Genome-Wide Profiling of WRKY, HSC, and ProDh Gene Families and VIGS-Mediated Functional Analysis of Negative Regulators of Cotton's Stress Response to Drought, Heat, and Whiteflies

Genome-Wide Profiling of WRKY, HSC, and ProDh Gene Families and VIGS-Mediated Functional Analysis of Negative Regulators of Cotton's Stress Response to Drought, Heat, and Whiteflies | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genome-Wide Profiling of WRKY, HSC, and ProDh Gene Families and VIGS-Mediated Functional Analysis of Negative Regulators of Cotton's Stress Response to Drought, Heat, and Whiteflies Mariam Akhtar, Rubab Zahra Naqvi, Muhammad Jawad Akbar Awan, Ifrah Imran, and 1 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-6591527/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Biotic and abiotic stress are fundamental contributors to restricting cotton yield and performance. Comprehension of molecular mechanisms behind these responses is necessary for elevating stress resistance. Genome wide profiling classified 100 WRKY, 63 HSC, and 10 ProDh family proteins identified in Gossypium hirsutum based on conserved domains and motif, and phylogenetic analysis. In the present study HSC70-1 , WRKY27 , and ProDh were characterized as negative stress regulators of heat, drought, and whiteflies and their functional analyses were performed to validate the roles of these genes in modulating the intensity of stress response and defense mechanism via Virus-Induced Gene Silencing (VIGS) using foliar sprays – a novel approach for transient gene silencing in cotton. Downregulation of HSC70-1 resulted in strong resilience to drought and heat stress. WRKY27 was the strong negative modulator of whiteflies and heat, and ProDh silenced plants showed susceptibility to all stresses. The relative expression of some other genes, BBX18 , GASA5 , MAP3K65 , and CKX1 , involved in these stress related pathways was also quantified. BBX18 and GASA5 were found downregulated in all silenced plants whereas MAP3K65 showed upregulation in HSC70 - 1 silenced plants while CKX1 was upregulated in WRKY27 silenced plants. Overall, this study aims to provide the functional importance of down-regulators to make heat, drought, and whitefly tolerant plants. Genome wide analysis signaling pathways WRKY HSC70 ProDh heat stress drought stress whitefly stress cotton VIGS Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Globally, cotton ( Gossypium Hirsutum L .) appears as a vital cash crop, with the USA, China, Pakistan, India, and Brazil being key contributors ( 1 ). It constitutes 35% of worldwide fiber production ( 2 ). Although cotton, being a halophytic crop, shows higher stress resistance compared to other plants, stringent stress conditions can considerably undermine its productivity and growth. ( 3 ). Cotton crops encounter significant biological threats, with insect pests being one of the most calamitous ( 4 ). Bemisia tabaci , a sap-sucking insect, is a complex species consisting of 44 morphologically similar but genetically distinct subspecies, present on all continents besides Antarctica ( 5 ). During feeding, both adults and nymphs discharge honeydew, a sugary substance that stimulates “sooty mold” formation on leaves and fruits, adversely impacting crop performance. Infested plants exhibit folding of leaves, yellowing, disfigured fruit, and reduced plant development ( 6 ). B. tabaci is particularly disreputable for its ability to transmit viruses through various modes: semi-persistent, persistent, and non-persistent. This pest acts as vector of begomoviruses ( Geminiviridae ) ipomoviruses ( Potyviridae ), carlaviruses ( Betaflexiviridae ), torradoviruses ( Secoviridae ), criniviruses ( Closteroviridae ), and carlaviruses ( Betaflexiviridae ). Diverse host range and tendency to acquire insecticide resistance make this pest progressively harmful ( 7 ). Cotton production has profoundly declined due to abiotic stresses, resulting in considerable reduction in quality and yield ( 8 ). Drought, heat, and biotic stress have been shown to cause 50–60% decline in cotton yield ( 9 ). Elevated temperature adversely impacts the stability of cell membranes, root development, photosynthesis, and stomatal regulation ( 10 ). Heat stress intensifies water loss via transpiration, creating water scarcity conditions and obstructing plant’s ability to maintain hydration ( 11 – 13 ). The severity of water stress on cotton yield is dependent on the duration and intensity of drought. The primary reason for diminished cotton yield during drought stress is curtailment of boll quantity, and boll size which is associated with boll shedding and heightened square drop ( 14 ). Closing of stomata during drought stress causes a reduction in gas exchange, nutrient uptake, and transpiration ( 15 ). The scarcity of water affects physiological processes including CO 2 diffusion, stomatal conductance, and photosynthesis ( 12 , 16 ). Plants react to stress conditions by modifying the transcription factors that are responsible for controlling the expression of signaling cascades ( 17 , 18 ). Research suggests that various WRKY genes across numerous plant species have been identified and shown to be involved in development, metabolism, growth, and environmental response. Evidence suggests that many genes react to elicitors, pathogens, and defense-related phytohormones like jasmonic acid, and salicylic acid, showcasing their potential role in plant immunity. These transcription factors (TFs) can negatively or positively modulate different facets of the plant innate immunity system, including effector-triggered immunity (ETI), and pathogen-associated molecular pattern (PAMP)-triggered immunity ( 19 ). The WRKY family’s conserved domain comprises 60–70 amino acids, prominently featuring “WRKYGQK”, a highly conserved seven-phthalide sequence ( 20 ). Another conserved characteristic is “CX4–5CX22–23HXH or CX7CX23HXC”, a unique zinc finger motif at C-terminal. They form hetero or homo complexes and locate a particular cis-regulatory element “5′-TTGAC(C/T)-3′” in gene promoter regions, known as W-box, at the N-terminal through 60 amino acid long chain. WRKY TF’s β-sheet enters the major groove of DNA (B form), forming non-polar contacts. The WRKYGQK domain’s Tyrosine (Y), Tryptophan (W), and two Lysine (K) residues are responsible for establishing a stable bond ( 17 , 21 – 23 ). Variants of this signature motif include “WRKYGEK” and “WRKYGKK” and various unconventional WRKY domains suggesting a canonical sequence of W(K/R)(R/K)Y. Some WRKY proteins contain two WRKY domains. Overall, WRKY proteins exhibit extensive diversity in overall structure, which can be organized in different groups, possibly reflecting their varied functions ( 24 ). The 70 kDa heat shock proteins are a large and well-conserved group of molecular chaperones present in both eukaryotes (Hsp70), and prokaryotes (DnaK). These chaperones play a pivotal role in multiple aspects of protein folding, featuring folding of recently synthesized proteins, refolding of proteins denatured by stress, preventing aggregation, breaking down protein aggregates, assisting disintegration of misfolded proteins, regulating stability and activity of regulatory proteins, and translocation of proteins across membranes. Hsp70 chaperones maintain cellular proteostasis via ATP-dependent cycles, primarily by interaction with non-native polypeptides and intermediates’ folding that are present in multiple comportments of cells, including nucleus, cytosol, endoplasmic reticulum, chloroplasts, and mitochondria ( 25 , 26 ). Members of Hsp70 family contribute to two out of four structural components found in the prototypical Hsp70, bacterial DnaK domain. These components include a 45-kDa N-terminal nucleotide binding domain (NBD), a 10-kDa helical lid domain (SBDα), a 15 kDa substrate binding domain (SBDβ), and a variable-length disordered C-terminal tail. In eukaryotic nuclear and cytosolic Hsp70s, the disheveled tail often concludes with “Glu-Glu-Val-Asp; EEVD, a conserved charged sequence that interacts with specialized cofactors. The NBD exhibits an actin-like structure that consists of IA, IB, IIA, IIB, four sub-domains, arranged in two lobes segmented by a deep cleft. ATP coordinates all four subdomains at the bottom of this cleft, moderating lobe movements within the catalytic center. SBDβ consists of an eight-stranded β-sandwich structure that includes polypeptide binding cavity with a central hydrophobic cavity. In nucleotide-free and ADP-bound states, SBDα adheres to the SBDβ, completely cloaking this activity. A conserved linker connects the SBDβ to the NBD, playing a significant role in allosteric mechanism that links ATP hydrolysis and NBD to substrate binding ( 27 , 28 ). Proline, a versatile amino acid, concentrates in a profuse amount within plants when exposed to stress conditions. Its aggregation is closely linked to numerous cellular processes such as energy management, osmotic pressure regulation, redox balance shifts, and pathogen defense mechanism. Proline metabolism is responsive to environmental signals and experiences specific modifications that influence stress tolerance. Upon exposure to dehydration, plants augment Proline synthesis and attenuate its breakdown, resulting in heightened levels of proline. This amino acid is synthesized from glutamic acid (Glu) and ornithine, primarily utilizing the former pathway during stress. This synthesis occurs in plastids, and cytosol, involving P5C reductase (P5CR) and ∆ 1 pyrroline-5-carboxylate (P5C) synthase (P5CS). Catabolism of Proline takes place in mitochondria where it is oxidized to Glu through a two-enzyme process. Initially, Pro is converted to PC5 by Pro dehydrogenase (ProDH) which is subsequently transformed into glutamate semi-aldehyde, non-enzymatically which then acts as a substrate for P5C dehydrogenase to synthesize Glu. Studies have shown the sensitivity of Pro metabolism genes to pathogen infections. For instance, in Arabidopsis, Pseudomonas syringae pv. Tomato (Pst) strains trigger hypersensitive response (HR) and effector triggered immunity (ETI) and activate P5CR, P5CS2, and ProDh. Under HR conditions, P5CS2 activation is facilitated by salicylic acid, resulting in alleviated Pro levels during infestation ( 29 , 30 ). In this study a reverse genetic approach, Virus-Induced Gene Silencing (VIGS) is used for functional characterization of genes. For VIGS, Agrobacterium -mediated inoculation is commonly used to transiently suppress the gene of interest. This is achieved using needleless syringes to deliver bacterial culture directly into plants that is commonly known as Agrobacterium infiltration assay. However, this method is laborious, limited, and time-consuming. Alternatively, Agrobacterium can be delivered through foliar sprays, vacuum-assisted infiltration, and mechanical inoculations. To enhance applicability, we have redesigned established methods of transient gene expression and gene delivery in cotton using foliar sprays and mechanical inoculations. This method can be implemented on a large scale to design a flexible, quick, and industrially scalable platform, conferring an alternative to traditional agro-infiltration. For foliar applications, surfactants such as Tween 20, Tween80, Triton X-100 and Silwett-77 are used to reduce surface tension and facilitate the uptake of active ingredients through the waxy cuticle via stomata into leaves. Additionally, abrasives are dusted on leaves to enable symplastic delivery (Fig. 1 ). We conducted a genome-wide characterization and analysis of WRKY, Hsc, and ProDh family in G. hirsutum . The classification was validated by conserved motif, domain and phylogenetic analyses. We validated the role of WRKY27, Hsc70-1 , and ProDh genes’ overexpression under heat, drought, and whitefly stresses ( 31 – 34 ) (Supplementay Fig. 1 ). The silencing effect on expression of some other genes such as BB1X8, GASA5, MAP3K65 , and CKX1 genes, involved in stress-related pathways, was also analyzed. This study provides a detailed analysis of WRKY , Hsc , and ProDh gene families and roles of WRKY27, Hsc70-1 , and ProDh in heat, drought, and whitefly stress management. Materials and Methods 2.1. Systematic categorization and Profiling of Gene families By employing BLAST of one known WRKY27 (NCBI ID: XP_040963566.1), Hsc70-1 (NCBI ID: NP_001313791.1), and ProDH (NCBI ID: NP_001314006.1) all available sequences were retrieved from Phytozome assembly Gossypium hirsutum v3.1. Multiple sequence alignment tool ClustalW was used to align all the retrieved sequences. Physio-chemical properties of proteins of all three gene families were accessed by enumerating their number of amino acids, molecular weight, isoelectric point, aliphatic index, instability index, and hydropathicity using ExPASy ProtPram. Using the standard setting of MEME suite conserved motif analysis was carried out, selected number of motifs were 10. NCBI Conserved Domains Database (CDD) was used for domain analysis. MEGA6 software was utilized for the construction of phylogenetic trees. Maximum likelihood tree, retaining 1000 bootstrap value, was contrived. Promotor analysis was performed on 800 bp upstream regions of Hsc70-1 , WRKY27 , and ProDh from Phytozome using PlantCARE. 2.2. Construction of TRV-Vectors Gene-specific primers containing restriction sites of EcoR I and Kpn I restriction endonucleases at 5’ ends were designed to amplify targeted region selected by SGN-VIGS tool 35). Total RNA was isolated from G. hirsutum leaves to synthesize cDNA using cDNA synthesis kit (OneScript Plus cDNA synthesis Kit Applied Biological Materials Cat. No. G236) and desired regions were amplified using specific primers. Amplicons and TRV2 plasmid were restricted with EcoR I and Kpn I restriction endonucleases and further ligated together by using T4 DNA ligase (Thermo Fisher Scientific, Cat. No. EL0011). Ligated product was transformed into Escherichia coli Top10 chemically competent cells via heat-shock method. Constructs were confirmed via PCR-based screening and restriction by subjective enzymes to confirm the presence of both ligated products. Positive constructs were transformed into Agrobacterium tumefaciens GV3101 cells and later on screened by using PCR. Sequences of primers used in this study are provided in Table 1 . Table 1 Sequence of primers used for amplification of targeted regions. Name Primer Sequence Annealing-T°C Amplicon size (bp) Hsc70-F 5’ CGTTCCGAATTCCTTCAATGACTCTCAGCGTC 3’ 52°C 258 Hsc70-R 5’ ATTCTGGGTACCAAATCTTCACCTCCAAGATG 3’ 52°C 258 WRKY27-F 5’ TTCAGAGAATTCTATTACAGGTGCAGCAGCTC 3’ 55°C 265 WRKY27-R 5’ AGAGATGGTACCGAGACTCGTGGCATAGCG 3’ 55°C 265 ProDH-F 5’ ACAACGGAATTCTTTAACCATTGATGCCGAGGA 3’ 52°C 218 ProDH-R 5’ TTTCGCGGTACCATGTAAGCGCCTCTCACCA 3’ 52°C 218 BBX18-F 5’ TCTTCCGAATTCGCTTGTAGTTTCCAGGGGAT 3’ 52°C 211 BBX18-R 5’ CTGTTGGGTACCGGCATTTAGATCAATCAACTC 3’ 52°C 211 GASA5-F 5’ GGCATCGAATTCGCCCTTCTCAAAAACAAAGAC 3’ 52°C 162 GASA5-R 5’ TTAGAAGGTACCTTAACTCACCTTGAGGACGA 3’ 52°C 162 MAP3K65-F 5’ CTGGGAGAATTCACTGGATAAGCACTTGAGC 3’ 52°C 177 MAP3K65-R 5’ AAGCGTGGTACCGTGGTACCTGCAACATCTTG 3’ 52°C 177 CKX1-F 5’ GAGCTGGAATTCTGATAGAACCAACCTCTGTT 3’ 51°C 206 CKX1-R 5’ TGTGTTGGTACCGTGGAAGAAATATCAGAAACTGA 3’ 51°C 206 2.3. Plant Growth parameters Cotton variety FH-333 was used for these experiments. Seeds were de-linted using H 2 SO 4 . Seeds were grown in plastic glasses by using peat moss, maintaining day and night temperatures between 19°C and 24°C, a 16-hour photoperiod (16h light/8h dark), and humidity ranging from 35–70%. Plants at cotyledon stage were exposed to VIGS-based sprays. 2.4. Agrobacterium -based Spray-Induced Gene Silencing Single colonies of TRV2-WRKY27, TRV2-Hsc, TRV2-ProDh, TRV2-CLA, TRV1, and TRV2 were cultured in Luria-Bertani (LB) medium augmented with Kanamycin (50 µg/mL) and Rifampicin (25 µg/mL) selections for two days at 28°C. For each culture, in 50 mL falcons 22.5mL of LB medium supplemented with Kanamycin (50 µg/mL) and Rifampicin (25 µg/mL) was added along with 2.5 mL of 10 mM MES, and 20 µM acetosyringone and incubated overnight at 28°C. For optimization of VIGS based foliar sprays the plants were sprayed with different concentrations of optical density (OD-600 nm), surfactant, and abrasive quantity to observe the effects of various factors on photobleaching caused by silencing of CLA1. Silencing of CLA1 served as a scorable marker (Supplementary File Table 1 , Supplementary Fig. 2). Cells were harvested and re-suspended in Agrobacterium inoculation solution (AIS: 10 mM MES pH 5.5, 10 mM MgCl 2 ) maintaining the final OD at 0.05. The cultures were kept in the dark for 3 hours at room temperature. At the time of spraying TRV-1 suspension was mixed in 1:1 ratio with TRV2-WRKY27, TRV2-Hsc, TRV2-ProDh, TRV2-CLA, and empty TRV2, each culture was supplemented with 0.08–0.1% v/v Tween20. Prior to spraying, carborundum was gently dusted on leaves to cause abrasion. A plastic hand sprayer was used for the delivery. Plants were kept in controlled conditions until the symptoms of photobleaching appeared on TRV:TRV2-CLA sprayed plants. 2.5. cDNA synthesis and RT-qPCR analysis After the appearance of photo-bleaching symptoms in true leaves of TRV:TRV2-CLA plants, total RNA was isolated from TRV2-WRKY27,TRV2-Hsc, TRV2-ProDh, and TRV:00 true leaves tissue by using TRIzol (Invitrogen, USA), ensued by DNAse treatment to eliminate genomic DNA traces. RNA concentration was measured using Nanodrop 2000 spectrophotometer (Thermo Scientific, USA). 3 µg RNA was transcribed to cDNA using kit (OneScript Plus cDNA synthesis Kit Applied Biological Materials Cat. No. G236). Real-time quantitative PCR was performed for the assessment of gene expression. The difference in expression levels of targeted genes in TRV:TRV2-WRKY27, TRV:TRV2-Hsc, TRV:TRV2-ProDh sprayed was evaluated. Real-time quantitative PCR (qPCR) was performed in CFX96 Touchdown machine (Bio-Rad USA) using SYBR Green Real-Time PCR Master Mix (Thermo-Fisher Scientific, USA) using the following cycling parameters: 5 min of initial denaturation at 95°C, 40 cycles of denaturation at 95°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec followed by melt curve analysis. The housekeeping cotton gene UBQ7 was used as an internal control to normalize gene expression data. Relative fold difference was calculated for each sample using ΔΔCt method. Primers used are provided in Table 1 . 2.6. Drought Assay Water was halted on TRV:TRV2-Hsc70-1, TRV:TRV2-WRKY27, TRV:TRV2-ProDH, TRV:00 sprayed plants for 30 days after the establishment of VIGS. Morphological alterations and trait variations in plants under stress were recorded. 2.7. Heat Stress After appearance of bleaching symptoms in TRV:TRV2-CLA plants, the establishment of VIGS was confirmed and plants were subjected to heat stress. TRV:TRV2-Hsc70-1, TRV:TRV2-WRKY27, and TRV:TRV2-ProDH, TRV:00 sprayed plants were kept at 40°C for 24 hours and after that structural modifications/alterations in plants were observed and noted. 2.8. Whitefly Bioassay: Under controlled conditions the TRV:TRV2-Hsc70-1, TRV:TRV2-WRKY27, TRV:TRV2-ProDH, and TRV:00 sprayed plants were subjected to whitefly infestation. On day 14 of infestation, the number of eggs, nymphs, and adult whiteflies were documented. Results 3.1. Multiple Sequence Alignment All possible sequences of WRKY, Hsc, and Pro-DH proteins were retrieved from the Phytozome assembly “ Gossypium hirsutum v3.1 ”. We identified 100 WRKYs , 63 Hsc70s , and 10 ProDHs encoding genes in G. hirsutum genome. All the WRKY sequences were classified into two groups (Group I, Group IIA-F) based on the conserved motifs present. Group-I has 38 WRKYs, Group-IIA has 11 WRKYs, Group-IIB has 8 WRKYs, Group-IIC has 10 WRKYs, Group-IID has 8 WRKYs, Group-IIE has 6 WRKYs, and Group-IIF has 18 WRKYs. At the C-terminal of all 100 WRKYs, there is a conserved motif “WRKYGQK” subsequent to zinc-finger motif, except a member of Group-IIA, WRKY80, which has a single amino acid substitution “WRKYGKK”. 3 members of Group-IIA WRKY 7, WRKY87, and WRKY100 have 2 “WRKYGQK” motifs. C-X n -C-X n -HXH-type zinc finger motif shows conserveness across Group-IIB, C, D, and E and a single amino substitution in some Groups. 5 WRKYs in Group-I have “HKH”, and 7 members of Group-IA have “HRH” instead of “HNH” motif. 4 WRKYs in Group-IIA have “HTH”, and one WRKY has “HKH”, similarly 8 WRKYs in Group-IIF have substitution in “HNH” motif. This classification can be illustrated in Fig. 2 A. 63 Hsc sequences were categorized into three groups, Group-IA, IB, Group-IIA, IIB, and Group-III depending upon consistency of motifs across sequences. Group-IA has 10 Hsc sequences, Group-IB has 4 Hsc’s, Group-IIA has 23 Hsc’s, Group-IIB has 20 Hsc’s, and Group-III has 4 Hsc’s. All Hsc sequences have a conserved “IDLGTTYS” motif, except sequences of Group-IA. Some groups show single amino acid substitution such as a member of Group-IIA, Hsc6 has “IDLGITYS” and 12 members of Group-IIB have “IDLGTTNS” motif. One member of Group-IIB, Hsc61 shows absence of this motif. Single or double amino acid substitution can be seen in sequences of other motifs as well. Conserved sequences are demonstrated in Fig. 2 B. 10 ProDh sequences were identified in G. hirsutum , they were classified into three groups: Group-IA, Group-IB, Group-II, and Group-III. Group-IA has 4 protein sequences, Group-IB, and Group-II have 2 and 3 protein sequences correspondingly, and remaining one sequence lies in Group-III. Some motifs show substitution of single amino acid, as can be seen in Fig. 2 C. 3.2. Physio-chemical Properties The Expasy ProtPram tool was used to determine molecular weight, PI number of amino acids, isoelectric point, instability index, aliphatic index, and hydropathicity. In WRKY sequences, in Group-I PI ranges from 9.26–9.98, number of amino acids are from 292–362, the molecular weight is between 32811.88 and 39350.54, instability index from 40.93–69.66, aliphatic index from 57.59–75.41, and hydropathicity ranges from 0.447–0.885, in Group-II PI ranges from 4.87–9.98, molecular weight is between 13162.98-6280.77, amino acid between 117–571, instability index 41.2-67.94, aliphatic index 40.41–66.99, hydropathicity − 0.545 to -1.069. Data is provided in Supplementary Table 2. In Group-I of Hsc’s PI ranges between 5.32-6, molecular weight from 84766.58-98701.31, amino acids from 757–886, instability index 35.66–49.64, aliphatic index 77.28–88.95, hydropathicity from 0.346–0.52. In Group-II PI ranges from 4.98–5.99, number of amino acids ranges between 255–886, molecular weight from 29307.45-98521.15, aliphatic index 60.47–89.62, instability index from 27.41–42.89, hydropathicity from − 0.3 to -1.191. In group-III PI ranges from 5-5.5, molecular weight is between 60950.23-62652.27, number of amino acids from 552–856, instability index 34.74–39.86, aliphatic index 99.18-104.47, hydropathicity − 0.007 to -0.069. Further details are provided in Supplementary Table 3. In ProDh sequences, PI ranges from 7.58–9.23, molecular weight is between 18157.9-57240.81, number of amino acids from 166–515, aliphatic index 81.8-90.55, instability index 42.72-57, hydropathicity − 0.11 to -0.277. Details are provided in Supplementary Table 4. 3.3. Motif and Domain Analysis Conserved motif analysis was carried out using MEME suite for the identification of functional regions in proteins, and exploration of structural elements indispensable for its activities. The 800 bp upstream promotor regions of WRKY27, Hsc70-1 , and ProDh were analyzed for the presence of motifs. 10 conserved motifs were selected to be shown ( Fig. 3 ) . In the case of WRKYs, Motif 1 and Motif 2 are present in all sequences, with Motif 2 situated on C-terminus of Motif 1. Motif 1 signifies the WRKY domain, and Motif 2 pertains to a zinc-finger motif. Motif 3 is found in all WRKYs except 5 members of Group-IIA. Motif 4 is situated only in Group-I. Motif 5 is present in Group-I, except 5 WRKYs, Group-IIB, and 4 Group-IIC, and 2 Group-IIE WRKYs. Motif 6 exists within Group-I, Group-IIC, Group-IID. Motif 7 can be mostly identified in Group-IIB, and IIC. Motif 8 is most prevalent in Group-IID, and F. Motif 9 and 10 are displayed in Group-I only. Members of Group-IIB, IIC, and IID show the most similarity among them, while Group-IIA is distinct from all. Figure 3 A. depicts the allocation of conserved motifs across the span of WRKYs. We identified two superfamilies via NCBI CDD for domain analysis, WRKY domain superfamily, and Zinc-cluster Domain superfamily. WRKY domain is present in all Groups while Zinc-cluster domain is only present in members of Group-I. In the case of HSCs Group-IIA, and IIB have all the conserved motifs present in them except HSC22, the only difference lies in distances of motifs. In members of Group IIA motif 2 and 8 are placed very close to N-terminal as compared to elements of Group-IIB. Motifs 3 and 7 are absent in Group-IA. Members of Group IB have only 3 domains in them; 1,4, and 7. In Group-III motif 8 is missing on C-terminal of motif 2. Group-III also lacks domain 5. All the motifs are displayed in Fig. 3 B. CDD analysis showed that PTZ superfamily, ASKHA_ATPase like superfamily, DnaK superfamily, HscA superfamily are present in all protein sequences except Hsc9 which only has 2 domains: PTZ, and ASKHA_ATPase. Among ProDH, Group-IA and Group-IB showed great resemblance among motifs, the only variation lies in location of Motif 10. Motif 1, 3, 9, 10 were present in all Groups. Motifs 5, 7, and 8 are present only in Group-I. Group-II, and Group-III differ in presence of one Motif, but the arrangement of Motifs varies vastly. Figure 3 C. shows motif analysis of ProDH sequences of G. hirsutum . In ProDH sequences, ProDh superfamily, PLN superfamily, and PutA superfamily domains are present in all. 3.4. Phylogenetic Analysis MEGA6 was used to construct the maximum likelihood tree for phylogenetic analysis of WRKY, Hsc, and ProDH protein sequences. In the case of WRKY, phylogenetic trees show each group as a separate clade, represented by different colors ( Fig. 4 ) . Sequences are divided into two major groups with WRKY domain present in all groups. Group I-A, shown by pink circles, is substantially distinct from other groups. Group-IIA, IIB, IIC, IID, IIE, and IIF are represented by green, red, mustard, blue, purple and brown circles. The phylogenetic tree constructed for WRKYs of G. hirsutum is demonstrated in Fig. 4 A. Phylogenetic analysis of HSCs showed three major clades, all of them represented by different colors. Group-IA, and IB are displayed by blue, and yellow circles respectively. Group IIA and IIB are shown by pink circles and squares. Group III is depicted by purple circles. HSC9 didn’t lie in any group and is presented by a grey circle. Phylogenetic tree of HSC proteins constructed by MEGA6 is evident in Fig. 4 B. ProDh sequences grouped together are shown in independent clades in phylogenetic tree constructed by MEGA6. All 4 members of Group-IA lie closely together, Group-III which is substantially distinct from other Groups exist in an independent clade. 2 members of Group-IB, and 3 members of Group-II lie close to each other. Phylogenetic tree constructed for ProDh is shown in Fig. 4 C. 3.5. Promoter analysis On PlantCARE promotor analysis was performed on 800 bp upstream region of genes selected for VIGS. Promotor element for transcription start (TATA-box), common cis-acting element in promotor and enhancer region (CAAT-box), light response (G-box), and abscisic acid responsiveness (ABRE) are common motifs in the promotor regions of all three genes. AT-TATA-box is present in HSC70-1 , and ProDh but absent in WRKY27 . TCT-motif which is a part of light responsive element is present in WRKY27 , and Hsc70-1 but absent in ProDh . Some motifs are unique in all sequences, light responsive element (3-AF1 binding site), cis-regulatory element involved in circadian control (circadian), and gibberellin responsive element (P-box) are unique in WRKY27 . A module of light response (AE-box), cis-acting regulatory element for the anaerobic induction (ARE), MeJA responsiveness (CGTCA and TGACG) are only present in Hsc70-1 , similarly cis-regulatory elements involved in stress and pathogen induced gene expression (AAGAA), light responsiveness (GATA motif), low temperature responsiveness (LTR), and auxin response (TGA) are only present in ProDh . Promotors sequences and their respective functions are shown in Supplementary Table 5 . Heat maps showing abundance of promotors across genes, and unique and shared promotors are shown as venn diagram in Fig. 5 . 3.6. Downregulation of Targeted Genes Four weeks after sprays, photobleaching symptoms appeared on true leaves of TRV:TRV2-CLA sprayed plants and it was used as phenotypic marker for validation of onset of gene silencing ( Fig. 6 B ) . After that RNA was isolated and transcribed to cDNA from TRV:TRV2-Hsc, TRV:TRV2-WRKY27, TRV:TRV2-ProDh sprayed plants. Gene expression analysis by qPCR showed remarkably low transcript levels as compared to TRV:00 plants. ( Fi. 6 C) 3.7. Heat stress assay Upon confirmation of reduced gene expression ( Fig. 6 B, C ) , VIGS sprayed plants were kept in a chamber at 40°C for 24 hours for heat stress. TRV:TRV2-Hsc, TRV:TRV2-WRKY27, TRV:TRV2-ProDh behaved well under heat stress, documented by the onset of leaf epinasty without any salient impact on the stem ( Fig. 6 D ) . Once the heat stress was alleviated, leaves of TRV:TRV2-Hsc, TRV:TRV2-WRKY27, TRV:TRV2-ProDh recovered, while TRV:00 sprayed plants failed to recover ( Fig. 6 E ) . Comparison of TRV:TRV2-Hsc, TRV:TRV2-WRKY27, TRV:TRV2-ProDh and TRV:00 sprayed plants immediately after heat stress and two days later can be seen in Fig. 6 D, E. 3.8. Drought stress assay Following validation of gene suppression ( Fig. 6 B, C ) , TRV:00, TRV:TRV2-Hsc, TRV:TRV2-WRKY27, TRV:TRV2-ProDh sprayed plants were kept in drought stress by curtailing water supply for four weeks. No wilting symptoms appear for up to 4 weeks as compared to TRV:00 sprayed plants which showed extreme desiccation and wilting within two to three weeks and did not recover even after watering as seen in Fig. 6 F. TRV:TRV2-Hsc outperformed TRV:TRV2-Hsc, TRV:TRV2-WRKY27. TRV:TRV2-WRKY27 showed leaf chlorosis and drought induced senescence to some extent ( Fig. 6 F ) . We conclude that TRV:TRV2-Hsc, TRV:TRV2-ProDh are strong while TRV:TRV2-WRKY27 is a moderate negative regulator of drought stress. 3.8. Whitefly bioassay TRV:00, TRV:TRV2-Hsc, TRV:TRV2-WRKY27, TRV:TRV2-ProDh sprayed plants were subjected to whitefly stress after confirmation of VIGS establishment ( Fig. 7 A ) . Using a light microscope, number of eggs, and nymphs were counted on 1mm 2 sections of different leaves were counted for whitefly reproductive assessment ( Fig. 7 B, C ) . Quantification of developmental stages on leaves of sprayed plants were compared with TRV:00 sprayed plants as control. TRV:TRV2-WRKY sprayed plants showed significantly low production of eggs and nymphs. As indicated by the graphs TRV:TRV2-WRKY27 showed significantly reduced number of eggs and nymphs. TRV:00 sprayed plants used as control showed abundant egg and nymph production. On day 14 egg count on TRV:TRV2-Hsc sprayed plants were 37% less than TRV:00 sprayed plants. TRV:TRV2-WRKY27 and TRV:TRV2-ProDh showed 70.4% and 63% less egg production respectively, as compared to control. On day 14 the nymphal count was 50%, 75%, and 66.7% reduced in TRV:TRV2-Hsc, TRV:TRV2-WRKY27, TRV:TRV2-ProDh sprayed plants, respectively. On day 14 the average egg count on TRV:00 plants were 90, 56 on TRV:TRV2-Hsc, 26.7 on TRV:TRV2-WRKY27, and 33.3 on TRV:TRV2-ProDh sprayed plants while the mean nymph count was 12 on plant sprayed with TRV:00, 6.6 on TRV:TRV2-Hsc, 3.3 on TRV:TRV2-WRKY27, and 4.6 on TRV:TRV2-ProDh ( Fig. 7 B, C ) . In conclusion, TRV:TRV2-WRKY27, TRV:TRV2-ProDh can be potential targets for combating biotic stress, while to some extent TRV:TRV2-Hsc can be a negative regulator of whitefly stress. 3.9. Relative expression of other stress-responsive genes The relative expression of other abiotic stress-related genes such as BBX18, GASA5, MAP3K65 , and CKX1 genes, was assessed and it displayed striking discrepancy. BBX18 and GASA5 were found to be downregulated in WRKY27, Hsc70-1, and ProDH downregulated plants. MAP3K65 was upregulated in Hsc70-1 silenced plants, while CKX1 showed upregulation in plants where WRKY27 was silenced. Expression pattern is shown in Fig. 8 . Discussion WRKY transcription factors (TFs) are housekeeping proteins and remarkably conserved across plant kingdom. Extensive research is available on WRKY’s genome wide classification in cotton, showcasing their potential as regulators of various biotic and abiotic stresses ( 17 , 36 , 37 ). This study explores the evolution and significance of WRKY genes in G. hirsutum . Here, we identified 100 WRKYs in the genome of G. hirsutum and they were divided into two major groups based on phylogenetic data, Group-I and Group-II, Group-II was further classified as Group-IIA, IIB, IIC, IID, IIE, and IIF based on subclades and conserveness in sequences of amino acid. Our findings vary from other studies where WRKYs are categorized in three Groups, and Group-I is characterized by presence of two WRKYGQK motifs, phylogenetic analysis of our sequences revealed two major Groups, and only three sequences among Group-IIA showed two WRKYGQK motifs. Sequences lying in the same sub-clades were further validated by presence of consecutive motifs conserved among them. In the protein sequences WRKYGQK domain is primarily positioned in the mid region with a zinc-finger domain present on its C-terminal. Domain analysis revealed that WRKY domain is present in all sequences, but Zinc-finger domain is present only in all proteins lying in Group-I, indicating functional divergence and structural independence. Physio-chemical properties of protein sequences present in Group-II showed the most variation owing to extensive size. Promotor analysis of 800 bp upstream genes showed presence of cis-regulating elements involved in stress responsiveness, abiotic stress, and light responsive elements. Here we used reverse genetics to assess the role of WRKY27 in heat, drought, and whitefly tolerance in G. hirsutum . Under heat stress WRKY27 silenced plants by VIGS based sprays remained intact except for transient leaf epinasty immediately followed by heat stress, which was recovered once the heat stress was alleviated, declaring it a negative modulator of heat stress as no leaf scorching or wilting was observed. Alternatively, under drought stress WRKY27 silenced plants remained unscathed for two weeks but after that they started showing wilting on the edges of leaves due to turgor pressure loss and their leaves had malformed appearance to some extent which makes it a moderate negative regulator of drought stress. Under whitefly stress WRKY27 silenced plants demonstrated a visible decline (70–75%) in number of eggs and nymphs, highlighting its role in inducing plant immunity and it corresponds with another finding reported by Ehsan et. al. on WRKY TF ( WRKY33 ) being a negative regulator of whitefly stress ( 17 ). Regardless of the fundamental roles played by HSC70 in eukaryotes, very less is understood about their specific roles in signaling pathways and corresponding molecular pathways ( 25 ). HSC70-1 is a crucial ubiquitous protein that shows constitutive expression, it is primarily attributed to the maintenance of protein homeostasis under non-stressed conditions and engages in promptly induced cellular defense after exposure to stress stimuli ( 38 ). This study provides genome wide analysis and functional validation for implication of HSC70-1 in various physiological mechanisms such as resilience to heat, drought, and whiteflies in cotton and our findings substantiates previous findings ( 32 , 39 ). We identified 63 HSC70 ’ s in G. hirsutum and performed extensive genome profiling, the classification was validated by phylogenetic analysis, conserved motif and domain analysis, and promoter analysis. All members with the same grouping of motifs lay in the same clade and cluster of phylogenetic trees. The presence of Dnak and ASKHA_ATPase domain in all sequences signifies a higher degree of function conservation among protein sequences. Promotor analysis shows the presence of regulatory motifs involved in stress responsive gene expression. Expression analysis revealed that HSC70-1 is a strong negative regulator of heat, and drought as the plants remained resilient and showed no observable phenotypic attributes of stress. Upon whitefly infestation fewer eggs and nymphs were documented when contrasted with TRV:00 sprayed plants, making it a partial negative regulator of whitefly stress mitigation. Proline is a proteinogenic amino acid involved in management of abiotic stress tolerance ( 40 ). Genome wide studies on Proline dehydrogenase in plants are not reported yet. The 10 protein sequences we retrieved had a high degree of conserveness among their motifs. Physio-chemical properties did not show much variation as well. Promotor analysis revealed presence of cis-regulatory elements involved in stress and pathogen induced gene expression, which is unique as compared to other two genes. When ProDH silenced plants were exposed to heat stress, the plant remained robust and exhibited no visible signs of heat-induced stress. Plants kept in drought stress also maintained normal physiology. Upon whitefly infestation, ProDh showed a significantly low count of eggs and nymphs, showing its potential in activation of defense signaling pathways. So, we declare ProDh to be an efficient negative modulator of heat stress, desiccation tolerance, and whiteflies. We observed the effect of silencing on expression of some other genes; BBX18, GASA5, MAP3K65 , and CKX1 involved in similar abiotic and biotic stresses on sprayed and non-sprayed plants. MAP3K65 known to be a negative regulator of heat and pathogens in G. hirsutum ( 41 ) was found highly downregulated in ProDh silenced plants, moderately in WRKY27 silenced plants but upregulated in HSC70-1 silenced plants. GASA5 , known to enhance heat sensitivity, hastened yellowing of cotyledon after thermal stress, and BBX18 a negative modulator of drought and heat ( 42 – 45 ) marked considerable attenuation in expression levels in HSC70-1, WRKY27 , and ProDh silenced plants indicating a coordination in molecular pathways and functional networks. Expression levels of CKX1 involved in heat and drought defense ( 46 ) showed upregulation in WRKY27 , and low expression in HSC70-1 , and ProDh silenced plants. We conclude by advocating the potential for harnessing HSC70-1, WRKY27 , and ProDh as negative stress regulators of heat, drought, and whiteflies via genome editing for development of resilient crops to improve yield and quality. Declarations Ethics approval and consent to participate Not applicable Consent for publication Not applicable Data availability Data will be made available on request. Declaration of Competing Interest All authors declare they do not have any competing interests. Funding The present study didn't receive any external funding. Authorship contribution statement Mariam Akhtar: Methodology, Investigation, Writing-original draft. Rubab Zahra Naqvi: Formal analysis, Validation, Review and editing. Muhammad Jawad Akbar Awan: Review and editing, investigation, Methodology. Ifrah Imran: Bioinformatics analysis. Imran Amin: Conceptualization, Supervision review and editing. Acknowledgment We are thankful to all the members of Molecular virology and gene silencing lab and green house staff of NIBGE Faisalabad for their support. References Ul-Allah S, Rehman A, Hussain M, Farooq M. Fiber yield and quality in cotton under drought: Effects and management. Agric Water Manage. 2021;255:106994. https://doi.org/10.1016/j.agwat.2021.106994 . Zafar S, Afzal H, Ijaz A, Mahmood A, Ayub A, Nayab A, et al. Cotton and drought stress: An updated overview for improving stress tolerance. South Afr J Bot. 2023;161:258–68. Ullah A, Shakeel A, Ahmed HGM-D, Naeem M, Ali M, Shah AN, et al. Genetic basis and principal component analysis in cotton (Gossypium hirsutum L.) grown under water deficit condition. Front Plant Sci. 2022;13:981369. https://doi.org/10.3389/fpls.2022.981369 . Anees M, Shad SA. Insect pests of cotton and their management. Cotton Production and Uses: Agronomy, Crop Protection, and Postharvest Technologies. 2020:177–212. 10.1007/978-981-15-1472-2_11 Suhag A, Yadav H, Chaudhary D, Subramanian S, Jaiwal R, Jaiwal PK. Biotechnological interventions for the sustainable management of a global pest, whitefly (Bemisia tabaci). Insect Sci. 2021;28(5):1228–52. https://doi.org/10.1111/1744-7917.12853 . Abubakar M, Koul B, Chandrashekar K, Raut A, Yadav D. Whitefly (Bemisia tabaci) management (WFM) strategies for sustainable agriculture: a review. Agriculture. 2022;12(9):1317. https://doi.org/10.3390/agriculture12091317 . Mahmood MA, Naqvi RZ, Siddiqui HA, Amin I, Mansoor S. Current knowledge and implementations of Bemisia tabaci genomic technologies for sustainable control. J Pest Sci. 2023;96(2):427–40. 10.1007/s10340-022-01520-5 . Zhang S. Recent advances of polyphenol oxidases in plants. Molecules. 2023;28(5):2158. 10.3390/molecules28052158 . Zahoor R, Dong H, Abid M, Zhao W, Wang Y, Zhou Z. Potassium fertilizer improves drought stress alleviation potential in cotton by enhancing photosynthesis and carbohydrate metabolism. Environ Exp Bot. 2017;137:73–83. 10.1016/j.envexpbot.2017.02.002 . Sarwar M, Saleem MF, Ullah N, Ali A, Collins B, Shahid M, et al. Superior leaf physiological performance contributes to sustaining the final yield of cotton (Gossypium hirsutum L.) genotypes under terminal heat stress. Physiol Mol Biology Plants. 2023;29(5):739–53. 10.1007/s12298-023-01322-8 . Dos Santos TB, Ribas AF, de Souza SGH, Budzinski IGF, Domingues DS. Physiological responses to drought, salinity, and heat stress in plants: a review. Stresses. 2022;2(1):113–35. https://doi.org/10.3390/stresses2010009 . Patil AM, Pawar BD, Wagh SG, Shinde H, Shelake RM, Markad NR, et al. Abiotic stress in cotton: Insights into plant responses and biotechnological solutions. Agriculture. 2024;14(9):1638. https://doi.org/10.3390/agriculture14091638 . Masoomi-Aladizgeh F, Najeeb U, Hamzelou S, Pascovici D, Amirkhani A, Tan DK, et al. Pollen development in cotton (Gossypium hirsutum) is highly sensitive to heat exposure during the tetrad stage. Plant Cell Environ. 2021;44(7):2150–66. 10.1111/pce.13908 . Gao M, Snider JL, Bai H, Hu W, Wang R, Meng Y, et al. Drought effects on cotton (Gossypium hirsutum L.) fibre quality and fibre sucrose metabolism during the flowering and boll-formation period. J Agron Crop Sci. 2020;206(3):309–21. 10.1111/jac.12389 . Zhang Y, Liu G, Dong H, Li C. Waterlogging stress in cotton: Damage, adaptability, alleviation strategies, and mechanisms. Crop J. 2021;9(2):257–70. https://doi.org/10.1016/j.cj.2020.08.005 . Dubey R, Pandey BK, Sawant SV, Shirke PA. Drought stress inhibits stomatal development to improve water use efficiency in cotton. Acta Physiol Plant. 2023;45(2):30. 10.1007/s11738-022-03511-6 . Ehsan A, Naqvi RZ, Azhar M, Awan MJA, Amin I, Mansoor S, Asif M. Genome-wide analysis of WRKY gene family and negative regulation of ghWRKY25 and ghWRKY33 reveal their role in whitefly and drought stress tolerance in cotton. Genes. 2023;14(1):171. https://doi.org/10.3390/genes14010171 . Ishiguro S, Nakamura K. Characterization of a cDNA encoding a novel DNA-binding protein, SPF1, that recognizes SP8 sequences in the 5′ upstream regions of genes coding for sporamin and β-amylase from sweet potato. Mol Gen Genet MGG. 1994;244:563–71. 10.1007/BF00282746 . Chen X, Li C, Wang H, Guo Z. WRKY transcription factors: evolution, binding, and action. Phytopathol Res. 2019;1(1):13. 10.1186/s42483-019-0022-x . Song X, Hou X, Zeng Y, Jia D, Li Q, Gu Y, Miao H. Genome-wide identification and comprehensive analysis of WRKY transcription factor family in safflower during drought stress. Sci Rep. 2023;13(1):16955. 10.1038/s41598-023-44340-y . Ciolkowski I, Wanke D, Birkenbihl RP, Somssich IE. Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function. Plant Mol Biol. 2008;68:81–92. 10.1007/s11103-008-9353-1 . Mingyu Z, Zhengbin Z, Shouyi C, Jinsong Z, Hongbo S. WRKY transcription factor superfamily: structure, origin and functions. Afr J Biotechnol. 2012;11(32):8051–9. Chen X, Li C, Wang H, Guo Z. WRKY transcription factors: evolution, binding, and action. Phytopathol Res. 2019;1(1):1–15. 10.1186/s42483-019-0022-x . Sheikh AH, Hussain RMF, Tabassum N, Badmi R, Marillonnet S, Scheel D, et al. Possible role of WRKY transcription factors in regulating immunity in Oryza sativa ssp. indica. Physiol Mol Plant Pathol. 2021;114:101623. 10.1016/j.pmpp.2021.101623 . Cazalé A-C, Clément M, Chiarenza S, Roncato M-A, Pochon N, Creff A, et al. Altered expression of cytosolic/nuclear HSC70-1 molecular chaperone affects development and abiotic stress tolerance in Arabidopsis thaliana. J Exp Bot. 2009;60(9):2653–64. 10.1093/jxb/erp109 . Sung DY, Guy CL. Physiological and molecular assessment of altered expression of Hsc70-1 in Arabidopsis. Evidence for pleiotropic consequences. Plant Physiol. 2003;132(2):979–87. 10.1104/pp.102.019398 . Rosenzweig R, Nillegoda NB, Mayer MP, Bukau B. The Hsp70 chaperone network. Nat Rev Mol Cell Biol. 2019;20(11):665–80. 10.1038/s41580-019-0133-3 . Kityk R, Vogel M, Schlecht R, Bukau B, Mayer MP. Pathways of allosteric regulation in Hsp70 chaperones. Nat Commun. 2015;6(1):8308. 10.1038/ncomms9308 . Monteoliva MI, Rizzi YS, Cecchini NM, Hajirezaei M-R, Alvarez ME. Context of action of proline dehydrogenase (ProDH) in the hypersensitive response of Arabidopsis. BMC Plant Biol. 2014;14:1–11. 10.1186/1471-2229-14-21 . Alvarez ME, Savouré A, Szabados L. Proline metabolism as regulatory hub. Trends Plant Sci. 2022;27(1):39–55. 10.1016/j.tplants.2021.07.009 . Dang F, Lin J, Xue B, Chen Y, Guan D, Wang Y, He S. CaWRKY27 negatively regulates H2O2-mediated thermotolerance in pepper (Capsicum annuum). Front Plant Sci. 2018;9:1633. https://doi.org/10.3389/fpls.2018.01633 . Tiwari LD, Khungar L, Grover A. AtHsc70-1 negatively regulates the basal heat tolerance in Arabidopsis thaliana through affecting the activity of HsfAs and Hsp101. Plant J. 2020;103(6):2069–83. 10.1111/tpj.14883 . Guo M, Zhang X, Liu J, Hou L, Liu H, Zhao X. OsProDH negatively regulates thermotolerance in rice by modulating proline metabolism and reactive oxygen species scavenging. Rice. 2020;13:1–5. 10.1186/s12284-020-00422-3 . Deng D, Gao Q, Zeng R, Jiang J, Shen Q, Ma Y, et al. The Proline Dehydrogenase Gene CsProDH1 Regulates Homeostasis of the Pro-P5C Cycle Under Drought Stress in Tea Plants. Int J Mol Sci. 2025;26(7):3121. 10.3390/ijms26073121 . SolGen. Sol Genomics Network https://solgenomics.net/. Li W, Pang S, Lu Z, Jin B. Function and mechanism of WRKY transcription factors in abiotic stress responses of plants. Plants. 2020;9(11):1515. 10.3390/plants9111515 . Mukhtar MS, Deslandes L, Auriac MC, Marco Y, Somssich IE. The Arabidopsis transcription factor WRKY27 influences wilt disease symptom development caused by Ralstonia solanacearum. Plant J. 2008;56(6):935–47. 10.1111/j.1365-313X.2008.03651.x . Wang Z, Li Y, Yang X, Zhao J, Cheng Y, Wang J. Mechanism and complex roles of HSC70 in viral infections. Front Microbiol. 2020;11:1577. https://doi.org/10.3389/fmicb.2020.01577 . Noel LD, Cagna G, Stuttmann J, Wirthmuller L, Betsuyaku S, Witte C-P, et al. Interaction between SGT1 and cytosolic/nuclear HSC70 chaperones regulates Arabidopsis immune responses. Plant Cell. 2007;19(12):4061–76. 10.1105/tpc.107.051896 . Demirkan A, Henneman P, Verhoeven A, Dharuri H, Amin N, van Klinken JB, et al. Insight in genome-wide association of metabolite quantitative traits by exome sequence analyses. PLoS Genet. 2015;11(1):e1004835. 10.1371/journal.pgen.1004835 . Zhai N, Jia H, Liu D, Liu S, Ma M, Guo X, Li H. GhMAP3K65, a cotton Raf-like MAP3K gene, enhances susceptibility to pathogen infection and heat stress by negatively modulating growth and development in transgenic Nicotiana benthamiana. Int J Mol Sci. 2017;18(11):2462. 10.3390/ijms18112462 . Zhang S, Wang X. Overexpression of GASA5 increases the sensitivity of Arabidopsis to heat stress. J Plant Physiol. 2011;168(17):2093–101. 10.1016/j.jplph.2011.06.010 . Lee SH, Yoon JS, Jung WJ, Kim DY, Seo YW. Genome-wide identification and characterization of the lettuce GASA family in response to abiotic stresses. BMC Plant Biol. 2023;23(1):106. 10.1186/s12870-023-04101-5 . Wang Q, Tu X, Zhang J, Chen X, Rao L. Heat stress-induced BBX18 negatively regulates the thermotolerance in Arabidopsis. Mol Biol Rep. 2013;40:2679–88. 10.1007/s11033-012-2354-9 . Li J, Ai G, Wang Y, Ding Y, Hu X, Liang Y, et al. A truncated B-box zinc finger transcription factor confers drought sensitivity in modern cultivated tomatoes. Nat Commun. 2024;15(1):8013. 10.1038/s41467-024-51699-7 . Lubovská Z, Dobrá J, Štorchová H, Wilhelmová N, Vanková R. Cytokinin oxidase/dehydrogenase overexpression modifies antioxidant defense against heat, drought and their combination in Nicotiana tabacum plants. J Plant Physiol. 2014;171(17):1625–33. 10.1016/j.jplph.2014.06.021 . Supplementary Files Supplementrydata.docx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-6591527","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":459184766,"identity":"eeceef1b-ccfc-4115-b37d-6085659c41c9","order_by":0,"name":"Mariam Akhtar","email":"","orcid":"","institution":"National Institute for Biotechnology and Genetic Engineering","correspondingAuthor":false,"prefix":"","firstName":"Mariam","middleName":"","lastName":"Akhtar","suffix":""},{"id":459184767,"identity":"742460ba-ab02-408d-a47f-15e5334ce727","order_by":1,"name":"Rubab Zahra Naqvi","email":"","orcid":"","institution":"National Institute for Biotechnology and Genetic Engineering","correspondingAuthor":false,"prefix":"","firstName":"Rubab","middleName":"Zahra","lastName":"Naqvi","suffix":""},{"id":459184768,"identity":"faa2a948-e38c-410f-85a2-fc313135aaa7","order_by":2,"name":"Muhammad Jawad Akbar Awan","email":"","orcid":"","institution":"National Institute for Biotechnology and Genetic Engineering","correspondingAuthor":false,"prefix":"","firstName":"Muhammad","middleName":"Jawad Akbar","lastName":"Awan","suffix":""},{"id":459184769,"identity":"c0bb90b4-707b-4325-9cab-c988336622e9","order_by":3,"name":"Ifrah Imran","email":"","orcid":"","institution":"National Institute for Biotechnology and Genetic Engineering","correspondingAuthor":false,"prefix":"","firstName":"Ifrah","middleName":"","lastName":"Imran","suffix":""},{"id":459184770,"identity":"bd8ba242-d9b1-4f06-8a24-3b381937f612","order_by":4,"name":"Imran Amin","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAyklEQVRIiWNgGAWjYBACNijNw8DMfICBsYEkLexsCcRpQQB+HgPitPCJnX34uaBmm4w5M883iZ87bOQY2A8f3YDXYdLpxtIzjt3msWzm3SbZeybNmIEnLe0Gfi1pDNI8bLd5DA7zbpPgbTuc2CDBY0ZIC/Nvnn8gLTzPJP8SqYVNmrcNrAXEIFKLNW8fSAubsbVsW5oxGyG/yM9OY77N8+22vcH5ww9vvm2zkeNnP3wMrxZkwCIBtpdY5SDA/IEU1aNgFIyCUTByAACYZ0B4GQwTMgAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0003-3063-4103","institution":"National Institute for Biotechnology and Genetic Engineering","correspondingAuthor":true,"prefix":"","firstName":"Imran","middleName":"","lastName":"Amin","suffix":""}],"badges":[],"createdAt":"2025-05-05 06:07:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-6591527/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-6591527/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":83224789,"identity":"72a34c42-1cd5-40a6-b875-0abcbb9765f2","added_by":"auto","created_at":"2025-05-21 11:20:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":248194,"visible":true,"origin":"","legend":"\u003cp\u003eSchematic\u003cstrong\u003e \u003c/strong\u003eillustration of VIGS based foliar sprays.\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-6591527/v1/b8f82ad9a8b36787deefa8af.png"},{"id":83225441,"identity":"d0aef787-9b30-4bf4-bf5d-6d3c1b5d28fa","added_by":"auto","created_at":"2025-05-21 11:28:47","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":1844086,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA. \u003c/strong\u003eMultiple sequence alignment of WRKY sequences performed group wise on Clustal W. \u003cstrong\u003eB. \u003c/strong\u003eMultiple sequence alignment of Hsc sequences performed group wise on Clustal W. \u003cstrong\u003eC. \u003c/strong\u003eMultiple sequence alignment of ProDh sequences performed group wise on Clustal W. Typical amino acids across sequences are highlighted in different colors.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-6591527/v1/290962ff28b7fe6a55a8095b.png"},{"id":83225443,"identity":"b67e26bc-615b-441e-9267-44bc2d51ac15","added_by":"auto","created_at":"2025-05-21 11:28:47","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1376371,"visible":true,"origin":"","legend":"\u003cp\u003eConserved motif analysis performed group wise using MEME suite on WRKY, HSc, and ProDh proteins in \u003cstrong\u003eA, B\u003c/strong\u003e, and \u003cstrong\u003eC\u003c/strong\u003e respectively. All motifs represent their own unique color and length across all three families. The details of specific motifs and their symbols were found.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-6591527/v1/266954fa4b82dcea57e78228.png"},{"id":83225681,"identity":"8b48a169-7062-41a3-9fa7-fd4e3f8a48c2","added_by":"auto","created_at":"2025-05-21 11:36:47","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":390777,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA. \u003c/strong\u003ePhylogenetic relationship of WRKYs in \u003cem\u003eG. hirsutum\u003c/em\u003e. \u003cstrong\u003eB.\u003c/strong\u003e Phylogenetic relationship of Hsc proteins in \u003cem\u003eG. hirsutum\u003c/em\u003e. \u003cstrong\u003eC.\u003c/strong\u003e Phylogenetic relationship among ProDh proteins in G. hirsutum. For phylogenetic analysis the maximum likelihood tree was constructed by Neighbor-Joining method on MEGA 6.0. The bootstrap test was conducted using 1000 iterations. Sub-families within each tree are represented by distinctive colors.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-6591527/v1/15f57ba5dfc861195a594eb8.png"},{"id":83224783,"identity":"b5d383f0-b207-44cd-8c52-f7791ae356f9","added_by":"auto","created_at":"2025-05-21 11:20:47","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":265406,"visible":true,"origin":"","legend":"\u003cp\u003ePormoter analysis of 800bp upstream region of \u003cem\u003eWRKY27\u003c/em\u003e, \u003cem\u003eHsc70-1\u003c/em\u003e, and \u003cem\u003eProDh. \u003c/em\u003e\u003cstrong\u003eA.\u003c/strong\u003e Heat map analysis of \u003cem\u003eWRKY27\u003c/em\u003e, \u003cem\u003eHsc70-1\u003c/em\u003e, and \u003cem\u003eProDh \u003c/em\u003eperformed on ITol by normalizing the logarithm values of all cis-elements. \u003cstrong\u003eB.\u003c/strong\u003e Venn diagram showing the number of shared and individual promoters found in \u003cem\u003eWRKY27\u003c/em\u003e, \u003cem\u003eHsc70-1\u003c/em\u003e, and \u003cem\u003eProDh \u003c/em\u003eregions\u003cem\u003e.\u003c/em\u003e\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-6591527/v1/4f6a9959f9f13e21edd20b29.png"},{"id":83225448,"identity":"a417342b-e6cb-42a3-96ef-65627a3891ae","added_by":"auto","created_at":"2025-05-21 11:28:47","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":2744800,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA.\u003c/strong\u003e PCR amplification of 258 bp band of \u003cem\u003eHsc70-1\u003c/em\u003e, 218 bp band of \u003cem\u003eProDh\u003c/em\u003e, and 265 bp band of \u003cem\u003eWRKY27 \u003c/em\u003ein Agrobacterium GV3101 cultures\u003cem\u003e. \u003c/em\u003e\u003cstrong\u003eB. \u003c/strong\u003ePhotobleaching in TRV:TRV2-CLA sprayed plants.\u003cem\u003e \u003c/em\u003e\u003cstrong\u003eC.\u003c/strong\u003e Real-time quantification analysis of relative gene expression levels of \u003cem\u003eHsc70-1\u003c/em\u003e, \u003cem\u003eWRKY27\u003c/em\u003e, and \u003cem\u003eProDh \u003c/em\u003egene transcripts\u003cem\u003e \u003c/em\u003enormalized against housekeeping gene \u003cem\u003eUBQ7\u003c/em\u003e’s expression levels. RNA was isolated from leaf tissue of TRV:00, TRV:TRV2-Hsc70-1, TRV:TRV2-WRKY27, and TRV:TRV2-ProDh sprayed plants on the 30\u003csup\u003eth\u003c/sup\u003e day. X-axes represent the plant names and Y-axes show their relative expression of genes. Statistical differences (**p\u0026lt;0.01) were calculated using Tuckey’s Test. Error bars show variation among three experimental repeats. \u003cstrong\u003eD. \u003c/strong\u003eTRV:TRV2-Hsc70-1, TRV:TRV2-WRKY27, and TRV:TRV2-ProDh, and TRV:00 sprayed plants immediately after heat stress. \u003cstrong\u003eE. \u003c/strong\u003eRecovery of TRV:TRV2-Hsc70-1, TRV:TRV2-WRKY27, and TRV:TRV2-ProDh, and TRV:00 sprayed plants two days after heat stress. \u003cstrong\u003eF. \u003c/strong\u003eDrought stress assay on TRV:00, TRV:TRV2-Hsc70-1, TRV:TRV2-WRKY27, and TRV:TRV2-ProDh sprayed cotton plants. Pictures were taken on the 30\u003csup\u003eth\u003c/sup\u003e day of water scarcity stress.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-6591527/v1/3e387d1b675fa1f1452ac7c5.png"},{"id":83225686,"identity":"698e4bb7-f089-4d29-8fbc-b16a9563b51b","added_by":"auto","created_at":"2025-05-21 11:36:47","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":241290,"visible":true,"origin":"","legend":"\u003cp\u003eWhitefly bioassay on VIGS-sprayed cotton plants. \u003cstrong\u003eA.\u003c/strong\u003eshows abundance of adult whiteflies on TRV:00, TRV:TRV2-Hsc70-1, TRV:TRV2-WRKY27, and TRV:TRV2-ProDh sprayed plants. \u003cstrong\u003eB.\u003c/strong\u003e Colored bars show average nymph count on Day 14 of whitefly infestation on TRV:00, TRV:TRV2-Hsc70-1, TRV:TRV2-WRKY27, and TRV:TRV2-ProDh sprayed plants \u003cstrong\u003eC.\u003c/strong\u003e Color bars show average egg count on Day 14 of whitefly infestation on TRV:00, TRV:TRV2-Hsc70-1, TRV:TRV2-WRKY27, and TRV:TRV2-ProDh sprayed plants. Error bars show deviation among replicates.\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-6591527/v1/2d51a020c79f59bace32b264.png"},{"id":83225445,"identity":"4af93f1c-965b-4248-b371-10ebd494485a","added_by":"auto","created_at":"2025-05-21 11:28:47","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":212842,"visible":true,"origin":"","legend":"\u003cp\u003eRelative gene expression analysis of \u003cem\u003eBBX18, GASA5, MAP3K65\u003c/em\u003e, and \u003cem\u003eCKX1 \u003c/em\u003eon VIGS-sprayed plants. A-E represents \u003cem\u003eBBX18, GASA5, MAP3K65\u003c/em\u003e, and \u003cem\u003eCKX1 \u003c/em\u003elevels in TRV:00, TRV:TRV2-Hsc70-1, TRV:TRV2-WRKY27, and TRV:TRV2-ProDh silenced plants. Error bars represent standard error among replicates.\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-6591527/v1/68cd3a3eb552fc957e949163.png"},{"id":98422770,"identity":"31db912a-76be-4a4d-9fee-de51483a2fc5","added_by":"auto","created_at":"2025-12-17 16:31:29","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":8057633,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-6591527/v1/8413c224-384f-4ed6-8a45-7a81aef03e37.pdf"},{"id":83224786,"identity":"cc3174f7-67cf-4f90-b98d-1afc298a7c17","added_by":"auto","created_at":"2025-05-21 11:20:47","extension":"docx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":2013834,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementrydata.docx","url":"https://assets-eu.researchsquare.com/files/rs-6591527/v1/3af57c59342bef22891b653e.docx"}],"financialInterests":"","formattedTitle":"Genome-Wide Profiling of WRKY, HSC, and ProDh Gene Families and VIGS-Mediated Functional Analysis of Negative Regulators of Cotton's Stress Response to Drought, Heat, and Whiteflies","fulltext":[{"header":"Introduction","content":"\u003cp\u003eGlobally, cotton (\u003cem\u003eGossypium Hirsutum L\u003c/em\u003e.) appears as a vital cash crop, with the USA, China, Pakistan, India, and Brazil being key contributors (\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e). It constitutes 35% of worldwide fiber production (\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e). Although cotton, being a halophytic crop, shows higher stress resistance compared to other plants, stringent stress conditions can considerably undermine its productivity and growth. (\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e). Cotton crops encounter significant biological threats, with insect pests being one of the most calamitous (\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e). \u003cem\u003eBemisia tabaci\u003c/em\u003e, a sap-sucking insect, is a complex species consisting of 44 morphologically similar but genetically distinct subspecies, present on all continents besides Antarctica (\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e). During feeding, both adults and nymphs discharge honeydew, a sugary substance that stimulates \u0026ldquo;sooty mold\u0026rdquo; formation on leaves and fruits, adversely impacting crop performance. Infested plants exhibit folding of leaves, yellowing, disfigured fruit, and reduced plant development (\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e). \u003cem\u003eB. tabaci\u003c/em\u003e is particularly disreputable for its ability to transmit viruses through various modes: semi-persistent, persistent, and non-persistent. This pest acts as vector of begomoviruses (\u003cem\u003eGeminiviridae\u003c/em\u003e) ipomoviruses (\u003cem\u003ePotyviridae\u003c/em\u003e), carlaviruses (\u003cem\u003eBetaflexiviridae\u003c/em\u003e), torradoviruses (\u003cem\u003eSecoviridae\u003c/em\u003e), criniviruses (\u003cem\u003eClosteroviridae\u003c/em\u003e), and carlaviruses (\u003cem\u003eBetaflexiviridae\u003c/em\u003e). Diverse host range and tendency to acquire insecticide resistance make this pest progressively harmful (\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCotton production has profoundly declined due to abiotic stresses, resulting in considerable reduction in quality and yield (\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e). Drought, heat, and biotic stress have been shown to cause 50\u0026ndash;60% decline in cotton yield (\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e). Elevated temperature adversely impacts the stability of cell membranes, root development, photosynthesis, and stomatal regulation (\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e). Heat stress intensifies water loss via transpiration, creating water scarcity conditions and obstructing plant\u0026rsquo;s ability to maintain hydration (\u003cspan additionalcitationids=\"CR12\" citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e). The severity of water stress on cotton yield is dependent on the duration and intensity of drought. The primary reason for diminished cotton yield during drought stress is curtailment of boll quantity, and boll size which is associated with boll shedding and heightened square drop (\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e). Closing of stomata during drought stress causes a reduction in gas exchange, nutrient uptake, and transpiration (\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e). The scarcity of water affects physiological processes including CO\u003csup\u003e2\u003c/sup\u003e diffusion, stomatal conductance, and photosynthesis (\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePlants react to stress conditions by modifying the transcription factors that are responsible for controlling the expression of signaling cascades (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e). Research suggests that various WRKY genes across numerous plant species have been identified and shown to be involved in development, metabolism, growth, and environmental response. Evidence suggests that many genes react to elicitors, pathogens, and defense-related phytohormones like jasmonic acid, and salicylic acid, showcasing their potential role in plant immunity. These transcription factors (TFs) can negatively or positively modulate different facets of the plant innate immunity system, including effector-triggered immunity (ETI), and pathogen-associated molecular pattern (PAMP)-triggered immunity (\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e). The WRKY family\u0026rsquo;s conserved domain comprises 60\u0026ndash;70 amino acids, prominently featuring \u0026ldquo;WRKYGQK\u0026rdquo;, a highly conserved seven-phthalide sequence (\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e). Another conserved characteristic is \u0026ldquo;CX4\u0026ndash;5CX22\u0026ndash;23HXH or CX7CX23HXC\u0026rdquo;, a unique zinc finger motif at C-terminal. They form hetero or homo complexes and locate a particular cis-regulatory element \u0026ldquo;5\u0026prime;-TTGAC(C/T)-3\u0026prime;\u0026rdquo; in gene promoter regions, known as W-box, at the N-terminal through 60 amino acid long chain. WRKY TF\u0026rsquo;s β-sheet enters the major groove of DNA (B form), forming non-polar contacts. The WRKYGQK domain\u0026rsquo;s Tyrosine (Y), Tryptophan (W), and two Lysine (K) residues are responsible for establishing a stable bond (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan additionalcitationids=\"CR22\" citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e). Variants of this signature motif include \u0026ldquo;WRKYGEK\u0026rdquo; and \u0026ldquo;WRKYGKK\u0026rdquo; and various unconventional WRKY domains suggesting a canonical sequence of W(K/R)(R/K)Y. Some WRKY proteins contain two WRKY domains. Overall, WRKY proteins exhibit extensive diversity in overall structure, which can be organized in different groups, possibly reflecting their varied functions (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe 70 kDa heat shock proteins are a large and well-conserved group of molecular chaperones present in both eukaryotes (Hsp70), and prokaryotes (DnaK). These chaperones play a pivotal role in multiple aspects of protein folding, featuring folding of recently synthesized proteins, refolding of proteins denatured by stress, preventing aggregation, breaking down protein aggregates, assisting disintegration of misfolded proteins, regulating stability and activity of regulatory proteins, and translocation of proteins across membranes. Hsp70 chaperones maintain cellular proteostasis via ATP-dependent cycles, primarily by interaction with non-native polypeptides and intermediates\u0026rsquo; folding that are present in multiple comportments of cells, including nucleus, cytosol, endoplasmic reticulum, chloroplasts, and mitochondria (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e). Members of Hsp70 family contribute to two out of four structural components found in the prototypical Hsp70, bacterial DnaK domain. These components include a 45-kDa N-terminal nucleotide binding domain (NBD), a 10-kDa helical lid domain (SBDα), a 15 kDa substrate binding domain (SBDβ), and a variable-length disordered C-terminal tail. In eukaryotic nuclear and cytosolic Hsp70s, the disheveled tail often concludes with \u0026ldquo;Glu-Glu-Val-Asp; EEVD, a conserved charged sequence that interacts with specialized cofactors. The NBD exhibits an actin-like structure that consists of IA, IB, IIA, IIB, four sub-domains, arranged in two lobes segmented by a deep cleft. ATP coordinates all four subdomains at the bottom of this cleft, moderating lobe movements within the catalytic center. SBDβ consists of an eight-stranded β-sandwich structure that includes polypeptide binding cavity with a central hydrophobic cavity. In nucleotide-free and ADP-bound states, SBDα adheres to the SBDβ, completely cloaking this activity. A conserved linker connects the SBDβ to the NBD, playing a significant role in allosteric mechanism that links ATP hydrolysis and NBD to substrate binding (\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eProline, a versatile amino acid, concentrates in a profuse amount within plants when exposed to stress conditions. Its aggregation is closely linked to numerous cellular processes such as energy management, osmotic pressure regulation, redox balance shifts, and pathogen defense mechanism. Proline metabolism is responsive to environmental signals and experiences specific modifications that influence stress tolerance. Upon exposure to dehydration, plants augment Proline synthesis and attenuate its breakdown, resulting in heightened levels of proline. This amino acid is synthesized from glutamic acid (Glu) and ornithine, primarily utilizing the former pathway during stress. This synthesis occurs in plastids, and cytosol, involving P5C reductase (P5CR) and ∆\u003csup\u003e1\u003c/sup\u003e pyrroline-5-carboxylate (P5C) synthase (P5CS). Catabolism of Proline takes place in mitochondria where it is oxidized to Glu through a two-enzyme process. Initially, Pro is converted to PC5 by Pro dehydrogenase (ProDH) which is subsequently transformed into glutamate semi-aldehyde, non-enzymatically which then acts as a substrate for P5C dehydrogenase to synthesize Glu. Studies have shown the sensitivity of Pro metabolism genes to pathogen infections. For instance, in Arabidopsis, \u003cem\u003ePseudomonas syringae\u003c/em\u003e pv. Tomato (Pst) strains trigger hypersensitive response (HR) and effector triggered immunity (ETI) and activate P5CR, P5CS2, and ProDh. Under HR conditions, P5CS2 activation is facilitated by salicylic acid, resulting in alleviated Pro levels during infestation (\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn this study a reverse genetic approach, Virus-Induced Gene Silencing (VIGS) is used for functional characterization of genes. For VIGS, \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated inoculation is commonly used to transiently suppress the gene of interest. This is achieved using needleless syringes to deliver bacterial culture directly into plants that is commonly known as \u003cem\u003eAgrobacterium\u003c/em\u003e infiltration assay. However, this method is laborious, limited, and time-consuming. Alternatively, \u003cem\u003eAgrobacterium\u003c/em\u003e can be delivered through foliar sprays, vacuum-assisted infiltration, and mechanical inoculations. To enhance applicability, we have redesigned established methods of transient gene expression and gene delivery in cotton using foliar sprays and mechanical inoculations. This method can be implemented on a large scale to design a flexible, quick, and industrially scalable platform, conferring an alternative to traditional agro-infiltration. For foliar applications, surfactants such as Tween 20, Tween80, Triton X-100 and Silwett-77 are used to reduce surface tension and facilitate the uptake of active ingredients through the waxy cuticle via stomata into leaves. Additionally, abrasives are dusted on leaves to enable symplastic delivery (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). We conducted a genome-wide characterization and analysis of WRKY, Hsc, and ProDh family in \u003cem\u003eG. hirsutum\u003c/em\u003e. The classification was validated by conserved motif, domain and phylogenetic analyses. We validated the role of \u003cem\u003eWRKY27, Hsc70-1\u003c/em\u003e, and \u003cem\u003eProDh\u003c/em\u003e genes\u0026rsquo; overexpression under heat, drought, and whitefly stresses (\u003cspan additionalcitationids=\"CR32 CR33\" citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e) (Supplementay Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The silencing effect on expression of some other genes such as \u003cem\u003eBB1X8, GASA5, MAP3K65\u003c/em\u003e, and \u003cem\u003eCKX1\u003c/em\u003e genes, involved in stress-related pathways, was also analyzed. This study provides a detailed analysis of \u003cem\u003eWRKY\u003c/em\u003e, \u003cem\u003eHsc\u003c/em\u003e, and \u003cem\u003eProDh\u003c/em\u003e gene families and roles of \u003cem\u003eWRKY27, Hsc70-1\u003c/em\u003e, and \u003cem\u003eProDh\u003c/em\u003e in heat, drought, and whitefly stress management.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Systematic categorization and Profiling of Gene families\u003c/h2\u003e \u003cp\u003eBy employing BLAST of one known \u003cem\u003eWRKY27\u003c/em\u003e (NCBI ID: XP_040963566.1), \u003cem\u003eHsc70-1\u003c/em\u003e (NCBI ID: NP_001313791.1), and \u003cem\u003eProDH\u003c/em\u003e (NCBI ID: NP_001314006.1) all available sequences were retrieved from Phytozome assembly \u003cem\u003eGossypium hirsutum v3.1.\u003c/em\u003e Multiple sequence alignment tool ClustalW was used to align all the retrieved sequences. Physio-chemical properties of proteins of all three gene families were accessed by enumerating their number of amino acids, molecular weight, isoelectric point, aliphatic index, instability index, and hydropathicity using ExPASy ProtPram. Using the standard setting of MEME suite conserved motif analysis was carried out, selected number of motifs were 10. NCBI Conserved Domains Database (CDD) was used for domain analysis. MEGA6 software was utilized for the construction of phylogenetic trees. Maximum likelihood tree, retaining 1000 bootstrap value, was contrived. Promotor analysis was performed on 800 bp upstream regions of \u003cem\u003eHsc70-1\u003c/em\u003e, \u003cem\u003eWRKY27\u003c/em\u003e, and \u003cem\u003eProDh\u003c/em\u003e from Phytozome using PlantCARE.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e2.2. Construction of TRV-Vectors\u003c/h3\u003e\n\u003cp\u003eGene-specific primers containing restriction sites of \u003cem\u003eEcoR\u003c/em\u003eI and \u003cem\u003eKpn\u003c/em\u003eI restriction endonucleases at 5\u0026rsquo; ends were designed to amplify targeted region selected by SGN-VIGS tool 35). Total RNA was isolated from \u003cem\u003eG. hirsutum\u003c/em\u003e leaves to synthesize cDNA using cDNA synthesis kit (OneScript Plus cDNA synthesis Kit Applied Biological Materials Cat. No. G236) and desired regions were amplified using specific primers. Amplicons and TRV2 plasmid were restricted with \u003cem\u003eEcoR\u003c/em\u003eI and \u003cem\u003eKpn\u003c/em\u003eI restriction endonucleases and further ligated together by using T4 DNA ligase (Thermo Fisher Scientific, Cat. No. EL0011). Ligated product was transformed into \u003cem\u003eEscherichia coli\u003c/em\u003e Top10 chemically competent cells via heat-shock method. Constructs were confirmed via PCR-based screening and restriction by subjective enzymes to confirm the presence of both ligated products. Positive constructs were transformed into \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e GV3101 cells and later on screened by using PCR. Sequences of primers used in this study are provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSequence of primers used for amplification of targeted regions.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eName\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer Sequence\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAnnealing-T\u0026deg;C\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eAmplicon size (bp)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHsc70-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; CGTTCCGAATTCCTTCAATGACTCTCAGCGTC 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e258\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHsc70-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; ATTCTGGGTACCAAATCTTCACCTCCAAGATG 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e258\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWRKY27-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; TTCAGAGAATTCTATTACAGGTGCAGCAGCTC 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e55\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e265\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eWRKY27-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; AGAGATGGTACCGAGACTCGTGGCATAGCG 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e55\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e265\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProDH-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; ACAACGGAATTCTTTAACCATTGATGCCGAGGA 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e218\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eProDH-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; TTTCGCGGTACCATGTAAGCGCCTCTCACCA 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e218\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBBX18-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; TCTTCCGAATTCGCTTGTAGTTTCCAGGGGAT 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e211\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBBX18-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; CTGTTGGGTACCGGCATTTAGATCAATCAACTC 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e211\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGASA5-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; GGCATCGAATTCGCCCTTCTCAAAAACAAAGAC 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e162\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGASA5-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; TTAGAAGGTACCTTAACTCACCTTGAGGACGA 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e162\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMAP3K65-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; CTGGGAGAATTCACTGGATAAGCACTTGAGC 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e177\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMAP3K65-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; AAGCGTGGTACCGTGGTACCTGCAACATCTTG 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e52\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e177\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCKX1-F\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; GAGCTGGAATTCTGATAGAACCAACCTCTGTT 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e51\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e206\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCKX1-R\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e5\u0026rsquo; TGTGTTGGTACCGTGGAAGAAATATCAGAAACTGA 3\u0026rsquo;\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e51\u0026deg;C\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e206\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e\n\u003ch3\u003e2.3. Plant Growth parameters\u003c/h3\u003e\n\u003cp\u003eCotton variety FH-333 was used for these experiments. Seeds were de-linted using H\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e. Seeds were grown in plastic glasses by using peat moss, maintaining day and night temperatures between 19\u0026deg;C and 24\u0026deg;C, a 16-hour photoperiod (16h light/8h dark), and humidity ranging from 35\u0026ndash;70%. Plants at cotyledon stage were exposed to VIGS-based sprays.\u003c/p\u003e \u003cp\u003e \u003cb\u003e2.4.\u003c/b\u003e \u003cb\u003eAgrobacterium\u003c/b\u003e\u003cb\u003e-based Spray-Induced Gene Silencing\u003c/b\u003e\u003c/p\u003e \u003cp\u003eSingle colonies of TRV2-WRKY27, TRV2-Hsc, TRV2-ProDh, TRV2-CLA, TRV1, and TRV2 were cultured in Luria-Bertani (LB) medium augmented with Kanamycin (50 \u0026micro;g/mL) and Rifampicin (25 \u0026micro;g/mL) selections for two days at 28\u0026deg;C. For each culture, in 50 mL falcons 22.5mL of LB medium supplemented with Kanamycin (50 \u0026micro;g/mL) and Rifampicin (25 \u0026micro;g/mL) was added along with 2.5 mL of 10 mM MES, and 20 \u0026micro;M acetosyringone and incubated overnight at 28\u0026deg;C. For optimization of VIGS based foliar sprays the plants were sprayed with different concentrations of optical density (OD-600 nm), surfactant, and abrasive quantity to observe the effects of various factors on photobleaching caused by silencing of \u003cem\u003eCLA1. Silencing of CLA1\u003c/em\u003e served as a scorable marker (Supplementary File Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, Supplementary Fig.\u0026nbsp;2). Cells were harvested and re-suspended in \u003cem\u003eAgrobacterium\u003c/em\u003e inoculation solution (AIS: 10 mM MES pH 5.5, 10 mM MgCl\u003csub\u003e2\u003c/sub\u003e) maintaining the final OD at 0.05. The cultures were kept in the dark for 3 hours at room temperature. At the time of spraying TRV-1 suspension was mixed in 1:1 ratio with TRV2-WRKY27, TRV2-Hsc, TRV2-ProDh, TRV2-CLA, and empty TRV2, each culture was supplemented with 0.08\u0026ndash;0.1% v/v Tween20. Prior to spraying, carborundum was gently dusted on leaves to cause abrasion. A plastic hand sprayer was used for the delivery. Plants were kept in controlled conditions until the symptoms of photobleaching appeared on TRV:TRV2-CLA sprayed plants.\u003c/p\u003e\n\u003ch3\u003e2.5. cDNA synthesis and RT-qPCR analysis\u003c/h3\u003e\n\u003cp\u003eAfter the appearance of photo-bleaching symptoms in true leaves of TRV:TRV2-CLA plants, total RNA was isolated from TRV2-WRKY27,TRV2-Hsc, TRV2-ProDh, and TRV:00 true leaves tissue by using TRIzol (Invitrogen, USA), ensued by DNAse treatment to eliminate genomic DNA traces. RNA concentration was measured using Nanodrop 2000 spectrophotometer (Thermo Scientific, USA). 3 \u0026micro;g RNA was transcribed to cDNA using kit (OneScript Plus cDNA synthesis Kit Applied Biological Materials Cat. No. G236). Real-time quantitative PCR was performed for the assessment of gene expression. The difference in expression levels of targeted genes in TRV:TRV2-WRKY27, TRV:TRV2-Hsc, TRV:TRV2-ProDh sprayed was evaluated. Real-time quantitative PCR (qPCR) was performed in CFX96 Touchdown machine (Bio-Rad USA) using SYBR Green Real-Time PCR Master Mix (Thermo-Fisher Scientific, USA) using the following cycling parameters: 5 min of initial denaturation at 95\u0026deg;C, 40 cycles of denaturation at 95\u0026deg;C for 30 sec, annealing at 55\u0026deg;C for 30 sec, and extension at 72\u0026deg;C for 30 sec followed by melt curve analysis. The housekeeping cotton gene \u003cem\u003eUBQ7\u003c/em\u003e was used as an internal control to normalize gene expression data. Relative fold difference was calculated for each sample using ΔΔCt method. Primers used are provided in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e\n\u003ch3\u003e2.6. Drought Assay\u003c/h3\u003e\n\u003cp\u003eWater was halted on TRV:TRV2-Hsc70-1, TRV:TRV2-WRKY27, TRV:TRV2-ProDH, TRV:00 sprayed plants for 30 days after the establishment of VIGS. Morphological alterations and trait variations in plants under stress were recorded.\u003c/p\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Heat Stress\u003c/h2\u003e \u003cp\u003eAfter appearance of bleaching symptoms in TRV:TRV2-CLA plants, the establishment of VIGS was confirmed and plants were subjected to heat stress. TRV:TRV2-Hsc70-1, TRV:TRV2-WRKY27, and TRV:TRV2-ProDH, TRV:00 sprayed plants were kept at 40\u0026deg;C for 24 hours and after that structural modifications/alterations in plants were observed and noted.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e2.8. Whitefly Bioassay:\u003c/h3\u003e\n\u003cp\u003eUnder controlled conditions the TRV:TRV2-Hsc70-1, TRV:TRV2-WRKY27, TRV:TRV2-ProDH, and TRV:00 sprayed plants were subjected to whitefly infestation. On day 14 of infestation, the number of eggs, nymphs, and adult whiteflies were documented.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Multiple Sequence Alignment\u003c/h2\u003e \u003cp\u003eAll possible sequences of WRKY, Hsc, and Pro-DH proteins were retrieved from the Phytozome assembly “\u003cem\u003eGossypium hirsutum v3.1\u003c/em\u003e”. We identified 100 \u003cem\u003eWRKYs\u003c/em\u003e, 63 \u003cem\u003eHsc70s\u003c/em\u003e, and 10 \u003cem\u003eProDHs\u003c/em\u003e encoding genes in \u003cem\u003eG. hirsutum\u003c/em\u003e genome. All the WRKY sequences were classified into two groups (Group I, Group IIA-F) based on the conserved motifs present. Group-I has 38 WRKYs, Group-IIA has 11 WRKYs, Group-IIB has 8 WRKYs, Group-IIC has 10 WRKYs, Group-IID has 8 WRKYs, Group-IIE has 6 WRKYs, and Group-IIF has 18 WRKYs. At the C-terminal of all 100 WRKYs, there is a conserved motif “WRKYGQK” subsequent to zinc-finger motif, except a member of Group-IIA, WRKY80, which has a single amino acid substitution “WRKYGKK”. 3 members of Group-IIA WRKY 7, WRKY87, and WRKY100 have 2 “WRKYGQK” motifs. C-X\u003csub\u003en\u003c/sub\u003e-C-X\u003csub\u003en\u003c/sub\u003e-HXH-type zinc finger motif shows conserveness across Group-IIB, C, D, and E and a single amino substitution in some Groups. 5 WRKYs in Group-I have “HKH”, and 7 members of Group-IA have “HRH” instead of “HNH” motif. 4 WRKYs in Group-IIA have “HTH”, and one WRKY has “HKH”, similarly 8 WRKYs in Group-IIF have substitution in “HNH” motif. This classification can be illustrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e63 Hsc sequences were categorized into three groups, Group-IA, IB, Group-IIA, IIB, and Group-III depending upon consistency of motifs across sequences. Group-IA has 10 Hsc sequences, Group-IB has 4 Hsc’s, Group-IIA has 23 Hsc’s, Group-IIB has 20 Hsc’s, and Group-III has 4 Hsc’s. All Hsc sequences have a conserved “IDLGTTYS” motif, except sequences of Group-IA. Some groups show single amino acid substitution such as a member of Group-IIA, Hsc6 has “IDLGITYS” and 12 members of Group-IIB have “IDLGTTNS” motif. One member of Group-IIB, Hsc61 shows absence of this motif. Single or double amino acid substitution can be seen in sequences of other motifs as well. Conserved sequences are demonstrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB.\u003c/p\u003e \u003cp\u003e10 ProDh sequences were identified in \u003cem\u003eG. hirsutum\u003c/em\u003e, they were classified into three groups: Group-IA, Group-IB, Group-II, and Group-III. Group-IA has 4 protein sequences, Group-IB, and Group-II have 2 and 3 protein sequences correspondingly, and remaining one sequence lies in Group-III. Some motifs show substitution of single amino acid, as can be seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Physio-chemical Properties\u003c/h2\u003e \u003cp\u003eThe Expasy ProtPram tool was used to determine molecular weight, PI number of amino acids, isoelectric point, instability index, aliphatic index, and hydropathicity. In WRKY sequences, in Group-I PI ranges from 9.26–9.98, number of amino acids are from 292–362, the molecular weight is between 32811.88 and 39350.54, instability index from 40.93–69.66, aliphatic index from 57.59–75.41, and hydropathicity ranges from 0.447–0.885, in Group-II PI ranges from 4.87–9.98, molecular weight is between 13162.98-6280.77, amino acid between 117–571, instability index 41.2-67.94, aliphatic index 40.41–66.99, hydropathicity − 0.545 to -1.069. Data is provided in \u003cb\u003eSupplementary Table\u0026nbsp;2.\u003c/b\u003e In Group-I of Hsc’s PI ranges between 5.32-6, molecular weight from 84766.58-98701.31, amino acids from 757–886, instability index 35.66–49.64, aliphatic index 77.28–88.95, hydropathicity from 0.346–0.52. In Group-II PI ranges from 4.98–5.99, number of amino acids ranges between 255–886, molecular weight from 29307.45-98521.15, aliphatic index 60.47–89.62, instability index from 27.41–42.89, hydropathicity from − 0.3 to -1.191. In group-III PI ranges from 5-5.5, molecular weight is between 60950.23-62652.27, number of amino acids from 552–856, instability index 34.74–39.86, aliphatic index 99.18-104.47, hydropathicity − 0.007 to -0.069. Further details are provided in \u003cb\u003eSupplementary Table\u0026nbsp;3.\u003c/b\u003e In ProDh sequences, PI ranges from 7.58–9.23, molecular weight is between 18157.9-57240.81, number of amino acids from 166–515, aliphatic index 81.8-90.55, instability index 42.72-57, hydropathicity − 0.11 to -0.277. Details are provided in \u003cb\u003eSupplementary Table\u0026nbsp;4.\u003c/b\u003e\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Motif and Domain Analysis\u003c/h2\u003e \u003cp\u003eConserved motif analysis was carried out using MEME suite for the identification of functional regions in proteins, and exploration of structural elements indispensable for its activities. The 800 bp upstream promotor regions of \u003cem\u003eWRKY27, Hsc70-1\u003c/em\u003e, and \u003cem\u003eProDh\u003c/em\u003e were analyzed for the presence of motifs. 10 conserved motifs were selected to be shown \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. In the case of WRKYs, Motif 1 and Motif 2 are present in all sequences, with Motif 2 situated on C-terminus of Motif 1. Motif 1 signifies the WRKY domain, and Motif 2 pertains to a zinc-finger motif. Motif 3 is found in all WRKYs except 5 members of Group-IIA. Motif 4 is situated only in Group-I. Motif 5 is present in Group-I, except 5 WRKYs, Group-IIB, and 4 Group-IIC, and 2 Group-IIE WRKYs. Motif 6 exists within Group-I, Group-IIC, Group-IID. Motif 7 can be mostly identified in Group-IIB, and IIC. Motif 8 is most prevalent in Group-IID, and F. Motif 9 and 10 are displayed in Group-I only. Members of Group-IIB, IIC, and IID show the most similarity among them, while Group-IIA is distinct from all. Figure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA. depicts the allocation of conserved motifs across the span of WRKYs. We identified two superfamilies via NCBI CDD for domain analysis, WRKY domain superfamily, and Zinc-cluster Domain superfamily. WRKY domain is present in all Groups while Zinc-cluster domain is only present in members of Group-I. In the case of HSCs Group-IIA, and IIB have all the conserved motifs present in them except HSC22, the only difference lies in distances of motifs. In members of Group IIA motif 2 and 8 are placed very close to N-terminal as compared to elements of Group-IIB. Motifs 3 and 7 are absent in Group-IA. Members of Group IB have only 3 domains in them; 1,4, and 7. In Group-III motif 8 is missing on C-terminal of motif 2. Group-III also lacks domain 5. All the motifs are displayed in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB. CDD analysis showed that PTZ superfamily, ASKHA_ATPase like superfamily, DnaK superfamily, HscA superfamily are present in all protein sequences except Hsc9 which only has 2 domains: PTZ, and ASKHA_ATPase. Among ProDH, Group-IA and Group-IB showed great resemblance among motifs, the only variation lies in location of Motif 10. Motif 1, 3, 9, 10 were present in all Groups. Motifs 5, 7, and 8 are present only in Group-I. Group-II, and Group-III differ in presence of one Motif, but the arrangement of Motifs varies vastly. Figure\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC. shows motif analysis of ProDH sequences of \u003cem\u003eG. hirsutum\u003c/em\u003e. In ProDH sequences, ProDh superfamily, PLN superfamily, and PutA superfamily domains are present in all.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Phylogenetic Analysis\u003c/h2\u003e \u003cp\u003eMEGA6 was used to construct the maximum likelihood tree for phylogenetic analysis of WRKY, Hsc, and ProDH protein sequences. In the case of WRKY, phylogenetic trees show each group as a separate clade, represented by different colors \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e\u003cb\u003e)\u003c/b\u003e. Sequences are divided into two major groups with WRKY domain present in all groups. Group I-A, shown by pink circles, is substantially distinct from other groups. Group-IIA, IIB, IIC, IID, IIE, and IIF are represented by green, red, mustard, blue, purple and brown circles. The phylogenetic tree constructed for WRKYs of \u003cem\u003eG. hirsutum\u003c/em\u003e is demonstrated in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA. Phylogenetic analysis of HSCs showed three major clades, all of them represented by different colors. Group-IA, and IB are displayed by blue, and yellow circles respectively. Group IIA and IIB are shown by pink circles and squares. Group III is depicted by purple circles. HSC9 didn’t lie in any group and is presented by a grey circle. Phylogenetic tree of HSC proteins constructed by MEGA6 is evident in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB. ProDh sequences grouped together are shown in independent clades in phylogenetic tree constructed by MEGA6. All 4 members of Group-IA lie closely together, Group-III which is substantially distinct from other Groups exist in an independent clade. 2 members of Group-IB, and 3 members of Group-II lie close to each other. Phylogenetic tree constructed for ProDh is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Promoter analysis\u003c/h2\u003e \u003cp\u003eOn PlantCARE promotor analysis was performed on 800 bp upstream region of genes selected for VIGS. Promotor element for transcription start (TATA-box), common cis-acting element in promotor and enhancer region (CAAT-box), light response (G-box), and abscisic acid responsiveness (ABRE) are common motifs in the promotor regions of all three genes. AT-TATA-box is present in \u003cem\u003eHSC70-1\u003c/em\u003e, and \u003cem\u003eProDh\u003c/em\u003e but absent in \u003cem\u003eWRKY27\u003c/em\u003e. TCT-motif which is a part of light responsive element is present in \u003cem\u003eWRKY27\u003c/em\u003e, and \u003cem\u003eHsc70-1\u003c/em\u003e but absent in \u003cem\u003eProDh\u003c/em\u003e. Some motifs are unique in all sequences, light responsive element (3-AF1 binding site), cis-regulatory element involved in circadian control (circadian), and gibberellin responsive element (P-box) are unique in \u003cem\u003eWRKY27\u003c/em\u003e. A module of light response (AE-box), cis-acting regulatory element for the anaerobic induction (ARE), MeJA responsiveness (CGTCA and TGACG) are only present in \u003cem\u003eHsc70-1\u003c/em\u003e, similarly cis-regulatory elements involved in stress and pathogen induced gene expression (AAGAA), light responsiveness (GATA motif), low temperature responsiveness (LTR), and auxin response (TGA) are only present in \u003cem\u003eProDh\u003c/em\u003e. Promotors sequences and their respective functions are shown in \u003cb\u003eSupplementary Table\u0026nbsp;5\u003c/b\u003e. Heat maps showing abundance of promotors across genes, and unique and shared promotors are shown as venn diagram in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e3.6. Downregulation of Targeted Genes\u003c/h2\u003e \u003cp\u003eFour weeks after sprays, photobleaching symptoms appeared on true leaves of TRV:TRV2-CLA sprayed plants and it was used as phenotypic marker for validation of onset of gene silencing \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB\u003cb\u003e)\u003c/b\u003e. After that RNA was isolated and transcribed to cDNA from TRV:TRV2-Hsc, TRV:TRV2-WRKY27, TRV:TRV2-ProDh sprayed plants. Gene expression analysis by qPCR showed remarkably low transcript levels as compared to TRV:00 plants. (\u003cb\u003eFi. 6 C)\u003c/b\u003e\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e3.7. Heat stress assay\u003c/h2\u003e \u003cp\u003eUpon confirmation of reduced gene expression \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, C\u003cb\u003e)\u003c/b\u003e, VIGS sprayed plants were kept in a chamber at 40°C for 24 hours for heat stress. TRV:TRV2-Hsc, TRV:TRV2-WRKY27, TRV:TRV2-ProDh behaved well under heat stress, documented by the onset of leaf epinasty without any salient impact on the stem \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD\u003cb\u003e)\u003c/b\u003e. Once the heat stress was alleviated, leaves of TRV:TRV2-Hsc, TRV:TRV2-WRKY27, TRV:TRV2-ProDh recovered, while TRV:00 sprayed plants failed to recover \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE\u003cb\u003e)\u003c/b\u003e. Comparison of TRV:TRV2-Hsc, TRV:TRV2-WRKY27, TRV:TRV2-ProDh and TRV:00 sprayed plants immediately after heat stress and two days later can be seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD, E.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e3.8. Drought stress assay\u003c/h2\u003e \u003cp\u003eFollowing validation of gene suppression \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB, C\u003cb\u003e)\u003c/b\u003e, TRV:00, TRV:TRV2-Hsc, TRV:TRV2-WRKY27, TRV:TRV2-ProDh sprayed plants were kept in drought stress by curtailing water supply for four weeks. No wilting symptoms appear for up to 4 weeks as compared to TRV:00 sprayed plants which showed extreme desiccation and wilting within two to three weeks and did not recover even after watering as seen in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF. TRV:TRV2-Hsc outperformed TRV:TRV2-Hsc, TRV:TRV2-WRKY27. TRV:TRV2-WRKY27 showed leaf chlorosis and drought induced senescence to some extent \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF\u003cb\u003e)\u003c/b\u003e. We conclude that TRV:TRV2-Hsc, TRV:TRV2-ProDh are strong while TRV:TRV2-WRKY27 is a moderate negative regulator of drought stress.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003e3.8. Whitefly bioassay\u003c/h2\u003e \u003cp\u003eTRV:00, TRV:TRV2-Hsc, TRV:TRV2-WRKY27, TRV:TRV2-ProDh sprayed plants were subjected to whitefly stress after confirmation of VIGS establishment \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA\u003cb\u003e)\u003c/b\u003e. Using a light microscope, number of eggs, and nymphs were counted on 1mm\u003csup\u003e2\u003c/sup\u003e sections of different leaves were counted for whitefly reproductive assessment \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB, C\u003cb\u003e)\u003c/b\u003e. Quantification of developmental stages on leaves of sprayed plants were compared with TRV:00 sprayed plants as control. TRV:TRV2-WRKY sprayed plants showed significantly low production of eggs and nymphs. As indicated by the graphs TRV:TRV2-WRKY27 showed significantly reduced number of eggs and nymphs. TRV:00 sprayed plants used as control showed abundant egg and nymph production. On day 14 egg count on TRV:TRV2-Hsc sprayed plants were 37% less than TRV:00 sprayed plants. TRV:TRV2-WRKY27 and TRV:TRV2-ProDh showed 70.4% and 63% less egg production respectively, as compared to control. On day 14 the nymphal count was 50%, 75%, and 66.7% reduced in TRV:TRV2-Hsc, TRV:TRV2-WRKY27, TRV:TRV2-ProDh sprayed plants, respectively. On day 14 the average egg count on TRV:00 plants were 90, 56 on TRV:TRV2-Hsc, 26.7 on TRV:TRV2-WRKY27, and 33.3 on TRV:TRV2-ProDh sprayed plants while the mean nymph count was 12 on plant sprayed with TRV:00, 6.6 on TRV:TRV2-Hsc, 3.3 on TRV:TRV2-WRKY27, and 4.6 on TRV:TRV2-ProDh \u003cb\u003e(\u003c/b\u003eFig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB, C\u003cb\u003e)\u003c/b\u003e. In conclusion, TRV:TRV2-WRKY27, TRV:TRV2-ProDh can be potential targets for combating biotic stress, while to some extent TRV:TRV2-Hsc can be a negative regulator of whitefly stress.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.9. Relative expression of other stress-responsive genes\u003c/h2\u003e \u003cp\u003eThe relative expression of other abiotic stress-related genes such as \u003cem\u003eBBX18, GASA5, MAP3K65\u003c/em\u003e, and \u003cem\u003eCKX1\u003c/em\u003e genes, was assessed and it displayed striking discrepancy. \u003cem\u003eBBX18\u003c/em\u003e and \u003cem\u003eGASA5\u003c/em\u003e were found to be downregulated in \u003cem\u003eWRKY27, Hsc70-1, and ProDH\u003c/em\u003e downregulated plants. \u003cem\u003eMAP3K65\u003c/em\u003e was upregulated in \u003cem\u003eHsc70-1\u003c/em\u003e silenced plants, while \u003cem\u003eCKX1\u003c/em\u003e showed upregulation in plants where \u003cem\u003eWRKY27\u003c/em\u003e was silenced. Expression pattern is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e "},{"header":"Discussion","content":"\u003cp\u003eWRKY transcription factors (TFs) are housekeeping proteins and remarkably conserved across plant kingdom. Extensive research is available on WRKY’s genome wide classification in cotton, showcasing their potential as regulators of various biotic and abiotic stresses (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e). This study explores the evolution and significance of WRKY genes in \u003cem\u003eG. hirsutum\u003c/em\u003e. Here, we identified 100 WRKYs in the genome of \u003cem\u003eG. hirsutum\u003c/em\u003e and they were divided into two major groups based on phylogenetic data, Group-I and Group-II, Group-II was further classified as Group-IIA, IIB, IIC, IID, IIE, and IIF based on subclades and conserveness in sequences of amino acid. Our findings vary from other studies where WRKYs are categorized in three Groups, and Group-I is characterized by presence of two WRKYGQK motifs, phylogenetic analysis of our sequences revealed two major Groups, and only three sequences among Group-IIA showed two WRKYGQK motifs. Sequences lying in the same sub-clades were further validated by presence of consecutive motifs conserved among them. In the protein sequences WRKYGQK domain is primarily positioned in the mid region with a zinc-finger domain present on its C-terminal. Domain analysis revealed that WRKY domain is present in all sequences, but Zinc-finger domain is present only in all proteins lying in Group-I, indicating functional divergence and structural independence. Physio-chemical properties of protein sequences present in Group-II showed the most variation owing to extensive size. Promotor analysis of 800 bp upstream genes showed presence of cis-regulating elements involved in stress responsiveness, abiotic stress, and light responsive elements. Here we used reverse genetics to assess the role of \u003cem\u003eWRKY27\u003c/em\u003e in heat, drought, and whitefly tolerance in \u003cem\u003eG. hirsutum\u003c/em\u003e. Under heat stress \u003cem\u003eWRKY27\u003c/em\u003e silenced plants by VIGS based sprays remained intact except for transient leaf epinasty immediately followed by heat stress, which was recovered once the heat stress was alleviated, declaring it a negative modulator of heat stress as no leaf scorching or wilting was observed. Alternatively, under drought stress \u003cem\u003eWRKY27\u003c/em\u003e silenced plants remained unscathed for two weeks but after that they started showing wilting on the edges of leaves due to turgor pressure loss and their leaves had malformed appearance to some extent which makes it a moderate negative regulator of drought stress. Under whitefly stress \u003cem\u003eWRKY27\u003c/em\u003e silenced plants demonstrated a visible decline (70–75%) in number of eggs and nymphs, highlighting its role in inducing plant immunity and it corresponds with another finding reported by Ehsan et. al. on WRKY TF (\u003cem\u003eWRKY33\u003c/em\u003e) being a negative regulator of whitefly stress (\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eRegardless of the fundamental roles played by \u003cem\u003eHSC70\u003c/em\u003e in eukaryotes, very less is understood about their specific roles in signaling pathways and corresponding molecular pathways (\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e). \u003cem\u003eHSC70-1\u003c/em\u003e is a crucial ubiquitous protein that shows constitutive expression, it is primarily attributed to the maintenance of protein homeostasis under non-stressed conditions and engages in promptly induced cellular defense after exposure to stress stimuli (\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e). This study provides genome wide analysis and functional validation for implication of \u003cem\u003eHSC70-1\u003c/em\u003e in various physiological mechanisms such as resilience to heat, drought, and whiteflies in cotton and our findings substantiates previous findings (\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e). We identified 63 \u003cem\u003eHSC70\u003c/em\u003e’\u003cem\u003es\u003c/em\u003e in \u003cem\u003eG. hirsutum\u003c/em\u003e and performed extensive genome profiling, the classification was validated by phylogenetic analysis, conserved motif and domain analysis, and promoter analysis. All members with the same grouping of motifs lay in the same clade and cluster of phylogenetic trees. The presence of Dnak and ASKHA_ATPase domain in all sequences signifies a higher degree of function conservation among protein sequences. Promotor analysis shows the presence of regulatory motifs involved in stress responsive gene expression. Expression analysis revealed that \u003cem\u003eHSC70-1\u003c/em\u003e is a strong negative regulator of heat, and drought as the plants remained resilient and showed no observable phenotypic attributes of stress. Upon whitefly infestation fewer eggs and nymphs were documented when contrasted with TRV:00 sprayed plants, making it a partial negative regulator of whitefly stress mitigation.\u003c/p\u003e\u003cp\u003eProline is a proteinogenic amino acid involved in management of abiotic stress tolerance (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e). Genome wide studies on Proline dehydrogenase in plants are not reported yet. The 10 protein sequences we retrieved had a high degree of conserveness among their motifs. Physio-chemical properties did not show much variation as well. Promotor analysis revealed presence of cis-regulatory elements involved in stress and pathogen induced gene expression, which is unique as compared to other two genes. When \u003cem\u003eProDH\u003c/em\u003e silenced plants were exposed to heat stress, the plant remained robust and exhibited no visible signs of heat-induced stress. Plants kept in drought stress also maintained normal physiology. Upon whitefly infestation, \u003cem\u003eProDh\u003c/em\u003e showed a significantly low count of eggs and nymphs, showing its potential in activation of defense signaling pathways. So, we declare \u003cem\u003eProDh\u003c/em\u003e to be an efficient negative modulator of heat stress, desiccation tolerance, and whiteflies.\u003c/p\u003e\u003cp\u003eWe observed the effect of silencing on expression of some other genes; \u003cem\u003eBBX18, GASA5, MAP3K65\u003c/em\u003e, and \u003cem\u003eCKX1\u003c/em\u003e involved in similar abiotic and biotic stresses on sprayed and non-sprayed plants. \u003cem\u003eMAP3K65\u003c/em\u003e known to be a negative regulator of heat and pathogens in \u003cem\u003eG. hirsutum\u003c/em\u003e (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e) was found highly downregulated in \u003cem\u003eProDh\u003c/em\u003e silenced plants, moderately in \u003cem\u003eWRKY27\u003c/em\u003e silenced plants but upregulated in \u003cem\u003eHSC70-1\u003c/em\u003e silenced plants. \u003cem\u003eGASA5\u003c/em\u003e, known to enhance heat sensitivity, hastened yellowing of cotyledon after thermal stress, and \u003cem\u003eBBX18\u003c/em\u003e a negative modulator of drought and heat (\u003cspan additionalcitationids=\"CR43 CR44\" citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e–\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e) marked considerable attenuation in expression levels in \u003cem\u003eHSC70-1, WRKY27\u003c/em\u003e, and \u003cem\u003eProDh\u003c/em\u003e silenced plants indicating a coordination in molecular pathways and functional networks. Expression levels of \u003cem\u003eCKX1\u003c/em\u003e involved in heat and drought defense (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e) showed upregulation in \u003cem\u003eWRKY27\u003c/em\u003e, and low expression in \u003cem\u003eHSC70-1\u003c/em\u003e, and \u003cem\u003eProDh\u003c/em\u003e silenced plants.\u003c/p\u003e\u003cp\u003eWe conclude by advocating the potential for harnessing \u003cem\u003eHSC70-1, WRKY27\u003c/em\u003e, and \u003cem\u003eProDh\u003c/em\u003e as negative stress regulators of heat, drought, and whiteflies via genome editing for development of resilient crops to improve yield and quality.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eData will be made available on request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of Competing Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare they do not have any competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe present study didn't receive any external funding.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthorship contribution statement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMariam Akhtar:\u0026nbsp;\u003c/strong\u003eMethodology, Investigation, Writing-original draft. \u003cstrong\u003eRubab Zahra Naqvi:\u0026nbsp;\u003c/strong\u003eFormal analysis, Validation, Review and editing. \u003cstrong\u003eMuhammad Jawad Akbar Awan:\u0026nbsp;\u003c/strong\u003eReview and editing, investigation, Methodology. \u003cstrong\u003eIfrah Imran:\u0026nbsp;\u003c/strong\u003eBioinformatics analysis. \u003cstrong\u003eImran Amin:\u0026nbsp;\u003c/strong\u003eConceptualization, Supervision review and editing. \u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgment\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe are thankful to all the members of Molecular virology and gene silencing lab and green house staff of NIBGE Faisalabad for their support.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eUl-Allah S, Rehman A, Hussain M, Farooq M. Fiber yield and quality in cotton under drought: Effects and management. Agric Water Manage. 2021;255:106994. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.agwat.2021.106994\u003c/span\u003e\u003cspan address=\"10.1016/j.agwat.2021.106994\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZafar S, Afzal H, Ijaz A, Mahmood A, Ayub A, Nayab A, et al. Cotton and drought stress: An updated overview for improving stress tolerance. South Afr J Bot. 2023;161:258\u0026ndash;68.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eUllah A, Shakeel A, Ahmed HGM-D, Naeem M, Ali M, Shah AN, et al. Genetic basis and principal component analysis in cotton (Gossypium hirsutum L.) grown under water deficit condition. Front Plant Sci. 2022;13:981369. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2022.981369\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2022.981369\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnees M, Shad SA. Insect pests of cotton and their management. Cotton Production and Uses: Agronomy, Crop Protection, and Postharvest Technologies. 2020:177\u0026ndash;212. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/978-981-15-1472-2_11\u003c/span\u003e\u003cspan address=\"10.1007/978-981-15-1472-2_11\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSuhag A, Yadav H, Chaudhary D, Subramanian S, Jaiwal R, Jaiwal PK. Biotechnological interventions for the sustainable management of a global pest, whitefly (Bemisia tabaci). Insect Sci. 2021;28(5):1228\u0026ndash;52. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/1744-7917.12853\u003c/span\u003e\u003cspan address=\"10.1111/1744-7917.12853\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAbubakar M, Koul B, Chandrashekar K, Raut A, Yadav D. Whitefly (Bemisia tabaci) management (WFM) strategies for sustainable agriculture: a review. Agriculture. 2022;12(9):1317. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/agriculture12091317\u003c/span\u003e\u003cspan address=\"10.3390/agriculture12091317\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMahmood MA, Naqvi RZ, Siddiqui HA, Amin I, Mansoor S. Current knowledge and implementations of Bemisia tabaci genomic technologies for sustainable control. J Pest Sci. 2023;96(2):427\u0026ndash;40. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s10340-022-01520-5\u003c/span\u003e\u003cspan address=\"10.1007/s10340-022-01520-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S. Recent advances of polyphenol oxidases in plants. Molecules. 2023;28(5):2158. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/molecules28052158\u003c/span\u003e\u003cspan address=\"10.3390/molecules28052158\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZahoor R, Dong H, Abid M, Zhao W, Wang Y, Zhou Z. Potassium fertilizer improves drought stress alleviation potential in cotton by enhancing photosynthesis and carbohydrate metabolism. Environ Exp Bot. 2017;137:73\u0026ndash;83. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.envexpbot.2017.02.002\u003c/span\u003e\u003cspan address=\"10.1016/j.envexpbot.2017.02.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSarwar M, Saleem MF, Ullah N, Ali A, Collins B, Shahid M, et al. Superior leaf physiological performance contributes to sustaining the final yield of cotton (Gossypium hirsutum L.) genotypes under terminal heat stress. Physiol Mol Biology Plants. 2023;29(5):739\u0026ndash;53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s12298-023-01322-8\u003c/span\u003e\u003cspan address=\"10.1007/s12298-023-01322-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDos Santos TB, Ribas AF, de Souza SGH, Budzinski IGF, Domingues DS. Physiological responses to drought, salinity, and heat stress in plants: a review. Stresses. 2022;2(1):113\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/stresses2010009\u003c/span\u003e\u003cspan address=\"10.3390/stresses2010009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePatil AM, Pawar BD, Wagh SG, Shinde H, Shelake RM, Markad NR, et al. Abiotic stress in cotton: Insights into plant responses and biotechnological solutions. Agriculture. 2024;14(9):1638. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/agriculture14091638\u003c/span\u003e\u003cspan address=\"10.3390/agriculture14091638\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMasoomi-Aladizgeh F, Najeeb U, Hamzelou S, Pascovici D, Amirkhani A, Tan DK, et al. Pollen development in cotton (Gossypium hirsutum) is highly sensitive to heat exposure during the tetrad stage. Plant Cell Environ. 2021;44(7):2150\u0026ndash;66. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/pce.13908\u003c/span\u003e\u003cspan address=\"10.1111/pce.13908\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGao M, Snider JL, Bai H, Hu W, Wang R, Meng Y, et al. Drought effects on cotton (Gossypium hirsutum L.) fibre quality and fibre sucrose metabolism during the flowering and boll-formation period. J Agron Crop Sci. 2020;206(3):309\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/jac.12389\u003c/span\u003e\u003cspan address=\"10.1111/jac.12389\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang Y, Liu G, Dong H, Li C. Waterlogging stress in cotton: Damage, adaptability, alleviation strategies, and mechanisms. Crop J. 2021;9(2):257\u0026ndash;70. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cj.2020.08.005\u003c/span\u003e\u003cspan address=\"10.1016/j.cj.2020.08.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDubey R, Pandey BK, Sawant SV, Shirke PA. Drought stress inhibits stomatal development to improve water use efficiency in cotton. Acta Physiol Plant. 2023;45(2):30. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11738-022-03511-6\u003c/span\u003e\u003cspan address=\"10.1007/s11738-022-03511-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEhsan A, Naqvi RZ, Azhar M, Awan MJA, Amin I, Mansoor S, Asif M. Genome-wide analysis of WRKY gene family and negative regulation of ghWRKY25 and ghWRKY33 reveal their role in whitefly and drought stress tolerance in cotton. Genes. 2023;14(1):171. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/genes14010171\u003c/span\u003e\u003cspan address=\"10.3390/genes14010171\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshiguro S, Nakamura K. Characterization of a cDNA encoding a novel DNA-binding protein, SPF1, that recognizes SP8 sequences in the 5\u0026prime; upstream regions of genes coding for sporamin and β-amylase from sweet potato. Mol Gen Genet MGG. 1994;244:563\u0026ndash;71. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/BF00282746\u003c/span\u003e\u003cspan address=\"10.1007/BF00282746\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X, Li C, Wang H, Guo Z. WRKY transcription factors: evolution, binding, and action. Phytopathol Res. 2019;1(1):13. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s42483-019-0022-x\u003c/span\u003e\u003cspan address=\"10.1186/s42483-019-0022-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong X, Hou X, Zeng Y, Jia D, Li Q, Gu Y, Miao H. Genome-wide identification and comprehensive analysis of WRKY transcription factor family in safflower during drought stress. Sci Rep. 2023;13(1):16955. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41598-023-44340-y\u003c/span\u003e\u003cspan address=\"10.1038/s41598-023-44340-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCiolkowski I, Wanke D, Birkenbihl RP, Somssich IE. Studies on DNA-binding selectivity of WRKY transcription factors lend structural clues into WRKY-domain function. Plant Mol Biol. 2008;68:81\u0026ndash;92. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11103-008-9353-1\u003c/span\u003e\u003cspan address=\"10.1007/s11103-008-9353-1\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMingyu Z, Zhengbin Z, Shouyi C, Jinsong Z, Hongbo S. WRKY transcription factor superfamily: structure, origin and functions. Afr J Biotechnol. 2012;11(32):8051\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen X, Li C, Wang H, Guo Z. WRKY transcription factors: evolution, binding, and action. Phytopathol Res. 2019;1(1):1\u0026ndash;15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s42483-019-0022-x\u003c/span\u003e\u003cspan address=\"10.1186/s42483-019-0022-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSheikh AH, Hussain RMF, Tabassum N, Badmi R, Marillonnet S, Scheel D, et al. Possible role of WRKY transcription factors in regulating immunity in Oryza sativa ssp. indica. Physiol Mol Plant Pathol. 2021;114:101623. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.pmpp.2021.101623\u003c/span\u003e\u003cspan address=\"10.1016/j.pmpp.2021.101623\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCazal\u0026eacute; A-C, Cl\u0026eacute;ment M, Chiarenza S, Roncato M-A, Pochon N, Creff A, et al. Altered expression of cytosolic/nuclear HSC70-1 molecular chaperone affects development and abiotic stress tolerance in Arabidopsis thaliana. J Exp Bot. 2009;60(9):2653\u0026ndash;64. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1093/jxb/erp109\u003c/span\u003e\u003cspan address=\"10.1093/jxb/erp109\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSung DY, Guy CL. Physiological and molecular assessment of altered expression of Hsc70-1 in Arabidopsis. Evidence for pleiotropic consequences. Plant Physiol. 2003;132(2):979\u0026ndash;87. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1104/pp.102.019398\u003c/span\u003e\u003cspan address=\"10.1104/pp.102.019398\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRosenzweig R, Nillegoda NB, Mayer MP, Bukau B. The Hsp70 chaperone network. Nat Rev Mol Cell Biol. 2019;20(11):665\u0026ndash;80. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41580-019-0133-3\u003c/span\u003e\u003cspan address=\"10.1038/s41580-019-0133-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKityk R, Vogel M, Schlecht R, Bukau B, Mayer MP. Pathways of allosteric regulation in Hsp70 chaperones. Nat Commun. 2015;6(1):8308. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/ncomms9308\u003c/span\u003e\u003cspan address=\"10.1038/ncomms9308\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMonteoliva MI, Rizzi YS, Cecchini NM, Hajirezaei M-R, Alvarez ME. Context of action of proline dehydrogenase (ProDH) in the hypersensitive response of Arabidopsis. BMC Plant Biol. 2014;14:1\u0026ndash;11. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/1471-2229-14-21\u003c/span\u003e\u003cspan address=\"10.1186/1471-2229-14-21\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAlvarez ME, Savour\u0026eacute; A, Szabados L. Proline metabolism as regulatory hub. Trends Plant Sci. 2022;27(1):39\u0026ndash;55. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.tplants.2021.07.009\u003c/span\u003e\u003cspan address=\"10.1016/j.tplants.2021.07.009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDang F, Lin J, Xue B, Chen Y, Guan D, Wang Y, He S. CaWRKY27 negatively regulates H2O2-mediated thermotolerance in pepper (Capsicum annuum). Front Plant Sci. 2018;9:1633. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2018.01633\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2018.01633\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTiwari LD, Khungar L, Grover A. AtHsc70-1 negatively regulates the basal heat tolerance in Arabidopsis thaliana through affecting the activity of HsfAs and Hsp101. Plant J. 2020;103(6):2069\u0026ndash;83. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/tpj.14883\u003c/span\u003e\u003cspan address=\"10.1111/tpj.14883\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuo M, Zhang X, Liu J, Hou L, Liu H, Zhao X. OsProDH negatively regulates thermotolerance in rice by modulating proline metabolism and reactive oxygen species scavenging. Rice. 2020;13:1\u0026ndash;5. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12284-020-00422-3\u003c/span\u003e\u003cspan address=\"10.1186/s12284-020-00422-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDeng D, Gao Q, Zeng R, Jiang J, Shen Q, Ma Y, et al. The Proline Dehydrogenase Gene CsProDH1 Regulates Homeostasis of the Pro-P5C Cycle Under Drought Stress in Tea Plants. Int J Mol Sci. 2025;26(7):3121. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms26073121\u003c/span\u003e\u003cspan address=\"10.3390/ijms26073121\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSolGen. Sol Genomics Network https://solgenomics.net/.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi W, Pang S, Lu Z, Jin B. Function and mechanism of WRKY transcription factors in abiotic stress responses of plants. Plants. 2020;9(11):1515. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/plants9111515\u003c/span\u003e\u003cspan address=\"10.3390/plants9111515\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMukhtar MS, Deslandes L, Auriac MC, Marco Y, Somssich IE. The Arabidopsis transcription factor WRKY27 influences wilt disease symptom development caused by Ralstonia solanacearum. Plant J. 2008;56(6):935\u0026ndash;47. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1111/j.1365-313X.2008.03651.x\u003c/span\u003e\u003cspan address=\"10.1111/j.1365-313X.2008.03651.x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z, Li Y, Yang X, Zhao J, Cheng Y, Wang J. Mechanism and complex roles of HSC70 in viral infections. Front Microbiol. 2020;11:1577. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fmicb.2020.01577\u003c/span\u003e\u003cspan address=\"10.3389/fmicb.2020.01577\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNoel LD, Cagna G, Stuttmann J, Wirthmuller L, Betsuyaku S, Witte C-P, et al. Interaction between SGT1 and cytosolic/nuclear HSC70 chaperones regulates Arabidopsis immune responses. Plant Cell. 2007;19(12):4061\u0026ndash;76. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1105/tpc.107.051896\u003c/span\u003e\u003cspan address=\"10.1105/tpc.107.051896\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDemirkan A, Henneman P, Verhoeven A, Dharuri H, Amin N, van Klinken JB, et al. Insight in genome-wide association of metabolite quantitative traits by exome sequence analyses. PLoS Genet. 2015;11(1):e1004835. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1371/journal.pgen.1004835\u003c/span\u003e\u003cspan address=\"10.1371/journal.pgen.1004835\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhai N, Jia H, Liu D, Liu S, Ma M, Guo X, Li H. GhMAP3K65, a cotton Raf-like MAP3K gene, enhances susceptibility to pathogen infection and heat stress by negatively modulating growth and development in transgenic Nicotiana benthamiana. Int J Mol Sci. 2017;18(11):2462. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.3390/ijms18112462\u003c/span\u003e\u003cspan address=\"10.3390/ijms18112462\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhang S, Wang X. Overexpression of GASA5 increases the sensitivity of Arabidopsis to heat stress. J Plant Physiol. 2011;168(17):2093\u0026ndash;101. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jplph.2011.06.010\u003c/span\u003e\u003cspan address=\"10.1016/j.jplph.2011.06.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLee SH, Yoon JS, Jung WJ, Kim DY, Seo YW. Genome-wide identification and characterization of the lettuce GASA family in response to abiotic stresses. BMC Plant Biol. 2023;23(1):106. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1186/s12870-023-04101-5\u003c/span\u003e\u003cspan address=\"10.1186/s12870-023-04101-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Q, Tu X, Zhang J, Chen X, Rao L. Heat stress-induced BBX18 negatively regulates the thermotolerance in Arabidopsis. Mol Biol Rep. 2013;40:2679\u0026ndash;88. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1007/s11033-012-2354-9\u003c/span\u003e\u003cspan address=\"10.1007/s11033-012-2354-9\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Ai G, Wang Y, Ding Y, Hu X, Liang Y, et al. A truncated B-box zinc finger transcription factor confers drought sensitivity in modern cultivated tomatoes. Nat Commun. 2024;15(1):8013. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1038/s41467-024-51699-7\u003c/span\u003e\u003cspan address=\"10.1038/s41467-024-51699-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLubovsk\u0026aacute; Z, Dobr\u0026aacute; J, Štorchov\u0026aacute; H, Wilhelmov\u0026aacute; N, Vankov\u0026aacute; R. Cytokinin oxidase/dehydrogenase overexpression modifies antioxidant defense against heat, drought and their combination in Nicotiana tabacum plants. J Plant Physiol. 2014;171(17):1625\u0026ndash;33. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.jplph.2014.06.021\u003c/span\u003e\u003cspan address=\"10.1016/j.jplph.2014.06.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Genome wide analysis, signaling pathways, WRKY, HSC70, ProDh, heat stress, drought stress, whitefly stress, cotton, VIGS","lastPublishedDoi":"10.21203/rs.3.rs-6591527/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-6591527/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eBiotic and abiotic stress are fundamental contributors to restricting cotton yield and performance. Comprehension of molecular mechanisms behind these responses is necessary for elevating stress resistance. Genome wide profiling classified 100 WRKY, 63 HSC, and 10 ProDh family proteins identified in \u003cem\u003eGossypium hirsutum\u003c/em\u003e based on conserved domains and motif, and phylogenetic analysis. In the present study \u003cem\u003eHSC70-1\u003c/em\u003e, \u003cem\u003eWRKY27\u003c/em\u003e, and \u003cem\u003eProDh\u003c/em\u003e were characterized as negative stress regulators of heat, drought, and whiteflies and their functional analyses were performed to validate the roles of these genes in modulating the intensity of stress response and defense mechanism via Virus-Induced Gene Silencing (VIGS) using foliar sprays \u0026ndash; a novel approach for transient gene silencing in cotton. Downregulation of \u003cem\u003eHSC70-1\u003c/em\u003e resulted in strong resilience to drought and heat stress. \u003cem\u003eWRKY27\u003c/em\u003e was the strong negative modulator of whiteflies and heat, and \u003cem\u003eProDh\u003c/em\u003e silenced plants showed susceptibility to all stresses. The relative expression of some other genes, \u003cem\u003eBBX18\u003c/em\u003e, \u003cem\u003eGASA5\u003c/em\u003e, \u003cem\u003eMAP3K65\u003c/em\u003e, and \u003cem\u003eCKX1\u003c/em\u003e, involved in these stress related pathways was also quantified. \u003cem\u003eBBX18\u003c/em\u003e and \u003cem\u003eGASA5\u003c/em\u003e were found downregulated in all silenced plants whereas \u003cem\u003eMAP3K65\u003c/em\u003e showed upregulation in \u003cem\u003eHSC70\u003c/em\u003e-\u003cem\u003e1\u003c/em\u003e silenced plants while \u003cem\u003eCKX1\u003c/em\u003e was upregulated in \u003cem\u003eWRKY27\u003c/em\u003e silenced plants. Overall, this study aims to provide the functional importance of down-regulators to make heat, drought, and whitefly tolerant plants.\u003c/p\u003e","manuscriptTitle":"Genome-Wide Profiling of WRKY, HSC, and ProDh Gene Families and VIGS-Mediated Functional Analysis of Negative Regulators of Cotton's Stress Response to Drought, Heat, and Whiteflies","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-05-21 11:20:42","doi":"10.21203/rs.3.rs-6591527/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"e6a67bcf-1baa-4106-93d9-3da382ac67f2","owner":[],"postedDate":"May 21st, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2025-12-11T02:03:35+00:00","versionOfRecord":[],"versionCreatedAt":"2025-05-21 11:20:42","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-6591527","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-6591527","identity":"rs-6591527","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}