LEF1 Gene Mutation Impairs Intestinal Barrier and Causes Diarrhea | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article LEF1 Gene Mutation Impairs Intestinal Barrier and Causes Diarrhea Jianan Jie, Mengling Qiu, Xing Liu, Qingqing Zhang, Jing Xie, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8469007/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 9 You are reading this latest preprint version Abstract Through investigating pediatric intractable chronic diarrhea, we identified a de novo, unreported heterozygous missense mutation in LEF1 (c.880C > T, p.Pro294Ser) via whole-exome sequencing in a 1.5-year-old boy with 4-year persistent yellow-green watery diarrhea, complicated by protein-energy malnutrition and growth retardation refractory to conventional therapies. Gastrointestinal endoscopy revealed mucosal swelling with mild chronic inflammation, and the variant was absent from public databases. Functional validation using Lef1 P292S (human P294S ortholog) knock-in mice demonstrated increased DSS-induced diarrhea susceptibility, inherent intestinal structural defects, and compromised barrier integrity. Molecular and proteomic analyses confirmed downregulated tight junction protein and aquaporin 4 in mutant mice and patient tissues, alongside dysregulated ion transport, epithelial adhesion, and inflammatory pathways. Mechanistically, the conserved regulatory domain-localized LEF1 P294S mutation disrupts Wnt/β-catenin transcriptional regulation, impairing intestinal barrier function and water-electrolyte balance. Our study establishes LEF1 P294S as a pathogenic variant for pediatric chronic diarrhea, expands LEF1’s role in intestinal homeostasis, and provides a novel diagnostic marker and therapeutic target. LEF1 Intestinal Barrier Diarrhea Mutation Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 1. Introduction Diarrhea ranks among the top ten causes of death in children worldwide, with etiologies encompassing infections, immune dysfunction, genetic defects, and environmental factors [ 1 ]. In 2021, diarrheal diseases accounted for 59 million Disability-Adjusted Life-Years (DALYs) globally, of which 30.9 million (52.4%) affected children under 5 years of age [ 2 , 3 ], imposing a substantial public health burden on the pediatric population. Monogenic variants have emerged as a crucial determinant of intractable diarrhea in children, with five major pathogenic mechanisms linked to over 40 genetic etiologies [ 4 – 6 ]: Electrolyte Channel Dysfunction (e.g., SLC26A3 [ 7 ]), Epithelial Polarity and Interferon Pathway Abnormalities (e.g., MYO5B, TTC7A [ 8 , 9 ]), Defects in Epithelial Cell Proliferation and Differentiation (e.g., WNT2B [ 10 ]), Epidermal Barrier and Metabolic Pathway Mutations (e.g., SI), and Abnormal Mucosal Immunity and Inflammation Regulation (e.g., FOXP3 [ 11 ]). Notably, intestinal barrier dysfunction represents the most severe pathogenic mechanism underlying congenital diarrhea, as it directly compromises the physical and functional integrity of the intestinal epithelium. This leads to uncontrolled translocation of luminal antigens and persistent intestinal inflammation, often resulting in severe malnutrition and life-threatening complications refractory to conventional therapies [ 12 , 13 ]. The Wnt/β-catenin signaling pathway plays a pivotal role in embryonic development, intestinal homeostasis, and regulation of epithelial cell proliferation and differentiation [ 14 ]. Lymphoid enhancer-binding factor 1 (LEF1), a key transcription factor in this pathway, is critical for preserving intestinal epithelial barrier integrity and water-electrolyte balance. Mutations in LEF1 may disrupt these processes by interfering with the expression of downstream tight junction proteins (e.g., occludin, claudin family) and aquaporins (e.g., AQP4), ultimately contributing to chronic or intractable diarrhea [ 15 , 16 ]. High-frequency LEF1 mutations drive the tumorigenesis and progression of human colorectal cancer [ 17 , 18 ]: mutations at NLK-binding phosphorylation sites (Thr155/Ser166) of LEF1 cause aberrant Wnt pathway hyperactivation [ 19 ], while an N-terminal truncation mutation abolishes its β-catenin binding capacity [ 20 ]. A heterozygous missense mutation (c.337G > A, p.G113R) in LEF1 has been identified in colorectal cancer, though its oncogenic function remains elusive [ 21 ]. These findings highlaght the critical role of LEF1 mutations in the precise regulation of the Wnt/β-catenin pathway and associated disease pathogenesis. In this study, we focus on the a specific LEF1 mutation, c.880C > T (p.Pro294Ser), and establish a novel causal link between this variant and intractable diarrhea. Mechanistically, the LEF1 P294S mutation significantly impaired intestinal barrier function. Our findings address a gap in LEF1 research regarding intestinal barrier regulation and expand the etiological spectrum of pediatric chronic diarrhea. 2. Materials and Methods 2.1. Reagents and Antibodies Antibodies against ZO-1 (21773-1-AP, 1:2000), occludin (27260-1-AP, 1:1000), N-cadherin (22018-1-AP, 1:1000), E-cadherin (20874-1-AP, 1:1000), AQP4 (20874-1-AP, 1:1000), and GAPDH (60004-1-Ig, 1:1000) were purchased from Proteintech (IL, USA). Anti-claudin-1 (A21971, 1:2,000) was obtained from Abclonal (Hubei, China). Phenyl Methane Sulfonyl Fluoride (PMSF, P0100) and Protease Inhibitor Cocktail (PIC, P6730) were acquired from Solarbio (Beijing, China). OB-Test Paper (BA2020B) was obtained from BASO (Guangdong, China). Dulbecco's Phosphate-Buffered Saline (DPBS, 14040117) and EDTA (0.5 M, AM9260G) were provided by Thermofisher (MA, USA). Dextran Sulfate Sodium Salt (DSS, MP − 0216011010) was obtained from MP Biomedicals CA, USA). FITC-Dextran (MW 10000, 0.6mg/g) was supplied by MedChemExpress (NJ, USA). 2.2. Clinical Data and Colonic Tissue Samples Colon tissue samples were obtained from endoscopy biopsy of a healthy volunteer and the diarrhea-afflicted patient, provided by the Department of Gastroenterology of Guangzhou Medical University Affiliated Women and Children's Medical Center. The study protocol was approved by the institutional ethics committee, and informed consent was obtained from the patient’s guardians. 2.3. Mouse Model We make Lef1-p.P292S knockin mice via CRISPR-Cas9 system. Firstly, gRNA-targeting the near sequence of inserted site constructed and transcribed in vitro. And the donor vector with the inserted fragment was designed and constructed in vitro. Then CRISPR- Cas9 system and donor will be co-injected into zygotes. Thereafter, the zygotes were transferred into the oviduct of pseudopregnant ICR females at 0.5 dpc. And F0 mice was birthed after 19 ~ 21 days of transplantation, all the offsprings (F0 mice) were identified by PCR and sequencing of tail DNA. Finally, crossing positive F0 mice with wildtype mouse to build up heterozygous mice. C57BL/6JGpt mice were used as the wild-type (WT), while B6/JGpt-Lef1em1Cin(p.P292S)/Gpt mice served as the mutant (MUT). Specific pathogen-free (SPF) mice were housed at 23 ± 2°C, 55 ± 5% humidity, and a 12-hour light/dark cycle. All animals were maintained in the SPF facilities of Guangzhou Medical University Affiliated Women and Children's Medical Center, and all experiments followed the guidelines approved by the Institutional Animal Experiment Committee of this center. 2.4. DSS-induced Colitis The acute DSS colitis model was established as previously described [ 22 ]. 8-week-old male WT and MUT mice were randomized into groups and weighed on day 1 (WT H2O ;MUT H2O ; WT DSS ; MUT DSS ; n = 4; one of MUT DSS died on the 7th day of modeling). Mice in the treatment group received drinking water containing 2.5% DSS, while the control group received sterile water. Body weight loss, fecal consistency, and intestinal bleeding were monitored daily. All mice were euthanized on day 8, and intestinal tissues were collected. Intestinal barrier damage was assessed using the Quantitative-Mucosal Algorithmic Rules for Scoring Histology (Q-MARSH) system by two independent observers. Villus height (Vh) and crypt depth (Cd) were quantified, with a normal Vh:Cd ratio ≥ 3.0 [ 23 ]. Diarrhea severity was scored based on fecal consistency (Table 1 ). Table 1 Stool consistency Scoring Criteria Score Stool consistency 0 Formed 1 Soft but formed 2 Soft 3 Very soft; moist 4 Watery diarrhea 2.5. Isolation of Intestinal Epithelial Cells (IECs) Colonic tissues were rapidly excised, placed in ice-cold DPBS supplemented with 1% penicillin-streptomycin (P/S), and trimmed of mesenteric fat. Tissues were cut into 0.5–1 cm fragments, rinsed 3–5 times with ice-cold DPBS, and resuspended in EDTA-containing dissociation buffer for incubation at 37°C with shaking for 30 min. The cell suspension was filtered through a 70 µm strainer and centrifuged. The cell pellet was resuspended in 30% Percoll solution, overlaid onto 70% Percoll, and subjected to density-gradient centrifugation. IECs at the 30%–70% Percoll interface were collected and either used immediately for downstream experiments or stored in liquid nitrogen. 2.6. RNA Extraction, Complementary DNA (cDNA) Preparation and Real-Time Reverse Transcription-polymerase Chain Reaction (qRT-PCR) Total RNA was isolated from IECs colon of mice using Universal RNA Purification Kit (EZB - RN4). Total RNA was eluted with elution solution. For reverse transcription, 1 µg RNA was used: 2 µl DNA removal reagent was added to the extracted RNA, followed by preparation of a 20 µl reaction system containing 4X EZscript RT Mix II, Oligo dT18 (20X), and ddH2O. A 20 µl real-time quantitative PCR (qPCR) system was then set up with cDNA, primers (Table 2 ), SYBR enzyme, and ddH2O. Gene expression differences between samples were calculated using the 2^(-ΔΔCt) method. The control group’s RQ value was set to 1, and mRNA levels of other groups were normalized to this value. Table 2 Primers Used for qRT-PCR. Gene(Mouse) Forward Primer (5’→3’) Reverse Primer (5’→3’) Zo-1 GAGCCCCCTAGTGATGTGTG TAGGGTCACAGTGTGGCAAG Claudin-1 AATTTGGCCAGGCCCTCTTT AGAGGTTGTTTTCCGGGGAC Occludin CCTCCACCCCCATCTGACTA GCTTGCCATTCACTTTGCCA Aqp4 AAGGCGGTGGGGTAAGTG TGAGCCACCCCAGTTTATGG Lef1 AGCACGGAAAGAGAGACAGC GCTGTCATTCTGGGACCTGT 2.7. Proteomic Analysis To profile protein expression in the mouse diarrhea model, small intestine and colon tissues from WT and MUT mice were analyzed using the Thermo Scientific™ Orbitrap™ Astral™ mass spectrometer. Samples were desalted via SOLA™ SPE, vacuum-dried, resuspended, and spiked with iRT peptides (1:10). LC-MS/MS was performed on a Tims TOF Pro system (Bruker) coupled to an EASY-nLCTM 1200 system using a C18 column (15 cm×75 µm) at 300 nL/min. The gradient was: 0–20 min (5–22% B), 20–24 min (22–37% B), 24–27 min (37–80% B), 27–30 min (80% B). Ion mobility (0.7–1.3 Vs/cm²) and collision energy (20–59 eV) were set; MS/MS spectra were recorded at 100–1700 m/z. Data were analyzed via DIA-NN to identify differential proteins (fold change ≥ 1.5, P < 0.05), yielding 191 and 160 differential proteins in small intestine and colon, respectively. 2.8. Western Blotting Protein lysate of IECs was collected. After quantification, samples were separated via SDS-PAGE, transferred to a PVDF membrane, blocked with fat-free milk, and incubated with primary antibodies (4°C, overnight). Horseradish peroxidase-conjugated secondary antibodies were added, and protein bands visualized via iBright Imaging Systems. 2.9. Hematoxylin and Eosin (H&E) Staining Paraffin sections were baked (30 min), dewaxed (xylene twice, 5 min each), hydrated, and antigen-retrieved. Sections were stained with hematoxylin (3–5 min), rinsed, counterstained with eosin (20 s), rinsed, dehydrated (ethanol gradient, 10–15 min each), cleared (xylene), and mounted with neutral resin. 2.10. Immunohistochemistry (IHC) Paraffin sections were dewaxed, hydrated, antigen-retrieved, and endogenous peroxidase-blocked. Sections were incubated with primary antibodies (4°C, overnight), followed by horseradish peroxidase-conjugated goat anti-rabbit IgG (1:1000, 20 min, room temperature), DAB (10 s), and hematoxylin (1 min). After rehydration, sections were mounted with neutral balsam. 2.11. Transmission Electron Microscopy (TEM) Intestinal tissues were fixed with 2.5% glutaraldehyde (4°C, 4 h) and 1% osmium tetroxide (1–2 h), washed with PBS (3 times, 10–15 min each), dehydrated (alcohol gradient, 10–15 min each; absolute ethanol twice, 10–15 min each; 100% acetone twice, 10–15 min each), infiltrated with 100% acetone/embedding medium (3:1, 30 min, room temperature), embedded, and polymerized (37°C, 24 h; 60°C, 48 h). Ultra-thin sections (~ 60–80 nm) were cut via Leica UC7 ultramicrotome, stained with uranyl acetate (20 min) and lead citrate (12 min), and microvilli length observed via TEM. 2.12. In Vivo Permeability Assay 8-week-old WT/MUT mice were fasted (24 h, water ad libitum), orally administered 4 kDa FITC-Dextran (0.6 mg/g body weight) via gastric tube, euthanized after 4 h, and plasma isolated for fluorescence detection [ 24 , 25 ]. FITC-Dextran distribution in frozen intestinal sections was examined via fluorescence microscopy. 2.13. Statistics Normally distributed data are presented as mean ± SD. Student’s t-test was used for two-group comparisons, and one-way ANOVA for multiple groups. Significance: *, p < 0.05; **, p < 0.01; ***, p < 0.001; ****, p 0.05. 2.14. Case Presentation A 1.5-year-old boy (born May 6, 2019; weight 10 kg, height 72 cm) presented in April 2021 with 6-month stool abnormalities. In November 2020, he developed diarrhea (yellow loose stools, 4–5 times/day) during hospitalization for asthmatic bronchitis and exudative erythema multiforme (Local hospital). Despite azithromycin, cephalosporins, and extensively hydrolyzed formulas, diarrhea and rash persisted. He was transferred to our hospital for cyclosporine therapy (exudative erythema multiforme); rash improved, but diarrhea worsened (5–7 times/day, yellow-green loose stools with severe acidosis). After etiological treatment, symptomatic care, and dietary adjustments (meat congee, vegetable puree, rice paste), stool frequency decreased to 4–5 times/day (pasty). On January 16, 2021, the patient developed fever, cough, severe dyspnea, and multiple pyemias; after advanced life support, plasma exchange, and anti-infective therapy, multi-organ dysfunction improved but diarrhea recurred. On March 11, 2021, stool volume was 1400–2000 ml/day (dark green). Sequential interventions (somatostatin, mucosal repair, probiotics, Remicade, donated breast milk) failed to resolve grayish watery stools, requiring ongoing pump-feeding and intravenous nutrition. Past History Full-term firstborn, no birth trauma/asphyxia. Non-consanguineous parents, no family metabolic disorder history. Delayed language development, allergies to eggs, milk, wheat. Genetic Testing : WES identified a de novo heterozygous missense mutation in LEF1 exon 8 (NM_016269: c.880C > T, p.Pro294Ser), confirmed via Sanger sequencing (parental wild-type, Fig. 1SA). This variant is absent from 1000 Genomes and gnomAD databases; bioinformatics analysis predicted pathogenicity. Prognosis Alive, afebrile, with persistent diarrhea (≈ 10 watery stools/day), satisfactory mental state, and minimal nutritional improvement. 3. Results 3.1. The Primary Clinical Phenotype is Persistent Diarrhe Clinical data review (4 years) showed large stool volume (1400–2000 mL/day; mean 1718.75 ± 358.26 mL/day) (Fig. 1 A). Correlation analysis of inflammatory markers C-reactive Protein (CRP) and Procalcitonin (PCT) with diarrhea frequency revealed recurrence post-anti-infective therapy and inflammation control, indicating non-infectious diarrhea (Fig. 1 B). Etiological analysis revealed higher daily frequency (Fig. 1 C) and longer duration (Fig. 1 D) than common diarrhea types Bacterial Infectious Diarrhea [BID], Viral Infectious Diarrhea [VID], Antibiotic-Associated Diarrhea [AAD], Irritable Bowel Syndrome [IBS], and Inflammatory Bowel Disease [IBD]), resembling congenital diarrheal disorders such as Congenital Diarrhea and Enteropathies (CoDEs) [ 26 – 30 ]. The patient had notable growth retardation, with body weight below − 3SD per WHO standards and electrolyte levels were chronically low. (Fig. 1 E; Fig. 1SB). Additionally, gastrointestinal endoscopy showed small intestinal/colonic mucosal swelling with minor hemorrhagic spots (no erosions/ulcers/masses) (Fig. 1 F). Pathological staining revealed intact epithelial structure, lymphocytic infiltration in the lamina propria, and eosinophil densities of 5–8/HPF (small intestine) and 7–8/HPF (colon) (no neutrophils), consistent with mild chronic mucosal inflammation (Fig. 1 G). Thus, we concluded this case's etiology aligns with congenital diarrhea, with relatively mild intestinal inflammation. 3.2. Lef1 Mutation in Mice Induces Significant Diarrhea Multi-species LEF1 amino acid sequence alignment showed conserved mutation sites across six mammals (Fig. 2 A). To confirm the relationship between LEF1 P294S mutation and the patient's diarrhea, Lef1 P292S KI mice (orthologous to human P294S) were treated with 2.5% DSS for 7 days; body weight, defecation frequency, and stool characteristics were recorded. DSS treatment shortened colon length in both WT and MUT mice; MUT mice had significantly shorter colon lengths than WT in both water and DSS groups (Fig. 2 B-C) Diarrhea scoring showed higher severity and greater weight loss in DSS-treated MUT mice than WT (Fig. 2 D-E), indicating increased diarrhea susceptibility. Thus, we conclude the LEF1 P294S mutation increases susceptibility to diarrhea. 3.3. Impaired Intestinal Structure and Barrier Function in Lef1 P292S Mice The integrity of intestinal barrier is critical for maintaining normal intestinal physiological functions [ 31 ]. H&E staining showed minimal inflammatory infiltration but significant morphological changes (Fig. 3 A-B). MUT mice (water-treated) had spontaneous small intestinal villous damage (shortening, atrophy, loose interstitium) and colonic villous shortening/localized defects; DSS treatment exacerbated these changes (extensive small intestinal microvilli loss, irregular colonic villi). Q-MARSH analysis revealed significantly reduced Vh (villus height):Cd(crypt depth) ratios in MUT small intestine/colon (water/DSS groups) (Fig. 3 C-D). Intestinal tissues were examined by TEM and microvillus length measured. As shown in Fig. 3 E, TEM showed shorter microvilli, epithelial brush border damage, and widened tight junctions in MUT mice. FITC-Dextran permeability assay showed weakened luminal fluorescence and elevated serum levels in MUT mice, confirming increased epithelial permeability (Fig. 3 F). Collectively, these findings demonstrate that the mutant genotype compromises baseline intestinal barrier integrity and increases susceptibility to DSS-induced injury. 3.4. Altered Intestinal Proteome in Lef1 Mutant Mice To obtain a comprehensive protein expression profile in the mouse diarrhea model, we performed proteomic mass spectrometry on small intestinal and colonic tissues from WT and MUT mice. Good biological reproducibility was observed among experimental groups (Fig. 4 A-B).A heatmap of top differential proteins identified 23 diarrhea-related proteins (Fig. 4 C). Gene Ontology (GO) analysis revealed significant enrichment in pathways including "ion transport," "immune response," and "secretion" (Fig. 4 D-E). Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis showed significant enrichment in "glycoprotein synthesis," "signal transduction," and "inflammation" (Fig. 4 F). Additionally, Protein-protein interaction (PPI) network analysis identified key hub proteins such as Parvalbumin α (Pvalb), Slc family members, and Mptx1 (Fig. 4 G-H), suggesting mutation-induced intestinal barrier dysfunction. 3.5. Lef1 Mutation Disrupts Tight Junctions and Triggers Diarrhea The intestinal barrier, acting as the first line of defense against external pathogen invasion [ 32 , 33 ], primarily relies on intact tight junctions between intestinal epithelial cells (e.g., ZO-1, OCCLUDIN, CLAUDIN family), adherens junctions (e.g., E-CADHERIN), and normal intestinal mucosal structures. We had found spontaneous shortening of intestinal villi and structural defects in intestinal structures in MUT mice. Nextly, we extracted the colonic epithelial cells, and mRNA/protein levels of tight junction proteins and aquaporins were measured via qPCR and Western blot analysis. Results showed elevated Lef1 mRNA and protein levels in MUT mice. In contrast, Zo-1, Occludin, Claudin, E-cadherin, and Aqp4 expression were decreased (Fig. 5 A-B). IHC staining of mouse colons revealed lower ZO-1, OCCLUDIN, CLAUDIN, and AQP4 expression in the MUT than in the WT (Fig. 5 C). To further validate these findings, IHC staining was performed on patient colon tissue sections, revealing significantly lower ZO-1 levels in the patient than in healthy controls (Fig. 5 D), indicating LEF1 regulates tight junction proteins/aquaporins in diarrhea pathogenesis. 4. Discussion Intestinal barrier integrity relies on epithelial renewal, tight junction maintenance, mucus secretion, gut microbiota, and precise regulation of the lamina propria immune system; the impairment of which ultimately presents as diarrhea [ 12 , 13 , 34 , 35 ]. Recurrent diarrhea episodes correlate with long-term physical and psychological developmental disorders, resulting in approximately 1400 healthy life-years lost per 100,000 people [ 36 , 37 ]. Although his vital signs were stable, his weight remained below the WHO − 3 SD threshold and electrolyte levels were low (Fig. 1SB), necessitating intravenous fluid replacement. Diarrhea can be classified into acute, persistent, and chronic categories, with each type exhibiting distinct characteristics in terms of stool frequency and duration duration [ 38 , 39 ]. This patient had prolonged, high-volume diarrhea with growth retardation, consistent with monogenic chronic diarrhea. WES identified a de novo LEF1 P294S mutation. Despite infection control, diarrhea persisted, excluding infectious etiologies. Unlike Very Early-Onset Inflammatory Bowel Disease (VEO-IBD) and other chronic diarrhea caused by inflammatory diseases, which typically exhibit endoscopic ulcers, erosions, small polyps, and extensive inflammatory exudation [ 40 , 41 ], endoscopy/ pathology showed mucosal swelling and mild inflammation (no ulcers/erosions). supporting gene-driven intestinal injury. The LEF1 P294S mutation localizes to the conserved context-dependent regulatory domain (CDRD, aa68-295) [ 42 ], a previously uncharacterized region whose 100% cross-species conservation indicates critical functional roles like co-regulator binding and post-translational modification [ 43 ]. Rather than directly causing overt diarrhea, this variant probably induces intestinal inflammatory susceptibility, weakening the epithelium’s ability to withstand inflammatory perturbations [ 44 ]. Inflammatory triggers such as microbial exposure and mucosal irritation act as a second hit [ 45 ], amplifying diarrhea severity, consistent with the mutant mice’s exacerbated phenotype under DSS challenge. This explains the patient’s therapy-refractory course: conventional anti-inflammatories alleviate acute flares but fail to reverse the genetic predisposition. Our findings expand the etiological spectrum of pediatric chronic diarrhea, highlighting LEF1 as a key mediator of intestinal inflammatory tolerance and a potential diagnostic target for inflammation-sensitive, idiopathic cases. Moveover, our results showed the LEF1 P294S mutation drives inherent intestinal structural abnormalities and compromised barrier integrity, which directly constitutes the core pathological basis for persistent diarrhea and growth retardation in affected individuals [ 46 , 47 ]. Biologically, this finding establishes LEF1 as a key regulator of intestinal structural maintenance and barrier homeostasis, expanding our understanding of its functional repertoire beyond known roles in developmental and oncogenic pathways. The identified pathogenic loop, where baseline barrier defects enhance inflammatory susceptibility, and inflammation further exacerbates epithelial damage, provides a novel mechanistic framework for understanding inflammation-associated chronic diarrhea. Clinically, this insight explains the refractoriness of such diarrhea to conventional anti-infective therapies, as these interventions fail to target the underlying genetic-driven structural and barrier deficits. Moreover, it highlights LEF1 as a valuable diagnostic target for idiopathic pediatric chronic diarrhea characterized by structural barrier impairment, enriching the etiological spectrum and facilitating precise diagnosis for previously unexplained cases. Proteomic analysis identifies a LEF1 mutation-driven molecular network encompassing ion transport, epithelial adhesion, calcium signaling, and inflammatory pathways, providing a precise molecular basis for intestinal structural abnormalities, barrier impairment, and inflammatory susceptibility. Biologically, this fills the gap in understanding LEF1’s downstream effector pathways in intestinal homeostasis. Key differential proteins (e.g., SLC transporters, Pcdhb14, CLCA1 [ 48 , 49 ]) and enriched pathways (cGMP-PKG [ 50 ], NF-κB [ 51 , 52 ], glycosaminoglycan biosynthesis [ 53 ]) confirm LEF1 orchestrates multi-dimensional intestinal function: nutrient transport, epithelial integrity, inflammation [ 54 ], and barrier dysfunction. Clinically, this molecular landscape explains refractory diarrhea: inflammation control fails to reverse dysregulated ion transport (e.g., Slc5a7) and epithelial adhesion, sustaining barrier leakage [ 55 ]. Besides, these molecules also combine LEF1 mutation detection with markers, enhanceing diagnostic specificity for idiopathic pediatric chronic diarrhea, avoiding misdiagnosis with inflammatory or infectious etiologies. As a key transcription factor in the Wnt/β-catenin signaling pathway, LEF1 regulates intestinal homeostasis via its C-terminal DNA-binding domain and N-terminal β-catenin-binding domain [ 42 ]. Since it’s localized near the DNA-binding domain, the P294S mutation mpairs β-catenin binding to dampen transcriptional activation of downstream tight junction genes (ZO-1, occludin, claudin-1) and aquaporin 4 (AQP4). Biologically, this finding establishes LEF1 as a dual regulator of intestinal barrier integrity and water-electrolyte balance: downregulated tight junction proteins compromise epithelial structural stability [ 56 ], while reduced AQP4 [ 57 , 58 ] exacerbates fluid transport dysfunction, collectively underpinning persistent diarrhea and growth impairment. This expands our understanding of LEF1’s functional repertoire beyond developmental and oncogenic roles to core intestinal physiological processes, linking transcriptional regulation to barrier structure and water homeostasis. Clinically, since conventional therapies fail to target LEF1-driven downregulation of tight junction proteins and AQP4, this dual molecular defect explains the refractoriness of the patient’s diarrhea. Moreover, our research also highlights LEF1 mutation as a specific diagnostic marker for idiopathic pediatric chronic diarrhea linked to barrier and water transport deficits, and identifies downstream targets such as tight junction stabilizers or AQP4 modulators for precision therapies, offering a path to address the root cause rather than merely alleviating symptoms. In summary, this study first establishes the pathogenic model: LEF1 P294S mutation disrupts the Wnt/β-catenin transcriptional network, downregulates tight junction proteins (ZO-1, occludin, claudin-1) and AQP4, impairs intestinal structure/barrier function, and enhances inflammatory susceptibility, leading to chronic refractory diarrhea. Biologically, it expands LEF1’s roles beyond development and carcinogenesis to core intestinal homeostasis regulation, filling critical research gaps. Clinically, the model explains conventional therapy failure, identifies LEF1 as a diagnostic marker for idiopathic pediatric chronic diarrhea, and provides precision targets, advancing diagnosis and targeted treatment of unexplained childhood diarrhea. Declarations Author Contributions: Conceptualization, Y.C. and J.J.; methodology, J.J. and X.L.; software, J.J.; data curation, J.J., M.Q. and X.L.; project administration, M.Q. and Q.Z.; writing—original draft preparation, J.J.; writing—review and editing, S.G. and Y.C.; supervision, L.G. All authors have read and agreed to the published version of the manuscript. Funding: This study was supported by the National Key R&D Program of China (Grant No. 2023YFC2706500) and the National Natural Science Foundation of China (81802339, 82073174). Institutional Review Board Statement: This study was conducted in accordance with the Declaration of Helsinki (as revised in 2013). The study protocol was approved by the Ethics Committee of Guangzhou Medical University Affiliated Women and Children's Medical Center (Approval No. GZFWEC-REC [2023] 228B01 and RSDW-2025-00955) . Informed Consent Statement: Prior to the patient's inclusion in this study, written informed consent was procured from the patient's legal guardians. Data Availability Statement: The novel contributions showcased in this research are incorporated in the article. Additional questions can be addressed to the corresponding author. Acknowledgments: Y.C. and J.J designed the conception of the study. Y.C. and S.G. supported the methodology and material of the study. J.J. and M.Q. mainly performed experiments on this study. X.L. and Q.Z. assisted with the experimental work. J.X. and L.G. supported the clinical data from the research. L.G. and X.L. implemented colonoscopy techniques and provided clinical specimens. Y.C. was responsible for reviewing the manuscript. Conflicts of Interest: The authors declare no conflicts of interest. References Thiagarajah JR, Donowitz M, Verkman AS (2015) Secretory diarrhoea: mechanisms and emerging therapies. Nat Rev Gastroenterol Hepatol 12:446–457. https://doi.org/10.1038/nrgastro.2015.111 Global, regional, and national age-sex-specific burden of diarrhoeal diseases, their risk factors, and aetiologies, 1990-2021, for 204 countries and territories: a systematic analysis for the Global Burden of Disease Study 2021 - PubMed. https://pubmed.ncbi.nlm.nih.gov/39708822/. Accessed 10 Dec 2025 Tag ZM, Alashwal H, Chemaitelly H, Abu-Raddad LJ (2025) Global childhood diarrhoea prevalence and its determinants: a systematic meta-analytic assessment, 1985-2024. EBioMedicine 121:105956. https://doi.org/10.1016/j.ebiom.2025.105956 Köglmeier J, Lindley KJ (2024) Congenital Diarrhoeas and Enteropathies. Nutrients 16:2971. https://doi.org/10.3390/nu16172971 Kotsiliti E (2025) Congenital diarrhoea and enteropathy genetics. Nat Rev Gastroenterol Hepatol 22:369. https://doi.org/10.1038/s41575-025-01074-8 Gaibee Z, Warner N, Bugda Gwilt K, et al (2025) The Genetic Architecture of Congenital Diarrhea and Enteropathy. N Engl J Med 392:1297–1309. https://doi.org/10.1056/NEJMoa2405333 SLC26A3 (DRA, the Congenital Chloride Diarrhea Gene): A Novel Therapeutic Target for Diarrheal Diseases - PubMed. https://pubmed.ncbi.nlm.nih.gov/39736385/. Accessed 10 Dec 2025 Loss of MYO5B Leads to Reductions in Na+ Absorption With Maintenance of CFTR-Dependent Cl- Secretion in Enterocytes - PubMed. https://pubmed.ncbi.nlm.nih.gov/30144427/. Accessed 10 Dec 2025 Müller T, Hess MW, Schiefermeier N, et al (2008) MYO5B mutations cause microvillus inclusion disease and disrupt epithelial cell polarity. Nat Genet 40:1163–1165. https://doi.org/10.1038/ng.225 O’Connell AE, Zhou F, Shah MS, et al (2018) Neonatal-Onset Chronic Diarrhea Caused by Homozygous Nonsense WNT2B Mutations. Am J Hum Genet 103:131–137. https://doi.org/10.1016/j.ajhg.2018.05.007 Ye Z, Huang Y, Zheng C, et al (2019) Clinical and genetic spectrum of children with congenital diarrhea and enteropathy in China. Genet Med 21:2224–2230. https://doi.org/10.1038/s41436-019-0488-z Kordahi MC, Daniel N, Gewirtz AT, Chassaing B (2025) Mucus-penetrating microbiota drive chronic low-grade intestinal inflammation and metabolic dysregulation. Gut Microbes 17:2455790. https://doi.org/10.1080/19490976.2025.2455790 Neurath MF, Artis D, Becker C (2025) The intestinal barrier: a pivotal role in health, inflammation, and cancer. Lancet Gastroenterol Hepatol 10:573–592. https://doi.org/10.1016/S2468-1253(24)00390-X Zhang Y, Seid K, Obermayr F, et al (2017) Activation of Wnt Signaling Increases Numbers of Enteric Neurons Derived From Neonatal Mouse and Human Progenitor Cells. Gastroenterology 153:154-165.e9. https://doi.org/10.1053/j.gastro.2017.03.019 Chen H-C, Zhu Y-T, Chen S-Y, Tseng SCG (2012) Wnt signaling induces epithelial-mesenchymal transition with proliferation in ARPE-19 cells upon loss of contact inhibition. Lab Invest 92:676–687. https://doi.org/10.1038/labinvest.2011.201 Eger A, Stockinger A, Schaffhauser B, et al (2000) Epithelial mesenchymal transition by c-Fos estrogen receptor activation involves nuclear translocation of beta-catenin and upregulation of beta-catenin/lymphoid enhancer binding factor-1 transcriptional activity. J Cell Biol 148:173–188. https://doi.org/10.1083/jcb.148.1.173 Xiao L, Zhang C, Li X, et al (2021) LEF1 Enhances the Progression of Colonic Adenocarcinoma via Remodeling the Cell Motility Associated Structures. Int J Mol Sci 22:10870. https://doi.org/10.3390/ijms221910870 Heino S, Fang S, Lähde M, et al (2021) Lef1 restricts ectopic crypt formation and tumor cell growth in intestinal adenomas. Sci Adv 7:eabj0512. https://doi.org/10.1126/sciadv.abj0512 Ishitani T, Ninomiya-Tsuji J, Matsumoto K (2003) Regulation of lymphoid enhancer factor 1/T-cell factor by mitogen-activated protein kinase-related Nemo-like kinase-dependent phosphorylation in Wnt/beta-catenin signaling. Mol Cell Biol 23:1379–1389. https://doi.org/10.1128/MCB.23.4.1379-1389.2003 Oulès B, Rognoni E, Hoste E, et al (2019) Mutant Lef1 controls Gata6 in sebaceous gland development and cancer. EMBO J 38:e100526. https://doi.org/10.15252/embj.2018100526 Sjöblom T, Jones S, Wood LD, et al (2006) The consensus coding sequences of human breast and colorectal cancers. Science 314:268–274. https://doi.org/10.1126/science.1133427 Wirtz S, Popp V, Kindermann M, et al (2017) Chemically induced mouse models of acute and chronic intestinal inflammation. Nat Protoc 12:1295–1309. https://doi.org/10.1038/nprot.2017.044 Adelman DC, Murray J, Wu T-T, et al (2018) Measuring Change In Small Intestinal Histology In Patients With Celiac Disease. Am J Gastroenterol 113:339–347. https://doi.org/10.1038/ajg.2017.480 Grosheva I, Zheng D, Levy M, et al (2020) High-Throughput Screen Identifies Host and Microbiota Regulators of Intestinal Barrier Function. Gastroenterology 159:1807–1823. https://doi.org/10.1053/j.gastro.2020.07.003 Xiong J, Zhou M-F, Wang Y-D, et al (2016) Protein Kinase D2 Protects against Acute Colitis Induced by Dextran Sulfate Sodium in Mice. Sci Rep 6:34079. https://doi.org/10.1038/srep34079 Case report of congenital chloride diarrhea and literature review | Article Information | J-GLOBAL. https://jglobal.jst.go.jp/en/detail?JGLOBAL_ID=201902259505858044. Accessed 11 Dec 2025 Hao R, Cong J, Xiaoying Zh, et al (2025) Analysis of etiological characteristies of infectious diarrhea in children. Journal of Pathogen Biology 20:206–210. https://doi.org/10.13350/j.cjpb.250214 Liu , Wei H, Duan LP, et al (2016) Clinical features of irritable bowel syndrome with small intestinal bacterial overgrowth and apreliminary study of effectiveness of Rifaximin. Natl Med J China 96:1896–1902. https://doi.org/10.3760/cma.j.issn.0376-2491.2016.24.005 Lin X, Zhu G, Yang W, et al (2015) Comparison between combined clostridium butyricum and bifidobacterium living powders and saccha-romyces boulardii for prevention of antibiotic-associated diarrhea in children:a randomized,controlled clinical trial. Chin Pediatr Emerg Med 22:257–261. https://doi.org/10.3760/cma.j.issn.1673-4912.2015.04.011 Bhowal A, Cardona N, Chua C, et al (2024) Cracking the Codes for Congenital Diarrhea and Enteropathies (CoDEs): A Case Report and Review. Cureus 16:e73529. https://doi.org/10.7759/cureus.73529 Bischoff SC, Barbara G, Buurman W, et al (2014) Intestinal permeability--a new target for disease prevention and therapy. BMC Gastroenterol 14:189. https://doi.org/10.1186/s12876-014-0189-7 Wardill HR, Bowen JM, Van Sebille YZA, et al (2016) TLR4-Dependent Claudin-1 Internalization and Secretagogue-Mediated Chloride Secretion Regulate Irinotecan-Induced Diarrhea. Mol Cancer Ther 15:2767–2779. https://doi.org/10.1158/1535-7163.MCT-16-0330 Wardill HR, Bowen JM, Al-Dasooqi N, et al (2014) Irinotecan disrupts tight junction proteins within the gut : implications for chemotherapy-induced gut toxicity. Cancer Biol Ther 15:236–244. https://doi.org/10.4161/cbt.27222 Sylvestre M, Di Carlo SE, Peduto L (2023) Stromal regulation of the intestinal barrier. Mucosal Immunol 16:221–231. https://doi.org/10.1016/j.mucimm.2023.01.006 Shi L, Jin L, Huang W (2023) Bile Acids, Intestinal Barrier Dysfunction, and Related Diseases. Cells 12:1888. https://doi.org/10.3390/cells12141888 Thiagarajah JR, Donowitz M, Verkman AS (2015) Secretory diarrhoea: mechanisms and emerging therapies. Nat Rev Gastroenterol Hepatol 12:446–457. https://doi.org/10.1038/nrgastro.2015.111 Wierzba TF, Muhib F (2018) Exploring the broader consequences of diarrhoeal diseases on child health. Lancet Glob Health 6:e230–e231. https://doi.org/10.1016/S2214-109X(18)30047-0 Thiagarajah JR, Kamin DS, Acra S, et al (2018) Advances in Evaluation of Chronic Diarrhea in Infants. Gastroenterology 154:2045-2059.e6. https://doi.org/10.1053/j.gastro.2018.03.067 Ugboko HU, Nwinyi OC, Oranusi SU, Oyewale JO (2020) Childhood diarrhoeal diseases in developing countries. Heliyon 6:e03690. https://doi.org/10.1016/j.heliyon.2020.e03690 Conrad MA, Carreon CK, Dawany N, et al (2019) Distinct Histopathological Features at Diagnosis of Very Early Onset Inflammatory Bowel Disease. J Crohns Colitis 13:615–625. https://doi.org/10.1093/ecco-jcc/jjy212 Hagiwara S-I, Shimizu H, Nambu R, et al (2025) Feasibility and Safety of Small Bowel Capsule Endoscopy in Very Early-Onset Inflammatory Bowel Disease: A Multi-Institutional Study. Inflamm Bowel Dis 31:3279–3285. https://doi.org/10.1093/ibd/izaf144 Ward BJH, Prasai K, Schaal DL, et al (2023) A distinct isoform of lymphoid enhancer binding factor 1 (LEF1) epigenetically restricts EBV reactivation to maintain viral latency. PLoS Pathog 19:e1011873. https://doi.org/10.1371/journal.ppat.1011873 Zhang J, Humphreys IR, Pei J, et al (2025) Predicting protein-protein interactions in the human proteome. Science 390:eadt1630. https://doi.org/10.1126/science.adt1630 Kuokkanen M, Kokkonen J, Enattah NS, et al (2006) Mutations in the translated region of the lactase gene (LCT) underlie congenital lactase deficiency. Am J Hum Genet 78:339–344. https://doi.org/10.1086/500053 Caporilli C, Giannì G, Grassi F, Esposito S (2023) An Overview of Short-Bowel Syndrome in Pediatric Patients: Focus on Clinical Management and Prevention of Complications. Nutrients 15:2341. https://doi.org/10.3390/nu15102341 Viswanathan VK, Hodges K, Hecht G (2009) Enteric infection meets intestinal function: how bacterial pathogens cause diarrhoea. Nat Rev Microbiol 7:110–119. https://doi.org/10.1038/nrmicro2053 Keusch GT, Denno DM, Black RE, et al (2014) Environmental enteric dysfunction: pathogenesis, diagnosis, and clinical consequences. Clin Infect Dis 59 Suppl 4:S207-212. https://doi.org/10.1093/cid/ciu485 Bujko M, Kober P, Mikula M, et al (2015) Expression changes of cell-cell adhesion-related genes in colorectal tumors. Oncol Lett 9:2463–2470. https://doi.org/10.3892/ol.2015.3107 Long AJ, Sypek JP, Askew R, et al (2006) Gob-5 contributes to goblet cell hyperplasia and modulates pulmonary tissue inflammation. Am J Respir Cell Mol Biol 35:357–365. https://doi.org/10.1165/rcmb.2005-0451OC Mishra V, Bose A, Kiran S, et al (2021) Gut-associated cGMP mediates colitis and dysbiosis in a mouse model of an activating mutation in GUCY2C. J Exp Med 218:e20210479. https://doi.org/10.1084/jem.20210479 Shang Z, Zhou L, Liu Y, et al (2025) Tongxie Yaofang attenuates ulcerative colitis by modulating gut microbiota and IL-10RA/NF-κB-mediated macrophage polarization. Phytomedicine 148:157459. https://doi.org/10.1016/j.phymed.2025.157459 Li M, Wu J, Li D, et al (2025) Baicalin ameliorates dextran sulfate solidum-induced colitis by modulating Th17-macrophage immune network via JAK2/STAT3/IL-17/NF-κB pathway. Phytomedicine 148:157414. https://doi.org/10.1016/j.phymed.2025.157414 Miguez PA, Bash E, Musskopf ML, et al (2024) Control of tissue homeostasis by the extracellular matrix: Synthetic heparan sulfate as a promising therapeutic for periodontal health and bone regeneration. Periodontol 2000 94:510–531. https://doi.org/10.1111/prd.12515 Tian Y, Jian T, Li J, et al (2024) Phenolic acids from Chicory roots ameliorate dextran sulfate sodium-induced colitis in mice by targeting TRP signaling pathways and the gut microbiota. Phytomedicine 128:155378. https://doi.org/10.1016/j.phymed.2024.155378 Wang J, Yang Y, Shi Y, et al (2024) Oxidized/unmodified-polyethylene microplastics neurotoxicity in mice: Perspective from microbiota-gut-brain axis. Environ Int 185:108523. https://doi.org/10.1016/j.envint.2024.108523 Liu M, Wang Y, Xu X, et al (2024) p-hydroxy benzaldehyde attenuates intestinal epithelial barrier dysfunction caused by colitis via activating the HNF-1β/SLC26A3 pathway. Front Pharmacol 15:1448863. https://doi.org/10.3389/fphar.2024.1448863 Villarreal AM, Lamadrid VG, Sanchez A, Múnera M (2025) Aquaporins in Allergic Response: A New Player. Clin Rev Allergy Immunol 68:71. https://doi.org/10.1007/s12016-025-09083-w Sakai H, Sagara A, Matsumoto K, et al (2014) Neutrophil recruitment is critical for 5-fluorouracil-induced diarrhea and the decrease in aquaporins in the colon. Pharmacol Res 87:71–79. https://doi.org/10.1016/j.phrs.2014.05.012 Additional Declarations No competing interests reported. Supplementary Files GelsandBlotsimages3.zip GelsandBlotsimages2.zip GelsandBlotsimages1.zip SupplementaryMaterials.docx Cite Share Download PDF Status: Under Review Version 1 posted Editorial decision: Revision requested 16 Feb, 2026 Reviews received at journal 14 Feb, 2026 Reviews received at journal 12 Feb, 2026 Reviewers agreed at journal 07 Feb, 2026 Reviewers agreed at journal 02 Feb, 2026 Reviewers invited by journal 15 Jan, 2026 Editor assigned by journal 15 Jan, 2026 Submission checks completed at journal 02 Jan, 2026 First submitted to journal 28 Dec, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8469007","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":575288349,"identity":"231e3119-52f5-48e7-9451-90a7720397de","order_by":0,"name":"Jianan Jie","email":"","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jianan","middleName":"","lastName":"Jie","suffix":""},{"id":575288350,"identity":"315b4631-86fd-407c-90df-ca9cf85b5264","order_by":1,"name":"Mengling Qiu","email":"","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Mengling","middleName":"","lastName":"Qiu","suffix":""},{"id":575288351,"identity":"4a13834e-fcf0-407c-9420-ca2014e1916d","order_by":2,"name":"Xing Liu","email":"","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xing","middleName":"","lastName":"Liu","suffix":""},{"id":575288352,"identity":"c8d84988-fd14-4eca-a25b-54b4c6a0e938","order_by":3,"name":"Qingqing Zhang","email":"","orcid":"","institution":"Guangzhou Medical University","correspondingAuthor":false,"prefix":"","firstName":"Qingqing","middleName":"","lastName":"Zhang","suffix":""},{"id":575288353,"identity":"bd521208-070e-42aa-80d6-96bd69b2a39d","order_by":4,"name":"Jing Xie","email":"","orcid":"","institution":"Guangzhou Women and Children Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Xie","suffix":""},{"id":575288354,"identity":"d541500e-b008-423d-b484-ad476cf0fafc","order_by":5,"name":"Lanlan Geng","email":"","orcid":"","institution":"Guangzhou Women and Children Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Lanlan","middleName":"","lastName":"Geng","suffix":""},{"id":575288355,"identity":"4c9bbfa7-3d7b-41ac-ac36-92e841d0816e","order_by":6,"name":"Sitang Gong","email":"","orcid":"","institution":"Guangzhou Women and Children Medical Center","correspondingAuthor":false,"prefix":"","firstName":"Sitang","middleName":"","lastName":"Gong","suffix":""},{"id":575288356,"identity":"9dc34455-4af6-4f2e-965a-bd2357032ba4","order_by":7,"name":"Yang Cheng","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA/0lEQVRIiWNgGAWjYDACCRiDvfn4jw8VDDwkaOE5liA54wxJWiRyDKR524hwF//s5mMPv7bZ5ck7pCUY8M6rkzFnP8D44WMOHkvuHEs3lm1LLjY8cPhAguS2wzyWPQnMkjO34dZiIJFjJi3Zxpy4sbEt4YDhtgM8BgcS2Jh58WrJ/wbUUp+4sZnHsCFxTh2PwfkHhLTksEl+bDucOJ+Nx5jhYAMzj8ENArZI3Egzk2Y4dzxxAw9bGmPDscNALQ+b8fqFf0byM8kfZdWJ8+c/Psb8p6bO3uB88sEPH/FoAQFmXjagCw/A+YwN+NWDlPz4w8AgT1jdKBgFo2AUjFQAAK6OVLjeRXE4AAAAAElFTkSuQmCC","orcid":"","institution":"Guangzhou Women and Children Medical Center","correspondingAuthor":true,"prefix":"","firstName":"Yang","middleName":"","lastName":"Cheng","suffix":""}],"badges":[],"createdAt":"2025-12-29 04:23:14","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8469007/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8469007/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100687995,"identity":"efde4f01-00d4-493a-a449-5fe7438ac88f","added_by":"auto","created_at":"2026-01-20 13:24:45","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":42307417,"visible":true,"origin":"","legend":"","description":"","filename":"LEF1GeneMutationImpairsIntestinalBarrierandCausesDiarrhea.docx","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/bbf610d4f65ba3b4d595808e.docx"},{"id":100687866,"identity":"c6bcce84-f8c5-4fa8-916c-dbf481b54c57","added_by":"auto","created_at":"2026-01-20 13:21:22","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9002,"visible":true,"origin":"","legend":"","description":"","filename":"b4e54f1a8df94e75974ded9981783fbf.json","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/05ac0ce36306b20e6faa87e8.json"},{"id":100687946,"identity":"e0bffa56-0338-4a28-913e-7d1748b46f0a","added_by":"auto","created_at":"2026-01-20 13:23:02","extension":"zip","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2635071,"visible":true,"origin":"","legend":"","description":"","filename":"GelsandBlotsimages1.zip","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/7d0b19def7ce70a8230b095c.zip"},{"id":100687982,"identity":"b8dadfc7-cad1-43ab-ade6-6b2f5c630acd","added_by":"auto","created_at":"2026-01-20 13:24:19","extension":"zip","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2773974,"visible":true,"origin":"","legend":"","description":"","filename":"GelsandBlotsimages2.zip","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/5b266a3ee30e6dbfe314ae05.zip"},{"id":100687920,"identity":"4c94c012-cc6a-48d6-bc13-3796ea323fbc","added_by":"auto","created_at":"2026-01-20 13:22:30","extension":"zip","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2632701,"visible":true,"origin":"","legend":"","description":"","filename":"GelsandBlotsimages3.zip","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/fee876ad48ede8026664b4ab.zip"},{"id":100687932,"identity":"b0dbe871-be62-4edb-a808-5adb12554d08","added_by":"auto","created_at":"2026-01-20 13:22:46","extension":"xml","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":132554,"visible":true,"origin":"","legend":"","description":"","filename":"b4e54f1a8df94e75974ded9981783fbf1enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/f6a4c088a3c9e03d42611914.xml"},{"id":100687901,"identity":"9a7bd42d-9f60-4510-9329-e0feaf36b392","added_by":"auto","created_at":"2026-01-20 13:21:55","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8530069,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/309873089d68d1c700a54f3b.jpeg"},{"id":100688027,"identity":"f5d0a8b8-3678-4e32-a751-1809a5d3d217","added_by":"auto","created_at":"2026-01-20 13:25:25","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":5299392,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/7243138930151da1306e36af.jpeg"},{"id":100687917,"identity":"bc87a985-07ef-4eb6-8aa9-c702f325a2c7","added_by":"auto","created_at":"2026-01-20 13:22:28","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":17965847,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/6d9b9fa8bd8d48f959d4c100.jpeg"},{"id":100687668,"identity":"a65838c4-07b7-464a-bc53-7bf47b35b4d7","added_by":"auto","created_at":"2026-01-20 13:19:41","extension":"jpeg","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3001835,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/c270283dab09667ca4b3c192.jpeg"},{"id":100687934,"identity":"85d4e235-d849-4da0-aa6d-c479952be763","added_by":"auto","created_at":"2026-01-20 13:22:47","extension":"jpeg","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10409378,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/f225b59b72e82e95f373537c.jpeg"},{"id":100687935,"identity":"e6961814-74ce-439f-8bce-c958c024b5da","added_by":"auto","created_at":"2026-01-20 13:22:48","extension":"jpeg","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":107275,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage6.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/b43d366107b79e4f885ea77f.jpeg"},{"id":100687883,"identity":"586c3110-fdec-4a4a-a805-bd1ff4ee8f8a","added_by":"auto","created_at":"2026-01-20 13:21:39","extension":"jpeg","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":830950,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage7.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/556f848f524f5e29c789bbf3.jpeg"},{"id":100687945,"identity":"a298857a-dcc5-488a-b721-f59258553dca","added_by":"auto","created_at":"2026-01-20 13:23:02","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":863202,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/2c248ed47af67f0a03e2b82d.png"},{"id":100688007,"identity":"e520d995-ee54-4870-91b2-c72ec61362ba","added_by":"auto","created_at":"2026-01-20 13:25:19","extension":"png","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":395826,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/6fe323e01a6ecb990e5b4027.png"},{"id":100687914,"identity":"d27ca4b7-484a-49e2-95fa-78b8d0d467a2","added_by":"auto","created_at":"2026-01-20 13:22:25","extension":"png","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2398516,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/e7b49d754bc2ff78adc61f0f.png"},{"id":100687839,"identity":"fd73dbc8-2f59-432f-ab37-bffd6274488d","added_by":"auto","created_at":"2026-01-20 13:21:07","extension":"png","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":312259,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/0c7b479b3e6e2e3984d0a98d.png"},{"id":100687997,"identity":"8ecfcaf7-46e3-4550-86dd-2f72ed5349b5","added_by":"auto","created_at":"2026-01-20 13:24:48","extension":"png","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1294255,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/02ab3ae27f749efaa2b9b33c.png"},{"id":100687949,"identity":"f44a0119-9dec-4e2a-9499-b1028ebd442b","added_by":"auto","created_at":"2026-01-20 13:23:05","extension":"png","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":102970,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage6.png","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/521dc13a459d6b3559bb562a.png"},{"id":100687881,"identity":"92cd0aab-9525-4854-8e23-3b8ed423f2ac","added_by":"auto","created_at":"2026-01-20 13:21:38","extension":"png","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":149991,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage7.png","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/bfe4b849411b61926b2bc9c1.png"},{"id":100687923,"identity":"d2baf813-c393-4de9-8b7c-11a925059057","added_by":"auto","created_at":"2026-01-20 13:22:32","extension":"xml","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":132157,"visible":true,"origin":"","legend":"","description":"","filename":"b4e54f1a8df94e75974ded9981783fbf1structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/607ca03aec33f695f6be77fb.xml"},{"id":100687950,"identity":"15234abd-f43a-4742-8b8b-eac6d0d7e0b9","added_by":"auto","created_at":"2026-01-20 13:23:07","extension":"html","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":148231,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/d01d3c82a3bb9ed47930e4ea.html"},{"id":100687902,"identity":"1a814b3b-4ee6-414b-aa34-b9dedc1b529f","added_by":"auto","created_at":"2026-01-20 13:21:56","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":393181,"visible":true,"origin":"","legend":"\u003cp\u003eClinical data and samples. (A) Daily stool volume over the past four years. (B) The analysis of the correlation between inflammatory index (CRP, PCT) and diarrhea frequency. (C-D) \u0026nbsp;Compared with various common causes of diarrhea, paitent has more frequent and longer episodes of diarrhea (****p\u0026lt;0.0001, # outclass 60 days). (E) The body weight change over the past four year.(F) Gastrointestinal endoscopy for volunteer and case. (G) Hematoxylin and eosin (H\u0026amp;E) staining for volunteer and case.\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/d834d40a62b54f7664bc8e8b.png"},{"id":100687666,"identity":"0d910205-cb1a-4987-a4bb-d45ed36204a4","added_by":"auto","created_at":"2026-01-20 13:19:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":356526,"visible":true,"origin":"","legend":"\u003cp\u003eDSS-induced diarrhea model. (A) Multi-species amino acid sequence alignment of LEF1 (conserved mutation sites are highlighted by red boxes). (B -C) Photographs and statistical charts of the mice colon intestinal tract (*p\u0026lt;0.05, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001). (D) The curve graph of mice stool consistency over time (MUT\u003csup\u003eDSS\u003c/sup\u003e vs WT\u003csup\u003eDSS\u003c/sup\u003e, **p\u0026lt;0.01, ***p\u0026lt;0.001, ****p\u0026lt;0.0001). (E) The curve graph of mice body weight over time (MUT\u003csup\u003eDSS\u003c/sup\u003e vs WT\u003csup\u003eDSS\u003c/sup\u003e, ***p\u0026lt;0.001, ****p\u0026lt;0.0001).\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/6f5c7ad4412aff81d5262689.png"},{"id":100687885,"identity":"8284da0b-0700-4d8e-b758-6457c46a8026","added_by":"auto","created_at":"2026-01-20 13:21:40","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":849214,"visible":true,"origin":"","legend":"\u003cp\u003eLef1 mutations increase susceptibility to intestinal damage. (A) H\u0026amp;E staining results of the small intestine in WT and MUT mice after treatment with 2.5% DSS or water. (B) H\u0026amp;E staining results of the colon in WT and MUT mice after treatment with 2.5% DSS or water. (C - D) Vh:cd ratio for WT and MUT mice (*p\u0026lt;0.05, ***p\u0026lt;0.001, ****p\u0026lt;0.0001). (E) TEM for microvilli structure of the small intestine and colon in WT and MUT mice, and quantitative analysis of microvilli length was performed ((*p\u0026lt;0.0001). (F) Fluorescence tracer assay for intestinal permeability: Quantitative analysis of FITC-Dextran in intestinal lumen and serum(*p\u0026lt;0.05, ****p\u0026lt;0.0001).\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/cf64f42fa2d53866bdc10398.png"},{"id":100687928,"identity":"8fe884d5-f3df-452f-bfb5-619a118a571f","added_by":"auto","created_at":"2026-01-20 13:22:43","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":279389,"visible":true,"origin":"","legend":"\u003cp\u003eProtein analysis of intestinal tissues in WT and MUT mice. (A) The Venn diagram illustrates the distribution and overlap of differential proteins between small intestinal and colonic tissues in mice. (B) Samplecorrplot demonstrate biological reproducibility of proteomic data in small intestinal and colonic tissues. (C) Proteinome heatmap displays the top correlated differentially expressed proteins in mouse intestinal tissues. (D-E) GO enrichment analysis reveals pathway enrichment in small intestinal and colonic tissues (BP: biological process; CC: cellular component; MF: molecular function). (F) KEGG enrichment analysis identifies key pathways in mouse intestinal tissues. (G-H) PPI network analysis identifies hub proteins in small intestinal and colonic tissues.\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/54e6539b502238d9f264b730.png"},{"id":100687971,"identity":"86600375-d5a6-4dbe-84c6-fd7cacc588e8","added_by":"auto","created_at":"2026-01-20 13:24:03","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":763173,"visible":true,"origin":"","legend":"\u003cp\u003eThe tight junctions in mutant mice and patient. (A) qPCR quantitative detection of tight junction proteins and AQP4 in mouse colonic epithelial cells. (B) Western blot analysis of tight junctions and AQP4 in mouse colonic epithelial cells. (C) Immunohistochemical staining and quantitative analysis of tight junction proteins and AQP4 in mouse colon(**p\u0026lt;0.01, ****p\u0026lt;0.0001). (D) Immunohistochemical staining and quantitative analysis of ZO-1 in this case (****p\u0026lt;0.0001).\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/5455e133a4db90313040d97a.png"},{"id":100687836,"identity":"d65b8bcd-d193-497f-ae94-87514d2c5047","added_by":"auto","created_at":"2026-01-20 13:21:04","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":140194,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic Diagram Illustrating the Mechanism of LEF1 Mutation in Diarrhea Development.\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/72cb806ee65a622a444c5862.png"},{"id":100694938,"identity":"bfdf6ec6-b0c8-4531-b49a-d69686cd4d8f","added_by":"auto","created_at":"2026-01-20 14:48:24","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3551538,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/4ca23796-a3ec-4640-b851-5ea28d1bd05a.pdf"},{"id":100687672,"identity":"dd6b6976-506e-4cb9-9ea9-9a62cd9ae6a5","added_by":"auto","created_at":"2026-01-20 13:19:44","extension":"zip","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":2632701,"visible":true,"origin":"","legend":"","description":"","filename":"GelsandBlotsimages3.zip","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/114ad7e896fc4b7226fe3f16.zip"},{"id":100687956,"identity":"fbba00f9-7200-4ee2-9966-6cdc9f3a27e0","added_by":"auto","created_at":"2026-01-20 13:23:24","extension":"zip","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":2773974,"visible":true,"origin":"","legend":"","description":"","filename":"GelsandBlotsimages2.zip","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/532d161d21328de9e703cf3a.zip"},{"id":100687918,"identity":"b48e6c97-0da4-4ae9-951b-8ba7cd05b1f9","added_by":"auto","created_at":"2026-01-20 13:22:28","extension":"zip","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":2635071,"visible":true,"origin":"","legend":"","description":"","filename":"GelsandBlotsimages1.zip","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/8b74abd05572078bbaa99f02.zip"},{"id":100687919,"identity":"2576cb8a-d822-436f-bff1-da800f4f6b06","added_by":"auto","created_at":"2026-01-20 13:22:30","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":845525,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-8469007/v1/e1739ff5c29dc7a3e8b80642.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"LEF1 Gene Mutation Impairs Intestinal Barrier and Causes Diarrhea","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eDiarrhea ranks among the top ten causes of death in children worldwide, with etiologies encompassing infections, immune dysfunction, genetic defects, and environmental factors [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. In 2021, diarrheal diseases accounted for 59\u0026nbsp;million Disability-Adjusted Life-Years (DALYs) globally, of which 30.9\u0026nbsp;million (52.4%) affected children under 5 years of age [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], imposing a substantial public health burden on the pediatric population. Monogenic variants have emerged as a crucial determinant of intractable diarrhea in children, with five major pathogenic mechanisms linked to over 40 genetic etiologies [\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]: Electrolyte Channel Dysfunction (e.g., SLC26A3 [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]), Epithelial Polarity and Interferon Pathway Abnormalities (e.g., MYO5B, TTC7A [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]), Defects in Epithelial Cell Proliferation and Differentiation (e.g., WNT2B [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]), Epidermal Barrier and Metabolic Pathway Mutations (e.g., SI), and Abnormal Mucosal Immunity and Inflammation Regulation (e.g., FOXP3 [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]). Notably, intestinal barrier dysfunction represents the most severe pathogenic mechanism underlying congenital diarrhea, as it directly compromises the physical and functional integrity of the intestinal epithelium. This leads to uncontrolled translocation of luminal antigens and persistent intestinal inflammation, often resulting in severe malnutrition and life-threatening complications refractory to conventional therapies [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe Wnt/β-catenin signaling pathway plays a pivotal role in embryonic development, intestinal homeostasis, and regulation of epithelial cell proliferation and differentiation [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Lymphoid enhancer-binding factor 1 (LEF1), a key transcription factor in this pathway, is critical for preserving intestinal epithelial barrier integrity and water-electrolyte balance. Mutations in LEF1 may disrupt these processes by interfering with the expression of downstream tight junction proteins (e.g., occludin, claudin family) and aquaporins (e.g., AQP4), ultimately contributing to chronic or intractable diarrhea [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. High-frequency LEF1 mutations drive the tumorigenesis and progression of human colorectal cancer [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]: mutations at NLK-binding phosphorylation sites (Thr155/Ser166) of LEF1 cause aberrant Wnt pathway hyperactivation [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], while an N-terminal truncation mutation abolishes its β-catenin binding capacity [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. A heterozygous missense mutation (c.337G\u0026thinsp;\u0026gt;\u0026thinsp;A, p.G113R) in LEF1 has been identified in colorectal cancer, though its oncogenic function remains elusive [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. These findings highlaght the critical role of LEF1 mutations in the precise regulation of the Wnt/β-catenin pathway and associated disease pathogenesis.\u003c/p\u003e \u003cp\u003eIn this study, we focus on the a specific LEF1 mutation, c.880C\u0026thinsp;\u0026gt;\u0026thinsp;T (p.Pro294Ser), and establish a novel causal link between this variant and intractable diarrhea. Mechanistically, the LEF1 P294S mutation significantly impaired intestinal barrier function. Our findings address a gap in LEF1 research regarding intestinal barrier regulation and expand the etiological spectrum of pediatric chronic diarrhea.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Reagents and Antibodies\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eAntibodies against ZO-1 (21773-1-AP, 1:2000), occludin (27260-1-AP, 1:1000), N-cadherin (22018-1-AP, 1:1000), E-cadherin (20874-1-AP, 1:1000), AQP4 (20874-1-AP, 1:1000), and GAPDH (60004-1-Ig, 1:1000) were purchased from Proteintech (IL, USA). Anti-claudin-1 (A21971, 1:2,000) was obtained from Abclonal (Hubei, China). Phenyl Methane Sulfonyl Fluoride (PMSF, P0100) and Protease Inhibitor Cocktail (PIC, P6730) were acquired from Solarbio (Beijing, China). OB-Test Paper (BA2020B) was obtained from BASO (Guangdong, China). Dulbecco's Phosphate-Buffered Saline (DPBS, 14040117) and EDTA (0.5 M, AM9260G) were provided by Thermofisher (MA, USA). Dextran Sulfate Sodium Salt (DSS, MP \u0026minus;\u0026thinsp;0216011010) was obtained from MP Biomedicals CA, USA). FITC-Dextran (MW 10000, 0.6mg/g) was supplied by MedChemExpress (NJ, USA).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. Clinical Data and Colonic Tissue Samples\u003c/h2\u003e \u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eColon tissue samples were obtained from endoscopy biopsy of a healthy volunteer and the diarrhea-afflicted patient, provided by the Department of Gastroenterology of Guangzhou Medical University Affiliated Women and Children's Medical Center. The study protocol was approved by the institutional ethics committee, and informed consent was obtained from the patient\u0026rsquo;s guardians.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Mouse Model\u003c/h2\u003e \u003cp\u003e\u003cdiv class=\"BlockQuote\"\u003e\u003cp\u003eWe make Lef1-p.P292S knockin mice via CRISPR-Cas9 system. Firstly, gRNA-targeting the near sequence of inserted site constructed and transcribed in vitro. And the donor vector with the inserted fragment was designed and constructed in vitro. Then CRISPR- Cas9 system and donor will be co-injected into zygotes. Thereafter, the zygotes were transferred into the oviduct of pseudopregnant ICR females at 0.5 dpc. And F0 mice was birthed after 19\u0026thinsp;~\u0026thinsp;21 days of transplantation, all the offsprings (F0 mice) were identified by PCR and sequencing of tail DNA. Finally, crossing positive F0 mice with wildtype mouse to build up heterozygous mice. C57BL/6JGpt mice were used as the wild-type (WT), while B6/JGpt-Lef1em1Cin(p.P292S)/Gpt mice served as the mutant (MUT). Specific pathogen-free (SPF) mice were housed at 23\u0026thinsp;\u0026plusmn;\u0026thinsp;2\u0026deg;C, 55\u0026thinsp;\u0026plusmn;\u0026thinsp;5% humidity, and a 12-hour light/dark cycle. All animals were maintained in the SPF facilities of Guangzhou Medical University Affiliated Women and Children's Medical Center, and all experiments followed the guidelines approved by the Institutional Animal Experiment Committee of this center.\u003c/p\u003e\u003c/div\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. DSS-induced Colitis\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe acute DSS colitis model was established as previously described [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. 8-week-old male WT and MUT mice were randomized into groups and weighed on day 1 (WT\u003csup\u003eH2O\u003c/sup\u003e;MUT\u003csup\u003eH2O\u003c/sup\u003e; WT\u003csup\u003eDSS\u003c/sup\u003e; MUT\u003csup\u003eDSS\u003c/sup\u003e; n\u0026thinsp;=\u0026thinsp;4; one of MUT\u003csup\u003eDSS\u003c/sup\u003e died on the 7th day of modeling). Mice in the treatment group received drinking water containing 2.5% DSS, while the control group received sterile water. Body weight loss, fecal consistency, and intestinal bleeding were monitored daily. All mice were euthanized on day 8, and intestinal tissues were collected. Intestinal barrier damage was assessed using the Quantitative-Mucosal Algorithmic Rules for Scoring Histology (Q-MARSH) system by two independent observers. Villus height (Vh) and crypt depth (Cd) were quantified, with a normal Vh:Cd ratio\u0026thinsp;\u0026ge;\u0026thinsp;3.0 [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. Diarrhea severity was scored based on fecal consistency (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eStool consistency Scoring Criteria\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eScore\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eStool consistency\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFormed\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSoft but formed\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eSoft\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eVery soft; moist\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eWatery diarrhea\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Isolation of Intestinal Epithelial Cells (IECs)\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eColonic tissues were rapidly excised, placed in ice-cold DPBS supplemented with 1% penicillin-streptomycin (P/S), and trimmed of mesenteric fat. Tissues were cut into 0.5\u0026ndash;1 cm fragments, rinsed 3\u0026ndash;5 times with ice-cold DPBS, and resuspended in EDTA-containing dissociation buffer for incubation at 37\u0026deg;C with shaking for 30 min. The cell suspension was filtered through a 70 \u0026micro;m strainer and centrifuged. The cell pellet was resuspended in 30% Percoll solution, overlaid onto 70% Percoll, and subjected to density-gradient centrifugation. IECs at the 30%\u0026ndash;70% Percoll interface were collected and either used immediately for downstream experiments or stored in liquid nitrogen.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. RNA Extraction, Complementary DNA (cDNA) Preparation and Real-Time Reverse Transcription-polymerase Chain Reaction (qRT-PCR)\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eTotal RNA was isolated from IECs colon of mice using Universal RNA Purification Kit (EZB - RN4). Total RNA was eluted with elution solution. For reverse transcription, 1 \u0026micro;g RNA was used: 2 \u0026micro;l DNA removal reagent was added to the extracted RNA, followed by preparation of a 20 \u0026micro;l reaction system containing 4X EZscript RT Mix II, Oligo dT18 (20X), and ddH2O. A 20 \u0026micro;l real-time quantitative PCR (qPCR) system was then set up with cDNA, primers (Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e), SYBR enzyme, and ddH2O. Gene expression differences between samples were calculated using the 2^(-ΔΔCt) method. The control group\u0026rsquo;s RQ value was set to 1, and mRNA levels of other groups were normalized to this value.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimers Used for qRT-PCR.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene(Mouse)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward Primer (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse Primer (5\u0026rsquo;\u0026rarr;3\u0026rsquo;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eZo-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGAGCCCCCTAGTGATGTGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTAGGGTCACAGTGTGGCAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eClaudin-1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATTTGGCCAGGCCCTCTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGAGGTTGTTTTCCGGGGAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eOccludin\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCCTCCACCCCCATCTGACTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTTGCCATTCACTTTGCCA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAqp4\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAAGGCGGTGGGGTAAGTG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGAGCCACCCCAGTTTATGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eLef1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCACGGAAAGAGAGACAGC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCTGTCATTCTGGGACCTGT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Proteomic Analysis\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eTo profile protein expression in the mouse diarrhea model, small intestine and colon tissues from WT and MUT mice were analyzed using the Thermo Scientific\u0026trade; Orbitrap\u0026trade; Astral\u0026trade; mass spectrometer. Samples were desalted via SOLA\u0026trade; SPE, vacuum-dried, resuspended, and spiked with iRT peptides (1:10). LC-MS/MS was performed on a Tims TOF Pro system (Bruker) coupled to an EASY-nLCTM 1200 system using a C18 column (15 cm\u0026times;75 \u0026micro;m) at 300 nL/min. The gradient was: 0\u0026ndash;20 min (5\u0026ndash;22% B), 20\u0026ndash;24 min (22\u0026ndash;37% B), 24\u0026ndash;27 min (37\u0026ndash;80% B), 27\u0026ndash;30 min (80% B). Ion mobility (0.7\u0026ndash;1.3 Vs/cm\u0026sup2;) and collision energy (20\u0026ndash;59 eV) were set; MS/MS spectra were recorded at 100\u0026ndash;1700 m/z. Data were analyzed via DIA-NN to identify differential proteins (fold change\u0026thinsp;\u0026ge;\u0026thinsp;1.5, P\u0026thinsp;\u0026lt;\u0026thinsp;0.05), yielding 191 and 160 differential proteins in small intestine and colon, respectively.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Western Blotting\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eProtein lysate of IECs was collected. After quantification, samples were separated via SDS-PAGE, transferred to a PVDF membrane, blocked with fat-free milk, and incubated with primary antibodies (4\u0026deg;C, overnight). Horseradish peroxidase-conjugated secondary antibodies were added, and protein bands visualized via iBright Imaging Systems.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Hematoxylin and Eosin (H\u0026amp;E) Staining\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eParaffin sections were baked (30 min), dewaxed (xylene twice, 5 min each), hydrated, and antigen-retrieved. Sections were stained with hematoxylin (3\u0026ndash;5 min), rinsed, counterstained with eosin (20 s), rinsed, dehydrated (ethanol gradient, 10\u0026ndash;15 min each), cleared (xylene), and mounted with neutral resin.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Immunohistochemistry (IHC)\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eParaffin sections were dewaxed, hydrated, antigen-retrieved, and endogenous peroxidase-blocked. Sections were incubated with primary antibodies (4\u0026deg;C, overnight), followed by horseradish peroxidase-conjugated goat anti-rabbit IgG (1:1000, 20 min, room temperature), DAB (10 s), and hematoxylin (1 min). After rehydration, sections were mounted with neutral balsam.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11. Transmission Electron Microscopy (TEM)\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eIntestinal tissues were fixed with 2.5% glutaraldehyde (4\u0026deg;C, 4 h) and 1% osmium tetroxide (1\u0026ndash;2 h), washed with PBS (3 times, 10\u0026ndash;15 min each), dehydrated (alcohol gradient, 10\u0026ndash;15 min each; absolute ethanol twice, 10\u0026ndash;15 min each; 100% acetone twice, 10\u0026ndash;15 min each), infiltrated with 100% acetone/embedding medium (3:1, 30 min, room temperature), embedded, and polymerized (37\u0026deg;C, 24 h; 60\u0026deg;C, 48 h). Ultra-thin sections (~\u0026thinsp;60\u0026ndash;80 nm) were cut via Leica UC7 ultramicrotome, stained with uranyl acetate (20 min) and lead citrate (12 min), and microvilli length observed via TEM.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12. In Vivo Permeability Assay\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003e8-week-old WT/MUT mice were fasted (24 h, water ad libitum), orally administered 4 kDa FITC-Dextran (0.6 mg/g body weight) via gastric tube, euthanized after 4 h, and plasma isolated for fluorescence detection [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. FITC-Dextran distribution in frozen intestinal sections was examined via fluorescence microscopy.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13. Statistics\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eNormally distributed data are presented as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;SD. Student\u0026rsquo;s t-test was used for two-group comparisons, and one-way ANOVA for multiple groups. Significance: *, p\u0026thinsp;\u0026lt;\u0026thinsp;0.05; **, p\u0026thinsp;\u0026lt;\u0026thinsp;0.01; ***, p\u0026thinsp;\u0026lt;\u0026thinsp;0.001; ****, p\u0026thinsp;\u0026lt;\u0026thinsp;0.0001; ns p\u0026thinsp;\u0026gt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.14. Case Presentation\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eA 1.5-year-old boy (born May 6, 2019; weight 10 kg, height 72 cm) presented in April 2021 with 6-month stool abnormalities. In November 2020, he developed diarrhea (yellow loose stools, 4\u0026ndash;5 times/day) during hospitalization for asthmatic bronchitis and exudative erythema multiforme (Local hospital). Despite azithromycin, cephalosporins, and extensively hydrolyzed formulas, diarrhea and rash persisted. He was transferred to our hospital for cyclosporine therapy (exudative erythema multiforme); rash improved, but diarrhea worsened (5\u0026ndash;7 times/day, yellow-green loose stools with severe acidosis). After etiological treatment, symptomatic care, and dietary adjustments (meat congee, vegetable puree, rice paste), stool frequency decreased to 4\u0026ndash;5 times/day (pasty). On January 16, 2021, the patient developed fever, cough, severe dyspnea, and multiple pyemias; after advanced life support, plasma exchange, and anti-infective therapy, multi-organ dysfunction improved but diarrhea recurred. On March 11, 2021, stool volume was 1400\u0026ndash;2000 ml/day (dark green). Sequential interventions (somatostatin, mucosal repair, probiotics, Remicade, donated breast milk) failed to resolve grayish watery stools, requiring ongoing pump-feeding and intravenous nutrition.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003ePast History\u003c/strong\u003e \u003cp\u003eFull-term firstborn, no birth trauma/asphyxia. Non-consanguineous parents, no family metabolic disorder history. Delayed language development, allergies to eggs, milk, wheat.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eGenetic Testing\u003c/b\u003e: WES identified a de novo heterozygous missense mutation in LEF1 exon 8 (NM_016269: c.880C\u0026thinsp;\u0026gt;\u0026thinsp;T, p.Pro294Ser), confirmed via Sanger sequencing (parental wild-type, Fig.\u0026nbsp;1SA). This variant is absent from 1000 Genomes and gnomAD databases; bioinformatics analysis predicted pathogenicity.\u003c/p\u003e \u003cp\u003e \u003cstrong\u003ePrognosis\u003c/strong\u003e \u003cp\u003eAlive, afebrile, with persistent diarrhea (\u0026asymp;\u0026thinsp;10 watery stools/day), satisfactory mental state, and minimal nutritional improvement.\u003c/p\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.1. The Primary Clinical Phenotype is Persistent Diarrhe\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eClinical data review (4 years) showed large stool volume (1400\u0026ndash;2000 mL/day; mean 1718.75\u0026thinsp;\u0026plusmn;\u0026thinsp;358.26 mL/day) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Correlation analysis of inflammatory markers C-reactive Protein (CRP) and Procalcitonin (PCT) with diarrhea frequency revealed recurrence post-anti-infective therapy and inflammation control, indicating non-infectious diarrhea (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). Etiological analysis revealed higher daily frequency (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eC) and longer duration (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eD) than common diarrhea types Bacterial Infectious Diarrhea [BID], Viral Infectious Diarrhea [VID], Antibiotic-Associated Diarrhea [AAD], Irritable Bowel Syndrome [IBS], and Inflammatory Bowel Disease [IBD]), resembling congenital diarrheal disorders such as Congenital Diarrhea and Enteropathies (CoDEs) [\u003cspan additionalcitationids=\"CR27 CR28 CR29\" citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. The patient had notable growth retardation, with body weight below \u0026minus;\u0026thinsp;3SD per WHO standards and electrolyte levels were chronically low. (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eE; Fig.\u0026nbsp;1SB). Additionally, gastrointestinal endoscopy showed small intestinal/colonic mucosal swelling with minor hemorrhagic spots (no erosions/ulcers/masses) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eF). Pathological staining revealed intact epithelial structure, lymphocytic infiltration in the lamina propria, and eosinophil densities of 5\u0026ndash;8/HPF (small intestine) and 7\u0026ndash;8/HPF (colon) (no neutrophils), consistent with mild chronic mucosal inflammation (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Thus, we concluded this case's etiology aligns with congenital diarrhea, with relatively mild intestinal inflammation.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Lef1 Mutation in Mice Induces Significant Diarrhea\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eMulti-species LEF1 amino acid sequence alignment showed conserved mutation sites across six mammals (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). To confirm the relationship between LEF1 P294S mutation and the patient's diarrhea, Lef1 P292S KI mice (orthologous to human P294S) were treated with 2.5% DSS for 7 days; body weight, defecation frequency, and stool characteristics were recorded. DSS treatment shortened colon length in both WT and MUT mice; MUT mice had significantly shorter colon lengths than WT in both water and DSS groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eB-C) Diarrhea scoring showed higher severity and greater weight loss in DSS-treated MUT mice than WT (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e2\u003c/span\u003eD-E), indicating increased diarrhea susceptibility. Thus, we conclude the LEF1 P294S mutation increases susceptibility to diarrhea.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Impaired Intestinal Structure and Barrier Function in Lef1\u003csup\u003eP292S\u003c/sup\u003e Mice\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe integrity of intestinal barrier is critical for maintaining normal intestinal physiological functions [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. H\u0026amp;E staining showed minimal inflammatory infiltration but significant morphological changes (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA-B). MUT mice (water-treated) had spontaneous small intestinal villous damage (shortening, atrophy, loose interstitium) and colonic villous shortening/localized defects; DSS treatment exacerbated these changes (extensive small intestinal microvilli loss, irregular colonic villi). Q-MARSH analysis revealed significantly reduced Vh (villus height):Cd(crypt depth) ratios in MUT small intestine/colon (water/DSS groups) (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eC-D). Intestinal tissues were examined by TEM and microvillus length measured. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, TEM showed shorter microvilli, epithelial brush border damage, and widened tight junctions in MUT mice. FITC-Dextran permeability assay showed weakened luminal fluorescence and elevated serum levels in MUT mice, confirming increased epithelial permeability (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). Collectively, these findings demonstrate that the mutant genotype compromises baseline intestinal barrier integrity and increases susceptibility to DSS-induced injury.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Altered Intestinal Proteome in Lef1 Mutant Mice\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eTo obtain a comprehensive protein expression profile in the mouse diarrhea model, we performed proteomic mass spectrometry on small intestinal and colonic tissues from WT and MUT mice. Good biological reproducibility was observed among experimental groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eA-B).A heatmap of top differential proteins identified 23 diarrhea-related proteins (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Gene Ontology (GO) analysis revealed significant enrichment in pathways including \"ion transport,\" \"immune response,\" and \"secretion\" (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eD-E). Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis showed significant enrichment in \"glycoprotein synthesis,\" \"signal transduction,\" and \"inflammation\" (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). Additionally, Protein-protein interaction (PPI) network analysis identified key hub proteins such as Parvalbumin α (Pvalb), Slc family members, and Mptx1 (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eG-H), suggesting mutation-induced intestinal barrier dysfunction.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Lef1 Mutation Disrupts Tight Junctions and Triggers Diarrhea\u003c/h2\u003e \u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eThe intestinal barrier, acting as the first line of defense against external pathogen invasion [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e], primarily relies on intact tight junctions between intestinal epithelial cells (e.g., ZO-1, OCCLUDIN, CLAUDIN family), adherens junctions (e.g., E-CADHERIN), and normal intestinal mucosal structures. We had found spontaneous shortening of intestinal villi and structural defects in intestinal structures in MUT mice. Nextly, we extracted the colonic epithelial cells, and mRNA/protein levels of tight junction proteins and aquaporins were measured via qPCR and Western blot analysis. Results showed elevated Lef1 mRNA and protein levels in MUT mice. In contrast, Zo-1, Occludin, Claudin, E-cadherin, and Aqp4 expression were decreased (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eA-B). IHC staining of mouse colons revealed lower ZO-1, OCCLUDIN, CLAUDIN, and AQP4 expression in the MUT than in the WT (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). To further validate these findings, IHC staining was performed on patient colon tissue sections, revealing significantly lower ZO-1 levels in the patient than in healthy controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e5\u003c/span\u003eD), indicating LEF1 regulates tight junction proteins/aquaporins in diarrhea pathogenesis.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003e \u003cdiv class=\"BlockQuote\"\u003e \u003cp\u003eIntestinal barrier integrity relies on epithelial renewal, tight junction maintenance, mucus secretion, gut microbiota, and precise regulation of the lamina propria immune system; the impairment of which ultimately presents as diarrhea [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. Recurrent diarrhea episodes correlate with long-term physical and psychological developmental disorders, resulting in approximately 1400 healthy life-years lost per 100,000 people [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Although his vital signs were stable, his weight remained below the WHO \u0026minus;\u0026thinsp;3 SD threshold and electrolyte levels were low (Fig.\u0026nbsp;1SB), necessitating intravenous fluid replacement. Diarrhea can be classified into acute, persistent, and chronic categories, with each type exhibiting distinct characteristics in terms of stool frequency and duration duration [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. This patient had prolonged, high-volume diarrhea with growth retardation, consistent with monogenic chronic diarrhea. WES identified a de novo LEF1 P294S mutation. Despite infection control, diarrhea persisted, excluding infectious etiologies. Unlike Very Early-Onset Inflammatory Bowel Disease (VEO-IBD) and other chronic diarrhea caused by inflammatory diseases, which typically exhibit endoscopic ulcers, erosions, small polyps, and extensive inflammatory exudation [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e], endoscopy/ pathology showed mucosal swelling and mild inflammation (no ulcers/erosions). supporting gene-driven intestinal injury.\u003c/p\u003e \u003cp\u003eThe LEF1 P294S mutation localizes to the conserved context-dependent regulatory domain (CDRD, aa68-295) [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], a previously uncharacterized region whose 100% cross-species conservation indicates critical functional roles like co-regulator binding and post-translational modification [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. Rather than directly causing overt diarrhea, this variant probably induces intestinal inflammatory susceptibility, weakening the epithelium\u0026rsquo;s ability to withstand inflammatory perturbations [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e]. Inflammatory triggers such as microbial exposure and mucosal irritation act as a second hit [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e], amplifying diarrhea severity, consistent with the mutant mice\u0026rsquo;s exacerbated phenotype under DSS challenge. This explains the patient\u0026rsquo;s therapy-refractory course: conventional anti-inflammatories alleviate acute flares but fail to reverse the genetic predisposition. Our findings expand the etiological spectrum of pediatric chronic diarrhea, highlighting LEF1 as a key mediator of intestinal inflammatory tolerance and a potential diagnostic target for inflammation-sensitive, idiopathic cases.\u003c/p\u003e \u003cp\u003eMoveover, our results showed the LEF1 P294S mutation drives inherent intestinal structural abnormalities and compromised barrier integrity, which directly constitutes the core pathological basis for persistent diarrhea and growth retardation in affected individuals [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Biologically, this finding establishes LEF1 as a key regulator of intestinal structural maintenance and barrier homeostasis, expanding our understanding of its functional repertoire beyond known roles in developmental and oncogenic pathways. The identified pathogenic loop, where baseline barrier defects enhance inflammatory susceptibility, and inflammation further exacerbates epithelial damage, provides a novel mechanistic framework for understanding inflammation-associated chronic diarrhea. Clinically, this insight explains the refractoriness of such diarrhea to conventional anti-infective therapies, as these interventions fail to target the underlying genetic-driven structural and barrier deficits. Moreover, it highlights LEF1 as a valuable diagnostic target for idiopathic pediatric chronic diarrhea characterized by structural barrier impairment, enriching the etiological spectrum and facilitating precise diagnosis for previously unexplained cases.\u003c/p\u003e \u003cp\u003eProteomic analysis identifies a LEF1 mutation-driven molecular network encompassing ion transport, epithelial adhesion, calcium signaling, and inflammatory pathways, providing a precise molecular basis for intestinal structural abnormalities, barrier impairment, and inflammatory susceptibility. Biologically, this fills the gap in understanding LEF1\u0026rsquo;s downstream effector pathways in intestinal homeostasis. Key differential proteins (e.g., SLC transporters, Pcdhb14, CLCA1 [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e]) and enriched pathways (cGMP-PKG [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e], NF-κB [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e], glycosaminoglycan biosynthesis [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]) confirm LEF1 orchestrates multi-dimensional intestinal function: nutrient transport, epithelial integrity, inflammation [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e], and barrier dysfunction. Clinically, this molecular landscape explains refractory diarrhea: inflammation control fails to reverse dysregulated ion transport (e.g., Slc5a7) and epithelial adhesion, sustaining barrier leakage [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Besides, these molecules also combine LEF1 mutation detection with markers, enhanceing diagnostic specificity for idiopathic pediatric chronic diarrhea, avoiding misdiagnosis with inflammatory or infectious etiologies.\u003c/p\u003e \u003cp\u003eAs a key transcription factor in the Wnt/β-catenin signaling pathway, LEF1 regulates intestinal homeostasis via its C-terminal DNA-binding domain and N-terminal β-catenin-binding domain [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. Since it\u0026rsquo;s localized near the DNA-binding domain, the P294S mutation mpairs β-catenin binding to dampen transcriptional activation of downstream tight junction genes (ZO-1, occludin, claudin-1) and aquaporin 4 (AQP4). Biologically, this finding establishes LEF1 as a dual regulator of intestinal barrier integrity and water-electrolyte balance: downregulated tight junction proteins compromise epithelial structural stability [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e], while reduced AQP4 [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e] exacerbates fluid transport dysfunction, collectively underpinning persistent diarrhea and growth impairment. This expands our understanding of LEF1\u0026rsquo;s functional repertoire beyond developmental and oncogenic roles to core intestinal physiological processes, linking transcriptional regulation to barrier structure and water homeostasis. Clinically, since conventional therapies fail to target LEF1-driven downregulation of tight junction proteins and AQP4, this dual molecular defect explains the refractoriness of the patient\u0026rsquo;s diarrhea. Moreover, our research also highlights LEF1 mutation as a specific diagnostic marker for idiopathic pediatric chronic diarrhea linked to barrier and water transport deficits, and identifies downstream targets such as tight junction stabilizers or AQP4 modulators for precision therapies, offering a path to address the root cause rather than merely alleviating symptoms.\u003c/p\u003e \u003cp\u003eIn summary, this study first establishes the pathogenic model: LEF1 P294S mutation disrupts the Wnt/β-catenin transcriptional network, downregulates tight junction proteins (ZO-1, occludin, claudin-1) and AQP4, impairs intestinal structure/barrier function, and enhances inflammatory susceptibility, leading to chronic refractory diarrhea. Biologically, it expands LEF1\u0026rsquo;s roles beyond development and carcinogenesis to core intestinal homeostasis regulation, filling critical research gaps. Clinically, the model explains conventional therapy failure, identifies LEF1 as a diagnostic marker for idiopathic pediatric chronic diarrhea, and provides precision targets, advancing diagnosis and targeted treatment of unexplained childhood diarrhea.\u003c/p\u003e \u003c/div\u003e \u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor Contributions:\u003c/strong\u003e Conceptualization, Y.C. and J.J.; methodology, J.J. and X.L.; software, J.J.;\u0026nbsp;data curation, J.J., M.Q. and X.L.; project administration, M.Q.\u0026nbsp;and Q.Z.; writing—original draft preparation, J.J.;\u0026nbsp;writing—review and editing, S.G. and Y.C.; supervision, L.G. All authors have read and agreed to the\u0026nbsp;published version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e This study was supported by the National Key R\u0026amp;D Program of China (Grant No. 2023YFC2706500) and the National Natural Science Foundation of China (81802339, 82073174).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInstitutional Review Board Statement:\u0026nbsp;\u003c/strong\u003eThis study was conducted in accordance with the Declaration\u0026nbsp;of Helsinki (as revised in 2013). The study protocol was\u0026nbsp;approved by the Ethics Committee of\u0026nbsp;Guangzhou Medical University Affiliated Women and Children's Medical Center (Approval No. GZFWEC-REC [2023] 228B01\u0026nbsp;and\u0026nbsp;RSDW-2025-00955)\u0026nbsp;.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eInformed Consent Statement:\u0026nbsp;\u003c/strong\u003ePrior to the patient's inclusion in this study, written informed consent was procured from the patient's legal\u0026nbsp;guardians.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData Availability Statement:\u003c/strong\u003e The novel contributions showcased in this research are incorporated in the article. Additional questions can be addressed to the corresponding author.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments:\u003c/strong\u003e Y.C. and J.J\u0026nbsp;designed the conception of the study. Y.C. and S.G. supported the methodology and material of the study. J.J.\u0026nbsp;and\u0026nbsp;M.Q. mainly performed experiments on this study. X.L. and Q.Z. assisted with the experimental work. J.X. and L.G. supported the clinical data from the research. L.G. and X.L. implemented colonoscopy techniques and provided clinical specimens. Y.C. was responsible for reviewing the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflicts of Interest:\u003c/strong\u003e The authors declare no conflicts of interest.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eThiagarajah JR, Donowitz M, Verkman AS (2015) Secretory diarrhoea: mechanisms and emerging therapies. Nat Rev Gastroenterol Hepatol 12:446\u0026ndash;457. https://doi.org/10.1038/nrgastro.2015.111\u003c/li\u003e\n \u003cli\u003eGlobal, regional, and national age-sex-specific burden of diarrhoeal diseases, their risk factors, and aetiologies, 1990-2021, for 204 countries and territories: a systematic analysis for the Global Burden of Disease Study 2021 - PubMed. https://pubmed.ncbi.nlm.nih.gov/39708822/. Accessed 10 Dec 2025\u003c/li\u003e\n \u003cli\u003eTag ZM, Alashwal H, Chemaitelly H, Abu-Raddad LJ (2025) Global childhood diarrhoea prevalence and its determinants: a systematic meta-analytic assessment, 1985-2024. EBioMedicine 121:105956. https://doi.org/10.1016/j.ebiom.2025.105956\u003c/li\u003e\n \u003cli\u003eK\u0026ouml;glmeier J, Lindley KJ (2024) Congenital Diarrhoeas and Enteropathies. Nutrients 16:2971. https://doi.org/10.3390/nu16172971\u003c/li\u003e\n \u003cli\u003eKotsiliti E (2025) Congenital diarrhoea and enteropathy genetics. Nat Rev Gastroenterol Hepatol 22:369. https://doi.org/10.1038/s41575-025-01074-8\u003c/li\u003e\n \u003cli\u003eGaibee Z, Warner N, Bugda Gwilt K, et al (2025) The Genetic Architecture of Congenital Diarrhea and Enteropathy. N Engl J Med 392:1297\u0026ndash;1309. https://doi.org/10.1056/NEJMoa2405333\u003c/li\u003e\n \u003cli\u003eSLC26A3 (DRA, the Congenital Chloride Diarrhea Gene): A Novel Therapeutic Target for Diarrheal Diseases - PubMed. https://pubmed.ncbi.nlm.nih.gov/39736385/. Accessed 10 Dec 2025\u003c/li\u003e\n \u003cli\u003eLoss of MYO5B Leads to Reductions in Na+ Absorption With Maintenance of CFTR-Dependent Cl- Secretion in Enterocytes - PubMed. https://pubmed.ncbi.nlm.nih.gov/30144427/. Accessed 10 Dec 2025\u003c/li\u003e\n \u003cli\u003eM\u0026uuml;ller T, Hess MW, Schiefermeier N, et al (2008) MYO5B mutations cause microvillus inclusion disease and disrupt epithelial cell polarity. Nat Genet 40:1163\u0026ndash;1165. https://doi.org/10.1038/ng.225\u003c/li\u003e\n \u003cli\u003eO\u0026rsquo;Connell AE, Zhou F, Shah MS, et al (2018) Neonatal-Onset Chronic Diarrhea Caused by Homozygous Nonsense WNT2B Mutations. Am J Hum Genet 103:131\u0026ndash;137. https://doi.org/10.1016/j.ajhg.2018.05.007\u003c/li\u003e\n \u003cli\u003eYe Z, Huang Y, Zheng C, et al (2019) Clinical and genetic spectrum of children with congenital diarrhea and enteropathy in China. Genet Med 21:2224\u0026ndash;2230. https://doi.org/10.1038/s41436-019-0488-z\u003c/li\u003e\n \u003cli\u003eKordahi MC, Daniel N, Gewirtz AT, Chassaing B (2025) Mucus-penetrating microbiota drive chronic low-grade intestinal inflammation and metabolic dysregulation. Gut Microbes 17:2455790. https://doi.org/10.1080/19490976.2025.2455790\u003c/li\u003e\n \u003cli\u003eNeurath MF, Artis D, Becker C (2025) The intestinal barrier: a pivotal role in health, inflammation, and cancer. Lancet Gastroenterol Hepatol 10:573\u0026ndash;592. https://doi.org/10.1016/S2468-1253(24)00390-X\u003c/li\u003e\n \u003cli\u003eZhang Y, Seid K, Obermayr F, et al (2017) Activation of Wnt Signaling Increases Numbers of Enteric Neurons Derived From Neonatal Mouse and Human Progenitor Cells. Gastroenterology 153:154-165.e9. https://doi.org/10.1053/j.gastro.2017.03.019\u003c/li\u003e\n \u003cli\u003eChen H-C, Zhu Y-T, Chen S-Y, Tseng SCG (2012) Wnt signaling induces epithelial-mesenchymal transition with proliferation in ARPE-19 cells upon loss of contact inhibition. Lab Invest 92:676\u0026ndash;687. https://doi.org/10.1038/labinvest.2011.201\u003c/li\u003e\n \u003cli\u003eEger A, Stockinger A, Schaffhauser B, et al (2000) Epithelial mesenchymal transition by c-Fos estrogen receptor activation involves nuclear translocation of beta-catenin and upregulation of beta-catenin/lymphoid enhancer binding factor-1 transcriptional activity. J Cell Biol 148:173\u0026ndash;188. https://doi.org/10.1083/jcb.148.1.173\u003c/li\u003e\n \u003cli\u003eXiao L, Zhang C, Li X, et al (2021) LEF1 Enhances the Progression of Colonic Adenocarcinoma via Remodeling the Cell Motility Associated Structures. Int J Mol Sci 22:10870. https://doi.org/10.3390/ijms221910870\u003c/li\u003e\n \u003cli\u003eHeino S, Fang S, L\u0026auml;hde M, et al (2021) Lef1 restricts ectopic crypt formation and tumor cell growth in intestinal adenomas. Sci Adv 7:eabj0512. https://doi.org/10.1126/sciadv.abj0512\u003c/li\u003e\n \u003cli\u003eIshitani T, Ninomiya-Tsuji J, Matsumoto K (2003) Regulation of lymphoid enhancer factor 1/T-cell factor by mitogen-activated protein kinase-related Nemo-like kinase-dependent phosphorylation in Wnt/beta-catenin signaling. Mol Cell Biol 23:1379\u0026ndash;1389. https://doi.org/10.1128/MCB.23.4.1379-1389.2003\u003c/li\u003e\n \u003cli\u003eOul\u0026egrave;s B, Rognoni E, Hoste E, et al (2019) Mutant Lef1 controls Gata6 in sebaceous gland development and cancer. EMBO J 38:e100526. https://doi.org/10.15252/embj.2018100526\u003c/li\u003e\n \u003cli\u003eSj\u0026ouml;blom T, Jones S, Wood LD, et al (2006) The consensus coding sequences of human breast and colorectal cancers. Science 314:268\u0026ndash;274. https://doi.org/10.1126/science.1133427\u003c/li\u003e\n \u003cli\u003eWirtz S, Popp V, Kindermann M, et al (2017) Chemically induced mouse models of acute and chronic intestinal inflammation. Nat Protoc 12:1295\u0026ndash;1309. https://doi.org/10.1038/nprot.2017.044\u003c/li\u003e\n \u003cli\u003eAdelman DC, Murray J, Wu T-T, et al (2018) Measuring Change In Small Intestinal Histology In Patients With Celiac Disease. Am J Gastroenterol 113:339\u0026ndash;347. https://doi.org/10.1038/ajg.2017.480\u003c/li\u003e\n \u003cli\u003eGrosheva I, Zheng D, Levy M, et al (2020) High-Throughput Screen Identifies Host and Microbiota Regulators of Intestinal Barrier Function. Gastroenterology 159:1807\u0026ndash;1823. https://doi.org/10.1053/j.gastro.2020.07.003\u003c/li\u003e\n \u003cli\u003eXiong J, Zhou M-F, Wang Y-D, et al (2016) Protein Kinase D2 Protects against Acute Colitis Induced by Dextran Sulfate Sodium in Mice. Sci Rep 6:34079. https://doi.org/10.1038/srep34079\u003c/li\u003e\n \u003cli\u003eCase report of congenital chloride diarrhea and literature review | Article Information | J-GLOBAL. https://jglobal.jst.go.jp/en/detail?JGLOBAL_ID=201902259505858044. Accessed 11 Dec 2025\u003c/li\u003e\n \u003cli\u003eHao R, Cong J, Xiaoying Zh, et al (2025) Analysis of etiological characteristies of infectious diarrhea in children. Journal of Pathogen Biology 20:206\u0026ndash;210. https://doi.org/10.13350/j.cjpb.250214\u003c/li\u003e\n \u003cli\u003eLiu , Wei H, Duan LP, et al (2016) Clinical features of irritable bowel syndrome with small intestinal bacterial overgrowth and apreliminary study of effectiveness of Rifaximin. Natl Med J China 96:1896\u0026ndash;1902. https://doi.org/10.3760/cma.j.issn.0376-2491.2016.24.005\u003c/li\u003e\n \u003cli\u003eLin X, Zhu G, Yang W, et al (2015) Comparison between combined clostridium butyricum and bifidobacterium living powders and saccha-romyces boulardii for prevention of antibiotic-associated diarrhea in children:a randomized,controlled clinical trial. Chin Pediatr Emerg Med 22:257\u0026ndash;261. https://doi.org/10.3760/cma.j.issn.1673-4912.2015.04.011\u003c/li\u003e\n \u003cli\u003eBhowal A, Cardona N, Chua C, et al (2024) Cracking the Codes for Congenital Diarrhea and Enteropathies (CoDEs): A Case Report and Review. Cureus 16:e73529. https://doi.org/10.7759/cureus.73529\u003c/li\u003e\n \u003cli\u003eBischoff SC, Barbara G, Buurman W, et al (2014) Intestinal permeability--a new target for disease prevention and therapy. BMC Gastroenterol 14:189. https://doi.org/10.1186/s12876-014-0189-7\u003c/li\u003e\n \u003cli\u003eWardill HR, Bowen JM, Van Sebille YZA, et al (2016) TLR4-Dependent Claudin-1 Internalization and Secretagogue-Mediated Chloride Secretion Regulate Irinotecan-Induced Diarrhea. Mol Cancer Ther 15:2767\u0026ndash;2779. https://doi.org/10.1158/1535-7163.MCT-16-0330\u003c/li\u003e\n \u003cli\u003eWardill HR, Bowen JM, Al-Dasooqi N, et al (2014) Irinotecan disrupts tight junction proteins within the gut : implications for chemotherapy-induced gut toxicity. Cancer Biol Ther 15:236\u0026ndash;244. https://doi.org/10.4161/cbt.27222\u003c/li\u003e\n \u003cli\u003eSylvestre M, Di Carlo SE, Peduto L (2023) Stromal regulation of the intestinal barrier. Mucosal Immunol 16:221\u0026ndash;231. https://doi.org/10.1016/j.mucimm.2023.01.006\u003c/li\u003e\n \u003cli\u003eShi L, Jin L, Huang W (2023) Bile Acids, Intestinal Barrier Dysfunction, and Related Diseases. Cells 12:1888. https://doi.org/10.3390/cells12141888\u003c/li\u003e\n \u003cli\u003eThiagarajah JR, Donowitz M, Verkman AS (2015) Secretory diarrhoea: mechanisms and emerging therapies. Nat Rev Gastroenterol Hepatol 12:446\u0026ndash;457. https://doi.org/10.1038/nrgastro.2015.111\u003c/li\u003e\n \u003cli\u003eWierzba TF, Muhib F (2018) Exploring the broader consequences of diarrhoeal diseases on child health. Lancet Glob Health 6:e230\u0026ndash;e231. https://doi.org/10.1016/S2214-109X(18)30047-0\u003c/li\u003e\n \u003cli\u003eThiagarajah JR, Kamin DS, Acra S, et al (2018) Advances in Evaluation of Chronic Diarrhea in Infants. Gastroenterology 154:2045-2059.e6. https://doi.org/10.1053/j.gastro.2018.03.067\u003c/li\u003e\n \u003cli\u003eUgboko HU, Nwinyi OC, Oranusi SU, Oyewale JO (2020) Childhood diarrhoeal diseases in developing countries. Heliyon 6:e03690. https://doi.org/10.1016/j.heliyon.2020.e03690\u003c/li\u003e\n \u003cli\u003eConrad MA, Carreon CK, Dawany N, et al (2019) Distinct Histopathological Features at Diagnosis of Very Early Onset Inflammatory Bowel Disease. J Crohns Colitis 13:615\u0026ndash;625. https://doi.org/10.1093/ecco-jcc/jjy212\u003c/li\u003e\n \u003cli\u003eHagiwara S-I, Shimizu H, Nambu R, et al (2025) Feasibility and Safety of Small Bowel Capsule Endoscopy in Very Early-Onset Inflammatory Bowel Disease: A Multi-Institutional Study. Inflamm Bowel Dis 31:3279\u0026ndash;3285. https://doi.org/10.1093/ibd/izaf144\u003c/li\u003e\n \u003cli\u003eWard BJH, Prasai K, Schaal DL, et al (2023) A distinct isoform of lymphoid enhancer binding factor 1 (LEF1) epigenetically restricts EBV reactivation to maintain viral latency. PLoS Pathog 19:e1011873. https://doi.org/10.1371/journal.ppat.1011873\u003c/li\u003e\n \u003cli\u003eZhang J, Humphreys IR, Pei J, et al (2025) Predicting protein-protein interactions in the human proteome. Science 390:eadt1630. https://doi.org/10.1126/science.adt1630\u003c/li\u003e\n \u003cli\u003eKuokkanen M, Kokkonen J, Enattah NS, et al (2006) Mutations in the translated region of the lactase gene (LCT) underlie congenital lactase deficiency. Am J Hum Genet 78:339\u0026ndash;344. https://doi.org/10.1086/500053\u003c/li\u003e\n \u003cli\u003eCaporilli C, Giann\u0026igrave; G, Grassi F, Esposito S (2023) An Overview of Short-Bowel Syndrome in Pediatric Patients: Focus on Clinical Management and Prevention of Complications. Nutrients 15:2341. https://doi.org/10.3390/nu15102341\u003c/li\u003e\n \u003cli\u003eViswanathan VK, Hodges K, Hecht G (2009) Enteric infection meets intestinal function: how bacterial pathogens cause diarrhoea. Nat Rev Microbiol 7:110\u0026ndash;119. https://doi.org/10.1038/nrmicro2053\u003c/li\u003e\n \u003cli\u003eKeusch GT, Denno DM, Black RE, et al (2014) Environmental enteric dysfunction: pathogenesis, diagnosis, and clinical consequences. Clin Infect Dis 59 Suppl 4:S207-212. https://doi.org/10.1093/cid/ciu485\u003c/li\u003e\n \u003cli\u003eBujko M, Kober P, Mikula M, et al (2015) Expression changes of cell-cell adhesion-related genes in colorectal tumors. Oncol Lett 9:2463\u0026ndash;2470. https://doi.org/10.3892/ol.2015.3107\u003c/li\u003e\n \u003cli\u003eLong AJ, Sypek JP, Askew R, et al (2006) Gob-5 contributes to goblet cell hyperplasia and modulates pulmonary tissue inflammation. Am J Respir Cell Mol Biol 35:357\u0026ndash;365. https://doi.org/10.1165/rcmb.2005-0451OC\u003c/li\u003e\n \u003cli\u003eMishra V, Bose A, Kiran S, et al (2021) Gut-associated cGMP mediates colitis and dysbiosis in a mouse model of an activating mutation in GUCY2C. J Exp Med 218:e20210479. https://doi.org/10.1084/jem.20210479\u003c/li\u003e\n \u003cli\u003eShang Z, Zhou L, Liu Y, et al (2025) Tongxie Yaofang attenuates ulcerative colitis by modulating gut microbiota and IL-10RA/NF-\u0026kappa;B-mediated macrophage polarization. Phytomedicine 148:157459. https://doi.org/10.1016/j.phymed.2025.157459\u003c/li\u003e\n \u003cli\u003eLi M, Wu J, Li D, et al (2025) Baicalin ameliorates dextran sulfate solidum-induced colitis by modulating Th17-macrophage immune network via JAK2/STAT3/IL-17/NF-\u0026kappa;B pathway. Phytomedicine 148:157414. https://doi.org/10.1016/j.phymed.2025.157414\u003c/li\u003e\n \u003cli\u003eMiguez PA, Bash E, Musskopf ML, et al (2024) Control of tissue homeostasis by the extracellular matrix: Synthetic heparan sulfate as a promising therapeutic for periodontal health and bone regeneration. Periodontol 2000 94:510\u0026ndash;531. https://doi.org/10.1111/prd.12515\u003c/li\u003e\n \u003cli\u003eTian Y, Jian T, Li J, et al (2024) Phenolic acids from Chicory roots ameliorate dextran sulfate sodium-induced colitis in mice by targeting TRP signaling pathways and the gut microbiota. Phytomedicine 128:155378. https://doi.org/10.1016/j.phymed.2024.155378\u003c/li\u003e\n \u003cli\u003eWang J, Yang Y, Shi Y, et al (2024) Oxidized/unmodified-polyethylene microplastics neurotoxicity in mice: Perspective from microbiota-gut-brain axis. Environ Int 185:108523. https://doi.org/10.1016/j.envint.2024.108523\u003c/li\u003e\n \u003cli\u003eLiu M, Wang Y, Xu X, et al (2024) p-hydroxy benzaldehyde attenuates intestinal epithelial barrier dysfunction caused by colitis via activating the HNF-1\u0026beta;/SLC26A3 pathway. Front Pharmacol 15:1448863. https://doi.org/10.3389/fphar.2024.1448863\u003c/li\u003e\n \u003cli\u003eVillarreal AM, Lamadrid VG, Sanchez A, M\u0026uacute;nera M (2025) Aquaporins in Allergic Response: A New Player. Clin Rev Allergy Immunol 68:71. https://doi.org/10.1007/s12016-025-09083-w\u003c/li\u003e\n \u003cli\u003eSakai H, Sagara A, Matsumoto K, et al (2014) Neutrophil recruitment is critical for 5-fluorouracil-induced diarrhea and the decrease in aquaporins in the colon. Pharmacol Res 87:71\u0026ndash;79. https://doi.org/10.1016/j.phrs.2014.05.012\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"molecular-and-cellular-pediatrics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"macp","sideBox":"Learn more about [Molecular and Cellular Pediatrics](http://molcellped.springeropen.com)","snPcode":"40348","submissionUrl":"https://submission.nature.com/new-submission/40348/3","title":"Molecular and Cellular Pediatrics","twitterHandle":"@springeropen","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"LEF1, Intestinal Barrier, Diarrhea, Mutation","lastPublishedDoi":"10.21203/rs.3.rs-8469007/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8469007/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eThrough investigating pediatric intractable chronic diarrhea, we identified a de novo, unreported heterozygous missense mutation in LEF1 (c.880C\u0026thinsp;\u0026gt;\u0026thinsp;T, p.Pro294Ser) via whole-exome sequencing in a 1.5-year-old boy with 4-year persistent yellow-green watery diarrhea, complicated by protein-energy malnutrition and growth retardation refractory to conventional therapies. Gastrointestinal endoscopy revealed mucosal swelling with mild chronic inflammation, and the variant was absent from public databases. Functional validation using Lef1 P292S (human P294S ortholog) knock-in mice demonstrated increased DSS-induced diarrhea susceptibility, inherent intestinal structural defects, and compromised barrier integrity. Molecular and proteomic analyses confirmed downregulated tight junction protein and aquaporin 4 in mutant mice and patient tissues, alongside dysregulated ion transport, epithelial adhesion, and inflammatory pathways. Mechanistically, the conserved regulatory domain-localized LEF1 P294S mutation disrupts Wnt/β-catenin transcriptional regulation, impairing intestinal barrier function and water-electrolyte balance. Our study establishes LEF1 P294S as a pathogenic variant for pediatric chronic diarrhea, expands LEF1\u0026rsquo;s role in intestinal homeostasis, and provides a novel diagnostic marker and therapeutic target.\u003c/p\u003e","manuscriptTitle":"LEF1 Gene Mutation Impairs Intestinal Barrier and Causes Diarrhea","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-20 11:11:28","doi":"10.21203/rs.3.rs-8469007/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2026-02-16T08:46:14+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-15T03:59:49+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-02-12T13:48:32+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"125131470782386170945806966728802735917","date":"2026-02-07T13:36:35+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"58552026627752194167288707048341121300","date":"2026-02-02T14:27:17+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-15T21:11:11+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-15T21:04:44+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-02T07:39:18+00:00","index":"","fulltext":""},{"type":"submitted","content":"Molecular and Cellular Pediatrics","date":"2025-12-29T04:05:58+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"molecular-and-cellular-pediatrics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"macp","sideBox":"Learn more about [Molecular and Cellular Pediatrics](http://molcellped.springeropen.com)","snPcode":"40348","submissionUrl":"https://submission.nature.com/new-submission/40348/3","title":"Molecular and Cellular Pediatrics","twitterHandle":"@springeropen","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"2c5ae22c-ef6c-4e09-aef8-c570ca12ea65","owner":[],"postedDate":"January 20th, 2026","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-05-08T07:10:51+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-20 11:11:28","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8469007","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8469007","identity":"rs-8469007","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.