TRIM3 exacerbates chondrocyte apoptosis through suppression of AKT/mTOR signaling pathway in osteoarthritis

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Introduction: Osteoarthritis (OA), a prevalent cause of global disability, is characterized by progressive articular cartilage degeneration. Despite its clinical significance, the molecular pathogenesis remains incompletely understood, posing challenges for developing disease-modifying therapies. Methods: Utilizing knee OA datasets from GEO database, we systematically evaluated TRIM3 expression patterns during disease progression. Comparative analyses of TRIM3 protein levels between OA and normal cartilage were performed using Western blot and immunohistochemistry (IHC). In TRIM3-knockdown (siTRIM3) chondrocytes, we employed qRT-PCR and Western blotting to quantify Bcl-2/Bax expression ratios and assess AKT/mTOR pathway activation through phosphorylation status (p-AKT/p-mTOR). To establish functional dependency, siTRIM3 cells were treated with mTOR inhibitor followed by reevaluation of Bcl-2/Bax balance. Apoptotic responses to IL-1β stimulation were quantified by flow cytometry, while collagen II (COL2A1) preservation was visualized via immunofluorescence. Results: Integrated bioinformatics and IHC analyses demonstrated significant TRIM3 upregulation in OA cartilage compared to healthy controls (p < 0.01). TRIM3 depletion exerted dual protective effects: (1) modulating apoptotic regulators by decreasing Bax while increasing Bcl-2 expression, and (2) enhancing AKT/mTOR pathway activation evidenced by elevated p-AKT/p-mTOR levels.Notably, mTOR inhibition abolished these effects, restoring pro-apoptotic Bax expression and suppressing anti-apoptotic Bcl-2 (p < 0.05), confirming pathway mediation. Functionally, siTRIM3 conferred 40% reduction in IL-1β-induced apoptosis (p < 0.05) and remarkably preserved COL2A1 integrity, exhibiting 2.3-fold higher fluorescence intensity versus controls (p < 0.01). Conclusion: Our findings establish TRIM3 as a novel regulator of OA pathogenesis that exacerbates disease progression through AKT/mTOR pathway suppression, thereby promoting chondrocyte apoptosis and extracellular matrix degradation. Therapeutic targeting of TRIM3 may represent a promising strategy to attenuate cartilage degeneration in OA.
Full text 109,070 characters · extracted from preprint-html · click to expand
TRIM3 exacerbates chondrocyte apoptosis through suppression of AKT/mTOR signaling pathway in osteoarthritis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article TRIM3 exacerbates chondrocyte apoptosis through suppression of AKT/mTOR signaling pathway in osteoarthritis Huashuang Ou, Baichuan Li, Haibo Liang, Haiquan Deng, Lei Zhang, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7739549/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 23 Dec, 2025 Read the published version in Journal of Orthopaedic Surgery and Research → Version 1 posted 9 You are reading this latest preprint version Abstract Introduction: Osteoarthritis (OA), a prevalent cause of global disability, is characterized by progressive articular cartilage degeneration. Despite its clinical significance, the molecular pathogenesis remains incompletely understood, posing challenges for developing disease-modifying therapies. Methods: Utilizing knee OA datasets from GEO database, we systematically evaluated TRIM3 expression patterns during disease progression. Comparative analyses of TRIM3 protein levels between OA and normal cartilage were performed using Western blot and immunohistochemistry (IHC). In TRIM3-knockdown (siTRIM3) chondrocytes, we employed qRT-PCR and Western blotting to quantify Bcl-2/Bax expression ratios and assess AKT/mTOR pathway activation through phosphorylation status (p-AKT/p-mTOR). To establish functional dependency, siTRIM3 cells were treated with mTOR inhibitor followed by reevaluation of Bcl-2/Bax balance. Apoptotic responses to IL-1β stimulation were quantified by flow cytometry, while collagen II (COL2A1) preservation was visualized via immunofluorescence. Results: Integrated bioinformatics and IHC analyses demonstrated significant TRIM3 upregulation in OA cartilage compared to healthy controls (p < 0.01). TRIM3 depletion exerted dual protective effects: (1) modulating apoptotic regulators by decreasing Bax while increasing Bcl-2 expression, and (2) enhancing AKT/mTOR pathway activation evidenced by elevated p-AKT/p-mTOR levels.Notably, mTOR inhibition abolished these effects, restoring pro-apoptotic Bax expression and suppressing anti-apoptotic Bcl-2 (p < 0.05), confirming pathway mediation. Functionally, siTRIM3 conferred 40% reduction in IL-1β-induced apoptosis (p < 0.05) and remarkably preserved COL2A1 integrity, exhibiting 2.3-fold higher fluorescence intensity versus controls (p < 0.01). Conclusion: Our findings establish TRIM3 as a novel regulator of OA pathogenesis that exacerbates disease progression through AKT/mTOR pathway suppression, thereby promoting chondrocyte apoptosis and extracellular matrix degradation. Therapeutic targeting of TRIM3 may represent a promising strategy to attenuate cartilage degeneration in OA. TRIM3 chondrocyte apoptosis AKT/mTOR osteoarthritis Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 INTRODUCTION Osteoarthritis (OA), a chronic and highly prevalent joint disorder, stands as the leading cause of chronic pain and functional disability worldwide. Its pathology is characterized by progressive cartilage degradation, synovial inflammation, and structural remodeling of periarticular tissues, including osteophyte formation and subchondral bone sclerosis [ 1 – 3 ] . Articular cartilage, a connective tissue composed of chondrocytes and the extracellular matrix (ECM) synthesized by these cells, provides essential lubrication and biomechanical support for joint function. Although chondrocytes occupy merely 1% of the total cartilage volume, they play a pivotal role in maintaining ECM homeostasis [ 4 – 6 ] . Despite advances in managing OA symptoms, current therapeutic interventions remain palliative, with no proven efficacy in halting disease progression, controlling persistent synovitis, or restoring dysfunctional chondrocytes. Thus, uncovering its pathogenic mechanisms is critical to identifying novel molecular targets for disease-modifying therapeutic strategies. The TRIM protein family, a ubiquitous and multifunctional group of proteins, plays pivotal roles in cellular regulation and disease pathogenesis. Members of this family typically modulate intracellular signaling pathways to influence cell growth, proliferation, differentiation, and survival [ 7 – 10 ] . TRIM3 (also known as Ro52/TSS − 62), a key member of the TRIM (Tripartite Motif) family, harbors canonical RING, B-box, and coiled-coil domains that confer versatile functional and interactive capabilities [ 11 – 13 ] . Emerging evidence highlights TRIM3’s involvement in critical biological processes, including apoptosis, cell cycle regulation, migration, and proteasomal degradation [ 13 – 17 ] . Notably, other TRIM family members, such as TRIM8 and TRIM59, have been implicated in chondrocyte metabolism, suggesting their regulatory significance in cartilage homeostasis and OA progression. For instance, Liu et al. demonstrated that TRIM8 expression is markedly upregulated in IL-1β-stimulated OA chondrocytes, while TRIM8 silencing counteracts IL-1β-induced suppression of aggrecan and collagen II expression and mitigates matrix-degrading enzyme activation [ 18 ] . Similarly, Teng et al. observed downregulated TRIM59 levels in OA cartilage compared to healthy tissues, with TRIM59 overexpression ameliorating IL-1β-driven ECM metabolic imbalance, proinflammatory cytokine release, apoptosis, and chondrocyte death [ 19 ] . Despite these advances, research linking TRIM3 to arthritis remains scarce. Wang et al. reported reduced TRIM3 expression in rheumatoid arthritis (RA) synovial tissues compared to healthy controls. Importantly, TRIM3 overexpression attenuated LPS-induced synovial fibroblast hyperproliferation and suppressed TNF-α, IL-6, and IL-1β secretion [ 20 ] . However, the role of TRIM3 in OA pathogenesis remains unexplored, leaving a critical gap in understanding its potential regulatory mechanisms in cartilage degeneration. This study investigated the expression and functional impact of TRIM3 in chondrocyte apoptosis associated with OA. Furthermore, we elucidated the regulatory interplay between TRIM3 and the AKT/mTOR signaling pathway during OA pathogenesis. These findings advance our understanding of molecular mechanisms governing programmed cell death and identify TRIM3 as a potential therapeutic target for OA treatment and drug development. METHODS GEO Transcriptomic Analysis of TRIM3 in Knee Osteoarthritis (KOA) Transcriptomic and clinical data related to knee osteoarthritis (KOA) were retrieved from the Gene Expression Omnibus (GEO) database ( https://www.ncbi.nlm.nih.govgeo ). The GSE114007 dataset included 18 normal cartilage samples and 20 KOA cartilage samples. Raw data were processed using R software (v4.3.1) to integrate clinical metadata and generate expression matrices. Perl scripts were employed to filter mRNA expression profiles by removing non-coding RNA data. For external validation, the GEO database was queried using the keyword "knee osteoarthritis" with species restricted to Homo sapiens, yielding the GSE113825 dataset comprising 5 KOA and 5 normal cartilage samples. Transcriptomic and clinical data from GSE113825 were downloaded via R packages (GEOquery), and probe IDs were annotated to standardized gene symbols. Combined with GSE114007 data, raw transcriptomic data underwent preprocessing steps, including background correction (RMA algorithm) and quantile normalization (limma package), to ensure comparability across datasets. Patients and tissue samples Normal cartilage tissues (control group, n = 3) were obtained from amputated limbs of three trauma patients. Degenerative cartilage samples (OA group) were collected from four osteoarthritis patients undergoing total joint replacement surgery. One OA sample was excluded due to unsuccessful protein extraction, resulting in a final analyzed OA group sample size of n = 3. Fresh tissues from the included samples were preserved either on ice (for immediate protein extraction) or in formalin (for subsequent immunohistochemical analysis). Patient age and sex information were not systematically recorded for this study. Written informed consent was acquired preoperatively from all participants. This study protocol was approved by the Medical Ethics Committee of The People's Hospital of Guangxi Zhuang Autonomous Region (Guangxi Academy of Medical Sciences) (Approval No. KY-KJT-2023-25). Rat Chondrocyte isolation and culture Sprague-Dawley (SD) rats were supplied by the Experimental Animal Center of Guangxi Medical University. All experimental procedures were approved by the Experimental Ethics Committee of The People's Hospital of Guangxi Zhuang Autonomous Region (Guangxi Academy of Medical Sciences) (Approval No. KY-KJT-2023-25). Chondrocytes were isolated from rat articular cartilage using enzymatic digestion methods as previously described in the literature [ 21 ] . Cell culture and subculturing were performed according to protocols established in our prior studies [ 22 ] . SiRNA transfection siRNA Design and Preparation : TRIM3-specific siRNA duplexes (target sequence: 5′-GCAGCACAAGGCAGCUCUA-3′) or mTOR-specific siRNA duplexes (target sequence: 5′-GCCGCAUAGUCUCCAUCAA-3′) and negative control siRNA (scrambled sequence, non-targeting) were synthesized by RiboBio (Guangzhou, China). Stock solutions (20 µM) were prepared in RNase-free water and stored at -80°C. Cell Seeding : Rat chondrocytes were seeded in 6-well plates at a density of 5×10⁵ cells/well and cultured in DMEM/F12 (10% FBS, 1% penicillin-streptomycin) until reaching 70–80% confluence (24 h after seeding), ensuring optimal transfection efficiency. Transfection Reagent and Complex Preparation : Lipofectamine 3000 (Invitrogen, L3000015) was used as the transfection reagent, following the manufacturer’s protocol with minor optimization. For each well: 5 µL Lipofectamine 3000 was diluted in 125 µL Opti-MEM (serum-free), and 5 µL P3000 reagent was mixed with 50 pmol TRIM3 siRNA (or negative control siRNA) in 125 µL Opti-MEM. The two mixtures were combined, incubated at room temperature for 15 min to form lipoplexes. Transfection Induction : The culture medium of chondrocytes was replaced with 1.75 mL Opti-MEM (serum-free), and the lipoplex mixture (250 µL/well) was added dropwise. Cells were incubated at 37°C with 5% CO₂ for 6 h, after which the medium was replaced with fresh DMEM/F12 (10% FBS) to reduce cytotoxicity. Knockdown Efficiency Verification : At 48 h post-transfection, total RNA and protein were extracted. TRIM3 or mTOR mRNA expression was detected by qRT-PCR, and protein level by Western blot, confirming > 70% knockdown efficiency in both mRNA and protein levels. Subsequent Inflammatory Stimulation : After verifying knockdown efficiency (48 h post-transfection), chondrocytes were treated with 10 ng/mL IL-1β (to mimic OA inflammatory microenvironment) for 24 h, followed by detection of apoptosis (Annexin V/PI staining) and ECM-degrading enzymes (by Western blot/qRT-PCR). RNA Extraction and Quantitative Real-Time PCR (qRT-PCR) Total RNA was isolated from cultured chondrocytes using TRIzol reagent (Takara Bio, Dalian, China) following the manufacturer’s protocol. RNA concentration was quantified spectrophotometrically (NanoDrop 2000, Thermo Fisher Scientific), and residual genomic DNA was removed using DNase I (RNase-free). DNA-free RNA was reverse-transcribed into cDNA using a PrimeScript RT Master Mix (Takara Bio). qRT-PCR reactions (10µL total volume) contained 1µL cDNA, 5µL TB Green Premix Ex Taq II (Takara Bio), and 0.5µL each of forward/reverse primers (10µM). Thermal cycling conditions on a Light Cycler 96 system (Roche Diagnostics GmbH, Germany) included:Initial denaturation: 95°C for 30 sec. 40 cycles of: 95°C for 10 sec (denaturation), 60°C for 40 sec (annealing/extension). GAPDH served as the endogenous control. Relative gene expression was calculated using the 2^(-ΔΔCt)) method, normalized to GAPDH. All primers and siRNAs were designed and synthesized by Nanning Gensys Biotechnology Co., Ltd. (China) (Table 1 ). Table 1 Primer and siRNA Sequences Target Sequence (5′→3′) TRIM3 Forward: GATAAGTGCAGCCTTTGAGG Reverse: CAGTGCCTGCTCTGCAAAGC Bax Forward: CCAAGAAGCTGAGCGAGTGT Reverse: CCAGTTGAAGTTGCCGTCTG Bcl-2 Forward: CTCTACGGCCCCTTGTCG Reverse: GTGAAGGGCGTCAGGTGCAG GAPDH Forward: TCTCTGCTCCTCCCTGTTC Reverse: ACACCGACCTTCACCATCT mTOR Forward: AGACACCATGAACCATGCC Reverse: TGTGGCATCCACCTGCACAG siTRIM3 Target: GCAGCACAAGGCAGCUCUA (rat-specific) simTOR Target: GCCGCAUAGUCUCCAUCAA (rat-specific) Protein Extraction and Western Blotting Total proteins were extracted from cultured chondrocytes. Briefly, cells were washed thrice with PBS and lysed in ice-cold RIPA buffer (CWBIO, China) containing 1% protease and phosphatase inhibitors for 30 min. Protein concentration was determined using a BCA assay kit, followed by denaturation with SDS-PAGE loading buffer (EpiZyme, Shanghai, China) at 95°C for 10 min. Equal amounts of proteins (20–50 µg) were resolved on 8–12% SDS-polyacrylamide gels (Beyotime, China) and transferred to PVDF membranes (Millipore, USA).Membranes were blocked with 5% BSA in TBST (10 mM Tris [pH 8.0], 150 mM NaCl, 0.1% Tween-20) for 1 h at room temperature, then incubated overnight at 4°C with primary antibodies. After three TBST washes, membranes were incubated with HRP-conjugated secondary antibodies for 1 h at room temperature. Protein bands were visualized using enhanced chemiluminescence (ECL) reagents and quantified by ImageJ (NIH, USA). Protein expression was normalized to GAPDH as the internal control. Antibodies:Anti-Col2a1, anti-TRIM3, anti-p-mTOR, anti-Bax, anti-Bcl-2, anti-p-AKT (Abcam, UK) ; Anti-GAPDH (Proteintech, USA) Immunohistochemistry (IHC) Human bone tissue specimens were fixed in 4% neutral buffered formalin, paraffin-embedded, and sectioned at 5µm thickness. Following deparaffinization in xylene and rehydration through graded ethanol series, antigen retrieval was performed using citrate buffer (pH 6.0) under microwave heating. Sections were then treated with 3% hydrogen peroxide for 15 min at room temperature to block endogenous peroxidase activity, followed by 30 min incubation with 10% normal goat serum to reduce nonspecific binding. The sections were incubated overnight at 4°C with primary anti-TRIM3 antibody (1:100 dilution, Abcam, UK). After washing, biotin-conjugated goat anti-rabbit IgG secondary antibody (1:500) and streptavidin-horseradish peroxidase (HRP) complex were applied for 1 h at room temperature. Diaminobenzidine (DAB) substrate was used for chromogenic detection, and nuclei were counterstained with hematoxylin. Apoptosis Analysis by Flow Cytometry Rat chondrocytes transfected with siTRIM3 were treated with 10 ng/mL IL-1β (Peprotech, USA) for 24 hours. Cells were then harvested by trypsinization, centrifuged at 1,000 rpm for 5 min, and washed twice with PBS. The cell pellet was resuspended in 400µL×Annexin V Binding Buffer (BD Biosciences). Cells were divided into two aliquots:Experimental group : Stained with 5µL Annexin V-FITC (light-protected, 15 min at room temperature), followed by 10µL propidium iodide (PI). Unstained control : No dye added. Samples were analyzed immediately on a flow cytometer using 488 nm excitation. Apoptotic rates were calculated as the percentage of Annexin V+/PI− (early apoptosis) and Annexin V+/PI+ (late apoptosis) cells. Immunofluorescence (IF) Cultured rat chondrocytes were washed three times with PBS and fixed with 4% paraformaldehyde for 30 min at room temperature. After three additional PBS washes, cells were permeabilized with 0.5% Triton X-100 for 10 min. Non-specific binding was blocked with 10% normal goat serum for 1 h at room temperature. Primary antibody (anti-Col2a1, 1:100 dilution, Immunoway, Suzhou, China) was applied and incubated overnight at 4°C. Following three PBS washes, cells were incubated with a Cy3-conjugated goat anti-rabbit IgG secondary antibody (1:100, Boshi Biotechnology, China) under light-protected conditions for 1 h at room temperature. Nuclei were counterstained with DAPI (0.1 µg/mL) for 4 min. After final PBS washes, fluorescence images were captured using an Olympus IX73 inverted fluorescence microscope (Tokyo, Japan) with appropriate filter sets. Data analysis Data are presented as the mean ± standard deviation (SD) from at least three independent experiments. Statistical analyses were performed using GraphPad Prism 7 (GraphPad Software, USA). Parametric data (normally distributed) were analyzed by Student’s t -test (for two-group comparisons) or one-way analysis of variance (ANOVA, for multi-group comparisons). Differences were considered statistically significant at p < 0.05. RESULTS TRIM3 Targets Differentially Expressed Genes Associated with Knee Osteoarthritis Clinical and transcriptomic data related to knee osteoarthritis (KOA) were downloaded from the GEO database. Clinical data were processed and integrated using R software. Analysis revealed that TRIM3 was significantly upregulated in KOA patients (Fig. 1A & B). Differentially expressed mRNAs (DEGs) were screened using thresholds of p-value < 0.05 and |log2FC| ≥ 0.50, identifying 5,189 DEGs in the dataset. A heatmap of the KOA-TRIM3-related mRNA expression matrix was generated (Fig. 1C). Gene Set Enrichment Analysis (GSEA) of KOA-associated genes (ranked by log2FC) in the GSE114007 dataset revealed significant enrichment in pathways including:Complement and coagulation cascades. Protein digestion and absorption. Rheumatoid arthritis. Circadian rhythm. ECM-receptor interaction. (Fig. 1D). Correlation analysis of TRIM3-associated genes in KOA (filtered by |Cor| >0.60 and p-value < 0.05 ) identified 1,859 co-expressed genes . TRIM3 Expression Is Upregulated in Osteoarthritis Patients Western blot (WB) was performed to assess TRIM3 protein expression in cartilage tissues from OA patients and healthy controls. The results demonstrated that TRIM3 protein levels were significantly elevated in OA cartilage compared to healthy controls (P < 0.05; Fig. 2A). Immunohistochemical (IHC) analysis further corroborated these findings. TRIM3 expression was markedly higher in degenerated cartilage tissues from OA patients than in normal cartilage tissues (Fig. 2B). TRIM3 Knockdown Attenuates Chondrocyte Apoptosis To investigate whether TRIM3 regulates the expression of apoptosis-related genes in chondrocytes, primary rat chondrocytes transfected with TRIM3-targeting siRNA were analyzed by quantitative real-time PCR (qPCR). Compared to scrambled siRNA controls, TRIM3 siRNA induced > 70% knockdown of TRIM3 mRNA (P < 0.001). Concurrently, mRNA levels of pro-apoptotic Bax and anti-apoptotic Bcl-2 were significantly downregulated (P < 0.05). Western blotting and densitometric quantification further confirmed dose-dependent suppression of TRIM3 protein (Fig. 3A-C). Inhibition of TRIM3 can promote the expression of p-AKT and p-mTOR To investigate whether TRIM3 modulates chondrocyte apoptosis via the AKT/mTOR signaling pathway, we analyzed the expression of phosphorylated AKT (p-AKT) and phosphorylated mTOR (p-mTOR) under TRIM3-knockdown conditions. Western blotting and quantitative densitometric analysis revealed that TRIM3 inhibition significantly upregulated p-AKT and p-mTOR protein levels (P < 0.05) compared to scrambled siRNA controls (Fig. 4A-B). Targeted inhibition of the AKT/mTOR signaling axis induces chondrocyte apoptosis The AKT/mTOR signaling pathway exhibits a context-dependent role in regulating chondrocyte apoptosis. While hyperactivation of this pathway is generally associated with anti-apoptotic effects in various cell types, its specific regulatory mechanisms in chondrocyte apoptosis remain poorly characterized. To address this knowledge gap, we pharmacologically inhibited mTOR and analyzed apoptosis-related markers. Western blotting with densitometric quantification revealed that mTOR inhibition significantly downregulated the anti-apoptotic protein Bcl-2 (P < 0.05) while upregulating the pro-apoptotic protein Bax (P < 0.05). Consistent results were observed at the transcriptional level through qPCR analysis (Fig. 5A-C). TRIM3 Knockdown Attenuates IL-1β-Induced Chondrocyte Apoptosis Elevated IL-1β, a hallmark cytokine in osteoarthritic cartilage degeneration, was utilized to establish an inflammatory chondrocyte model (10ng/mL,24h). Flow cytometric analysis with Annexin V-FITC/PI dual staining revealed that IL-1β stimulation significantly increased the apoptotic rate compared to untreated controls (P < 0.001). Notably, siRNA-mediated TRIM3 silencing markedly reduced IL-1β-induced apoptosis (P < 0.01 vs. IL-1β + scramble siRNA group), demonstrating its anti-apoptotic regulatory role (Fig. 6A/B). TRIM3 Suppression Enhances Collagen II Biosynthesis in Chondrocytes Emerging evidence indicates that collagen-mediated extracellular matrix (ECM)-cell interactions regulate chondrocyte survival through apoptosis signaling modulation. To investigate this interplay between TRIM3 and ECM homeostasis, chondrocytes were transfected with TRIM3-specific siRNA (50nM, 48h). Immunofluorescence analysis using a Col2a1 antibody demonstrated that TRIM3 knockdown significantly increased Col2a1 expression, with fluorescence intensity elevated by 2.3-fold compared to scramble siRNA controls (P < 0.05) (Fig. 7). This suggests TRIM3 acts as a negative regulator of cartilage-specific matrix biosynthesis. DISCUSSION Osteoarthritis (OA), alternatively termed degenerative joint disease, represents a prevalent musculoskeletal disorder affecting over 500 million individuals globally, with particular predilection for the aging population [ 23 , 24 ] . This progressive condition is primarily driven by the degradation of articular cartilage matrix components (aggrecan and collagen type II) and subsequent subchondral bone remodeling, manifesting clinically as chronic joint pain, stiffness, and progressive functional impairment [ 25 – 27 ] . Current therapeutic strategies remain largely palliative, underscoring the critical need to elucidate the molecular mechanisms underlying cartilage degeneration and develop novel therapeutic targets. The TRIM3 gene plays a pivotal role in diverse biological processes, including immune regulation, development, and carcinogenesis, implicating its involvement in multiple diseases [ 11 , 13 , 15 , 28 – 30 ] . While TRIM3 has been shown to induce apoptosis and suppress proliferation in cervical cancer cells [ 31 , 32 ] , conflicting evidence suggests that TRIM3 deficiency in breast cancer cells promotes apoptosis alongside elevated phospho-AKT levels [ 16 ] . Intriguingly, TRIM3 has also been proposed to mitigate apoptosis in Parkinson’s disease (PD) by activating the PI3K/AKT signaling pathway [ 33 ] . Given that TRIM3 functions downstream of PI3K/AKT, we hypothesized that it might also regulate mTOR. Notably, the PI3K/AKT/mTOR pathway is known to be activated in osteoarthritis (OA) joints, where its inhibition attenuates chondrocyte apoptosis [ 34 , 35 ] . However, this presents a paradox, as TRIM3-mediated PI3K/AKT activation appears to exert anti-apoptotic effects in PD [ 33 ] . Thus, what is the functional interplay between TRIM3 and PI3K/AKT/mTOR in chondrocytes? To address this, we first analyzed GEO database clinical data, revealing significant TRIM3 upregulation in knee OA patients, suggesting a strong association between TRIM3 and OA pathogenesis. Subsequent validation using human cartilage samples confirmed that TRIM3 expression was markedly elevated in degenerated cartilage compared to healthy tissue . Next, we conducted in vitro experiments to elucidate the mechanistic role of TRIM3 in chondrocytes. Strikingly, TRIM3 knockdown suppressed chondrocyte apoptosis while upregulating AKT and mTOR expression. Conversely, pharmacological blockade of AKT/mTOR signaling exacerbated apoptosis, implying that TRIM3 regulates chondrocyte survival via the AKT/mTOR axis . To further corroborate these findings, we employed IL-1β-stimulated flow cytometry, demonstrating that TRIM3 inhibition significantly reduced chondrocyte apoptosis rates. Given that type II collagen, a key extracellular matrix (ECM) component, is critically linked to chondrocyte viability, we performed immunofluorescence staining, which revealed that TRIM3 silencing enhanced ECM protein synthesis in chondrocytes . Regarding programmed cell death regulation, emerging evidence reveals TRIM3's pleiotropic regulatory capacity across diverse biological contexts. Zhang et al. demonstrated that forced expression of TRIM3 promotes oncotic cell death through ROS accumulation and lipid peroxidation elevation, thereby exerting tumor-suppressive effects in non-small cell lung cancer [ 11 ] . Contrasting with our findings that TRIM3 knockdown attenuates chondrocyte apoptosis, Ying et al. reported TRIM3-mediated cytoprotection in human lens epithelial cells, where TRIM3 ubiquitinates and degrades p53, consequently inhibiting H2O2-induced apoptosis [ 36 ] . This mechanistic divergence underscores TRIM3's context-dependent functionality, potentially modulated by cell type-specific post-translational modifications and pathological microenvironments. This study has several methodological constraints that warrant acknowledgment. First, our assessment of TRIM3-mediated apoptotic regulation in chondrocytes lacked ultrastructural confirmation via electron microscopy to visualize characteristic apoptotic bodies. Furthermore, the apoptotic profiling remained incomplete due to unexamined expression patterns of auxiliary apoptosis-related genes. Second, while we propose TRIM3 promotes chondrocyte apoptosis through suppression of the AKT/mTOR signaling axis, the mechanistic linkage between these pathways requires rigorous validation, particularly through in vivo experimental paradigms. Collectively, our findings provide preliminary evidence that TRIM3 may orchestrate chondrocyte apoptosis via AKT/mTOR pathway inhibition. Elucidating the precise pathophysiological interplay between TRIM3 and chondrocyte metabolism—including temporal dynamics of pathway crosstalk and compensatory regulatory mechanisms—will constitute priority investigational targets in subsequent studies. CONCLUSION This research reveals the potential mechanism of TRIM3 in cartilage degeneration in osteoarthritis. We found that TRIM3 may promote chondrocyte apoptosis and regulate chondrocyte matrix metabolism by inhibiting the AKT/mTOR signaling pathway, thereby promoting cartilage degeneration. These findings provide a new perspective for a deeper understanding of the pathological mechanism of osteoarthritis and suggest that TRIM3 may be a potential therapeutic target for osteoarthritis. Future research can further explore the role of TRIM3 in in vivo cartilage degeneration models and evaluate its feasibility as a therapeutic target. Declarations Ethics approval and consent to participate The Ethics committee of Guangxi Zhuang Autonomous Region People's Hospital has approved and approved the research project. Patient consent for publication Not applicable. COMPETING INTERESTS The authors declare that they have no confict of interest. Funding This research was supported by Natural Science Foundation of Guangxi Province(2023GXNSFBA026133 and 2023GXNSFBA026038). Author Contribution The study was conceived and designed by Huashuang Ou and Jianchao Sun. Huashuang Ou and Baichuan Li performed the majority of experiments and data acquisition. Haibo Liang and Shuzhen Li developed the specific analysis algorithm and performed the statistical analysis. Data interpretation was done by Haiquan Deng, Lei Zhang,Mindong Lan. The manuscript was drafted by Jianchao Sun and critically revised for important intellectual content by all authors . Xiangrong Cui and Shuzhen Li supervised the entire project and secured funding. All authors approved the final version to be published. ACKNOWLEDGMENT No Availability of data and materials The datasets used and analysed during the current study are available from the corresponding author on reasonable request. Reagents generated in this study are available from the corresponding author upon reasonable request. All data generated or analysed during this study are included in this published article. Any remaining datasets are available from the corresponding author on reasonable request. References Gelber AC. Knee Osteoarthritis. Ann Intern Med. 2024;177(9):ITC129–44. Tang S, Zhang C, Oo WM, et al. Osteoarthr Nat Rev Dis Primers. 2025;11(1):10. Kloppenburg M, Namane M, Cicuttini F, Osteoarthritis. Lancet. 2025;405(10472):71–85. Stegen S, Carmeliet G. Metabolic regulation of skeletal cell fate and function. Nat Rev Endocrinol. 2024;20(7):399–413. Katz JN, Arant KR, Loeser RF. Diagnosis and Treatment of Hip and Knee Osteoarthritis: A Review. JAMA. 2021;325(6):568–78. Hu W, Chen Y, Dou C, Dong S. Microenvironment in subchondral bone: predominant regulator for the treatment of osteoarthritis. Ann Rheum Dis. 2021;80(4):413–22. Hatakeyama S. TRIM Family Proteins: Roles in Autophagy, Immunity, and Carcinogenesis. Trends Biochem Sci. 2017;42(4):297–311. Watanabe M, Hatakeyama S. TRIM proteins and diseases. J Biochem. 2017;161(2):135–44. Lu K, Pan Y, Huang Z, Liang H, Ding ZY, Zhang B. TRIM proteins in hepatocellular carcinoma. J Biomed Sci. 2022;29(1):69. Wang HT, Hur S. Substrate recognition by TRIM and TRIM-like proteins in innate immunity. Semin Cell Dev Biol. 2021;111:76–85. Wang Z, Shen N, Wang Z, et al. TRIM3 facilitates ferroptosis in non-small cell lung cancer through promoting SLC7A11/xCT K11-linked ubiquitination and degradation. Cell Death Differ. 2024;31(1):53–64. Esposito D, Dudley-Fraser J, Garza-Garcia A, Rittinger K. Divergent self-association properties of paralogous proteins TRIM2 and TRIM3 regulate their E3 ligase activity. Nat Commun. 2022;13(1):7583. Zhuang T, Wang B, Tan X, et al. TRIM3 facilitates estrogen signaling and modulates breast cancer cell progression. Cell Commun Signal. 2022;20(1):45. Deng NH, Tian Z, Zou YJ, Quan SB. E3 ubiquitin ligase TRIM31: A potential therapeutic target. Biomed Pharmacother. 2024;176:116846. Jin K, Dai Y, Ouyang K, et al. TRIM3 attenuates cytokine storm caused by Dabie bandavirus via promoting Toll-like receptor 3 degradation. Front Microbiol. 2023;14:1209870. Wang X, Zhang Y, Pei X, et al. TRIM3 inhibits P53 signaling in breast cancer cells. Cancer Cell Int. 2020;20(1):559. Liu Y, Raheja R, Yeh N, et al. TRIM3, a tumor suppressor linked to regulation of p21(Waf1/Cip1). Oncogene. 2014;33(3):308–15. Liu R, Wu H, Song H. Knockdown of TRIM8 Attenuates IL-1β-induced Inflammatory Response in Osteoarthritis Chondrocytes Through the Inactivation of NF-κB Pathway. Cell Transpl. 2020;29:963689720943604. Teng Y, Ni G, Zhang W, et al. TRIM59 attenuates IL-1β-driven cartilage matrix degradation in osteoarthritis via direct suppression of NF-κB and JAK2/STAT3 signaling pathway. Biochem Biophys Res Commun. 2020;529(1):28–34. Wang M, Wu J, Zhou E, Chang X, Gan J, Cheng T. Forkhead box o3a suppresses lipopolysaccharide-stimulated proliferation and inflammation in fibroblast-like synoviocytes through regulating tripartite motif-containing protein 3. J Cell Physiol. 2019;234(11):20139–48. Gosset M, Berenbaum F, Thirion S, Jacques C. Primary culture and phenotyping of murine chondrocytes. Nat Protoc. 2008;3(8):1253–60. Zhou J, Sun J, Markova DZ, et al. MicroRNA-145 overexpression attenuates apoptosis and increases matrix synthesis in nucleus pulposus cells. Life Sci. 2019;221:274–83. Knights AJ, Redding SJ, Maerz T. Inflammation in osteoarthritis: the latest progress and ongoing challenges. Curr Opin Rheumatol. 2023;35(2):128–34. Yu H, Huang T, Lu WW, Tong L, Chen D. Osteoarthritis Pain. Int J Mol Sci. 2022;23(9):4642. Richard MJ, Driban JB, McAlindon TE. Pharmaceutical treatment of osteoarthritis. Osteoarthritis Cartilage. 2023;31(4):458–66. Hodgkinson T, Kelly DC, Curtin CM, O'Brien FJ. Mechanosignalling in cartilage: an emerging target for the treatment of osteoarthritis. Nat Rev Rheumatol. 2022;18(2):67–84. Diekman BO, Loeser RF. Aging and the emerging role of cellular senescence in osteoarthritis. Osteoarthritis Cartilage. 2024;32(4):365–71. Han Y, Lu S, Song C, Xuan Y, Zhang M, Cai H. Dual roles of TRIM3 in colorectal cancer by retaining p53 in the cytoplasm to decrease its nuclear expression. Cell Death Discov. 2023;9(1):85. Fu H, Yang H, Zhang X, et al. Exosomal TRIM3 is a novel marker and therapy target for gastric cancer. J Exp Clin Cancer Res. 2018;37(1):162. Schreiber J, Végh MJ, Dawitz J, et al. Ubiquitin ligase TRIM3 controls hippocampal plasticity and learning by regulating synaptic γ-actin levels. J Cell Biol. 2015;211(3):569–86. Song Y, Guo Q, Gao S, Hua K. miR-454-3p promotes proliferation and induces apoptosis in human cervical cancer cells by targeting TRIM3. Biochem Biophys Res Commun. 2019;516(3):872–9. Song Y, Guo Q, Gao S, Hua K. Tripartite motif-containing protein 3 plays a role of tumor inhibitor in cervical cancer. Biochem Biophys Res Commun. 2018;498(3):686–92. Dong W, Luo B, Qiu C, et al. TRIM3 attenuates apoptosis in Parkinson's disease via activating PI3K/AKT signal pathway. Aging. 2020;13(1):735–49. Xu K, He Y, Moqbel S, Zhou X, Wu L, Bao J. SIRT3 ameliorates osteoarthritis via regulating chondrocyte autophagy and apoptosis through the PI3K/Akt/mTOR pathway. Int J Biol Macromol. 2021;175:351–60. Zhang Y, Cai W, Han G, et al. [Corrigendum] Panax notoginseng saponins prevent senescence and inhibit apoptosis by regulating the PI3K–AKT–mTOR pathway in osteoarthritic chondrocytes. Int J Mol Med. 2022;49(3):30. [pii]. Deng Y, Shi Y, Wen C. TRIM3 Inhibits H(2)O(2)-Induced Apoptosis in Human Lens Epithelial Cells by Decreasing p53 via Ubiquitination. Curr Eye Res. 2022;47(5):747–52. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 23 Dec, 2025 Read the published version in Journal of Orthopaedic Surgery and Research → Version 1 posted Editorial decision: Revision requested 13 Oct, 2025 Reviews received at journal 13 Oct, 2025 Reviewers agreed at journal 13 Oct, 2025 Reviewers agreed at journal 12 Oct, 2025 Reviewers agreed at journal 08 Oct, 2025 Reviewers invited by journal 07 Oct, 2025 Editor assigned by journal 04 Oct, 2025 Submission checks completed at journal 01 Oct, 2025 First submitted to journal 29 Sep, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7739549","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":528954215,"identity":"bbca9e82-2cb5-460a-87bd-6aad83a0cb37","order_by":0,"name":"Huashuang Ou","email":"","orcid":"","institution":"The People's Hospital of Guangxi Zhuang Autonomous Region \u0026 Guangxi Academy of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Huashuang","middleName":"","lastName":"Ou","suffix":""},{"id":528954216,"identity":"3b5d7e17-de60-4c71-b8c7-2f920b0c8907","order_by":1,"name":"Baichuan Li","email":"","orcid":"","institution":"The People's Hospital of Guangxi Zhuang Autonomous Region \u0026 Guangxi Academy of Medical Sciences","correspondingAuthor":false,"prefix":"","firstName":"Baichuan","middleName":"","lastName":"Li","suffix":""},{"id":528954217,"identity":"e91568ad-4ae3-4437-af94-0002e0318c7c","order_by":2,"name":"Haibo Liang","email":"","orcid":"","institution":"Guangxi Hospital Division of The First Affiliated Hospital, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Haibo","middleName":"","lastName":"Liang","suffix":""},{"id":528954219,"identity":"d2425de2-3faf-4478-90c7-2ecced45ab60","order_by":3,"name":"Haiquan Deng","email":"","orcid":"","institution":"Guangxi Hospital Division of The First Affiliated Hospital, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Haiquan","middleName":"","lastName":"Deng","suffix":""},{"id":528954221,"identity":"4128aeaf-27ea-4748-8f87-d398e66053ec","order_by":4,"name":"Lei Zhang","email":"","orcid":"","institution":"Guangxi Hospital Division of The First Affiliated Hospital, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Lei","middleName":"","lastName":"Zhang","suffix":""},{"id":528954222,"identity":"0c8481b6-165b-4aab-a759-c5b60c4ee249","order_by":5,"name":"Mindong Lan","email":"","orcid":"","institution":"Guangxi Hospital Division of The First Affiliated Hospital, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Mindong","middleName":"","lastName":"Lan","suffix":""},{"id":528954223,"identity":"32e605c2-4da3-4c5e-9e47-3cd41e57d518","order_by":6,"name":"Xiangrong Cui","email":"","orcid":"","institution":"Guangxi Hospital Division of The First Affiliated Hospital, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Xiangrong","middleName":"","lastName":"Cui","suffix":""},{"id":528954224,"identity":"c97dc63c-e018-4905-b3ce-b23f7ac85e09","order_by":7,"name":"Shuzhen Li","email":"","orcid":"","institution":"Guangxi Hospital Division of The First Affiliated Hospital, Sun Yat-sen University","correspondingAuthor":false,"prefix":"","firstName":"Shuzhen","middleName":"","lastName":"Li","suffix":""},{"id":528954225,"identity":"1d89cf00-21a7-453d-af42-709a491f9336","order_by":8,"name":"Jianchao Sun","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA1UlEQVRIiWNgGAWjYBACNvbG9h8fKv7LMTYzHyBOCx/P4QOSM84wGzO3syUQp0VOIi1BmreFObG9n8eASIcx5BgY8DawJfY283y88YbBTk63gaCWMwYJkjt4jGc28262nMOQbGx2gJAWxh6DA4ZnJGQ3NvNuk+ZhOJC4jaAWZh7DhsQ2A8b9h3meEamFjS2Z4WBbgmJjMw8bkVp4mI8xNpw5YMzYzGZsOceACL/Iz3/Yxvyn4oAcY//hhzfeVNjJEdSCAiSIjRpkLaTqGAWjYBSMghEBANA5QG9pbV2tAAAAAElFTkSuQmCC","orcid":"","institution":"Guangxi Hospital Division of The First Affiliated Hospital, Sun Yat-sen University","correspondingAuthor":true,"prefix":"","firstName":"Jianchao","middleName":"","lastName":"Sun","suffix":""}],"badges":[],"createdAt":"2025-09-29 08:23:10","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7739549/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7739549/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13018-025-06510-8","type":"published","date":"2025-12-23T15:57:53+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":93964548,"identity":"771c26fd-4fc4-4556-9f5b-09c7e101cdcf","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":39444,"visible":true,"origin":"","legend":"","description":"","filename":"202509Manuscript.docx","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/0182c3fdea5a8eda96bc42bc.docx"},{"id":93964558,"identity":"257cbc0c-67f2-465f-a5eb-fb871f3e17a8","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9748004,"visible":true,"origin":"","legend":"","description":"","filename":"figure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/ce22f847af941872fabc55e1.tif"},{"id":93964621,"identity":"931df342-66bf-4d4f-a82a-0bdd9ff23946","added_by":"auto","created_at":"2025-10-20 18:20:22","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":12040,"visible":true,"origin":"","legend":"","description":"","filename":"Table.docx","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/ba97ceca28a82cf708221708.docx"},{"id":93964626,"identity":"96b13822-2dea-41bb-b481-71818a45e6fc","added_by":"auto","created_at":"2025-10-20 18:20:22","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1593612,"visible":true,"origin":"","legend":"","description":"","filename":"figure2A.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/292e0caf0b685b2e432b592a.tif"},{"id":93965123,"identity":"5444aee7-ddc6-4fe0-ad0d-fa2ca3a52bb2","added_by":"auto","created_at":"2025-10-20 18:28:22","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6454336,"visible":true,"origin":"","legend":"","description":"","filename":"figure2B.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/93b334105c869730cf45fb68.tif"},{"id":93965337,"identity":"ce5cdcdc-54d7-4a6e-8746-a4ce3a4f1a80","added_by":"auto","created_at":"2025-10-20 18:36:22","extension":"tif","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":108764,"visible":true,"origin":"","legend":"","description":"","filename":"figure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/e862d732f09066ab99686bd9.tif"},{"id":93964628,"identity":"bab2e2ca-8e17-4fe6-bb72-9ffd75e83e94","added_by":"auto","created_at":"2025-10-20 18:20:22","extension":"tif","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":109312,"visible":true,"origin":"","legend":"","description":"","filename":"figure4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/0c08bb8a6588a02a4c20d2a5.tif"},{"id":93965122,"identity":"6eed595c-521e-4cd5-a3af-c3537c9c8ee9","added_by":"auto","created_at":"2025-10-20 18:28:22","extension":"tif","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":104848,"visible":true,"origin":"","legend":"","description":"","filename":"figure5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/56681434b3607f15b50ac3a2.tif"},{"id":93965338,"identity":"76904662-0787-4f85-9205-e0a0a9bfde7a","added_by":"auto","created_at":"2025-10-20 18:36:22","extension":"tif","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":415804,"visible":true,"origin":"","legend":"","description":"","filename":"figure6A.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/b1c04711a92242d693d6271d.tif"},{"id":93964563,"identity":"17150493-68ad-42f8-a8ff-96e335b2e928","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"tif","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59728,"visible":true,"origin":"","legend":"","description":"","filename":"figure6B.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/4a1ed1b9d69e1fcce918509b.tif"},{"id":93965127,"identity":"8dd2e5d8-eab8-41ff-ac85-83b9b35566d9","added_by":"auto","created_at":"2025-10-20 18:28:22","extension":"tif","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8791168,"visible":true,"origin":"","legend":"","description":"","filename":"figure7.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/fe49940e5232eed7f8cd8ead.tif"},{"id":93964643,"identity":"bd9ac5fa-f752-4f02-beb4-ca25929a8038","added_by":"auto","created_at":"2025-10-20 18:20:23","extension":"json","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":10331,"visible":true,"origin":"","legend":"","description":"","filename":"20d93978890c41dfba51e7e9b6ba8460.json","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/2e4eb79a40c8e8725bb64883.json"},{"id":93964561,"identity":"ccc5b06b-e019-4636-b30b-e0f1dae8532d","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"xml","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":87723,"visible":true,"origin":"","legend":"","description":"","filename":"20d93978890c41dfba51e7e9b6ba84601enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/a29a59c84d1fb6620e0e56f0.xml"},{"id":93964573,"identity":"ce1dd223-f82b-4ed3-9bdb-f318d0765d8a","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"tif","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9748004,"visible":true,"origin":"","legend":"","description":"","filename":"figure1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/4d29e66d26b71d909561d072.tif"},{"id":93964579,"identity":"bd8d6654-24f5-4b56-8fa7-b8b70160a42d","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"tif","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1593612,"visible":true,"origin":"","legend":"","description":"","filename":"figure2A.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/9302e99556446d594b0c3e01.tif"},{"id":93964577,"identity":"ae582c2e-b1e0-4688-972f-911bffc1e7d6","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"tif","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":6454336,"visible":true,"origin":"","legend":"","description":"","filename":"figure2B.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/f422439aae6ce5515442be95.tif"},{"id":93964576,"identity":"6b659d71-690d-4b32-ba4c-7c0ddc4b3533","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"tif","order_by":16,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":108764,"visible":true,"origin":"","legend":"","description":"","filename":"figure3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/cddbbb5f6da8c6462084dfda.tif"},{"id":93965125,"identity":"44155548-1454-4540-8ce5-5601e2f4fd44","added_by":"auto","created_at":"2025-10-20 18:28:22","extension":"tif","order_by":17,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":109312,"visible":true,"origin":"","legend":"","description":"","filename":"figure4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/5f6b57dacdd12c0caa18646f.tif"},{"id":93964630,"identity":"5cd4b181-da2a-4d51-9c03-fda5239dc6ec","added_by":"auto","created_at":"2025-10-20 18:20:22","extension":"tif","order_by":18,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":104848,"visible":true,"origin":"","legend":"","description":"","filename":"figure5.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/e3cc7edccdd5e14a0f821bd6.tif"},{"id":93964565,"identity":"f5e761c5-2e6c-4f72-9a42-ebab6776dbc5","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"tif","order_by":19,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":415804,"visible":true,"origin":"","legend":"","description":"","filename":"figure6A.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/836bc1bf1614d7ad6bea7341.tif"},{"id":93964575,"identity":"a6c75767-bd15-4294-ba9f-4679ab15d895","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"tif","order_by":20,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":59728,"visible":true,"origin":"","legend":"","description":"","filename":"figure6B.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/fdb52c6c71a0810ba8e5f285.tif"},{"id":93964581,"identity":"ff02b2bb-7292-40d4-a989-adca410be1dc","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"tif","order_by":21,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":8791168,"visible":true,"origin":"","legend":"","description":"","filename":"figure7.tif","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/abb0855db059266fd63d0e56.tif"},{"id":93964632,"identity":"2a086912-6be8-42ac-812b-2023200132a4","added_by":"auto","created_at":"2025-10-20 18:20:22","extension":"png","order_by":22,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":99795,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/e031cdc1d6234b789fe9855e.png"},{"id":93964578,"identity":"21225f59-245e-4351-a5ce-70a661ba030a","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"png","order_by":23,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":21634,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefigure2A.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/fb400d1db8734adf08845382.png"},{"id":93964636,"identity":"404a2e10-163a-4b37-80c3-36f6aa996fab","added_by":"auto","created_at":"2025-10-20 18:20:22","extension":"png","order_by":24,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":262920,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefigure2B.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/f2f4519077c3d109c4ab030d.png"},{"id":93964633,"identity":"7a241b16-fd9e-4121-a0da-73519af90719","added_by":"auto","created_at":"2025-10-20 18:20:22","extension":"png","order_by":25,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":23995,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/2efea4cc23704573cac1cb03.png"},{"id":93964569,"identity":"2de22c69-435e-46a9-a61a-8a25badf733d","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"png","order_by":26,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":19998,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/9eedd1b4d460d5f3e5011dcb.png"},{"id":93965339,"identity":"7afd41d0-a38a-4796-aa5c-405c93e50a20","added_by":"auto","created_at":"2025-10-20 18:36:22","extension":"png","order_by":27,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":20864,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/77842a31021f09d055043f24.png"},{"id":93964639,"identity":"44f6437f-dcba-4540-b75e-3a4454e79529","added_by":"auto","created_at":"2025-10-20 18:20:22","extension":"png","order_by":28,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":98401,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefigure6A.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/b8fcbffe163fbaedece6af53.png"},{"id":93964641,"identity":"fd3c338c-ac3c-4b84-976d-87bc1381c0b5","added_by":"auto","created_at":"2025-10-20 18:20:22","extension":"png","order_by":29,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":16375,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefigure6B.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/b2716b5309928ea81519b18a.png"},{"id":93964584,"identity":"0c2f6aca-5132-410b-a913-fbc6d0c3141c","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"png","order_by":30,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":138250,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefigure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/3deb76ed1aef9a3d78e2f1df.png"},{"id":93964640,"identity":"88f76b5f-f77e-4040-8ebe-14bd45b2be53","added_by":"auto","created_at":"2025-10-20 18:20:22","extension":"xml","order_by":31,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":85384,"visible":true,"origin":"","legend":"","description":"","filename":"20d93978890c41dfba51e7e9b6ba84601structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/7f8cad2e166f56241d2cb314.xml"},{"id":93964580,"identity":"3e7a33d9-abab-4b0b-a309-36933b810927","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"html","order_by":32,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":94690,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/678db015bf5adb8d20c8e9ac.html"},{"id":93964546,"identity":"583573cb-7e19-46a2-8764-2a9ee286b353","added_by":"auto","created_at":"2025-10-20 18:12:21","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2246204,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/38cb72755554c3e77e7ccb8c.png"},{"id":93965119,"identity":"155138d2-ca28-4ef3-855f-63dc26fa260c","added_by":"auto","created_at":"2025-10-20 18:28:22","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":7221825,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/f1327212fce2d3eb1f285de9.png"},{"id":93964549,"identity":"494c2038-ab3f-4cb8-b61e-eb6404e7aa72","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":909985,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/f932f91f20444d37340264b9.jpg"},{"id":93964622,"identity":"79197c28-d836-4756-bfa8-750b862699cb","added_by":"auto","created_at":"2025-10-20 18:20:22","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":268145,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/9ef72efa4935a77d6814bc16.png"},{"id":93964553,"identity":"7e5c622f-96ac-4d55-ba22-9ae67548fec5","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":275395,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/55ed8f92e336039bd052c666.png"},{"id":93964550,"identity":"37bb7d11-960a-4eb5-bfde-8d28c3c56b8b","added_by":"auto","created_at":"2025-10-20 18:12:22","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":255204,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/3745b916220124e73181c273.png"},{"id":93965120,"identity":"33dd9ba1-3cff-4991-830f-cc50de89a1bd","added_by":"auto","created_at":"2025-10-20 18:28:22","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":6855631,"visible":true,"origin":"","legend":"\u003cp\u003eLegend not included with this version.\u003c/p\u003e","description":"","filename":"figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/8e9ac9db3d7a52bbf8c79dc8.png"},{"id":99172464,"identity":"b4bb9f1d-aa16-41e1-9aa3-0239a7297220","added_by":"auto","created_at":"2025-12-29 16:09:54","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":21236339,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7739549/v1/243d6700-4e7f-4575-a730-4b8615eb5933.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"TRIM3 exacerbates chondrocyte apoptosis through suppression of AKT/mTOR signaling pathway in osteoarthritis","fulltext":[{"header":"INTRODUCTION","content":"\u003cp\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003eOsteoarthritis (OA), a chronic and highly prevalent joint disorder, stands as the leading cause of chronic pain and functional disability worldwide. Its pathology is characterized by progressive cartilage degradation, synovial inflammation, and structural remodeling of periarticular tissues, including osteophyte formation and subchondral bone sclerosis\u003csup\u003e[\u003cspan additionalcitationids=\"CR2\" citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]\u003c/sup\u003e. Articular cartilage, a connective tissue composed of chondrocytes and the extracellular matrix (ECM) synthesized by these cells, provides essential lubrication and biomechanical support for joint function. Although chondrocytes occupy merely 1% of the total cartilage volume, they play a pivotal role in maintaining ECM homeostasis\u003csup\u003e[\u003cspan additionalcitationids=\"CR5\" citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]\u003c/sup\u003e. Despite advances in managing OA symptoms, current therapeutic interventions remain palliative, with no proven efficacy in halting disease progression, controlling persistent synovitis, or restoring dysfunctional chondrocytes. Thus, uncovering its pathogenic mechanisms is critical to identifying novel molecular targets for disease-modifying therapeutic strategies.\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003cp\u003eThe TRIM protein family, a ubiquitous and multifunctional group of proteins, plays pivotal roles in cellular regulation and disease pathogenesis. Members of this family typically modulate intracellular signaling pathways to influence cell growth, proliferation, differentiation, and survival\u003csup\u003e[\u003cspan additionalcitationids=\"CR8 CR9\" citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]\u003c/sup\u003e. TRIM3 (also known as Ro52/TSS\u0026thinsp;\u0026minus;\u0026thinsp;62), a key member of the TRIM (Tripartite Motif) family, harbors canonical RING, B-box, and coiled-coil domains that confer versatile functional and interactive capabilities\u003csup\u003e[\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]\u003c/sup\u003e. Emerging evidence highlights TRIM3\u0026rsquo;s involvement in critical biological processes, including apoptosis, cell cycle regulation, migration, and proteasomal degradation\u003csup\u003e[\u003cspan additionalcitationids=\"CR14 CR15 CR16\" citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]\u003c/sup\u003e. Notably, other TRIM family members, such as TRIM8 and TRIM59, have been implicated in chondrocyte metabolism, suggesting their regulatory significance in cartilage homeostasis and OA progression. For instance, Liu et al. demonstrated that TRIM8 expression is markedly upregulated in IL-1β-stimulated OA chondrocytes, while TRIM8 silencing counteracts IL-1β-induced suppression of aggrecan and collagen II expression and mitigates matrix-degrading enzyme activation\u003csup\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/sup\u003e. Similarly, Teng et al. observed downregulated TRIM59 levels in OA cartilage compared to healthy tissues, with TRIM59 overexpression ameliorating IL-1β-driven ECM metabolic imbalance, proinflammatory cytokine release, apoptosis, and chondrocyte death\u003csup\u003e[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/sup\u003e. Despite these advances, research linking TRIM3 to arthritis remains scarce. Wang et al. reported reduced TRIM3 expression in rheumatoid arthritis (RA) synovial tissues compared to healthy controls. Importantly, TRIM3 overexpression attenuated LPS-induced synovial fibroblast hyperproliferation and suppressed TNF-α, IL-6, and IL-1β secretion\u003csup\u003e[\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/sup\u003e. However, the role of TRIM3 in OA pathogenesis remains unexplored, leaving a critical gap in understanding its potential regulatory mechanisms in cartilage degeneration.\u003c/p\u003e\u003cp\u003eThis study investigated the expression and functional impact of TRIM3 in chondrocyte apoptosis associated with OA. Furthermore, we elucidated the regulatory interplay between TRIM3 and the AKT/mTOR signaling pathway during OA pathogenesis. These findings advance our understanding of molecular mechanisms governing programmed cell death and identify TRIM3 as a potential therapeutic target for OA treatment and drug development.\u003c/p\u003e"},{"header":"METHODS","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003eGEO Transcriptomic Analysis of TRIM3 in Knee Osteoarthritis (KOA)\u003c/h2\u003e\u003cp\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003eTranscriptomic and clinical data related to knee osteoarthritis (KOA) were retrieved from the Gene Expression Omnibus (GEO) database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.govgeo\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.govgeo\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e ). The GSE114007 dataset included 18 normal cartilage samples and 20 KOA cartilage samples. Raw data were processed using R software (v4.3.1) to integrate clinical metadata and generate expression matrices. Perl scripts were employed to filter mRNA expression profiles by removing non-coding RNA data. For external validation, the GEO database was queried using the keyword \"knee osteoarthritis\" with species restricted to Homo sapiens, yielding the GSE113825 dataset comprising 5 KOA and 5 normal cartilage samples. Transcriptomic and clinical data from GSE113825 were downloaded via R packages (GEOquery), and probe IDs were annotated to standardized gene symbols. Combined with GSE114007 data, raw transcriptomic data underwent preprocessing steps, including background correction (RMA algorithm) and quantile normalization (limma package), to ensure comparability across datasets.\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003ePatients and tissue samples\u003c/h3\u003e\n\u003cp\u003eNormal cartilage tissues (control group, n\u0026thinsp;=\u0026thinsp;3) were obtained from amputated limbs of three trauma patients. Degenerative cartilage samples (OA group) were collected from four osteoarthritis patients undergoing total joint replacement surgery. One OA sample was excluded due to unsuccessful protein extraction, resulting in a final analyzed OA group sample size of n\u0026thinsp;=\u0026thinsp;3. Fresh tissues from the included samples were preserved either on ice (for immediate protein extraction) or in formalin (for subsequent immunohistochemical analysis). Patient age and sex information were not systematically recorded for this study. Written informed consent was acquired preoperatively from all participants. This study protocol was approved by the Medical Ethics Committee of The People's Hospital of Guangxi Zhuang Autonomous Region (Guangxi Academy of Medical Sciences) (Approval No. KY-KJT-2023-25).\u003c/p\u003e\n\u003ch3\u003eRat Chondrocyte isolation and culture\u003c/h3\u003e\n\u003cp\u003eSprague-Dawley (SD) rats were supplied by the Experimental Animal Center of Guangxi Medical University. All experimental procedures were approved by the Experimental Ethics Committee of The People's Hospital of Guangxi Zhuang Autonomous Region (Guangxi Academy of Medical Sciences) (Approval No. KY-KJT-2023-25). Chondrocytes were isolated from rat articular cartilage using enzymatic digestion methods as previously described in the literature\u003csup\u003e[\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/sup\u003e. Cell culture and subculturing were performed according to protocols established in our prior studies\u003csup\u003e[\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\n\u003ch3\u003eSiRNA transfection\u003c/h3\u003e\n\u003cp\u003esiRNA Design and Preparation : TRIM3-specific siRNA duplexes (target sequence: 5\u0026prime;-GCAGCACAAGGCAGCUCUA-3\u0026prime;) or mTOR-specific siRNA duplexes (target sequence: 5\u0026prime;-GCCGCAUAGUCUCCAUCAA-3\u0026prime;) and negative control siRNA (scrambled sequence, non-targeting) were synthesized by RiboBio (Guangzhou, China). Stock solutions (20 \u0026micro;M) were prepared in RNase-free water and stored at -80\u0026deg;C.\u003c/p\u003e\u003cp\u003eCell Seeding : Rat chondrocytes were seeded in 6-well plates at a density of 5\u0026times;10⁵ cells/well and cultured in DMEM/F12 (10% FBS, 1% penicillin-streptomycin) until reaching 70\u0026ndash;80% confluence (24 h after seeding), ensuring optimal transfection efficiency.\u003c/p\u003e\u003cp\u003eTransfection Reagent and Complex Preparation : Lipofectamine 3000 (Invitrogen, L3000015) was used as the transfection reagent, following the manufacturer\u0026rsquo;s protocol with minor optimization. For each well: 5 \u0026micro;L Lipofectamine 3000 was diluted in 125 \u0026micro;L Opti-MEM (serum-free), and 5 \u0026micro;L P3000 reagent was mixed with 50 pmol TRIM3 siRNA (or negative control siRNA) in 125 \u0026micro;L Opti-MEM. The two mixtures were combined, incubated at room temperature for 15 min to form lipoplexes.\u003c/p\u003e\u003cp\u003eTransfection Induction : The culture medium of chondrocytes was replaced with 1.75 mL Opti-MEM (serum-free), and the lipoplex mixture (250 \u0026micro;L/well) was added dropwise. Cells were incubated at 37\u0026deg;C with 5% CO₂ for 6 h, after which the medium was replaced with fresh DMEM/F12 (10% FBS) to reduce cytotoxicity.\u003c/p\u003e\u003cp\u003eKnockdown Efficiency Verification : At 48 h post-transfection, total RNA and protein were extracted. TRIM3 or mTOR mRNA expression was detected by qRT-PCR, and protein level by Western blot, confirming\u0026thinsp;\u0026gt;\u0026thinsp;70% knockdown efficiency in both mRNA and protein levels.\u003c/p\u003e\u003cp\u003eSubsequent Inflammatory Stimulation : After verifying knockdown efficiency (48 h post-transfection), chondrocytes were treated with 10 ng/mL IL-1β (to mimic OA inflammatory microenvironment) for 24 h, followed by detection of apoptosis (Annexin V/PI staining) and ECM-degrading enzymes (by Western blot/qRT-PCR).\u003c/p\u003e\n\u003ch3\u003eRNA Extraction and Quantitative Real-Time PCR (qRT-PCR)\u003c/h3\u003e\n\u003cp\u003eTotal RNA was isolated from cultured chondrocytes using TRIzol reagent (Takara Bio, Dalian, China) following the manufacturer\u0026rsquo;s protocol. RNA concentration was quantified spectrophotometrically (NanoDrop 2000, Thermo Fisher Scientific), and residual genomic DNA was removed using DNase I (RNase-free). DNA-free RNA was reverse-transcribed into cDNA using a PrimeScript RT Master Mix (Takara Bio).\u003c/p\u003e\u003cp\u003eqRT-PCR reactions (10\u0026micro;L total volume) contained 1\u0026micro;L cDNA, 5\u0026micro;L TB Green Premix Ex Taq II (Takara Bio), and 0.5\u0026micro;L each of forward/reverse primers (10\u0026micro;M). Thermal cycling conditions on a Light Cycler 96 system (Roche Diagnostics GmbH, Germany) included:Initial denaturation: 95\u0026deg;C for 30 sec. 40 cycles of: 95\u0026deg;C for 10 sec (denaturation), 60\u0026deg;C for 40 sec (annealing/extension). GAPDH served as the endogenous control. Relative gene expression was calculated using the 2^(-ΔΔCt)) method, normalized to GAPDH.\u003c/p\u003e\u003cp\u003eAll primers and siRNAs were designed and synthesized by Nanning Gensys Biotechnology Co., Ltd. (China) (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e\u003ccaption language=\"En\"\u003e\u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e\u003cdiv class=\"CaptionContent\"\u003e\u003cp\u003ePrimer and siRNA Sequences\u003c/p\u003e\u003c/div\u003e\u003c/caption\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTarget\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eSequence (5\u0026prime;\u0026rarr;3\u0026prime;)\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eTRIM3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: GATAAGTGCAGCCTTTGAGG\u003c/p\u003e\u003cp\u003eReverse: CAGTGCCTGCTCTGCAAAGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBax\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: CCAAGAAGCTGAGCGAGTGT\u003c/p\u003e\u003cp\u003eReverse: CCAGTTGAAGTTGCCGTCTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eBcl-2\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: CTCTACGGCCCCTTGTCG\u003c/p\u003e\u003cp\u003eReverse: GTGAAGGGCGTCAGGTGCAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eGAPDH\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: TCTCTGCTCCTCCCTGTTC\u003c/p\u003e\u003cp\u003eReverse: ACACCGACCTTCACCATCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003emTOR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eForward: AGACACCATGAACCATGCC\u003c/p\u003e\u003cp\u003eReverse: TGTGGCATCCACCTGCACAG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003esiTRIM3\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTarget: GCAGCACAAGGCAGCUCUA (rat-specific)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003esimTOR\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTarget: GCCGCAUAGUCUCCAUCAA (rat-specific)\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eProtein Extraction and Western Blotting\u003c/h2\u003e\u003cp\u003eTotal proteins were extracted from cultured chondrocytes. Briefly, cells were washed thrice with PBS and lysed in ice-cold RIPA buffer (CWBIO, China) containing 1% protease and phosphatase inhibitors for 30 min. Protein concentration was determined using a BCA assay kit, followed by denaturation with SDS-PAGE loading buffer (EpiZyme, Shanghai, China) at 95\u0026deg;C for 10 min. Equal amounts of proteins (20\u0026ndash;50 \u0026micro;g) were resolved on 8\u0026ndash;12% SDS-polyacrylamide gels (Beyotime, China) and transferred to PVDF membranes (Millipore, USA).Membranes were blocked with 5% BSA in TBST (10 mM Tris [pH 8.0], 150 mM NaCl, 0.1% Tween-20) for 1 h at room temperature, then incubated overnight at 4\u0026deg;C with primary antibodies. After three TBST washes, membranes were incubated with HRP-conjugated secondary antibodies for 1 h at room temperature. Protein bands were visualized using enhanced chemiluminescence (ECL) reagents and quantified by ImageJ (NIH, USA). Protein expression was normalized to GAPDH as the internal control.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eAntibodies:Anti-Col2a1, anti-TRIM3, anti-p-mTOR, anti-Bax, anti-Bcl-2, anti-p-AKT (Abcam, UK) ; Anti-GAPDH (Proteintech, USA)\u003c/h3\u003e\n\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e\u003ch2\u003eImmunohistochemistry (IHC)\u003c/h2\u003e\u003cp\u003eHuman bone tissue specimens were fixed in 4% neutral buffered formalin, paraffin-embedded, and sectioned at 5\u0026micro;m thickness. Following deparaffinization in xylene and rehydration through graded ethanol series, antigen retrieval was performed using citrate buffer (pH 6.0) under microwave heating. Sections were then treated with 3% hydrogen peroxide for 15 min at room temperature to block endogenous peroxidase activity, followed by 30 min incubation with 10% normal goat serum to reduce nonspecific binding. The sections were incubated overnight at 4\u0026deg;C with primary anti-TRIM3 antibody (1:100 dilution, Abcam, UK). After washing, biotin-conjugated goat anti-rabbit IgG secondary antibody (1:500) and streptavidin-horseradish peroxidase (HRP) complex were applied for 1 h at room temperature. Diaminobenzidine (DAB) substrate was used for chromogenic detection, and nuclei were counterstained with hematoxylin.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e\u003ch2\u003eApoptosis Analysis by Flow Cytometry\u003c/h2\u003e\u003cp\u003eRat chondrocytes transfected with siTRIM3 were treated with 10 ng/mL IL-1β (Peprotech, USA) for 24 hours. Cells were then harvested by trypsinization, centrifuged at 1,000 rpm for 5 min, and washed twice with PBS. The cell pellet was resuspended in 400\u0026micro;L\u0026times;Annexin V Binding Buffer (BD Biosciences).\u003c/p\u003e\u003cp\u003eCells were divided into two aliquots:Experimental group : Stained with 5\u0026micro;L Annexin V-FITC (light-protected, 15 min at room temperature), followed by 10\u0026micro;L propidium iodide (PI). Unstained control : No dye added. Samples were analyzed immediately on a flow cytometer using 488 nm excitation. Apoptotic rates were calculated as the percentage of Annexin V+/PI\u0026minus; (early apoptosis) and Annexin V+/PI+ (late apoptosis) cells.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e\u003ch2\u003eImmunofluorescence (IF)\u003c/h2\u003e\u003cp\u003eCultured rat chondrocytes were washed three times with PBS and fixed with 4% paraformaldehyde for 30 min at room temperature. After three additional PBS washes, cells were permeabilized with 0.5% Triton X-100 for 10 min. Non-specific binding was blocked with 10% normal goat serum for 1 h at room temperature. Primary antibody (anti-Col2a1, 1:100 dilution, Immunoway, Suzhou, China) was applied and incubated overnight at 4\u0026deg;C. Following three PBS washes, cells were incubated with a Cy3-conjugated goat anti-rabbit IgG secondary antibody (1:100, Boshi Biotechnology, China) under light-protected conditions for 1 h at room temperature. Nuclei were counterstained with DAPI (0.1 \u0026micro;g/mL) for 4 min. After final PBS washes, fluorescence images were captured using an Olympus IX73 inverted fluorescence microscope (Tokyo, Japan) with appropriate filter sets.\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec13\" class=\"Section2\"\u003e\u003ch2\u003eData analysis\u003c/h2\u003e\u003cp\u003eData are presented as the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) from at least three independent experiments. Statistical analyses were performed using GraphPad Prism 7 (GraphPad Software, USA). Parametric data (normally distributed) were analyzed by Student\u0026rsquo;s t -test (for two-group comparisons) or one-way analysis of variance (ANOVA, for multi-group comparisons). Differences were considered statistically significant at p\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e\u003c/div\u003e"},{"header":"RESULTS","content":"\u003cdiv id=\"Sec15\" class=\"Section2\"\u003e\u003ch2\u003eTRIM3 Targets Differentially Expressed Genes Associated with Knee Osteoarthritis\u003c/h2\u003e\u003cp\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003eClinical and transcriptomic data related to knee osteoarthritis (KOA) were downloaded from the GEO database. Clinical data were processed and integrated using R software. Analysis revealed that TRIM3 was significantly upregulated in KOA patients (Fig.\u0026nbsp;1A \u0026amp; B). Differentially expressed mRNAs (DEGs) were screened using thresholds of p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and |log2FC| \u0026ge; 0.50, identifying 5,189 DEGs in the dataset. A heatmap of the KOA-TRIM3-related mRNA expression matrix was generated (Fig.\u0026nbsp;1C). Gene Set Enrichment Analysis (GSEA) of KOA-associated genes (ranked by log2FC) in the GSE114007 dataset revealed significant enrichment in pathways including:Complement and coagulation cascades. Protein digestion and absorption. Rheumatoid arthritis. Circadian rhythm. ECM-receptor interaction. (Fig.\u0026nbsp;1D). Correlation analysis of TRIM3-associated genes in KOA (filtered by |Cor| \u0026gt;0.60 and p-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 ) identified 1,859 co-expressed genes .\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec16\" class=\"Section2\"\u003e\u003ch2\u003eTRIM3 Expression Is Upregulated in Osteoarthritis Patients\u003c/h2\u003e\u003cp\u003eWestern blot (WB) was performed to assess TRIM3 protein expression in cartilage tissues from OA patients and healthy controls. The results demonstrated that TRIM3 protein levels were significantly elevated in OA cartilage compared to healthy controls (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05; Fig.\u0026nbsp;2A). Immunohistochemical (IHC) analysis further corroborated these findings. TRIM3 expression was markedly higher in degenerated cartilage tissues from OA patients than in normal cartilage tissues (Fig.\u0026nbsp;2B).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec17\" class=\"Section2\"\u003e\u003ch2\u003eTRIM3 Knockdown Attenuates Chondrocyte Apoptosis\u003c/h2\u003e\u003cp\u003eTo investigate whether TRIM3 regulates the expression of apoptosis-related genes in chondrocytes, primary rat chondrocytes transfected with TRIM3-targeting siRNA were analyzed by quantitative real-time PCR (qPCR). Compared to scrambled siRNA controls, TRIM3 siRNA induced\u0026thinsp;\u0026gt;\u0026thinsp;70% knockdown of TRIM3 mRNA (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Concurrently, mRNA levels of pro-apoptotic Bax and anti-apoptotic Bcl-2 were significantly downregulated (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Western blotting and densitometric quantification further confirmed dose-dependent suppression of TRIM3 protein (Fig.\u0026nbsp;3A-C).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec18\" class=\"Section2\"\u003e\u003ch2\u003eInhibition of TRIM3 can promote the expression of p-AKT and p-mTOR\u003c/h2\u003e\u003cp\u003eTo investigate whether TRIM3 modulates chondrocyte apoptosis via the AKT/mTOR signaling pathway, we analyzed the expression of phosphorylated AKT (p-AKT) and phosphorylated mTOR (p-mTOR) under TRIM3-knockdown conditions. Western blotting and quantitative densitometric analysis revealed that TRIM3 inhibition significantly upregulated p-AKT and p-mTOR protein levels (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) compared to scrambled siRNA controls (Fig.\u0026nbsp;4A-B).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\u003ch2\u003eTargeted inhibition of the AKT/mTOR signaling axis induces chondrocyte apoptosis\u003c/h2\u003e\u003cp\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003eThe AKT/mTOR signaling pathway exhibits a context-dependent role in regulating chondrocyte apoptosis. While hyperactivation of this pathway is generally associated with anti-apoptotic effects in various cell types, its specific regulatory mechanisms in chondrocyte apoptosis remain poorly characterized. To address this knowledge gap, we pharmacologically inhibited mTOR and analyzed apoptosis-related markers. Western blotting with densitometric quantification revealed that mTOR inhibition significantly downregulated the anti-apoptotic protein Bcl-2 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) while upregulating the pro-apoptotic protein Bax (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Consistent results were observed at the transcriptional level through qPCR analysis (Fig.\u0026nbsp;5A-C).\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\u003ch2\u003eTRIM3 Knockdown Attenuates IL-1β-Induced Chondrocyte Apoptosis\u003c/h2\u003e\u003cp\u003e\u003cul\u003e\u003cli\u003e\u003cp\u003eElevated IL-1β, a hallmark cytokine in osteoarthritic cartilage degeneration, was utilized to establish an inflammatory chondrocyte model (10ng/mL,24h). Flow cytometric analysis with Annexin V-FITC/PI dual staining revealed that IL-1β stimulation significantly increased the apoptotic rate compared to untreated controls (P\u0026thinsp;\u0026lt;\u0026thinsp;0.001). Notably, siRNA-mediated TRIM3 silencing markedly reduced IL-1β-induced apoptosis (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01 vs. IL-1β\u0026thinsp;+\u0026thinsp;scramble siRNA group), demonstrating its anti-apoptotic regulatory role (Fig.\u0026nbsp;6A/B).\u003c/p\u003e\u003c/li\u003e\u003c/ul\u003e\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\u003ch2\u003eTRIM3 Suppression Enhances Collagen II Biosynthesis in Chondrocytes\u003c/h2\u003e\u003cp\u003eEmerging evidence indicates that collagen-mediated extracellular matrix (ECM)-cell interactions regulate chondrocyte survival through apoptosis signaling modulation. To investigate this interplay between TRIM3 and ECM homeostasis, chondrocytes were transfected with TRIM3-specific siRNA (50nM, 48h). Immunofluorescence analysis using a Col2a1 antibody demonstrated that TRIM3 knockdown significantly increased Col2a1 expression, with fluorescence intensity elevated by 2.3-fold compared to scramble siRNA controls (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;7). This suggests TRIM3 acts as a negative regulator of cartilage-specific matrix biosynthesis.\u003c/p\u003e\u003c/div\u003e"},{"header":"DISCUSSION","content":"\u003cp\u003eOsteoarthritis (OA), alternatively termed degenerative joint disease, represents a prevalent musculoskeletal disorder affecting over 500\u0026nbsp;million individuals globally, with particular predilection for the aging population\u003csup\u003e[\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]\u003c/sup\u003e. This progressive condition is primarily driven by the degradation of articular cartilage matrix components (aggrecan and collagen type II) and subsequent subchondral bone remodeling, manifesting clinically as chronic joint pain, stiffness, and progressive functional impairment\u003csup\u003e[\u003cspan additionalcitationids=\"CR26\" citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]\u003c/sup\u003e. Current therapeutic strategies remain largely palliative, underscoring the critical need to elucidate the molecular mechanisms underlying cartilage degeneration and develop novel therapeutic targets.\u003c/p\u003e\u003cp\u003eThe TRIM3 gene plays a pivotal role in diverse biological processes, including immune regulation, development, and carcinogenesis, implicating its involvement in multiple diseases \u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan additionalcitationids=\"CR29\" citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/sup\u003e. While TRIM3 has been shown to induce apoptosis and suppress proliferation in cervical cancer cells \u003csup\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/sup\u003e, conflicting evidence suggests that TRIM3 deficiency in breast cancer cells promotes apoptosis alongside elevated phospho-AKT levels\u003csup\u003e[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/sup\u003e. Intriguingly, TRIM3 has also been proposed to mitigate apoptosis in Parkinson\u0026rsquo;s disease (PD) by activating the PI3K/AKT signaling pathway\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eGiven that TRIM3 functions downstream of PI3K/AKT, we hypothesized that it might also regulate mTOR. Notably, the PI3K/AKT/mTOR pathway is known to be activated in osteoarthritis (OA) joints, where its inhibition attenuates chondrocyte apoptosis\u003csup\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]\u003c/sup\u003e. However, this presents a paradox, as TRIM3-mediated PI3K/AKT activation appears to exert anti-apoptotic effects in PD\u003csup\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/sup\u003e.\u003c/p\u003e\u003cp\u003eThus, what is the functional interplay between TRIM3 and PI3K/AKT/mTOR in chondrocytes? To address this, we first analyzed GEO database clinical data, revealing significant TRIM3 upregulation in knee OA patients, suggesting a strong association between TRIM3 and OA pathogenesis. Subsequent validation using human cartilage samples confirmed that TRIM3 expression was markedly elevated in degenerated cartilage compared to healthy tissue .\u003c/p\u003e\u003cp\u003eNext, we conducted in vitro experiments to elucidate the mechanistic role of TRIM3 in chondrocytes. Strikingly, TRIM3 knockdown suppressed chondrocyte apoptosis while upregulating AKT and mTOR expression. Conversely, pharmacological blockade of AKT/mTOR signaling exacerbated apoptosis, implying that TRIM3 regulates chondrocyte survival via the AKT/mTOR axis .\u003c/p\u003e\u003cp\u003eTo further corroborate these findings, we employed IL-1β-stimulated flow cytometry, demonstrating that TRIM3 inhibition significantly reduced chondrocyte apoptosis rates. Given that type II collagen, a key extracellular matrix (ECM) component, is critically linked to chondrocyte viability, we performed immunofluorescence staining, which revealed that TRIM3 silencing enhanced ECM protein synthesis in chondrocytes .\u003c/p\u003e\u003cp\u003eRegarding programmed cell death regulation, emerging evidence reveals TRIM3's pleiotropic regulatory capacity across diverse biological contexts. Zhang et al. demonstrated that forced expression of TRIM3 promotes oncotic cell death through ROS accumulation and lipid peroxidation elevation, thereby exerting tumor-suppressive effects in non-small cell lung cancer\u003csup\u003e[\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]\u003c/sup\u003e. Contrasting with our findings that TRIM3 knockdown attenuates chondrocyte apoptosis, Ying et al. reported TRIM3-mediated cytoprotection in human lens epithelial cells, where TRIM3 ubiquitinates and degrades p53, consequently inhibiting H2O2-induced apoptosis\u003csup\u003e[\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]\u003c/sup\u003e. This mechanistic divergence underscores TRIM3's context-dependent functionality, potentially modulated by cell type-specific post-translational modifications and pathological microenvironments.\u003c/p\u003e\u003cp\u003eThis study has several methodological constraints that warrant acknowledgment. First, our assessment of TRIM3-mediated apoptotic regulation in chondrocytes lacked ultrastructural confirmation via electron microscopy to visualize characteristic apoptotic bodies. Furthermore, the apoptotic profiling remained incomplete due to unexamined expression patterns of auxiliary apoptosis-related genes. Second, while we propose TRIM3 promotes chondrocyte apoptosis through suppression of the AKT/mTOR signaling axis, the mechanistic linkage between these pathways requires rigorous validation, particularly through in vivo experimental paradigms. Collectively, our findings provide preliminary evidence that TRIM3 may orchestrate chondrocyte apoptosis via AKT/mTOR pathway inhibition. Elucidating the precise pathophysiological interplay between TRIM3 and chondrocyte metabolism\u0026mdash;including temporal dynamics of pathway crosstalk and compensatory regulatory mechanisms\u0026mdash;will constitute priority investigational targets in subsequent studies.\u003c/p\u003e"},{"header":"CONCLUSION","content":"\u003cp\u003eThis research reveals the potential mechanism of TRIM3 in cartilage degeneration in osteoarthritis. We found that TRIM3 may promote chondrocyte apoptosis and regulate chondrocyte matrix metabolism by inhibiting the AKT/mTOR signaling pathway, thereby promoting cartilage degeneration. These findings provide a new perspective for a deeper understanding of the pathological mechanism of osteoarthritis and suggest that TRIM3 may be a potential therapeutic target for osteoarthritis. Future research can further explore the role of TRIM3 in in vivo cartilage degeneration models and evaluate its feasibility as a therapeutic target.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eEthics approval and consent to participate\u003c/h2\u003e\u003cp\u003e The Ethics committee of Guangxi Zhuang Autonomous Region People's Hospital has approved and approved the research project.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003ePatient consent for publication\u003c/h2\u003e\u003cp\u003eNot applicable.\u003c/p\u003e\u003c/p\u003e\u003cp\u003e\u003ch2\u003eCOMPETING INTERESTS\u003c/h2\u003e\u003cp\u003eThe authors declare that they have no confict of interest.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis research was supported by Natural Science Foundation of Guangxi Province(2023GXNSFBA026133 and 2023GXNSFBA026038).\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eThe study was conceived and designed by Huashuang Ou and Jianchao Sun. Huashuang Ou and Baichuan Li performed the majority of experiments and data acquisition. Haibo Liang and Shuzhen Li developed the specific analysis algorithm and performed the statistical analysis. Data interpretation was done by Haiquan Deng, Lei Zhang,Mindong Lan. The manuscript was drafted by Jianchao Sun and critically revised for important intellectual content by all authors . Xiangrong Cui and Shuzhen Li supervised the entire project and secured funding. All authors approved the final version to be published.\u003c/p\u003e\u003ch2\u003eACKNOWLEDGMENT\u003c/h2\u003e\u003cp\u003eNo\u003c/p\u003e\u003ch2\u003eAvailability of data and materials\u003c/h2\u003e\u003cp\u003eThe datasets used and analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\u003cp\u003eReagents generated in this study are available from the corresponding author upon reasonable request.\u003c/p\u003e\u003cp\u003eAll data generated or analysed during this study are included in this published article. Any remaining datasets are available from the corresponding author on reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eGelber AC. Knee Osteoarthritis. Ann Intern Med. 2024;177(9):ITC129\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTang S, Zhang C, Oo WM, et al. Osteoarthr Nat Rev Dis Primers. 2025;11(1):10.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKloppenburg M, Namane M, Cicuttini F, Osteoarthritis. Lancet. 2025;405(10472):71\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eStegen S, Carmeliet G. Metabolic regulation of skeletal cell fate and function. Nat Rev Endocrinol. 2024;20(7):399\u0026ndash;413.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKatz JN, Arant KR, Loeser RF. Diagnosis and Treatment of Hip and Knee Osteoarthritis: A Review. JAMA. 2021;325(6):568\u0026ndash;78.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHu W, Chen Y, Dou C, Dong S. Microenvironment in subchondral bone: predominant regulator for the treatment of osteoarthritis. Ann Rheum Dis. 2021;80(4):413\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHatakeyama S. TRIM Family Proteins: Roles in Autophagy, Immunity, and Carcinogenesis. Trends Biochem Sci. 2017;42(4):297\u0026ndash;311.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWatanabe M, Hatakeyama S. TRIM proteins and diseases. J Biochem. 2017;161(2):135\u0026ndash;44.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLu K, Pan Y, Huang Z, Liang H, Ding ZY, Zhang B. TRIM proteins in hepatocellular carcinoma. J Biomed Sci. 2022;29(1):69.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang HT, Hur S. Substrate recognition by TRIM and TRIM-like proteins in innate immunity. Semin Cell Dev Biol. 2021;111:76\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang Z, Shen N, Wang Z, et al. TRIM3 facilitates ferroptosis in non-small cell lung cancer through promoting SLC7A11/xCT K11-linked ubiquitination and degradation. Cell Death Differ. 2024;31(1):53\u0026ndash;64.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eEsposito D, Dudley-Fraser J, Garza-Garcia A, Rittinger K. Divergent self-association properties of paralogous proteins TRIM2 and TRIM3 regulate their E3 ligase activity. Nat Commun. 2022;13(1):7583.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhuang T, Wang B, Tan X, et al. TRIM3 facilitates estrogen signaling and modulates breast cancer cell progression. Cell Commun Signal. 2022;20(1):45.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeng NH, Tian Z, Zou YJ, Quan SB. E3 ubiquitin ligase TRIM31: A potential therapeutic target. Biomed Pharmacother. 2024;176:116846.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eJin K, Dai Y, Ouyang K, et al. TRIM3 attenuates cytokine storm caused by Dabie bandavirus via promoting Toll-like receptor 3 degradation. Front Microbiol. 2023;14:1209870.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang X, Zhang Y, Pei X, et al. TRIM3 inhibits P53 signaling in breast cancer cells. Cancer Cell Int. 2020;20(1):559.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu Y, Raheja R, Yeh N, et al. TRIM3, a tumor suppressor linked to regulation of p21(Waf1/Cip1). Oncogene. 2014;33(3):308\u0026ndash;15.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiu R, Wu H, Song H. Knockdown of TRIM8 Attenuates IL-1β-induced Inflammatory Response in Osteoarthritis Chondrocytes Through the Inactivation of NF-κB Pathway. Cell Transpl. 2020;29:963689720943604.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTeng Y, Ni G, Zhang W, et al. TRIM59 attenuates IL-1β-driven cartilage matrix degradation in osteoarthritis via direct suppression of NF-κB and JAK2/STAT3 signaling pathway. Biochem Biophys Res Commun. 2020;529(1):28\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang M, Wu J, Zhou E, Chang X, Gan J, Cheng T. Forkhead box o3a suppresses lipopolysaccharide-stimulated proliferation and inflammation in fibroblast-like synoviocytes through regulating tripartite motif-containing protein 3. J Cell Physiol. 2019;234(11):20139\u0026ndash;48.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGosset M, Berenbaum F, Thirion S, Jacques C. Primary culture and phenotyping of murine chondrocytes. Nat Protoc. 2008;3(8):1253\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhou J, Sun J, Markova DZ, et al. MicroRNA-145 overexpression attenuates apoptosis and increases matrix synthesis in nucleus pulposus cells. Life Sci. 2019;221:274\u0026ndash;83.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKnights AJ, Redding SJ, Maerz T. Inflammation in osteoarthritis: the latest progress and ongoing challenges. Curr Opin Rheumatol. 2023;35(2):128\u0026ndash;34.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eYu H, Huang T, Lu WW, Tong L, Chen D. Osteoarthritis Pain. Int J Mol Sci. 2022;23(9):4642.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRichard MJ, Driban JB, McAlindon TE. Pharmaceutical treatment of osteoarthritis. Osteoarthritis Cartilage. 2023;31(4):458\u0026ndash;66.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHodgkinson T, Kelly DC, Curtin CM, O'Brien FJ. Mechanosignalling in cartilage: an emerging target for the treatment of osteoarthritis. Nat Rev Rheumatol. 2022;18(2):67\u0026ndash;84.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDiekman BO, Loeser RF. Aging and the emerging role of cellular senescence in osteoarthritis. Osteoarthritis Cartilage. 2024;32(4):365\u0026ndash;71.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHan Y, Lu S, Song C, Xuan Y, Zhang M, Cai H. Dual roles of TRIM3 in colorectal cancer by retaining p53 in the cytoplasm to decrease its nuclear expression. Cell Death Discov. 2023;9(1):85.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFu H, Yang H, Zhang X, et al. Exosomal TRIM3 is a novel marker and therapy target for gastric cancer. J Exp Clin Cancer Res. 2018;37(1):162.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchreiber J, V\u0026eacute;gh MJ, Dawitz J, et al. Ubiquitin ligase TRIM3 controls hippocampal plasticity and learning by regulating synaptic γ-actin levels. J Cell Biol. 2015;211(3):569\u0026ndash;86.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSong Y, Guo Q, Gao S, Hua K. miR-454-3p promotes proliferation and induces apoptosis in human cervical cancer cells by targeting TRIM3. Biochem Biophys Res Commun. 2019;516(3):872\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSong Y, Guo Q, Gao S, Hua K. Tripartite motif-containing protein 3 plays a role of tumor inhibitor in cervical cancer. Biochem Biophys Res Commun. 2018;498(3):686\u0026ndash;92.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDong W, Luo B, Qiu C, et al. TRIM3 attenuates apoptosis in Parkinson's disease via activating PI3K/AKT signal pathway. Aging. 2020;13(1):735\u0026ndash;49.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu K, He Y, Moqbel S, Zhou X, Wu L, Bao J. SIRT3 ameliorates osteoarthritis via regulating chondrocyte autophagy and apoptosis through the PI3K/Akt/mTOR pathway. Int J Biol Macromol. 2021;175:351\u0026ndash;60.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang Y, Cai W, Han G, et al. [Corrigendum] Panax notoginseng saponins prevent senescence and inhibit apoptosis by regulating the PI3K\u0026ndash;AKT\u0026ndash;mTOR pathway in osteoarthritic chondrocytes. Int J Mol Med. 2022;49(3):30. [pii].\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDeng Y, Shi Y, Wen C. TRIM3 Inhibits H(2)O(2)-Induced Apoptosis in Human Lens Epithelial Cells by Decreasing p53 via Ubiquitination. Curr Eye Res. 2022;47(5):747\u0026ndash;52.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-orthopaedic-surgery-and-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"josr","sideBox":"Learn more about [Journal of Orthopaedic Surgery and Research](http://josr-online.biomedcentral.com)","snPcode":"13018","submissionUrl":"https://submission.nature.com/new-submission/13018/3","title":"Journal of Orthopaedic Surgery and Research","twitterHandle":"@MSKmedBMC","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"TRIM3, chondrocyte, apoptosis, AKT/mTOR, osteoarthritis","lastPublishedDoi":"10.21203/rs.3.rs-7739549/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7739549/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIntroduction: Osteoarthritis (OA), a prevalent cause of global disability, is characterized by progressive articular cartilage degeneration. Despite its clinical significance, the molecular pathogenesis remains incompletely understood, posing challenges for developing disease-modifying therapies.\u003c/p\u003e\u003cp\u003eMethods: Utilizing knee OA datasets from GEO database, we systematically evaluated TRIM3 expression patterns during disease progression. Comparative analyses of TRIM3 protein levels between OA and normal cartilage were performed using Western blot and immunohistochemistry (IHC). In TRIM3-knockdown (siTRIM3) chondrocytes, we employed qRT-PCR and Western blotting to quantify Bcl-2/Bax expression ratios and assess AKT/mTOR pathway activation through phosphorylation status (p-AKT/p-mTOR). To establish functional dependency, siTRIM3 cells were treated with mTOR inhibitor followed by reevaluation of Bcl-2/Bax balance. Apoptotic responses to IL-1β stimulation were quantified by flow cytometry, while collagen II (COL2A1) preservation was visualized via immunofluorescence.\u003c/p\u003e\u003cp\u003eResults: Integrated bioinformatics and IHC analyses demonstrated significant TRIM3 upregulation in OA cartilage compared to healthy controls (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01). TRIM3 depletion exerted dual protective effects: (1) modulating apoptotic regulators by decreasing Bax while increasing Bcl-2 expression, and (2) enhancing AKT/mTOR pathway activation evidenced by elevated p-AKT/p-mTOR levels.Notably, mTOR inhibition abolished these effects, restoring pro-apoptotic Bax expression and suppressing anti-apoptotic Bcl-2 (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05), confirming pathway mediation. Functionally, siTRIM3 conferred 40% reduction in IL-1β-induced apoptosis (p\u0026thinsp;\u0026lt;\u0026thinsp;0.05) and remarkably preserved COL2A1 integrity, exhibiting 2.3-fold higher fluorescence intensity versus controls (p\u0026thinsp;\u0026lt;\u0026thinsp;0.01).\u003c/p\u003e\u003cp\u003eConclusion: Our findings establish TRIM3 as a novel regulator of OA pathogenesis that exacerbates disease progression through AKT/mTOR pathway suppression, thereby promoting chondrocyte apoptosis and extracellular matrix degradation. Therapeutic targeting of TRIM3 may represent a promising strategy to attenuate cartilage degeneration in OA.\u003c/p\u003e","manuscriptTitle":"TRIM3 exacerbates chondrocyte apoptosis through suppression of AKT/mTOR signaling pathway in osteoarthritis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-10-20 18:12:17","doi":"10.21203/rs.3.rs-7739549/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-10-13T15:46:02+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-10-13T08:34:34+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"223513343522743201806944948817666815397","date":"2025-10-13T08:03:35+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"154966238169200638743533239796294842503","date":"2025-10-13T01:42:26+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"260303812323678047157711323490606267367","date":"2025-10-08T16:33:02+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-10-07T08:56:51+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-10-04T12:21:51+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-10-01T05:20:09+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Orthopaedic Surgery and Research","date":"2025-09-29T08:07:28+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-orthopaedic-surgery-and-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"josr","sideBox":"Learn more about [Journal of Orthopaedic Surgery and Research](http://josr-online.biomedcentral.com)","snPcode":"13018","submissionUrl":"https://submission.nature.com/new-submission/13018/3","title":"Journal of Orthopaedic Surgery and Research","twitterHandle":"@MSKmedBMC","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"d9c88c62-f54d-4c64-b0c3-fff31f02c29b","owner":[],"postedDate":"October 20th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-12-29T16:05:06+00:00","versionOfRecord":{"articleIdentity":"rs-7739549","link":"https://doi.org/10.1186/s13018-025-06510-8","journal":{"identity":"journal-of-orthopaedic-surgery-and-research","isVorOnly":false,"title":"Journal of Orthopaedic Surgery and Research"},"publishedOn":"2025-12-23 15:57:53","publishedOnDateReadable":"December 23rd, 2025"},"versionCreatedAt":"2025-10-20 18:12:17","video":"","vorDoi":"10.1186/s13018-025-06510-8","vorDoiUrl":"https://doi.org/10.1186/s13018-025-06510-8","workflowStages":[]},"version":"v1","identity":"rs-7739549","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7739549","identity":"rs-7739549","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2025) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00