with standard phenotypic tests and confirmed by VITEK (Biomereux). Gram-negative bacilli isolated on BCYE agar with no growth after subculturing on blood agar were identified as L. pneumophila (Fig. 2 ) and confirmed by biochemical tests and PCR Storage of bacterial culture The isolates were maintained in the laboratory as stab culture in Nutrient Agar and suspension in Nutrient Broth with 16% glycerol, kept at -80°C. Serology Serum IgG and IgM for atypical bacteria ( M.pneumoniae, C.pneumoniae, L.pneumophila ) were detected by ELISA using the commercial kit NovaTec immunodiagnostic gmbh (NovaLisa). The criteria given by the manufacturer were used to label the samples as positive or negative. Briefly, the units (NTU) were calculated by taking the mean OD of the cut-off serum provided in the kit. More than 11 units were considered positive. Demonstration of seroconversion was defined as a change from a negative acute serum sample to a positive convalescent serum sample or a four-fold rise in antibody units between the paired sera. Wherever only acute serum was available then IgM titer of 4 times the NTU was considered positive. Similarly, high IgG levels (More than 2 times the cut-off OD in the acute sample and/or a 4-fold rise in the units in the convalescent serum whenever available were considered positive. DNA isolation from clinical samples DNA extraction was carried out following the QIAamp DNA blood extraction kit (Qiagen) following the manufacturer’s instructions. Briefly, after the sample preparation, the QIAGEN mini spin column was used for DNA extraction and DNA was eluted in a final volume of 55 µl, and stored at -20°C. In addition, 200 µl of culture-positive PPLO broth was used for the extraction of DNA for M. pneumoniae PCR assay targeting M. pneumoniae P1 gene and L. pneumophila mip gene Multiplex PCR assay targeting the M. pneumoniae P1 gene and L. pneumophila mip gene were carried out using the published protocols [ 8 , 9 ]. Two sets of primers, each specific for the P1 adhesin gene of M. pneumoniae and the macrophage infectivity potentiator ( mip ) gene of L. pneumophila were used. For M. pneumoniae both forward primer CAAGCCAAACACGAGCTCCGGCC and reverse primer CCAGTGTCAGCTGTTTGTCCTTCCCC and for L. pneumophila forward primer- GACAAGGATAAGTTGTCTTATAGC and reverse primer- ACGACCAG TGTATTCCACAG were used targeting 543 bp segment of M. pneumoniae and 375 bp segment of L. pneumophila , ) PCR standardization was done by using M . pneumoniae ATCC 15531 strain and L. pneumophila ATCC 33152 strain. The reaction mixture was prepared in a final volume of 25 µl containing 2.5 µl of 10x PCR buffer, 0.5µl of dNTPs, 0.5 µl of Taq polymerase, 2 µl of DNA sample, 1 µl of 5 pmol/µl of each forward and reverse primers of each gene and nuclease-free water to achieve desired final volume. The reaction was performed in a thermocycler (Biorad) under the following conditions. 94°C for 5 minutes, followed by 35 cycles of amplification each at 94°C for 1 minute of denaturation, 55°C for 1 minute of annealing and 72°C for 2 minutes of extension, and a final elongation step of 72°C for 10 minutes. Real-time PCR for identification of M.pneumoniae, L.pneumophila and C. pneumoniae Detection of M. pneumoniae , L. pneumophila, and C.pneumoniae from clinical samples and the positive culture was carried out by Multiplex PCR using FTD Atypical CAP kit [FTD Bacterial pneumonia CAP (RUO)] on a CFX96 (Biorad) thermocycler. The assay was performed according to the manufacturer's instructions. L. pneumophila antigen detection in urine Urinary antigen for L.pneumophila was performed by using the Alere BinaxNOW Legionella urinary antigen card (Alere BinaxNOW Legionella ) targeting serogroup Lp1 antigen. Briefly, all reagents, patient urine samples and card were allowed to equilibrate to room temperature before testing. An Alere swab was dipped into the urine specimen, completely covering the swab head. Then the swab was inserted into the bottom hole of the card (Two holes on the inner right panel of the card) and was firmly pushed upwards so that the swab tip was fully visible in the top hole. The reagent A, supplied in the kit, was held vertically (1/2 inch to 1 inch above the card) and 2 free-falling drops were slowly added to the bottom hole. Then the adhesive liner was immediately peeled off from the right edge of the test card, closed immediately and the result was taken within 15 minutes after closing the card. Sample positive for antigen gave two pink-purple-coloured bands whereas a negative sample gave only one band. Statistical Analysis The data was statistically analysed using Stata 12.0 (College Station, Texas, USA). Diagnostic accuracy of serology and PCR against culture was reported by calculating Sensitivity (95%CI), specificity (95%CI), positive predictive value (95% CI), negative predictive value (95%CI) and likelihood ratio of a positive test was (95%CI). Chi-square/Fisher exact test was used to test the association between severity of COPD and AECOPD with sex, AECOPD and Pathogens, AECOPD and atypical bacteria and AECOPD and comorbid conditions, atypical bacteria with the comorbid condition. The p-value less than 0.05 was considered statistically significant. Results One hundred and ninety-six patients with COPD admitted to Vishwanathan Chest Hospital were included in the study. Nasopharyngeal swabs, throat swabs, urine samples, and sputum samples were collected from all these patients. Two hundred and thirty-four serum samples were also collected. The Age of the Patients ranged from 35 to 80 years. One hundred forty-seven (75%) of the patients were males and 49 (25%) were females with most males being in the 51–60 age group and females in the 61–70 age group. No significant association was seen between the sexes and different stages of COPD and AECOPD. Out of a total of 196 COPD patients, 44 (22.4%) Mild, 38 (19.4%) Moderate, 78 (39.8%) severe and 36 (18.3) very severe were observed. All these patients showed varying degrees of exacerbation with 96 (48.9%), 55 (28.1%) and 42 (21.4%) in the mild, moderate and severe stages of AECOPD. 102/196 (52.04%) patients of COPD yielded organisms in culture of which 101 with varying degrees of exacerbations yielded pathogens. Acinetobacter 22(11.22%) was the most common followed by M. pneumoniae 31(15.81%), Klebsiella pneumoniae 28 (14.28%), Escherichia coli 11(5.61%) and MRSA 10 (5.10%) (Table 1 , Fig. 1 ). In 32 patients more than one organism was isolated. Out of the 31 that were positive for M. pneumoniae in culture 18 were isolated from Throat swab, 9 from nasopharyngeal swab and 4 from both. Table 1 Bacterial pathogens isolated from patients ( n = 196) Organisms Total number (%) n = 134 Gram-negative Acinetobacter spp 22 (11.22%) Citrobacter freundi 2 (1.02%) Elizabeth kingae 1 (0.51%) Enterobacter spp 3 (1.53%) Escherichia coli 11 (5.61%) Klebsiella pneumoniae 28 (14.28%) Pseudomonas aeruginosa 10 (5.10%) Pseudomonas spp 6 (3.06%) Stenotrophomonas maltophilia 1 (0.51%) Mycoplasma pneumoniae 31 (15.81%) Gram positive Enterococcus spp 1 (0.51%) MRSA 10 (5.10%) Staphylococcus aureus 6 (3.06%) streptococcus pneumoniae 1 (0.51%) PCR From Clinical samples A multiplex PCR for M. pneumoniae and L. pneumophila and Real-time PCR for M. pneumoniae , L. pneumophila, and C. pneumoniae were carried out on the DNA isolated from clinical samples. 11 and 22 were positive for Mycoplasma and Legionella respectively in multiplex PCR. Among the total number of M. pneumoniae isolates 11 isolates were positive by PCR. Out of these 3 were positive by RT-PCR only. None of the samples were positive for L.pneumophila in culture whereas, 22 were positive in PCR (Fig. 2 ). Out of these 12 were positive by RT PCR only. None of the samples were positive for Chlamydia pneumoniae in RT- PCR Serology results Out of 196 patients, paired sera were available for only 38 patients, the rest were only single acute-phase sera. IgG and IgM were tested in all the samples including the paired samples. Forty-five samples were positive for M. pneumoniae in serology. IgM was positive in 8 (4%) acute phase sera and 2 (5.3%) in convalescent sera. Out of these one was positive for both IgM and IgG. Two of these had seroconverted (More than 2-fold Units) for IgG. Forty patients were positive for IgG 5 of which seroconverted (4-fold rise). Three (3) of these patients showed both IgM and IgG antibodies. Fifteen were positive for Legionella pneumonia- specific IgM antibodies. None of the samples were positive for IgG in acute sera. However, 2/38 samples showed seroconversion. Hence, 17 (7.26%) samples were positive for Legionella antibodies. Thirty-four out of 234 samples (14.5%) were positive for Chlamydia antibodies. Twenty-two were positive for Chlamydia pneumoniae specific IgM antibody, none seroconverted. Three acute samples were IgG positive (with a 2-fold rise) all of which showed a 4-fold rise in convalescent serum. Hence, 12 (15.30%) samples were positive for IgG Chlamydia antibodies. Since culture is not a sensitive technique, we have adopted the expanded gold standard method [ 10 , 11 ] to calculate the sensitivity and specificity of PCR, culture and serology. According to this, all the culture-positive and /or both PCR and serology-positive were taken as Gold Standard positive and culture-negative and /or only serology-positive and PCR-negative and vice versa were taken as Gold Standard negative. So, 35 were positive for M.pneumoniae and 161 were negative. Similarly, for L.pneumophila , 2 were positive and 194 were negative (Table 2 , 3 ). Table 2 Serology results of Mycoplasma pneumoniae and Legionella pneumophila according to expanded gold standard Mycoplasma pneumoniae Gold standard positive (n = 35) Gold standard negative (n = 161) Serology positive 17 28 Serology negative 18 133 Legionella pneumophila Gold standard positive (5) Gold standard negative (191) Serology positive 5 12 Serology negative 0 179 Table 3 PCR results of Mycoplasma pneumoniae and Legionella pneumophila according to expanded gold standard Mycoplasma pneumoniae Gold standard positive (n = 35) Gold standard negative (n = 161) PCR positive 4 7 PCR negative 31 154 Legionella pneumophila Gold standard positive (5) Gold standard negative (191) PCR positive 5 17 PCR negative 0 174 For M. pneumoniae according to the expanded gold standard, serology is 48.6% sensitive and 82.6% specific. Similarly, PCR was 11.4% sensitive and 95.7% Specific. The serology for Legionella was 100% sensitive and 93.7% specific. PCR showed a Sensitivity and specificity of 100% and 91.1% respectively. None of the samples were positive for Legionella urinary antigen. Discussion The present study included 196 COPD patients showing varying degrees of exacerbations. Only a quarter of the patients were females. Most of the patients had severe COPD (39.8%) with mild (49.7%) exacerbation. There were patients in all the exacerbated groups so comparison of data across the groups was possible. Among the 193 patients with exacerbation, bacterial aetiology could be identified in 101 (52.3%) patients. Similar findings were observed by Sapey & Stockley et al ., 2006 [ 12 ]. Thirty-two patients had infections with multiple pathogens. In the present study, Diabetes Mellitus (38), Hypertension (25), past Tuberculosis (21) and chronic smokers (112) were observed. All the patients had comorbid conditions; 98 with one, 27 with 2, 11 with 3 and 3 with all four comorbid conditions. These increase the chances of exacerbation in the patients [ 2 ]. Common organisms isolated in the present study were Acinetobacter 22 (11.2%) followed by M. pneumoniae 31(15.8%), Klebsiella pneumoniae 28 (14.2%), Escherichia coli 11(5.6%) and MRSA 10 (5.1%). In many studies, Hemophilus influenzae , Streptococcus pneumoniae and Moraxella were more commonly isolated [ 13 , 14 ]. In the present study, 39.8% of the patients had severe COPD. These patients presenting with frequent exacerbations have repeated hospital admissions and a greater degree of colonization. A positive correlation was found between lower airway colonization and frequency of exacerbations [ 15 ]. In the present study, as many as 151 patients were hospitalised previously. Hence, the common hospital-acquired organism like Acinetobacter was prevalent in the present study. Among the atypical pathogens, Mycoplasma was the most common. It was isolated in 35 (17.9%) of our patients. It agrees with many studies [ 16 ]. However, a very low (3.9%) isolation was seen in a study by Chaudhry R et al ., 2017 where patients with community-acquired pneumonia were included. In the present study, L. pneumophila was not isolated from any specimen. Similar findings were observed in a study by Chaudhry et al ., 2017[ 17 ]. This could be due to empirical antibiotic treatment. The negative culture may also be due to the following reasons: A positive result usually appears within 3–5 days, although 2 weeks may be required. Additional treatment of clinical samples may be necessary to reduce background flora that can inhibit the growth of Legionella [ 18 ]. The throat swab was observed to be a better sample than the Nasopharyngeal swab in isolation of M. pneumoniae . This observation is concordant with other studies [19,20,21]. This could be because the Nasopharyngeal swabs cannot be manipulated much unlike the Throat swab and the clinical material in the NP may be inadequate. PCR from clinical samples Only 11(5.6%) of our isolates were positive for M. pneumoniae by PCR whereas 31 (15.81%) were Culture positive. The false negative results of the PCR can be explained by a bacterial load below the detection limit of the PCR, dilution of samples when added to the transport medium, or the presence of interfering DNA coming from Human cells or other colonizing microorganisms of the respiratory tract which could affect amplification. Legionella was detected in 22 cases by PCR. Real Time PCR detected M. pneumoniae in three more samples, and Legionella in 12 more samples as compared to conventional PCR. It is well known that RT PCR is more sensitive than conventional PCR because it can even detect low copy numbers in clinical samples [ 22 ]. Serology The great advantage of serologic testing is that the positive serology of an infectious agent is proof of a patient's significant exposure to that pathogen. However, serology is not useful for the early diagnosis of M. pneumoniae infection in adults. Adults may fail to develop IgM during an M. pneumoniae infection [23] probably because of re-infection [ 24 , 25 , 26 ], or the IgM response may be delayed, not being detectable until 15 days after the onset of symptoms [ 26 , 27 ]. Thus, the absence of IgM in the first serum sample does not exclude a current infection. Also, high IgG titre without IgM can occur if there is re-infection. Therefore, a high IgG titer in an acute serum can be taken as a recent infection. Hence, we have used these samples as serology-positive. In the present study 19.89% of M. pneumoniae , 17.3% of C. pneumoniae and 8.67% of L. pneumophila were positive by serology. These are lower than the results of Lieberman D et al. , in 2001 where 240 paired samples were analysed. They observed P. pneumoniae, C. pneumoniae and Legionella spp. in 14%, 34% and 17%, of patients respectively. The variation in the result may be because of the low sample size, only 38 paired samples, from the 196 patients were available.[ 14 ] Sensitivity and specificity of the tests Culture especially of M. pneumoniae is time-consuming because it takes 2–5 weeks for the colonies to be visible and relatively insensitive. Serology depends on the time of collection of the sample from disease onset and the availability of paired serum. In adults, IgM may not be produced and directly IgG may be formed in early infection due to reinfection. Hence, difficult to interpret. Nucleic acid amplification techniques produce rapid, specific and sensitive results. But due to increased sensitivity false positive results may occur. In the absence of a good reference gold standard method, an expanded gold standard method where more tests can be used to determine the Gold standard can be used [ 10 , 11 ]. With the expanded gold standards, more isolates were included in the positive group. Mycoplasma serology was 48.6% sensitive and 82.6% specific. The positive predictive value was only 36%. In L. pneumophila since they were all culture-negative, the serology was 100% sensitive and 93.7% specific Comparisons of various tests : Thirty-one patients were positive for Mycoplasma pneumoniae in culture, 45 by serology and 11 by PCR. As compared to culture, low rates of positivity of PCR could be due to false-negative PCR results. The presence of inhibitors and a low bacterial load resulting from previous antimicrobial treatment or dilution of the sample below the limit of detection could explain the negative PCR results. Serology was positive in 45 cases, 14 more than culture. Out of these 37 cases had IgG antibodies, due to a past infection which could explain the culture negativity in these cases. However, 15 of these cases were positive in culture. This could be because of various reasons: 1. New infection but persistence of IgG antibodies from a previous infection which is insufficient to inhibit the current infection. 2. Alternatively, these cases may represent an asymptomatic carriage of M. pneumoniae due to the persistence of a previous disease [ 28 ]. 3. Seroconversion is fast enough in these cases where the culture is still positive. Culture detected 31 cases, and with the addition of serology, 25 more cases were added, taking the number to 56. Similarly, when PCR was included with culture 10 extra cases were detected taking the total number to 41. Three cases were detected using PCR and serology. Therefore, Mycoplasma was detected in 62 cases instead of 31, 45 and 11 cases by Culture, serology and PCR respectively. So, a combination of tests improves the sensitivity of Mycoplasma detection. Seventeen patients were positive for Legionella antibodies, of which 5 were positive by both PCR and serology. Individually, twenty-two cases were detected by PCR and 17 by serology. Hence a total of 39 cases were positive for Legionella when the two tests were combined. Detection of Legionella Antigen in urine Detection of soluble antigens in urine provides rapid qualitative detection of Legionella infections. The captured antibody used in these assays is specific for Lp1. Hence, non-Lp1 strains can give negative results [ 29 , 30 ]. Legionella serotype 1 is the most common type prevalent all over the world. However, serotypes 1–15 have been isolated from environmental samples in India [31]. Also concentrating the urine sample may improve the sensitivity of antigen detection. Prolonged storage of specimens may hamper the test performance due to degradation of Legionella urinary antigen. In the present study, Legionella antigen was absent in all 196 samples. Any of the above reasons may have led to this result. It is commonly accepted that atypical bacteria cause 5–10% of AECOPD, either as independent pathogens or, more frequently, as co-pathogens However, in several serological studies, much higher proportions of exacerbated patients had evidence of a recent infection with C. pneumoniae, M. pneumoniae or Legionella spp . –up to 34%, 14% and 17%, respectively [ 14 ]. By performing Culture, PCR and serology for different samples from the patients 80 (41%), 39 (20%) and 30 (15%) samples were found positive for M. pneumoniae , 39 L. pneumophila and C. pneumoniae respectively in AECOPD cases. Multiple pathogens were seen in 32 patients. This could be because of an impaired innate lung defence mechanism and hence the organisms may be colonized in the lower airway system [ 2 ]. In the present study, a single patient was infected with all three atypical organisms The patient was a sixty-one-year-old male with h/o smoking, very severe COPD and moderate AECOPD, had multiple pathogens ( Klebsiella and E.coli), sputum yielded Mycoplasma , Legionella was positive in PCR. IgM antibodies to Legionella and Chlamydia and IgG antibodies to Mycoplasma in the second sample were present. No other co-morbidities were seen. In 6 cases Mycoplasma with Chlamydia were present. Out of these 6 cases showed co-morbidities. Among these, one each of hypertension and chronic smoking were observed and in 3 cases only a history of chronic smoking was observed. All cases had a history of previous hospitalization. In 3 cases no comorbidity was seen. Legionella and Chlamydia were found in one case, 62 Yr old with h/o of previous hospitalization with moderate COPD and exacerbation and had IgM antibodies to both organisms. AECOPD staging and isolation of Pathogens It is expected that patients in severe stages of exacerbation will show higher isolation rates of Pathogens. In the present study, the presence of pathogens, specifically atypical bacteria, did not correlate with the staging of AECOPD. The results were not statistically significant. The results were concordant with other studies [ 14 , 15 ]. This could be because the lungs of severe patients are compromised and are more sensitive to non-infectious agents such as air pollutants and heart failure and show exacerbated symptoms more quickly. However, the variety of potentially pathogenic bacteria and frequency of mixed infection is higher in severe patients when compared to those with mild and moderate exacerbations [ 15 ]. Similarly, there was no statistically significant correlation between staging and M. pneumoniae. Lacunae of the study In the present study patients with different stages of COPD were included and compared. No controls were included in the study which could have given an idea of whether identified bacteria were pathogens or commensals. Viruses and Fungi were not tested. They could have caused exacerbation. Paired serum samples were available in only 38 patients. This could have affected the sensitivity of serology. Conclusion No one method is suitable for the detection of atypical bacteria. Hence, to increase the sensitivity a combination of tests is required. Bacterial pathogens including atypical bacteria were found in 60.10% of cases. Since 30.56% were atypical bacteria, the antibiotic regimen recommended for AECOPD should include an antibiotic directed at atypical bacteria. Declarations Ethical Approval: Institutional ethical approval was taken for the study Ref: VPCI/DIR/Protocol/2017 by the Institutional Human Ethics Committee. Consent for publication: Not applicable Data Availability: The datasets generated during and/or analyzed during the current study are available from the corresponding author upon reasonable request. Conflict of Interest: The authors declare no competing interests. Funding: The study was not funded by any source. Author Contribution: TS: Recruited the patients, collected samples, performed the experiments, tabulated the results, and wrote the first draft of the manuscript. MS: Conceptualized the study, validated the results, reviewed the manuscript and corresponded with the journal. KM: Statistical analysis All authors reviewed the manuscript References World Health Organization. Global Surveillance, Prevention and Control of Chronic Respiratory Diseases: A Comprehensive Approach. Geneva, Switzerland: World Health Organization; 2007. Sethi S. Infectious etiology of acute exacerbations of chronic bronchitis. Chest 2000; 117 :380. Sethi S, Wrona C, Eschberger K, Lobbins P, Cai X, Murphy TF. Inflammatory profile of new bacterial strain exacerbations of chronic obstructive pulmonary disease. Am J Respir Crit Care Med 2008; 177 :491-97. Murdoch DR. Molecular genetic methods in the diagnosis of lower respiratory tract infections. APMIS 2004; 112 : 713–727. Global initiative for chronic obstructive lung disease ( GOLD) 2018. Anthonisen NR, Manfreda J, Warren CP, Hershfield ES, Harding GK and Nelson NA. Antibiotic therapy in exacerbations of pulmonary disease. Chronic Ann Intern Med 1987;106:196–204. Forbes BA, Sham DF, Weissfeld AS (ed.), bailey & Scott‘s Diagnostic Microbiology, 12th ed. Mosby Inc 2007; 187-214. Williamson J, Marmion BP, Worswick DA, Kok TW, Tannock G, Herd R, Harris RJ, 1992. Laboratory diagnosis of Mycoplasma pneumoniae infection. 4. Antigen capture and PCR-gene amplification for detection of the Mycoplasma : problems of clinical correlation. Epidemiol Infect 1992; 109 : 519–537. Welti M, Jaton K, Altwegg M, Sahli R, Wenger A, Bille J, .Development of a multiplex real-time quantitative PCR assay to detect Chlamydia pneumoniae, Legionella pneumophila and Mycoplasma pneumoniae in respiratory tract secretions. Diagn Microbiol Infect Dis 2003; 45 : 85–95. Loens K, Ursi D, Goossens H, & Ieven M. Molecular diagnosis of Mycoplasma pneumoniae respiratory tract infections. J Clin Microbiol 2003; 41 : 4915–4923. Tjhie J H, Gnarpe J, Gnarpe H, Larsson P G, Platz-Christensen J J, Ostergaard L, Victor A, Expanded gold standard in the diagnosis of Chlamydia trachomatis in a low prevalence population: diagnostic efficacy of tissue culture, direct immunofluorescence, enzyme immunoassay, PCR and serology Genitourin Med 1994; 70 :300-303. Sapey E, Stockley RA. COPD exacerbations . 2: aetiology. Thorax. 2006 Mar;61(3):250-8. doi: 10.1136/thx.2005.041822. PMID: 16517585; PMCID: PMC2080749. Dorigo-Zetsma J W, Zaat SAJ, Wertheim-van Dillen PME, Spanjaard L, Rijntjens J, van Waveren G, Jensen JS, Angulo AF, and Dankert J. Comparison of PCR, culture, and serological tests for diagnosis of Mycoplasma pneumoniae respiratory tract infection in children. J. Clin. Microbiol. 1999; 37: 14-17. Lieberman D, Lieberman D, Ben-Yaakov M, Lazarovich Z, Hoffman S, Ohana B, Friedman MG, Dvoskin B, Leinonen M, Boldur I. Infectious etiologies in acute exacerbation of COPD. Diagn Microbiol Infect Dis. 2001 Jul;40(3):95-102. doi: 10.1016/s0732-8893(01)00255-3. PMID: 11502375. Aydemir Y, Kalem F. Relationship between the GOLD combined COPD assessment staging system and bacterial isolation 2014; 9(1) : 1045—1051. Lieberman D, Lieberman D, Ben-Yaakov M, Shmarkov O, Gelfer Y, Varshavsky R, et al . Serological evidence of Mycoplasma pneumoniae infection in acute exacerbation of COPD. Diagn Microbiol Infect Dis . 2002; 44 : 1–6 Chaudhry R, Valavane A, Sreenath K, Choudhary M, Sagar T, Shende T, Varma-Basil M, Mohanty S, Kabra SK, Dey AB, Thakur B. Detection of Mycoplasma pneumoniae and Legionella pneumophila in Patients Having Community-Acquired Pneumonia: A Multicentric Study from New Delhi, India. Am J Trop Med Hyg. 2017 Dec;97(6):1710-1716. doi: 10.4269/ajtmh.17-0249. Epub 2017 Sep 21. PMID: 29016299; PMCID: PMC5805046. Pierre DM, Baron J, LY Victor, ES Janet Diagnostic testing for Legionnaires‘ disease Pierre et al. Ann Clin Microbiol Antimicrob 2017; 16:59. Ramirez, J. A., Ahkee, S., Tolentino, A., Miller, R. D. & Summersgill, J. T.Diagnosis of Legionella pneumophila, Mycoplasma pneumoniae or Chlamydia References 66 pneumoniae lower respiratory infection using the polymerase chain reaction on a single throat swab specimen. Diagn Microbiol Infect Dis 1996; 24: 7–14 Gnarpe JA. Lunbäck H, Gnarpe and Sundelöf B. Comparison of nasopharyngeal and throat swabs for the detection of Chlamydia pneumoniae and Mycoplasma pneumoniae by polymerase chain reaction. Scand J Infect Dis Suppl. 1997; 104:11-12 Honda J T, Yano M, Kusaba J, Yonemitsu H, Kitajima M, Masuoka K, Hamada, and Oizumi K. Clinical use of capillary PCR to diagnose Mycoplasma pneumoniae. J Clin Microbiol. 2000; 38:1382-1384 Gullsby K, Storm M, Bondeson K. Simultaneous detection of Chlamydophila pneumoniae and Mycoplasma pneumoniae by use of molecular beacons in a duplex real-time PCR. J Clin Microbiol 2008; 46: 727–731 Martínez TMA, Pino PY, Salazar BT, Jover LE, Caroca CC, Espinoza NMA & Avendaño CLF. Diagnostic utility of the polymerase chain reaction for the diagnosis of Mycoplasma pneumoniae in elderly patients with communityacquired pneumonia. Rev Chilena Infectol 2005; 22:251–256. Sillis, M.The limitation of IgM assays in the serological diagnosis of Mycoplasma pneumoniae infections. J Med Microbiol 1990 ;33: 253– 258 Uldum SA, Jensen J S, Søndergård-Andersen J & Lind K. Enzyme immunoassay for detection of immunoglobulin IgM and IgG antibodies to Mycoplasma pneumoniae. J Clin Microbiol 1992; 30: 1198–1204. Jacobs E, Bennewitz A, and Bredt W. Reaction pattern of human anti- Mycoplasma pneumoniae antibodies in enzyme-linked immunosorbent assays and immunoblotting. J Clin Microbiol 1986; 23: 517–522 Moule JH, Caul EO, & Wreghitt TG. The specific IgM response to Mycoplasma pneumoniae infection: interpretation and application to early diagnosis. Epidemiol Infect 1987; 99: 685–692 Daxboeck F, Krause R, and Wenisch C. Laboratory diagnosis of Mycoplasma pneumoniae infection. Clin Microbiol Infect 2003; 9:263– 273 Cunha BA, Burillo A, Bouza E. Legionnaires' disease. Lancet 2016; 387:376-85. Shimada T, Noguchi Y, Jackson JL, Miyashita J, Hayashino Y, Kamiya T, et al. Systematic review and meta-analysis: Urinary antigen tests for Legionellosis. Chest 2009;136:1576-85 Jinna S, Gaikwad UN. Environmental surveillance of Legionella pneumophila in distal water supplies of a hospital for early identification & prevention of hospital-acquired legionellosis. Indian J Med Res. 2018 Jun;147(6):611-614. doi: 10.4103/ijmr.IJMR_527_17. PMID: 30168494; PMCID: PMC6118141. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6062069","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":424134374,"identity":"fbd435e9-6a8d-4bdf-a76e-0c009678bf55","order_by":0,"name":"Tonushyam Sonowal","email":"","orcid":"","institution":"Vallabhbhai Patel Chest Institute","correspondingAuthor":false,"prefix":"","firstName":"Tonushyam","middleName":"","lastName":"Sonowal","suffix":""},{"id":424134375,"identity":"44ffe551-00fe-4926-bd21-c8fad6deace8","order_by":1,"name":"Malini Shariff","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8ElEQVRIie2PMQrCMBSGX3Fw6QG8hJCpLqE9iEtKIE5CRweHOrl4AC8hOAluTwJO1awFF7s4Ky4ODiZRRIdG3ATzEUjy8z7+BMDj+UkaOQIBswAHlOotGKFbCV6UQohH8kGxm1GgENJenEp7vBrJLIOk09xUiEzFs7HULUParVOiIs3llEC6nPSIVnZ8oROEtejndQpqJSTACAqQp8uOmwSDXNYrqrJKQtQBdMuWm8StlPeWYF4Ko2Bskg+KbWml89K2cGYSZK6/KC7P4ZXqh4nGEVmcRKpX7Y9DWqs8aD1PqZ1k7vF3km+GPR6P5z+4AUr8bpDSIYtqAAAAAElFTkSuQmCC","orcid":"","institution":"Vallabhbhai Patel Chest Institute","correspondingAuthor":true,"prefix":"","firstName":"Malini","middleName":"","lastName":"Shariff","suffix":""},{"id":424134376,"identity":"f5bdf86d-3745-4c1a-b196-f2d13d47c938","order_by":2,"name":"Kalaivani Mani","email":"","orcid":"","institution":"All India Institute of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Kalaivani","middleName":"","lastName":"Mani","suffix":""}],"badges":[],"createdAt":"2025-02-19 08:23:32","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6062069/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6062069/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":78144761,"identity":"0ad5469a-a475-4a11-bc54-ff858e8ecd13","added_by":"auto","created_at":"2025-03-10 10:49:42","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":160702,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eBar diagram depicting pathogens isolated in different patients\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-6062069/v1/08736ab7a638b312b0d54502.png"},{"id":78146869,"identity":"d17471bb-22be-481a-a4b5-d5d2d6782867","added_by":"auto","created_at":"2025-03-10 11:05:42","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":187682,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eIdentification of \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eMycoplasma pneumoniae\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003eand \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eLegionella pneumophila\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e by multiplex PCR.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eLane 1- 100 bp ladder marker, lane - 3, 21, 24 shows p1 gene and mip gene product of \u003cem\u003eMycoplasma pneumoniae\u003c/em\u003e (543 bp) and \u003cem\u003eLegionella pneumophila\u003c/em\u003e (375 bp)\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-6062069/v1/be42cffa807bf1f384f91d4d.png"},{"id":78147885,"identity":"19d546c3-35cf-4e09-96e3-16731b343f09","added_by":"auto","created_at":"2025-03-10 11:21:43","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1502403,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6062069/v1/774a4a08-f7f7-4fcb-87cb-cf30011dac6e.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Identification of bacterial pathogens in patients with chronic obstructive pulmonary disease (COPD) with special reference to Mycoplasma pneumoniae, Chlamydia pneumoniae and Legionella pneumophila","fulltext":[{"header":"Introduction","content":"\u003cp\u003eChronic obstructive pulmonary disease (COPD) represents an important public health challenge and is a major cause of morbidity and mortality throughout the world.\u003c/p\u003e \u003cp\u003eCOPD is currently the 4th leading cause of death in the world [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e] but is projected to be the 3rd leading cause of death by 2020. COPD is often accompanied by acute exacerbations of COPD [AECOPD]), due to mainly increased inflammation. The etiology remains unclear in nearly 30% of AECOPD cases, whereas the remaining cases are due to a respiratory tract infection (50\u0026ndash;60%), or environmental factors (10%) [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. The role of microorganisms, especially bacteria, in the pathogenesis of COPD, has been well documented. About 70% of exacerbations are caused by infection due to aerobic bacteria, 30% due to viruses and 5\u0026ndash;10% by atypical bacteria [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. The term atypical pathogens\u0026lsquo;\u0026lsquo; refers to \u003cem\u003eMycoplasma pneumoniae (M. pneumoniae)\u003c/em\u003e, \u003cem\u003eChlamydia pneumoniae\u003c/em\u003e (\u003cem\u003eC. pneumoniae\u003c/em\u003e) and \u003cem\u003eLegionella pneumophila\u003c/em\u003e (\u003cem\u003eL.pneumophila\u003c/em\u003e). The role of these bacteria in AECOPD remains unclear. The isolation of atypical pathogens in culture is very demanding and the sensitivity is very low. Serological studies suggest that these atypical pathogens may play an important role in AECOPD [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. However, the interpretation of the role of these atypical pathogens in AECOPD is not easy, since these organisms are difficult to cultivate from respiratory tract specimens. Also, variability among authors exists in the reliability and interpretation of the results of serological assays. Molecular diagnostic techniques, such as PCR, have become useful tools for the aetiological diagnosis of lower respiratory tract infections [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. PCR can detect minute amounts of nucleic acids from potentially all PPMO (potential pathogenic microorganisms); it does not depend on the viability of the target microbe; it is probably less affected by previous antimicrobial therapy than culture-based methods and can provide results quickly. For patients with pneumonia, molecular techniques offer distinct advantages over conventional tests for the detection of atypical pathogens. [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Atypical bacteria play an important role in COPD patients and the active presence of these organisms in COPD patients helps in the progression to AECOPD. The isolation of atypical pathogens in culture is very demanding and the sensitivity is very low. However, with the availability of newer molecular diagnostic techniques such as PCR and Real-time PCR (RT-PCR), the sensitivity in detecting these pathogens has improved and can be tested simultaneously.\u003c/p\u003e \u003cp\u003eReports have shown the association between AECOPD and the presence of bacterial, atypical, or viral pathogens; in most cases, a single procedure has been used (serology, single detection with culture, or PCR), and studies with all these techniques are extremely scarce.\u003c/p\u003e \u003cp\u003eThe present prospective study was undertaken to determine the predominant bacterial pathogens with special reference to atypical pathogens in patients with COPD using all three detection approaches in combination (serology, culture, PCR).\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cp\u003e This is a prospective study cleared by the Institutional Human Ethics Committee. It follows the norms set by the Indian Council of Medical Research for National ethical guidelines for Biomedical and health research involving Human participants which is in line with the declaration of Helsinki. Written informed consent was taken from all patients. Confidentiality of data has been maintained and there are no conflicts of interest. 196 adult patients with COPD attending Viswanathan Chest Hospital were included in the study. Staging of COPD was done using GOLD criteria [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. Patients with exacerbations were also noted using the Anthonisen criteria [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Clinical details regarding coughing with or without production of sputum, dyspnea, history of smoking patient, risk factors for infection, exposure to antibiotics, fever, and history of prior hospitalization were assessed. Spirometry findings were also included for the staging of COPD and AECOPD. Subjects not willing to participate in the study were excluded. Clinical details regarding cough with or without sputum production, dyspnea, history of smoking patient, risk factors for infection, exposure to antibiotics, fever, and history of prior hospitalization were recorded.\u003c/p\u003e \u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eSample collection\u003c/h2\u003e \u003cp\u003eClinical samples such as sputum, nasopharyngeal swabs, throat swabs and urine, were collected from patients included in the study.10 ml of paired blood samples for serum were collected at the time of admission and 4 weeks later wherever possible. The specimens were subjected to appropriate laboratory investigations for bacterial pathogens including atypical bacterial pathogens (\u003cem\u003eMycoplasma, Legionella\u003c/em\u003e and \u003cem\u003eChlamydia\u003c/em\u003e).\u003c/p\u003e \u003cp\u003e \u003cstrong\u003eIsolation and identification\u003c/strong\u003e \u003c/p\u003e \u003cp\u003eThe clinical samples were processed by standard microbiological methods [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. However, for sputum and urine, a semiquantitative method was used. More than or equal to 10\u003csup\u003e5\u003c/sup\u003ecfu/ml for sputum and urine was considered significant. Sputum and other respiratory samples were inoculated onto blood agar and McConkey agar. Urine samples were inoculated on CLED (cysteine lactose electrolyte-deficient) agar and McConkey agar and significant bacterial growth was further identified using the standard techniques.\u003c/p\u003e \u003cp\u003eIn addition, Buffered charcoal yeast extract (BCYE) agar plates containing BMPA-ALPHA (Buffer, cefamandole, Polymyxin, Anisomycin alpha-ketoglutarate) selective supplement for isolation of \u003cem\u003eL. pneumophila\u003c/em\u003e, PPLO broth and PPLO agar for \u003cem\u003eM. pneumoniae\u003c/em\u003e were used. The inoculated media were incubated overnight at 37\u0026deg;C in ambient air. Blood agar plates and BCYE agar plates were incubated in 5% CO2. PPLO broth was incubated at 37\u0026deg;C under 5% CO2 for 4\u0026ndash;5 weeks. The colour change from slightly orange to yellow indicated the growth of \u003cem\u003eM. pneumoniae. Further\u003c/em\u003e confirmation was done by subculturing from PPLO broth to PPLO agar media and observing tiny yellowish-white fried egg colonies under the microscope. Diene's stain was also performed to confirm the growth of \u003cem\u003eM.pneumoniae\u003c/em\u003e colonies (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The isolates were identified with standard phenotypic tests and confirmed by VITEK (Biomereux). Gram-negative bacilli isolated on BCYE agar with no growth after subculturing on blood agar were identified as \u003cem\u003eL. pneumophila\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) and confirmed by biochemical tests and PCR\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eStorage of bacterial culture\u003c/h3\u003e\n\u003cp\u003eThe isolates were maintained in the laboratory as stab culture in Nutrient Agar and suspension in Nutrient Broth with 16% glycerol, kept at -80\u0026deg;C.\u003c/p\u003e\n\u003ch3\u003eSerology\u003c/h3\u003e\n\u003cp\u003eSerum IgG and IgM for atypical bacteria (\u003cem\u003eM.pneumoniae, C.pneumoniae, L.pneumophila\u003c/em\u003e) were detected by ELISA using the commercial kit NovaTec immunodiagnostic gmbh (NovaLisa). The criteria given by the manufacturer were used to label the samples as positive or negative. Briefly, the units (NTU) were calculated by taking the mean OD of the cut-off serum provided in the kit. More than 11 units were considered positive. Demonstration of seroconversion was defined as a change from a negative acute serum sample to a positive convalescent serum sample or a four-fold rise in antibody units between the paired sera. Wherever only acute serum was available then IgM titer of 4 times the NTU was considered positive. Similarly, high IgG levels (More than 2 times the cut-off OD in the acute sample and/or a 4-fold rise in the units in the convalescent serum whenever available were considered positive.\u003c/p\u003e\n\u003ch3\u003eDNA isolation from clinical samples\u003c/h3\u003e\n\u003cp\u003eDNA extraction was carried out following the QIAamp DNA blood extraction kit (Qiagen) following the manufacturer\u0026rsquo;s instructions. Briefly, after the sample preparation, the QIAGEN mini spin column was used for DNA extraction and DNA was eluted in a final volume of 55 \u0026micro;l, and stored at -20\u0026deg;C. In addition, 200 \u0026micro;l of culture-positive PPLO broth was used for the extraction of DNA for \u003cem\u003eM. pneumoniae\u003c/em\u003e\u003c/p\u003e \u003cp\u003e \u003cb\u003ePCR assay targeting\u003c/b\u003e \u003cb\u003eM. pneumoniae P1\u003c/b\u003e \u003cb\u003egene and\u003c/b\u003e \u003cb\u003eL. pneumophila mip\u003c/b\u003e \u003cb\u003egene\u003c/b\u003e\u003c/p\u003e \u003cp\u003eMultiplex PCR assay targeting the \u003cem\u003eM. pneumoniae P1\u003c/em\u003e gene and \u003cem\u003eL. pneumophila mip\u003c/em\u003e gene were carried out using the published protocols [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. Two sets of primers, each specific for the \u003cem\u003eP1 adhesin\u003c/em\u003e gene of \u003cem\u003eM. pneumoniae and the\u003c/em\u003e macrophage infectivity potentiator (\u003cem\u003emip\u003c/em\u003e) gene of \u003cem\u003eL. pneumophila\u003c/em\u003e were used. For \u003cem\u003eM. pneumoniae\u003c/em\u003e both forward primer CAAGCCAAACACGAGCTCCGGCC and reverse primer CCAGTGTCAGCTGTTTGTCCTTCCCC and for \u003cem\u003eL. pneumophila\u003c/em\u003e forward primer- GACAAGGATAAGTTGTCTTATAGC and reverse primer- ACGACCAG TGTATTCCACAG were used targeting 543 bp segment of \u003cem\u003eM. pneumoniae\u003c/em\u003e and 375 bp segment of \u003cem\u003eL. pneumophila\u003c/em\u003e, ) PCR standardization was done by using \u003cem\u003eM\u003c/em\u003e. \u003cem\u003epneumoniae\u003c/em\u003e ATCC 15531 strain and \u003cem\u003eL. pneumophila\u003c/em\u003e ATCC 33152 strain. The reaction mixture was prepared in a final volume of 25 \u0026micro;l containing 2.5 \u0026micro;l of 10x PCR buffer, 0.5\u0026micro;l of dNTPs, 0.5 \u0026micro;l of Taq polymerase, 2 \u0026micro;l of DNA sample, 1 \u0026micro;l of 5 pmol/\u0026micro;l of each forward and reverse primers of each gene and nuclease-free water to achieve desired final volume. The reaction was performed in a thermocycler (Biorad) under the following conditions. 94\u0026deg;C for 5 minutes, followed by 35 cycles of amplification each at 94\u0026deg;C for 1 minute of denaturation, 55\u0026deg;C for 1 minute of annealing and 72\u0026deg;C for 2 minutes of extension, and a final elongation step of 72\u0026deg;C for 10 minutes.\u003c/p\u003e \u003cp\u003e \u003cb\u003eReal-time PCR for identification of\u003c/b\u003e \u003cb\u003eM.pneumoniae, L.pneumophila and C. pneumoniae\u003c/b\u003e\u003c/p\u003e \u003cp\u003eDetection of \u003cem\u003eM. pneumoniae\u003c/em\u003e, \u003cem\u003eL. pneumophila, and C.pneumoniae\u003c/em\u003e from clinical samples and the positive culture was carried out by Multiplex PCR using FTD Atypical CAP kit [FTD Bacterial pneumonia CAP (RUO)] on a CFX96 (Biorad) thermocycler. The assay was performed according to the manufacturer's instructions.\u003c/p\u003e \u003cp\u003e \u003cb\u003eL. pneumophila\u003c/b\u003e \u003cb\u003eantigen detection in urine\u003c/b\u003e\u003c/p\u003e \u003cp\u003eUrinary antigen for \u003cem\u003eL.pneumophila\u003c/em\u003e was performed by using the Alere BinaxNOW \u003cem\u003eLegionella\u003c/em\u003e urinary antigen card (Alere BinaxNOW \u003cem\u003eLegionella\u003c/em\u003e) targeting serogroup Lp1 antigen. Briefly, all reagents, patient urine samples and card were allowed to equilibrate to room temperature before testing. An Alere swab was dipped into the urine specimen, completely covering the swab head. Then the swab was inserted into the bottom hole of the card (Two holes on the inner right panel of the card) and was firmly pushed upwards so that the swab tip was fully visible in the top hole.\u003c/p\u003e \u003cp\u003eThe reagent A, supplied in the kit, was held vertically (1/2 inch to 1 inch above the card) and 2 free-falling drops were slowly added to the bottom hole. Then the adhesive liner was immediately peeled off from the right edge of the test card, closed immediately and the result was taken within 15 minutes after closing the card. Sample positive for antigen gave two pink-purple-coloured bands whereas a negative sample gave only one band.\u003c/p\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eStatistical Analysis\u003c/h2\u003e \u003cp\u003eThe data was statistically analysed using Stata 12.0 (College Station, Texas, USA). Diagnostic accuracy of serology and PCR against culture was reported by calculating Sensitivity (95%CI), specificity (95%CI), positive predictive value (95% CI), negative predictive value (95%CI) and likelihood ratio of a positive test was (95%CI). Chi-square/Fisher exact test was used to test the association between severity of COPD and AECOPD with sex, AECOPD and Pathogens, AECOPD and atypical bacteria and AECOPD and comorbid conditions, atypical bacteria with the comorbid condition. The p-value less than 0.05 was considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eOne hundred and ninety-six patients with COPD admitted to Vishwanathan Chest Hospital were included in the study. Nasopharyngeal swabs, throat swabs, urine samples, and sputum samples were collected from all these patients. Two hundred and thirty-four serum samples were also collected.\u003c/p\u003e \u003cp\u003eThe Age of the Patients ranged from 35 to 80 years. One hundred forty-seven (75%) of the patients were males and 49 (25%) were females with most males being in the 51\u0026ndash;60 age group and females in the 61\u0026ndash;70 age group. No significant association was seen between the sexes and different stages of COPD and AECOPD. Out of a total of 196 COPD patients, 44 (22.4%) Mild, 38 (19.4%) Moderate, 78 (39.8%) severe and 36 (18.3) very severe were observed. All these patients showed varying degrees of exacerbation with 96 (48.9%), 55 (28.1%) and 42 (21.4%) in the mild, moderate and severe stages of AECOPD. 102/196 (52.04%) patients of COPD yielded organisms in culture of which 101 with varying degrees of exacerbations yielded pathogens. Acinetobacter 22(11.22%) was the most common followed by \u003cem\u003eM. pneumoniae\u003c/em\u003e 31(15.81%), \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e 28 (14.28%), \u003cem\u003eEscherichia coli\u003c/em\u003e 11(5.61%) and MRSA 10 (5.10%) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). In 32 patients more than one organism was isolated. Out of the 31 that were positive for \u003cem\u003eM. pneumoniae\u003c/em\u003e in culture 18 were isolated from Throat swab, 9 from nasopharyngeal swab and 4 from both.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eBacterial pathogens isolated from patients ( n\u0026thinsp;=\u0026thinsp;196)\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOrganisms\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTotal number (%) n\u0026thinsp;=\u0026thinsp;134\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGram-negative\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eAcinetobacter spp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e22 (11.22%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eCitrobacter freundi\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e2 (1.02%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eElizabeth kingae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1 (0.51%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEnterobacter spp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e3 (1.53%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEscherichia coli\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e11 (5.61%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e28 (14.28%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas aeruginosa\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e10 (5.10%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003ePseudomonas spp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6 (3.06%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eStenotrophomonas maltophilia\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1 (0.51%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMycoplasma pneumoniae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e31 (15.81%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eGram positive\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eEnterococcus spp\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1 (0.51%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMRSA\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e10 (5.10%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eStaphylococcus aureus\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e6 (3.06%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003estreptococcus pneumoniae\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c2\"\u003e \u003cp\u003e1 (0.51%)\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e\n\u003ch3\u003ePCR From Clinical samples\u003c/h3\u003e\n\u003cp\u003eA multiplex PCR for \u003cem\u003eM. pneumoniae\u003c/em\u003e and \u003cem\u003eL. pneumophila\u003c/em\u003e and Real-time PCR for \u003cem\u003eM. pneumoniae\u003c/em\u003e, \u003cem\u003eL. pneumophila, and C. pneumoniae\u003c/em\u003e were carried out on the DNA isolated from clinical samples. 11 and 22 were positive for \u003cem\u003eMycoplasma\u003c/em\u003e and \u003cem\u003eLegionella\u003c/em\u003e respectively in multiplex PCR. Among the total number of \u003cem\u003eM. pneumoniae\u003c/em\u003e isolates 11 isolates were positive by PCR. Out of these 3 were positive by RT-PCR only. None of the samples were positive for \u003cem\u003eL.pneumophila\u003c/em\u003e in culture whereas, 22 were positive in PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). Out of these 12 were positive by RT PCR only.\u003c/p\u003e \u003cp\u003eNone of the samples were positive for \u003cem\u003eChlamydia pneumoniae\u003c/em\u003e in RT- PCR\u003c/p\u003e \n\u003ch3\u003eSerology results\u003c/h3\u003e\n\u003cp\u003eOut of 196 patients, paired sera were available for only 38 patients, the rest were only single acute-phase sera. IgG and IgM were tested in all the samples including the paired samples. Forty-five samples were positive for \u003cem\u003eM. pneumoniae\u003c/em\u003e in serology. IgM was positive in 8 (4%) acute phase sera and 2 (5.3%) in convalescent sera. Out of these one was positive for both IgM and IgG. Two of these had seroconverted (More than 2-fold Units) for IgG. Forty patients were positive for IgG 5 of which seroconverted (4-fold rise). Three (3) of these patients showed both IgM and IgG antibodies.\u003c/p\u003e \u003cp\u003eFifteen were positive for \u003cem\u003eLegionella pneumonia-\u003c/em\u003especific IgM antibodies. None of the samples were positive for IgG in acute sera. However, 2/38 samples showed seroconversion. Hence, 17 (7.26%) samples were positive for \u003cem\u003eLegionella\u003c/em\u003e antibodies.\u003c/p\u003e \u003cp\u003eThirty-four out of 234 samples (14.5%) were positive for Chlamydia antibodies. Twenty-two were positive for \u003cem\u003eChlamydia pneumoniae\u003c/em\u003e specific IgM antibody, none seroconverted. Three acute samples were IgG positive (with a 2-fold rise) all of which showed a 4-fold rise in convalescent serum. Hence, 12 (15.30%) samples were positive for IgG \u003cem\u003eChlamydia\u003c/em\u003e antibodies.\u003c/p\u003e \u003cp\u003eSince culture is not a sensitive technique, we have adopted the \u003cb\u003eexpanded gold standard method\u003c/b\u003e [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e11\u003c/span\u003e] to calculate the sensitivity and specificity of PCR, culture and serology. According to this, all the culture-positive and /or both PCR and serology-positive were taken as Gold Standard positive and culture-negative and /or only serology-positive and PCR-negative and vice versa were taken as Gold Standard negative. So, 35 were positive for \u003cem\u003eM.pneumoniae\u003c/em\u003e and 161 were negative. Similarly, for \u003cem\u003eL.pneumophila\u003c/em\u003e, 2 were positive and 194 were negative (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e,\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSerology results of \u003cem\u003eMycoplasma pneumoniae\u003c/em\u003e and \u003cem\u003eLegionella pneumophila\u003c/em\u003e according to expanded gold standard\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMycoplasma pneumoniae\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGold standard positive\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;35)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGold standard negative\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;161)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSerology positive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e28\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSerology negative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e18\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e133\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLegionella pneumophila\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eGold standard positive\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(5)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eGold standard negative\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(191)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSerology positive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e12\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSerology negative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e179\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePCR results of \u003cem\u003eMycoplasma pneumoniae\u003c/em\u003e and \u003cem\u003eLegionella pneumophila\u003c/em\u003e according to expanded gold standard\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMycoplasma pneumoniae\u003c/em\u003e\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGold standard positive\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;35)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGold standard negative\u003c/p\u003e \u003cp\u003e(n\u0026thinsp;=\u0026thinsp;161)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR positive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e7\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR negative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e31\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e154\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cb\u003eLegionella pneumophila\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e\u003cb\u003eGold standard positive\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(5)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e\u003cb\u003eGold standard negative\u003c/b\u003e\u003c/p\u003e \u003cp\u003e\u003cb\u003e(191)\u003c/b\u003e\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR positive\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e17\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePCR negative\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e174\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eFor \u003cem\u003eM. pneumoniae according\u003c/em\u003e to the expanded gold standard, serology is 48.6% sensitive and 82.6% specific. Similarly, PCR was 11.4% sensitive and 95.7% Specific. The serology for Legionella was 100% sensitive and 93.7% specific. PCR showed a Sensitivity and specificity of 100% and 91.1% respectively. None of the samples were positive for Legionella urinary antigen.\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe present study included 196 COPD patients showing varying degrees of exacerbations. Only a quarter of the patients were females. Most of the patients had severe COPD (39.8%) with mild (49.7%) exacerbation. There were patients in all the exacerbated groups so comparison of data across the groups was possible. Among the 193 patients with exacerbation, bacterial aetiology could be identified in 101 (52.3%) patients. Similar findings were observed by Sapey \u0026amp; Stockley \u003cem\u003eet al\u003c/em\u003e., 2006 [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Thirty-two patients had infections with multiple pathogens. In the present study, Diabetes Mellitus (38), Hypertension (25), past Tuberculosis (21) and chronic smokers (112) were observed. All the patients had comorbid conditions; 98 with one, 27 with 2, 11 with 3 and 3 with all four comorbid conditions. These increase the chances of exacerbation in the patients [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eCommon organisms isolated in the present study were \u003cem\u003eAcinetobacter\u003c/em\u003e 22 (11.2%) followed by \u003cem\u003eM. pneumoniae\u003c/em\u003e 31(15.8%), \u003cem\u003eKlebsiella pneumoniae\u003c/em\u003e 28 (14.2%), \u003cem\u003eEscherichia coli\u003c/em\u003e 11(5.6%) and MRSA 10 (5.1%). In many studies, \u003cem\u003eHemophilus influenzae\u003c/em\u003e, \u003cem\u003eStreptococcus pneumoniae\u003c/em\u003e and \u003cem\u003eMoraxella\u003c/em\u003e were more commonly isolated [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. In the present study, 39.8% of the patients had severe COPD. These patients presenting with frequent exacerbations have repeated hospital admissions and a greater degree of colonization. A positive correlation was found between lower airway colonization and frequency of exacerbations [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In the present study, as many as 151 patients were hospitalised previously. Hence, the common hospital-acquired organism like \u003cem\u003eAcinetobacter\u003c/em\u003e was prevalent in the present study.\u003c/p\u003e \u003cp\u003eAmong the atypical pathogens, \u003cem\u003eMycoplasma\u003c/em\u003e was the most common. It was isolated in 35 (17.9%) of our patients. It agrees with many studies [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. However, a very low (3.9%) isolation was seen in a study by Chaudhry R \u003cem\u003eet al\u003c/em\u003e., 2017 where patients with community-acquired pneumonia were included. In the present study, \u003cem\u003eL. pneumophila\u003c/em\u003e was not isolated from any specimen. Similar findings were observed in a study by Chaudhry \u003cem\u003eet al\u003c/em\u003e., 2017[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. This could be due to empirical antibiotic treatment. The negative culture may also be due to the following reasons: A positive result usually appears within 3\u0026ndash;5 days, although 2 weeks may be required. Additional treatment of clinical samples may be necessary to reduce background flora that can inhibit the growth of \u003cem\u003eLegionella\u003c/em\u003e [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. The throat swab was observed to be a better sample than the Nasopharyngeal swab in isolation of \u003cem\u003eM. pneumoniae\u003c/em\u003e. This observation is concordant with other studies [19,20,21]. This could be because the Nasopharyngeal swabs cannot be manipulated much unlike the Throat swab and the clinical material in the NP may be inadequate.\u003c/p\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003ePCR from clinical samples\u003c/h2\u003e \u003cp\u003eOnly 11(5.6%) of our isolates were positive for \u003cem\u003eM. pneumoniae\u003c/em\u003e by PCR whereas 31 (15.81%) were Culture positive. The false negative results of the PCR can be explained by a bacterial load below the detection limit of the PCR, dilution of samples when added to the transport medium, or the presence of interfering DNA coming from Human cells or other colonizing microorganisms of the respiratory tract which could affect amplification. Legionella was detected in 22 cases by PCR. Real Time PCR detected \u003cem\u003eM. pneumoniae in\u003c/em\u003e three more samples, and Legionella in 12 more samples as compared to conventional PCR. It is well known that RT PCR is more sensitive than conventional PCR because it can even detect low copy numbers in clinical samples [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e22\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eSerology\u003c/h2\u003e \u003cp\u003eThe great advantage of serologic testing is that the positive serology of an infectious agent is proof of a patient's significant exposure to that pathogen. However, serology is not useful for the early diagnosis of \u003cem\u003eM. pneumoniae\u003c/em\u003e infection in adults. Adults may fail to develop IgM during an \u003cem\u003eM. pneumoniae\u003c/em\u003e infection [23] probably because of re-infection [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e26\u003c/span\u003e], or the IgM response may be delayed, not being detectable until 15 days after the onset of symptoms [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Thus, the absence of IgM in the first serum sample does not exclude a current infection. Also, high IgG titre without IgM can occur if there is re-infection. Therefore, a high IgG titer in an acute serum can be taken as a recent infection. Hence, we have used these samples as serology-positive.\u003c/p\u003e \u003cp\u003eIn the present study 19.89% of \u003cem\u003eM. pneumoniae\u003c/em\u003e, 17.3% of \u003cem\u003eC. pneumoniae\u003c/em\u003e and 8.67% of \u003cem\u003eL. pneumophila were\u003c/em\u003e positive by serology. These are lower than the results of Lieberman D \u003cem\u003eet al.\u003c/em\u003e, in 2001 where 240 paired samples were analysed. They observed \u003cem\u003eP. pneumoniae, C. pneumoniae\u003c/em\u003e and \u003cem\u003eLegionella spp.\u003c/em\u003e in 14%, 34% and 17%, of patients respectively. The variation in the result may be because of the low sample size, only 38 paired samples, from the 196 patients were available.[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e14\u003c/span\u003e]\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eSensitivity and specificity of the tests\u003c/h2\u003e \u003cp\u003eCulture especially of \u003cem\u003eM. pneumoniae\u003c/em\u003e is time-consuming because it takes 2\u0026ndash;5 weeks for the colonies to be visible and relatively insensitive. Serology depends on the time of collection of the sample from disease onset and the availability of paired serum. In adults, IgM may not be produced and directly IgG may be formed in early infection due to reinfection. Hence, difficult to interpret. Nucleic acid amplification techniques produce rapid, specific and sensitive results. But due to increased sensitivity false positive results may occur. In the absence of a good reference gold standard method, an expanded gold standard method where more tests can be used to determine the Gold standard can be used [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. With the expanded gold standards, more isolates were included in the positive group. \u003cem\u003eMycoplasma\u003c/em\u003e serology was 48.6% sensitive and 82.6% specific. The positive predictive value was only 36%. In \u003cem\u003eL. pneumophila\u003c/em\u003e since they were all culture-negative, the serology was 100% sensitive and 93.7% specific\u003c/p\u003e \u003cp\u003e \u003cb\u003eComparisons of various tests\u003c/b\u003e: Thirty-one patients were positive for \u003cem\u003eMycoplasma pneumoniae\u003c/em\u003e in culture, 45 by serology and 11 by PCR. As compared to culture, low rates of positivity of PCR could be due to false-negative PCR results. The presence of inhibitors and a low bacterial load resulting from previous antimicrobial treatment or dilution of the sample below the limit of detection could explain the negative PCR results. Serology was positive in 45 cases, 14 more than culture. Out of these 37 cases had IgG antibodies, due to a past infection which could explain the culture negativity in these cases. However, 15 of these cases were positive in culture. This could be because of various reasons: 1. New infection but persistence of IgG antibodies from a previous infection which is insufficient to inhibit the current infection. 2. Alternatively, these cases may represent an asymptomatic carriage of \u003cem\u003eM. pneumoniae\u003c/em\u003e due to the persistence of a previous disease [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. 3. Seroconversion is fast enough in these cases where the culture is still positive.\u003c/p\u003e \u003cp\u003eCulture detected 31 cases, and with the addition of serology, 25 more cases were added, taking the number to 56. Similarly, when PCR was included with culture 10 extra cases were detected taking the total number to 41. Three cases were detected using PCR and serology. Therefore, \u003cem\u003eMycoplasma\u003c/em\u003e was detected in 62 cases instead of 31, 45 and 11 cases by Culture, serology and PCR respectively. So, a combination of tests improves the sensitivity of \u003cem\u003eMycoplasma\u003c/em\u003e detection.\u003c/p\u003e \u003cp\u003eSeventeen patients were positive for \u003cem\u003eLegionella\u003c/em\u003e antibodies, of which 5 were positive by both PCR and serology. Individually, twenty-two cases were detected by PCR and 17 by serology. Hence a total of 39 cases were positive for Legionella when the two tests were combined.\u003c/p\u003e \u003cp\u003e \u003cb\u003eDetection of\u003c/b\u003e \u003cb\u003eLegionella\u003c/b\u003e \u003cb\u003eAntigen in urine\u003c/b\u003e\u003c/p\u003e \u003cp\u003eDetection of soluble antigens in urine provides rapid qualitative detection of \u003cem\u003eLegionella\u003c/em\u003e infections.\u003c/p\u003e \u003cp\u003eThe captured antibody used in these assays is specific for Lp1. Hence, non-Lp1 strains can give negative results [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. \u003cem\u003eLegionella serotype\u003c/em\u003e 1 is the most common type prevalent all over the world. However, serotypes 1\u0026ndash;15 have been isolated from environmental samples in India [31]. Also concentrating the urine sample may improve the sensitivity of antigen detection. Prolonged storage of specimens may hamper the test performance due to degradation of \u003cem\u003eLegionella\u003c/em\u003e urinary antigen. In the present study, \u003cem\u003eLegionella\u003c/em\u003e antigen was absent in all 196 samples. Any of the above reasons may have led to this result.\u003c/p\u003e \u003cp\u003eIt is commonly accepted that atypical bacteria cause 5\u0026ndash;10% of AECOPD, either as independent pathogens or, more frequently, as co-pathogens However, in several serological studies, much higher proportions of exacerbated patients had evidence of a recent infection with \u003cem\u003eC. pneumoniae, M. pneumoniae\u003c/em\u003e or \u003cem\u003eLegionella spp\u003c/em\u003e. \u0026ndash;up to 34%, 14% and 17%, respectively [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. By performing Culture, PCR and serology for different samples from the patients 80 (41%), 39 (20%) and 30 (15%) samples were found positive for \u003cem\u003eM. pneumoniae\u003c/em\u003e, 39 \u003cem\u003eL. pneumophila\u003c/em\u003e and \u003cem\u003eC. pneumoniae\u003c/em\u003e respectively in AECOPD cases.\u003c/p\u003e \u003cp\u003eMultiple pathogens were seen in 32 patients. This could be because of an impaired innate lung defence mechanism and hence the organisms may be colonized in the lower airway system [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. In the present study, a single patient was infected with all three atypical organisms The patient was a sixty-one-year-old male with h/o smoking, very severe COPD and moderate AECOPD, had multiple pathogens ( Klebsiella and E.coli), sputum yielded \u003cem\u003eMycoplasma\u003c/em\u003e, \u003cem\u003eLegionella\u003c/em\u003e was positive in PCR. IgM antibodies to \u003cem\u003eLegionella\u003c/em\u003e and \u003cem\u003eChlamydia\u003c/em\u003e and IgG antibodies to \u003cem\u003eMycoplasma\u003c/em\u003e in the second sample were present. No other co-morbidities were seen. In 6 cases \u003cem\u003eMycoplasma\u003c/em\u003e with \u003cem\u003eChlamydia\u003c/em\u003e were present. Out of these 6 cases showed co-morbidities. Among these, one each of hypertension and chronic smoking were observed and in 3 cases only a history of chronic smoking was observed. All cases had a history of previous hospitalization. In 3 cases no comorbidity was seen. Legionella and Chlamydia were found in one case, 62 Yr old with h/o of previous hospitalization with moderate COPD and exacerbation and had IgM antibodies to both organisms.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eAECOPD staging and isolation of Pathogens\u003c/h2\u003e \u003cp\u003eIt is expected that patients in severe stages of exacerbation will show higher isolation rates of Pathogens. In the present study, the presence of pathogens, specifically atypical bacteria, did not correlate with the staging of AECOPD. The results were not statistically significant. The results were concordant with other studies [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e14\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. This could be because the lungs of severe patients are compromised and are more sensitive to non-infectious agents such as air pollutants and heart failure and show exacerbated symptoms more quickly. However, the variety of potentially pathogenic bacteria and frequency of mixed infection is higher in severe patients when compared to those with mild and moderate exacerbations [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Similarly, there was no statistically significant correlation between staging and \u003cem\u003eM. pneumoniae.\u003c/em\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eLacunae of the study\u003c/h2\u003e \u003cp\u003eIn the present study patients with different stages of COPD were included and compared. No controls were included in the study which could have given an idea of whether identified bacteria were pathogens or commensals. Viruses and Fungi were not tested. They could have caused exacerbation. Paired serum samples were available in only 38 patients. This could have affected the sensitivity of serology.\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eNo one method is suitable for the detection of atypical bacteria. Hence, to increase the sensitivity a combination of tests is required. Bacterial pathogens including atypical bacteria were found in 60.10% of cases. Since 30.56% were atypical bacteria, the antibiotic regimen recommended for AECOPD should include an antibiotic directed at atypical bacteria.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical Approval:\u003c/strong\u003e Institutional ethical approval was taken for the study Ref: VPCI/DIR/Protocol/2017 by the Institutional Human Ethics Committee.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication:\u003c/strong\u003e Not applicable\u003c/p\u003e\n\u003cp\u003eData Availability: The datasets generated during and/or analyzed during the current study are available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest:\u003c/strong\u003e The authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e The study was not funded by any source.\u003c/p\u003e\n\u003cp\u003eAuthor Contribution:\u003c/p\u003e\n\u003cp\u003eTS: Recruited the patients, collected samples, performed the experiments, tabulated the results, and wrote the first draft of the manuscript. \u003c/p\u003e\n\u003cp\u003eMS: Conceptualized the study, validated the results, reviewed the manuscript and corresponded with the journal.\u003c/p\u003e\n\u003cp\u003eKM: Statistical analysis\u003c/p\u003e\n\u003cp\u003eAll authors reviewed the manuscript\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eWorld Health Organization. Global Surveillance, Prevention and Control of Chronic Respiratory Diseases: A Comprehensive Approach. Geneva, Switzerland: World Health Organization; 2007.\u003c/li\u003e\n\u003cli\u003eSethi S. Infectious etiology of acute exacerbations of chronic bronchitis. \u003cem\u003eChest \u003c/em\u003e2000; \u003cstrong\u003e117\u003c/strong\u003e:380.\u003c/li\u003e\n\u003cli\u003eSethi S, Wrona C, Eschberger K, Lobbins P, Cai X, Murphy TF. Inflammatory profile of new bacterial strain exacerbations of chronic obstructive pulmonary disease. \u003cem\u003eAm J Respir Crit Care Med \u003c/em\u003e2008; \u003cstrong\u003e177\u003c/strong\u003e:491-97.\u003c/li\u003e\n\u003cli\u003eMurdoch DR. Molecular genetic methods in the diagnosis of lower respiratory tract infections. APMIS 2004; \u003cstrong\u003e112\u003c/strong\u003e: 713\u0026ndash;727.\u003c/li\u003e\n\u003cli\u003eGlobal initiative for chronic obstructive lung disease ( GOLD) 2018.\u003c/li\u003e\n\u003cli\u003eAnthonisen NR, Manfreda J, Warren CP, Hershfield ES, Harding GK and Nelson NA. Antibiotic therapy in exacerbations of pulmonary disease. Chronic Ann Intern Med 1987;106:196\u0026ndash;204. \u003c/li\u003e\n\u003cli\u003eForbes BA, Sham DF, Weissfeld AS (ed.), bailey \u0026amp; Scott\u0026lsquo;s Diagnostic Microbiology, 12th ed. Mosby Inc 2007; 187-214.\u003c/li\u003e\n\u003cli\u003eWilliamson J, Marmion BP, Worswick DA, Kok TW, Tannock G, Herd R, Harris RJ, 1992. Laboratory diagnosis of \u003cem\u003eMycoplasma pneumoniae \u003c/em\u003einfection. 4. Antigen capture and PCR-gene amplification for detection of the \u003cem\u003eMycoplasma\u003c/em\u003e: problems of clinical correlation. \u003cem\u003eEpidemiol Infect \u003c/em\u003e1992; \u003cstrong\u003e109\u003c/strong\u003e\u003cem\u003e: \u003c/em\u003e519\u0026ndash;537.\u003c/li\u003e\n\u003cli\u003eWelti M, Jaton K, Altwegg M, Sahli R, Wenger A, Bille J, .Development of a multiplex real-time quantitative PCR assay to detect \u003cem\u003eChlamydia pneumoniae, \u003c/em\u003e\u003cem\u003eLegionella pneumophila \u003c/em\u003eand \u003cem\u003eMycoplasma pneumoniae \u003c/em\u003ein respiratory tract secretions. \u003cem\u003eDiagn Microbiol Infect Dis \u003c/em\u003e2003; \u003cstrong\u003e45\u003c/strong\u003e\u003cem\u003e: \u003c/em\u003e85\u0026ndash;95.\u003c/li\u003e\n\u003cli\u003eLoens K, Ursi D, Goossens H, \u0026amp; Ieven M. Molecular diagnosis of \u003cem\u003eMycoplasma \u003c/em\u003e\u003cem\u003epneumoniae \u003c/em\u003erespiratory tract infections. \u003cem\u003eJ Clin Microbiol \u003c/em\u003e2003; \u003cstrong\u003e41\u003c/strong\u003e: 4915\u0026ndash;4923.\u003c/li\u003e\n\u003cli\u003eTjhie J H, Gnarpe J, Gnarpe H, Larsson P G, Platz-Christensen J J, Ostergaard L, Victor A, Expanded gold standard in the diagnosis of Chlamydia trachomatis in a low prevalence population: diagnostic efficacy of tissue culture, direct immunofluorescence, enzyme immunoassay, PCR and serology \u003cem\u003eGenitourin \u003c/em\u003e\u003cem\u003eMed \u003c/em\u003e1994; \u003cstrong\u003e70\u003c/strong\u003e:300-303. \u003c/li\u003e\n\u003cli\u003eSapey E, Stockley RA. COPD exacerbations . 2: aetiology. Thorax. 2006 Mar;61(3):250-8. doi: 10.1136/thx.2005.041822. PMID: 16517585; PMCID: PMC2080749.\u003c/li\u003e\n\u003cli\u003eDorigo-Zetsma J W, Zaat SAJ, Wertheim-van Dillen PME, Spanjaard L, Rijntjens J, van Waveren G, Jensen JS, Angulo AF, and Dankert J. Comparison of PCR, culture, and serological tests for diagnosis of \u003cem\u003eMycoplasma pneumoniae \u003c/em\u003erespiratory tract infection in children. \u003cem\u003eJ. Clin. Microbiol. \u003c/em\u003e1999; \u003cstrong\u003e37:\u003c/strong\u003e14-17.\u003c/li\u003e\n\u003cli\u003eLieberman D, Lieberman D, Ben-Yaakov M, Lazarovich Z, Hoffman S, Ohana B, Friedman MG, Dvoskin B, Leinonen M, Boldur I. Infectious etiologies in acute exacerbation of COPD. Diagn Microbiol Infect Dis. 2001 Jul;40(3):95-102. doi: 10.1016/s0732-8893(01)00255-3. PMID: 11502375.\u003c/li\u003e\n\u003cli\u003eAydemir Y, Kalem F. Relationship between the GOLD combined COPD assessment staging system and bacterial isolation 2014; \u003cstrong\u003e9(1)\u003c/strong\u003e: 1045\u0026mdash;1051.\u003c/li\u003e\n\u003cli\u003eLieberman D, Lieberman D, Ben-Yaakov M, Shmarkov O, Gelfer Y, Varshavsky R, \u003cem\u003eet al\u003c/em\u003e. Serological evidence of Mycoplasma pneumoniae infection in acute exacerbation of COPD. \u003cem\u003eDiagn Microbiol Infect Dis\u003c/em\u003e. 2002; \u003cstrong\u003e44\u003c/strong\u003e\u003cstrong\u003e:\u003c/strong\u003e1\u0026ndash;6\u003c/li\u003e\n\u003cli\u003eChaudhry R, Valavane A, Sreenath K, Choudhary M, Sagar T, Shende T, Varma-Basil M, Mohanty S, Kabra SK, Dey AB, Thakur B. Detection of \u003cem\u003eMycoplasma pneumoniae\u003c/em\u003e and \u003cem\u003eLegionella pneumophila\u003c/em\u003e in Patients Having Community-Acquired Pneumonia: A Multicentric Study from New Delhi, India. Am J Trop Med Hyg. 2017 Dec;97(6):1710-1716. doi: 10.4269/ajtmh.17-0249. Epub 2017 Sep 21. PMID: 29016299; PMCID: PMC5805046.\u003c/li\u003e\n\u003cli\u003ePierre DM, Baron J, LY Victor, ES Janet Diagnostic testing for Legionnaires\u0026lsquo; disease Pierre et al. Ann Clin Microbiol Antimicrob 2017; 16:59.\u003c/li\u003e\n\u003cli\u003eRamirez, J. A., Ahkee, S., Tolentino, A., Miller, R. D. \u0026amp; Summersgill, J. T.Diagnosis of Legionella pneumophila, Mycoplasma pneumoniae or Chlamydia References 66 pneumoniae lower respiratory infection using the polymerase chain reaction on a single throat swab specimen. Diagn Microbiol Infect Dis 1996; 24: 7\u0026ndash;14\u003c/li\u003e\n\u003cli\u003eGnarpe JA. Lunb\u0026auml;ck H, Gnarpe and Sundel\u0026ouml;f B. Comparison of nasopharyngeal and throat swabs for the detection of Chlamydia pneumoniae and Mycoplasma pneumoniae by polymerase chain reaction. Scand J Infect Dis Suppl. 1997; 104:11-12\u003c/li\u003e\n\u003cli\u003eHonda J T, Yano M, Kusaba J, Yonemitsu H, Kitajima M, Masuoka K, Hamada, and Oizumi K. Clinical use of capillary PCR to diagnose Mycoplasma pneumoniae. J Clin Microbiol. 2000; 38:1382-1384\u003c/li\u003e\n\u003cli\u003eGullsby K, Storm M, Bondeson K. Simultaneous detection of Chlamydophila pneumoniae and Mycoplasma pneumoniae by use of molecular beacons in a duplex real-time PCR. J Clin Microbiol 2008; 46: 727\u0026ndash;731\u003c/li\u003e\n\u003cli\u003eMart\u0026iacute;nez TMA, Pino PY, Salazar BT, Jover LE, Caroca CC, Espinoza NMA \u0026amp; Avenda\u0026ntilde;o CLF. Diagnostic utility of the polymerase chain reaction for the diagnosis of Mycoplasma pneumoniae in elderly patients with communityacquired pneumonia. Rev Chilena Infectol 2005; 22:251\u0026ndash;256.\u003c/li\u003e\n\u003cli\u003eSillis, M.The limitation of IgM assays in the serological diagnosis of Mycoplasma pneumoniae infections. J Med Microbiol 1990 ;33: 253\u0026ndash; 258\u003c/li\u003e\n\u003cli\u003eUldum SA, Jensen J S, S\u0026oslash;nderg\u0026aring;rd-Andersen J \u0026amp; Lind K. Enzyme immunoassay for detection of immunoglobulin IgM and IgG antibodies to Mycoplasma pneumoniae. J Clin Microbiol 1992; 30: 1198\u0026ndash;1204.\u003c/li\u003e\n\u003cli\u003eJacobs E, Bennewitz A, and Bredt W. Reaction pattern of human anti- Mycoplasma pneumoniae antibodies in enzyme-linked immunosorbent assays and immunoblotting. J Clin Microbiol 1986; 23: 517\u0026ndash;522\u003c/li\u003e\n\u003cli\u003eMoule JH, Caul EO, \u0026amp; Wreghitt TG. The specific IgM response to Mycoplasma pneumoniae infection: interpretation and application to early diagnosis. Epidemiol Infect 1987; 99: 685\u0026ndash;692\u003c/li\u003e\n\u003cli\u003eDaxboeck F, Krause R, and Wenisch C. Laboratory diagnosis of Mycoplasma pneumoniae infection. Clin Microbiol Infect 2003; 9:263\u0026ndash; 273\u003c/li\u003e\n\u003cli\u003eCunha BA, Burillo A, Bouza E. Legionnaires\u0026apos; disease. Lancet 2016; 387:376-85.\u003c/li\u003e\n\u003cli\u003eShimada T, Noguchi Y, Jackson JL, Miyashita J, Hayashino Y, Kamiya T, et al. Systematic review and meta-analysis: Urinary antigen tests for Legionellosis. Chest 2009;136:1576-85\u003c/li\u003e\n\u003cli\u003eJinna S, Gaikwad UN. Environmental surveillance of \u003cem\u003eLegionella pneumophila\u003c/em\u003e in distal water supplies of a hospital for early identification \u0026amp; prevention of hospital-acquired legionellosis. Indian J Med Res. 2018 Jun;147(6):611-614. doi: 10.4103/ijmr.IJMR_527_17. PMID: 30168494; PMCID: PMC6118141.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Chronic obstructive disease, Atypical bacteria, Mycoplasma pneumoniae, Legionella pneumophila, Chlamydia pneumoniae","lastPublishedDoi":"10.21203/rs.3.rs-6062069/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6062069/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eChronic obstructive pulmonary disease (COPD) is a major cause of morbidity and mortality throughout the world. COPD is often accompanied by acute exacerbations [AECOPD] where 70% of it is caused by aerobic bacteria, 30% due to viruses and 5-10 % by atypical bacteria,most commonly \u003cem\u003eMycoplasma pneumoniae\u003c/em\u003e (\u003cem\u003eM. pneumoniae\u003c/em\u003e), \u003cem\u003eChlamydia pneumoniae \u003c/em\u003e(\u003cem\u003eC. pneumoniae\u003c/em\u003e)\u003cem\u003e \u003c/em\u003eand \u003cem\u003eLegionella pneumophila\u003c/em\u003e (\u003cem\u003eL.pneumophila\u003c/em\u003e). Isolation and identification of these atypical microorganisms are challenging. However, the sensitivity in detecting these pathogens has improved with the availability of newer molecular diagnostic techniques.\u003c/p\u003e\n\u003cp\u003eThe present prospective study was undertaken to determine the predominant bacterial pathogens with special reference to atypical pathogens in patients with COPD using all three detection approaches in combination (serology, culture, PCR and RT-PCR).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethodology\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOne hundred and ninety-six hospitalized patients, categorized into different stages of COPD and AECOPD using GOLD and Anthonisen criteria, were included in the study. Clinical samples such as throat swabs, nasopharyngeal swabs, sputum, urine and 10 ml of both acute and convalescent serum were collected. Isolation and identification of bacteria were done using standard methods. Atypical bacteria were identified by using phenotypic molecular methods. Antibody levels were detected in the serum using commercially available kits.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOut of 196 patients, \u0026nbsp;39.8% patients were in the severe stage of COPD and 49.7% showed mild exacerbations. 102/196 (52.04%) patients of COPD yielded organisms in culture, of which 101 had exacerbations of varying degrees. None of the samples were positive for \u003cem\u003eL.pneumophila\u003c/em\u003e in culture. PCR was found to be positive in 11 and 22 numbers for \u003cem\u003eM. pneumoniae\u003c/em\u003e and \u003cem\u003eL.pneumophila \u003c/em\u003erespectively. Serology was positive in 19.89 % of \u003cem\u003eM. pneumoniae\u003c/em\u003e, 17.3 % of \u003cem\u003eC. pneumoniae\u003c/em\u003e and 8.67 % of \u003cem\u003eL. pneumophila\u003c/em\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present study found bacterial pathogens, including atypical bacteria, in 60.10 % of cases. 30.6% were atypical bacteria. Hence, the antibiotic regimen recommended for AECOPD should include an antibiotic directed at atypical bacteria. No one method is suitable for the detection of atypical bacteria. Therefore, atypical pathogens should be diagnosed using a combination of tests for better sensitivity.\u003c/p\u003e","manuscriptTitle":"Identification of bacterial pathogens in patients with chronic obstructive pulmonary disease (COPD) with special reference to Mycoplasma pneumoniae, Chlamydia pneumoniae and Legionella pneumophila","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-03-10 10:49:38","doi":"10.21203/rs.3.rs-6062069/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b46d79b7-14f2-4700-9c3d-4cdcb171a567","owner":[],"postedDate":"March 10th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-03-27T16:23:10+00:00","versionOfRecord":[],"versionCreatedAt":"2025-03-10 10:49:38","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6062069","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6062069","identity":"rs-6062069","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.