Molecular Consequences of Pathogenic SDHA Variants: From Defective Flavinylation and Assembly to Lipid Remodeling | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Molecular Consequences of Pathogenic SDHA Variants: From Defective Flavinylation and Assembly to Lipid Remodeling María José Saucedo-Rodríguez, Petr Pecina, Kateřina Tauchmannová, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8568560/v1 This work is licensed under a CC BY 4.0 License Status: Under Review Version 1 posted 8 You are reading this latest preprint version Abstract Background Succinate dehydrogenase (SDH), also known as complex II, connects the tricarboxylic acid cycle with oxidative phosphorylation, and mutations in its subunits are linked to mitochondrial disease and cancer. However, the molecular consequences of SDHA pathogenic variants remain poorly understood. Here, we generated a panel of patient-derived SDHA variants in an SDHA knockout HEK293 cell model and examined their effects on SDH assembly, function, and cellular metabolism. Results We found that SDHA mutations differentially affect SDH assembly and stability, yet most variants display severely impaired catalytic activity, despite partial or complete enzyme assembly. Loss of SDH function reduced succinate-driven respiration, altered the content of complexes I and IV, and shifted respiration toward NADH-supported pathways. Metabolomic and lipidomic analyses revealed extensive metabolic remodeling, including reorganization of the tricarboxylic acid cycle, succinate accumulation, and adaptive regulation of polyunsaturated fatty acid metabolism. Variants retaining partial SDH activity exhibited intermediate structural, functional, and metabolic phenotypes. Conclusions These findings define how different pathogenic variants of SDHA disrupt SDH structure and function, drive divergent metabolic adaptations, and provide mechanistic insight into the heterogeneous disease manifestations associated with SDHA deficiency. Succinate dehydrogenase SDHA oxidative phosphorylation mitochondrial metabolism complex II metabolomics lipid metabolism Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Succinate dehydrogenase (SDH, complex II) connects the tricarboxylic acid cycle (TCA) to oxidative phosphorylation (OXPHOS) [ 1 ], the key pathway of energy transduction. Embedded in the inner mitochondrial membrane, SDH oxidizes succinate to fumarate and transfers the released electrons to ubiquinone [ 2 ]. This dual role places SDH at the intersection of energy transduction and metabolic regulation. SDH differs in several aspects from other complexes of the OXPHOS system, as it is entirely nuclear-encoded and, unlike the other respiratory complexes, does not directly contribute to the formation of the proton gradient used by ATP synthase to generate ATP [ 3 , 4 ]. SDH function within mitochondrial metabolism depends on the coordinated assembly of its four subunits: SDHA, a flavoprotein with covalently bound FAD; SDHB, an iron-sulfur protein; and the membrane-anchored SDHC and SDHD, which contain heme b and mediate electron transfer to ubiquinone. The assembly of this multisubunit enzyme proceeds through a stepwise process that requires dedicated assembly factors (SDHAF1-4). A key early checkpoint in this process is the covalent flavinylation of SDHA [ 5 ], which depends on SDHAF2, FAD, and a bound dicarboxylate ligand. Following flavinylation, SDHB binds SDHA to form a soluble dimer, which subsequently integrates with SDHC and SDHD to generate the functional enzyme. This ordered assembly pathway ensures that only properly matured subunits are incorporated, thereby maintaining SDH stability and activity [ 6 , 7 ]. Defects in SDH assembly or function have profound pathological consequences. Once considered incompatible with life because of its central role in metabolism [ 8 ], SDH deficiency is now well documented in humans and can result from germline mutations in either SDH subunits or assembly factors. These mutations give rise primarily to two classes of disease: cancer or severe encephalomyopathies that are typically associated with primary mitochondrial disorders [ 9 – 11 ]. SDHB, SDHC, and SDHD variants are strongly associated with tumorigenesis, particularly paragangliomas, pheochromocytomas, and gastrointestinal stromal tumors (GIST) [ 12 – 15 ]. In contrast, mutations affecting SDHA are more commonly associated with mitochondrial disease, most notably Leigh syndrome (LS) [ 11 , 16 , 17 ]. The C-to-T transition at nucleotide 1684 in the SDHA gene (p. Arg554Trp, R554W), causing LS, was the first reported mutation in a nuclear gene associated with mitochondrial deficiency [ 16 ]. Besides LS, the SDHA pathogenic variants were linked to multisystem mitochondrial disease [ 11 , 17 ], such as neurodegeneration with ataxia and late-onset optic atrophy (NDAXOA, p. Arg451Cys, R451C) [ 18 , 19 ]. However, certain SDHA pathogenic variants were also linked to the most common SDH-related cancer types, such as GIST (p. Arg171His, R171H) [ 20 ] or paraganglioma (p. Arg589Trp, R589W) [ 21 ]. Interestingly, the SDHA variant resulting in a stop codon at position 31 of the protein (R31*) was reported in patients with LS, but also associated with paraganglioma or GIST [ 11 ]. Additional reports describe infantile leukodystrophy in patients with SDHB mutations and progressive encephalomyopathy in those with SDHD variants [ 10 ]. Together, these clinical phenotypes highlight the dual consequences of SDH dysfunction, underscoring its dual roles as both a tumor suppressor and an essential element in neurological development and mitochondrial function. The mechanisms underlying the contrasting clinical outcomes associated with SDH deficiency remain poorly understood, yet accumulating evidence suggests that SDH mutations drive distinct metabolic adaptations. Loss of SDH activity constrains TCA cycle-derived oxaloacetate, limiting aspartate synthesis and promoting compensatory anaplerosis through pyruvate carboxylase to sustain anabolic growth [ 22 ]. In parallel, SDH dysfunction alters redox-dependent and hypoxia-associated signaling, as loss of SDHB but not SDHA increases reactive oxygen species (ROS) and stabilizes the transcription factor HIF-1α – a key driver of hypoxic signaling and tumorigenesis [ 23 ]. In addition, succinate accumulation can promote HIF-1α stabilization independently of detectable ROS through inhibition of prolyl-hydroxylase-dependent degradation, leading to pseudohypoxia and epigenetic changes [ 24 ]. Beyond effects on central metabolism and signaling, SDH mutations are also associated with remodeling of lipid metabolism, as patient serum profiling reveals alterations in the length and saturation of polyunsaturated fatty acid (PUFA) chains. These changes are thought to reflect adjustments in the cellular NAD + /NADH balance, indicating an adaptive remodeling of lipid pathways [ 25 ]. Together, these studies demonstrate how SDH dysfunction alters cellular metabolism through multiple, context-dependent mechanisms, which may account for the spectrum of associated disease phenotypes. Notably, most of this mechanistic insight derives from studies of SDHB, SDHC, and SDHD, reflecting their strong links to tumorigenesis. In contrast, the consequences of SDHA mutations remain comparatively underexplored. Although SDHA variants are increasingly recognized in both mitochondrial disease and cancer, the mechanisms by which these mutations disrupt SDH structure, function, and downstream metabolic pathways remain poorly defined. To bridge this knowledge gap, we established a panel of patient-derived SDHA mutations in HEK293 cells. By integrating structural, biochemical, and multi-omics analyses, we define the variant-specific mechanisms that underline the diverse clinical outcomes associated with SDHA deficiency. Results Mutations in SDHA lead to distinct changes in OXPHOS protein expression Mutations in the SDHA subunit of succinate dehydrogenase (SDH) are associated with a wide spectrum of clinical outcomes, ranging from mitochondrial disease to cancer. To explore how selected SDHA mutations drive these phenotypes, we generated four patient-derived SDHA mutant models by re-expressing SDHA mutant variants in HEK293 cells, lacking the SDHA subunit (SDHA KO) [ 7 ] (Fig. 1 ). We investigated the variant R171H (GIST) [ 20 ], R451C (NDAXOA) [ 18 , 19 ], R554W (LS) [ 16 ] and R589W (paraganglioma) [ 21 ]. To have relevant control, we also generated a rescue model by re-expressing wild-type SDHA on the SDHA KO background (SDHA RES). To assess the impact of these variants on SDH composition, we performed label-free quantitative mass spectrometry (LFQ-MS). Compared to wild-type, the level of SDHA re-expressed variants was similar, except for the R589W variant, which showed severely reduced SDHA content (Fig. 2 A, S1A). SDS-PAGE/WB analysis displayed a comparable SDHA pattern (Fig. 2 B), confirming that the SDHA-specific antibody recognizes modified variants. Further, the LFQ-MS revealed a significant reduction of other SDH subunits in the SHDA KO and R589W cell lines. In contrast, R171H, R451C, and R554W variants showed a modest but significant decrease in SDHB and SDHC abundance, whereas the changes in SDHD levels were less pronounced (Fig. 2 A, S1A). These findings were confirmed by SDS-PAGE followed by immunoblotting for SDHA and SDHB, which showed that SDHB was consistently reduced across all mutant cell lines (Fig. 2 B, C). In addition to SDH subunits, the levels of complex assembly factors (SDHAF1-4) were changed, notably the abundance of SDHAF2, an assembly factor required for SDHA maturation [ 6 ], closely mirrored the content of SDHA (Fig. 2 A, B, S1A). These data suggest that the pathogenic variants interfere with the assembly of the SDHA complex, with the most severe being the R589W variant, which compromises the expression or stability of the SDHA protein. Severe deficiencies in OXPHOS complexes, including SDHA KO, have been linked to a secondary downregulation of complexes I and IV – a phenomenon known as interdependence, which is caused by the attenuation of mitochondrial protein synthesis, with its manifestation being strongly associated with the severity of the primary mitochondrial defect [ 26 ]. To assess whether this effect extends to our models, we quantified subunits of complexes I and IV. As the content of SDH was strongly reduced, we expected a corresponding reduction in cI subunits in R589W cells, similar to SDHA KO [ 26 ]. Notably, cI abundance was also decreased in the R171H and R451C models, despite SDHA protein levels in these models being comparable to those in the control cells (WT). On the contrary, a slight increase in the cI subunits content was observed in R554W cells (Fig. 2 A, S1B). The level of cIV subunits mirrored that of cI subunits, being more pronounced in SDHA mutant models (Fig. 2 A, S1C). In summary, although each pathogenic SDHA variant altered the profile of SDH subunits to different extents, all variants showed a reduction in cI and cIV subunits. This pattern suggests that these mutations may compromise SDH assembly, stability, or function. Impact of SDHA mutations on the assembly and function of SDH To determine how SDHA variants affect the structural integrity of SDH, we assessed SDH content and assembly by blue-native electrophoresis (BN-PAGE). Assembled SDH was not present in SDHA KO and R589W models. In all other cases, a fully assembled enzyme was present, albeit its levels were reduced in the case of the R451C variant (Figs. 3 A and 3 C). Across all variants, we also observed an accumulation of assembly intermediates containing SDHA or SDHAF2 (Figs. 3 A, B) that were not present in the WT. Such intermediates have been described under bioenergetic stress conditions and are referred to as cII low [ 27 ]. Since cII low migrates as a broad band at approximately 100 kDa, it is still debated whether it consists of one or more structural entities [ 28 ]. Clearly, one of them is SDHA-SDHAF2 assembly intermediate, which we also observe in our models (SDHA-AF2 in Fig. 3 B). Additionally, a band at a lower molecular weight is present, which does not contain SDHAF2 but does contain SDHA (Fig. 3 D) – most likely, this represents free SDHA. Either it indicates a stalled maturation of SDHA variants even before the binding of SDHAF2, or it may relate to higher-than-native expression of recombinant SDHA. Analysis of native complex I and complex IV content (Figures S1 D, E) was consistent with the LFQ-MS proteomics data and the subunit analysis of complex I (Figure S1 B) and complex IV (Figure S1 C), further supporting the concept of interdependence among respiratory complexes [ 26 ]. Specifically, reduced levels of complex I were observed in the SDHA KO model [ 26 ], as well as in R171H and R451C, with a more pronounced reduction in R589W. In contrast, R554W exhibited complex I levels comparable to those of the SDHA RES and WT cells (Figure S1 D). A similar pattern was observed for complex IV, with decreased levels detected in the KO, R171H, R451C, and R589W models (Figure S1 E). We next investigated whether pathogenic variants in the SDHA gene affect SDH enzymatic activity. To explore this, we measured succinate:coenzyme Q oxidoreductase (SQR) activity as a readout of the isolated SDH catalytic function [ 29 ]. SQR activity was nearly absent in R171H and R589W, and only partially retained (~ 50% of WT) in R554W (Fig. 4 A). Interestingly, the activity was also markedly reduced in R451C, despite the presence of assembled SDH. Normalization to citrate synthase, used as a marker of mitochondrial mass, confirmed that these differences reflected impaired catalytic activity rather than changes in mitochondrial abundance. Given the pronounced defects in isolated SDH activity, we next investigated the extent to which it influences overall OXPHOS function. To test this, we measured oxygen consumption, focusing on individual pathways that feed electrons into the coenzyme Q pool – complex I and SDH. An example of the experimental trace and substrate additions is shown in Fig. 4 C. Cells were first permeabilized with digitonin to allow access of substrates and inhibitors to mitochondria. Complex I-linked respiration was then assessed in the phosphorylating state using NADH-linked substrates, pyruvate and malate (PM), together with ADP, all in saturating conditions (Fig. 4 D). All variants displayed reduced complex I-linked respiration relative to WT, consistent with the secondary decrease of complex I content. R554W retained 77% of WT respiration, R171H60%, R451C 51%, and both R589W and the KO approximately 45%. Following complex I inhibition with rotenone, succinate was added to assess SDH-linked respiration (Fig. 4 E). In agreement with the SQR assay, R171H, R451C, and R589W showed almost no succinate-driven respiration, whereas R554W retained approximately 50% of WT capacity. We also calculated the ratio between SDH and complex I-driven respiration, which revealed a significant reduction across all mutant models (Fig. 4 F). This demonstrates that despite secondary complex I downregulation, a metabolic shift towards NADH-driven respiration can still be observed, since SDH function is profoundly compromised. As SDH enzymatic activity was diminished in three mutant models despite the presence of assembled enzyme, we next investigated whether SDHA mutations affected covalent FAD binding (Fig. 4 G). Flavinylated SDHA, detected by intrinsic fluorescence [ 30 ], was present in WT, SDHA RES, R171H, and R554W but was absent in R451C and R589W. Notably, R451 cells retained expression of SDHAF2, the assembly factor required for FAD insertion, as well as assembled SDH. This suggests that the R451C variant disrupts FAD binding and that SDH assembly can proceed past the SDHA-AF2 checkpoint even in the absence of flavinylated SDHA. In summary, SDHA variants exhibit distinct structural and functional phenotypes. While R589W closely resembles the SDHA KO model and lacks assembled SDH, R554W maintains a partially assembled and functional flavinylated enzyme. In contrast, R171H and R451C form a partially assembled enzyme that is unable to transfer electrons, with loss of FAD binding contributing to the defect in R451C. Metabolic consequences of mutations in SDHA We previously reported that in the absence of SDHA in HEK cells, the cellular redox balance, as measured by the NAD + /NADH ratio, remains unchanged [ 31 ]. To determine whether this also applies to cells expressing pathogenic SDHA variants, we measured the NAD + /NADH ratio across all mutant models (Fig. 5 A). Similar to SDHA KO cells, none of the mutants showed significant changes in the NAD + /NADH ratio, indicating that global redox balance is maintained despite impaired SDH function. This likely reflects the combined effect of reduced NADH generation due to a slowed TCA cycle and decreased NADH oxidation resulting from compensatory downregulation of complex I. We have previously shown that SDHA KO cells display increased extracellular acidification rate and lactate production, indicative of enhanced glycolytic activity to meet cellular ATP demands [ 31 ]. In addition, loss of SDHA was shown to induce metabolic rewiring [ 31 ], including succinate accumulation and increased glutamine anaplerosis of the TCA cycle. To test whether a similar metabolic response occurs in SDHA mutant cells, we performed LC-MS-based metabolic profiling. As observed in SDHA KO cells, the SDH-impaired mutant cells R171H, R451C, and R589W accumulated lactate (Fig. 5 B) and showed depletion of TCA cycle intermediates, except for succinate, which was markedly increased (Fig. 5 C). In accordance with the partially preserved SDH activity in R554W cells, they did not present profound metabolic rearrangements either. The only observed change was a slight decrease in the content of α-ketoglutarate (Fig. 5 C). In addition, the deficiency of ETC triggered a polyunsaturated fatty acid (PUFA) stress response, characterized by the downregulation of cellular desaturases, upregulation of glutathione peroxidase 4 (GPX4), and the accumulation of neutral lipids enriched in PUFAs. Since PUFA-rich membrane phospholipids are particularly susceptible to oxidation, suppression of PUFA synthesis and their sequestration into neutral triacylglycerols represent a protective mechanism that preserves membrane integrity [ 32 ]. Consistent with this, lipidomic profiling revealed accumulation of triacylglycerols (TG) and a reduction in diacylglycerols (DG) in the R171H, R451C, and R589W models, indicating increased neutral lipid storage (Fig. 5 D). Detailed analysis of TG and two major classes of membrane phospholipids – phosphatidylcholines (PC) and phosphatidylethanolamines (PE) – further confirmed the sequestration of PUFAs into TG (Fig. 5 E, S2). Again, this rearrangement was not observed in the R554W model. Notably, LFQ-MS analysis of the ferroptosis-related pathway (KEGG pathway hsa04216) revealed reduced expression of fatty acid desaturases FADS1 and FADS2 and increased abundance of GPX4 and ferritin light chain (FTL) across SDHA KO, all mutant models, and SDHA RES (Fig. 5 F). Together, these findings suggest that loss of SDH function results in a profound reorganization of the TCA cycle, regulation of PUFA formation and their protective storage in TGs, as well as activation of phospholipid hydroperoxide peroxidase. When SDH activity is partially retained, an intermediate adaptive response is observed, which includes a decrease in fatty acid desaturases and activation of the lipid peroxide detoxification enzyme (GPX4). Discussion Pathogenic variants of SDHA, the catalytic subunit of succinate dehydrogenase (SDH), have been linked to a variety of clinical outcomes that include mitochondrial disease and tumor formation [ 17 ]. The mechanisms by which these variants alter SDH structure and function, as well as the basis of their divergent phenotypes, remain unclear. To address this, we examined four patient-derived SDHA mutant models, two associated with mitochondrial disease (R451C, R554W) and two associated with cancer (R171H, R589W). The abundance of SDH subunits was altered in mutant cells, although no clear pattern distinguished mitochondrial disease-associated from cancer-associated variants. Quantitative proteomics and SDS-PAGE consistently demonstrated that the R589W mutant, associated with paraganglioma [ 21 ], exhibited a phenotype resembling the knockout, characterized by decreased levels of all SDH subunits. In contrast, in R171H, which is associated with GIST [ 20 ], only SDHB and SDHC were slightly decreased. The substitution of arginine 589 with tryptophan results from the c.1765 C > T mutation and affects a conserved region of SDHA located near the protein surface, away from the electron transport pathway and distal to the interface with SDHB. This positioning suggests that tryptophan 589 destabilizes SDHA by eliminating polar contacts and by introducing a bulky side chain into the constrained space formed by residues surrounding arginine 589 [ 21 ]. The R451C mutant, which is associated with optic atrophy and cardiomyopathy, exhibited slightly increased levels of SDHA, consistent with observations from a previous study by Kent et al. [ 33 ]. The original report describing R451C[ 19 ] showed that the mutant SDHA protein was stable. Across all mutants, SDHB levels showed a borderline decrease. Since SDHA maturation is considered a prerequisite for SDHB binding [ 5 ], this decrease suggests that SDHA mutations may impair SDHA maturation and consequently SDHA-SDHB heterodimerization, leading to SDH destabilization. Supporting this interpretation, SDHAF2 levels paralleled SDHA abundance, consistent with its role in early SDH assembly and stability [ 5 ]. Beyond SDH itself and consistent with the documented interdependence [ 26 ] of OXPHOS complexes, the reduction of complex I and complex IV subunits reflected the severity of SDH dysfunction. It is well established that individual OXPHOS defects can give rise to combined enzymatic deficiencies. The RC complexes may also exist in higher-order assemblies – supercomplexes – usually formed by interaction between complexes I, III, and IV [ 34 , 35 ]. In line with studies showing that a primary defect in one complex can cause a secondary decrease in others [ 26 , 36 , 37 ], our models R171H, R451C, and R589W also showed decreased levels of complex I and IV subunits, despite the fact that SDH is not part of the supercomplexes. Complex IV subunits were consistently more affected than those of complex I. Although reports describing a selective decrease of complex IV in SDH-deficient cells are limited, cross-complex coupling is well supported [ 36 , 38 ], and complex IV instability has been observed in diverse mitochondrial impairments, including models in which complex IV defects secondarily compromise complex I [ 37 , 39 , 40 ]. These observations support the view that SDH dysfunction influences the broader respiratory chain organization rather than acting independently of it. Since SDH is not physically associated with the respirasome, these secondary effects cannot stem from direct interaction between OXPHOS complexes. Analysis of native OXPHOS complexes provided further insight into how these mutations affect SDH assembly. Fully assembled SDH was not detected in R589W or in the knockout, consistent with the marked decrease of all SDH subunits in these models. In contrast, fully assembled SDH was detected in R171H and R554W, and notably also in R451C, despite the absence of a covalently bound flavin on the SDHA subunit. Previous studies have shown that flavinylation of the catalytic subunit by the assembly factor SDHAF2 (also known as SDH5) is necessary for SDH assembly and stability [ 41 ]. Later work demonstrated that SDHAF2 is dispensable for SDHA flavinylation in MDA-MB-231 cells [ 42 ]. This was subsequently explained by Sharma et al. [ 5 ], who showed that covalent flavinylation of SDHA can occur in the absence of SDHAF2 when dicarboxylate levels are high. Although impaired flavinylation at this residue has been predicted or inferred from non-human models [ 43 , 44 ], to our knowledge, this is the first demonstration in a human cell line that the R451C variant lacks covalently bound FAD, directly linking defective flavinylation to loss of SDH function. Interestingly, FAD-free SDHA can still be assembled into a complete SDH. In addition, all mutants in which SDH assembly was detectable showed accumulation of assembly intermediates, partially compatible with the described cII low . The cII low intermediate consists primarily of SDHA, SDHAF2, and SDHAF4, migrates as a stable 100 kDa band, and has been described in knockdown models of SDHB and SDHC, but not in SDHA knockdown cells [ 27 ]. In addition to cII low , we can also observe free SDHA. The presence of cII low and free SDHA suggests a stalling of the SDH assembly at the level of SDHA maturation in our variant models. Despite the accumulation of SDHA assembly intermediates, assembly can also proceed to form the fully mature SDH. This phenomenon also occurs in the case of flavinylation-negative R451C, suggesting that the formation of a covalent bond with flavin is not a strict prerequisite for the subsequent switch in SDHAF2 SDHAF4 binding partners, at least in the context of this pathogenic variant. Still, the presence of assembled SDH is not sufficient to predict SDH activity, as demonstrated by functional assays. SDH activity was negligible in R171H, R451C, R589W, and the knockout, whereas R554W retained approximately half of WT activity. In R451C and R589W, the loss of activity clearly stems from a lack of covalent flavinylation, which is a prerequisite for the catalytic conversion of succinate to fumarate. In contrast, R171H retained both FAD and assembled SDH, yet exhibited activity levels comparable to those of the non-flavinylated or non-assembled models. This discrepancy suggests that dysfunction in R171H may arise from defects in the electron transfer pathway. A recent study analyzing a large panel of SDHA variants concluded that most cancer-associated mutations are highly destabilizing and display severe SDH dysfunction [ 33 ]. This is consistent with our observations for the cancer-associated variants R171H and R589W, both of which showed severe loss of function regardless of SDHA expression level, assembly state, or flavinylation status. Notably, in R171H, SDHA expression was comparable to WT, yet the function was still severely impaired. The same study also proposed that mitochondrial disease-associated variants retain partial SDH function, whereas cancer-associated variants are fully inactivating, which is not entirely consistent with our findings. In our models, R451C, a mitochondrial disease-associated variant, exhibited a defect as severe as those observed in the cancer-associated models. One possible explanation is that patient-derived cells often retain at least one hypomorphic allele, whereas in our knockout-based system, both alleles are replaced, thereby eliminating residual activity. This interpretation is consistent with the original description of R451C, in which patient fibroblasts (heterozygous for the R451C variant) retained residual SDH activity [ 19 ]. Metabolic profiling revealed adaptive changes that depend on the severity of SDH dysfunction across the mutant models. Despite severe impairment of SDH activity in three out of the four variants, cellular NAD + /NADH ratios were not significantly altered, indicating that redox balance is buffered in cells with missing or deficient SDH. Such buffering has been linked to alterations in mitochondrial electron flux, particularly involving complex I activity in SDH deficiency [ 45 ]. Disrupted flux through the TCA cycle in SDH-deficient cells results in an increase in the NAD + /NADH ratio. Such an increase is counteracted at the cellular level through adaptive mechanisms, particularly the reduction of complex I activity and, consequently, a decrease in the NADH reoxidation rate [ 45 ]. Indeed, we observed reduced content as well as activity of complex I in our models, which may contribute to the maintained NAD + /NADH balance. While downregulation of cI can be directly adaptive, it is unclear how it is regulated. In our models, we observed combined secondary downregulation of cI as well as cIV, which is compatible with the full interdependency phenomenon observed across the panel of OXPHOS complexes deficiencies and not specific for cII models [ 26 ]. Of interest, secondary cIV drop can also be observed in the aforementioned SDHB KO model [ 45 ]. Therefore, both cI and cIV levels may be regulated through the levels of mitochondrial ribosomes and subsequently mitochondrial translation [ 26 ], possibly by sensing redox imbalance at the level of mitochondrial ribosome biogenesis [ 46 ]. In our models, the NAD + /NADH ratio was comparable to WT values, presumably thanks to the reduced complex I levels to keep redox balance in SDH dysfunction. Another aspect of the disrupted TCA cycle in SDH-deficient models is their dependence on pyruvate carboxylation to sustain aspartate biosynthesis and cell growth [ 22 , 47 ]. Further, we and others [ 22 , 47 ] observed increased lactate levels in models with severe SDH loss of function, supporting a shift toward glycolytic ATP production. This metabolic profile closely resembled that of SDHA KO cells, indicating that both cancer-associated variants and the severe mitochondrial disease variant R451C undergo similar rewiring in response to near-complete SDH dysfunction. In contrast, R554W exhibited a milder metabolic phenotype, characterized by partial preservation of oxidative metabolism, which is consistent with its retained SDH activity. Beyond central carbon metabolism, lipidomic analysis revealed a marked accumulation of triacylglycerols (TGs) and depletion of TCA cycle intermediates in models with severe SDH impairment. This lipid remodeling was accompanied by sequestration of polyunsaturated fatty acids (PUFAs) into TGs, a pattern previously described as a protective adaptation in cells with OXPHOS deficiencies [ 31 ]. In contrast, TG accumulation was absent in the R554W model, consistent with the higher residual SDH activity in this model. Sequestration of PUFAs into neutral lipid stores reduces their availability in membrane phospholipids and thereby reduces susceptibility to lipid peroxidation and ferroptotic stress. The close similarity between the SDHA KO and the severe SDHA variants indicates that SDH deficiency is sufficient to trigger this adaptive lipid response. Consistent with activation of this PUFA stress response, expression of the fatty acid desaturases FADS1 and FADS2 was downregulated across the mutant models, while glutathione peroxidase 4 (GPX4) was upregulated. We previously demonstrated [ 31 ] that downregulation of desaturases together with increased GPX4 levels reduces the burden of PUFA-derived lipid peroxides in OXPHOS-deficient cells. Within this framework, R554W exhibited an intermediate phenotype, characterized by GPX4 upregulation and a mild yet significant reduction of FADS1 and FADS2. A more pronounced response in R554W cells regarding GPX4 may also result from ATF4-dependent proteostatic stress, as GPX4 is also under the regulation of ATF4 [ 48 , 49 ]. Conclusions Together, these findings show that SDHA mutations exert diverse effects on SDH assembly and function. While variant R589W primarily destabilizes SDH subunits and prevents assembly, others, including R451C and R171H, allow partial assembly but fail at the level of enzymatic activity, implicating defects in SDHA maturation or disrupted electron transfer. R554W emerges as a variant with relatively preserved assembly and function, consistent with its milder biochemical phenotype. The downregulation of SDHB across models suggests a shared bottleneck in SDHA-SDHB heterodimerization, whereas the broader decreases in complex I and IV highlight the interdependence of OXPHOS complexes. Methods Generation of mutant cell lines Site-Directed mutagenesis Four individual SDHA models simulating patients’ mutations were generated. These variants were selected based on previously reported associations with distinct clinical outcomes. Two are linked to mitochondrial disease and two to cancer (Table 1 ). Mutagenic primers were designed using the QuikChange Primer Design tool (Agilent). The wild-type SDHA sequence (reference sequence: NM_004168) from GenScript was used as a reference to identify target sites for single amino acid substitutions. Table 1 Summary of modelled SDHA variants Mutation Amino acid change Clinical phenotype Reference (PMID) Forward primer Reverse primer c.512G > A p.(Arg171His) Gastrointestinal stromal tumor Pantaleo et al. [ 20 ] ctctgtccaccaaatgcatgctgataaatcttcccat atgggaagatttatcagcatgcatttggtggacagag c.1351C > T p.(Arg451Cys) Optic atrophy and cardiomyopathy Courage et al. [ 19 ] gtttgccccgaggcagttggcaccatgta tacatggtgccaactgcctcggggcaaac c.1660C > T p.(Arg554Trp) Leigh syndrome Bourgeron et al. [ 16 ] tccagaccattccccagtcgaacgtcttcag ctgaagacgttcgactggggaatggtctgga c.1765C > T p.Arg589Trp Paraganglioma Burnichon et al. [ 21 ] cgcgccccatgactccttccgtgc gcacggaaggagtcatggggcgcg Site-directed mutagenesis was performed on a wild-type plasmid (SDHA pcDNA3.1 + , Clone ID: OHu28692, GenScript). The construct lacked any protein tags. Mutations were introduced using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, Catalogue #210518), following the manufacturer’s instructions. Following bacterial transformation, colonies were selected and grown overnight in LB medium supplemented with ampicillin (100 µg/mL). Plasmids were isolated using the NucleoBond Xtra Midi Kit (MACHEREY-NAGEL) and verified by Sanger sequencing to confirm the incorporation of the intended mutations. Sequencing data was analyzed using SnapGene. Transfection and cell culture Mutated and wild-type constructs were recombinantly expressed in a previously established [ 26 ] SDHA knockout (SDHA KO) model in HEK293 cells. Transfections were performed using Metafectene Pro (Biontex Laboratories GmbH). Stably transfected cells were selected with 1 mg/mL G418. Cells were maintained at 37°C and 5% CO 2 atmosphere in DMEM/F-12 medium (Biowest) supplemented with 10% (v/v) FBS, 40 mM HEPES, antibiotics (100 U/mL penicillin + 100 µg/mL streptomycin), and 50 µM uridine and supplemented with G 418 disulfate salt (1 mg/mL). Validation of cellular models Stable clones were screened for expression of mutant SDHA by SDS-PAGE followed by Western blotting as described in the section below. SDS-PAGE Tricine - sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) was used for protein separation under denaturing conditions. Samples were prepared from frozen cellular pellets as described [ 50 ]. Samples containing 25 µg of protein were separated on a 12% gel using a Mini-PROTEAN III Cell apparatus (Bio-Rad). Experiments were performed at least three times to assess the statistical significance of the results. Native electrophoresis Blue-native gel electrophoresis (BN – PAGE) was used for the separation of native protein complexes. Mitochondrial pellets were isolated from freshly harvested cells by hypotonic shock followed by differential centrifugation [ 51 ] and solubilized using 8 grams of digitonin per 1 gram of protein. Samples (30 µg of protein) were separated on a 5–16% polyacrylamide gradient gel using the Mini-Protean III apparatus (Bio-Rad). Western blotting Proteins separated by SDS-PAGE or BN-PAGE were transferred to polyvinylidene difluoride (PVDF) membranes as previously described [ 50 ]. The following primary antibodies were used: SDHA (Abcam 14715), SDHB (Abcam 14714), SDH5 (for SDHAF2, Proteintech 19906-1-AP), citrate synthase (Abcam 129095), NDUFA9 (Abcam 14713), and MTCO1 (Abcam 14705). For quantitative detection: donkey anti-Mouse IgG (H + L) Highly Cross-Adsorbed Secondary Antibody Alexa Fluor 680 and donkey anti-Rabbit IgG (H + L) Highly Cross-Adsorbed Secondary Antibody Alexa Fluor 680 (Thermo Fisher Scientific A10038 and A10043); IRDye 800CW Donkey anti-Mouse IgG and IRDye 800CW Donkey anti-Rabbit IgG (LI-COR Biosciences 926–32212 and 926–32213) were used. Detection was performed using the Odyssey fluorescence scanner (LI-COR Biosciences). The resulting signals were analyzed and quantified using the Image Lab software (Bio-Rad). High-resolution respirometry Oxygen consumption was measured at 37°C using Oxygraph-2K high-resolution respirometer (Oroboros). Oxygen sensors were air-calibrated in MiR05 respiration medium (0.5 mM EGTA, 3 mM MgCl2, 60 mM lactobionic acid, 20 mM taurine, 10 mM KH2PO4, 20 mM HEPES, 110 mM D-sucrose, and 1 g/l of BSA) [ 52 ]. Freshly harvested cells were resuspended in PBS and added to pre-calibrated oxygraph chambers containing 2.14 mL of MiR05. Cells were permeabilized with digitonin (0.05 g/ g protein) to allow access to mitochondrial substrates and inhibitors. To assess cellular respiration, a specific protocol of sequential substrate-uncoupler-inhibitor titrations was applied (Fig. 4 C). Complex I-linked respiration was measured by adding pyruvate (10 mM) and malate (2 mM), followed by ADP (1 mM) and cytochrome c (5 µM). Then, rotenone (0.5 µM) was added to inhibit complex I. Subsequently, SDH-linked respiration was measured by adding succinate (10 mM). ATP synthase activity was inhibited with oligomycin (0.25 µM), and the respiratory chain capacity was measured via stepwise titrations of uncoupler carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP; maximal 0.5 µM). SDH was then inhibited by the addition of malonate (10 mM), followed by antimycin A (0.25 µM) to inhibit complex III. Finally, complex IV was measured by adding artificial substrates ascorbate (2 mM) and TMPD (1 mM) and subsequently inhibited with potassium cyanide (KCN; 0.5 mM), to subtract non-specific oxygen consumption due to substrate autooxidation. Oxygen consumption rates were normalized to total protein content and expressed as picomoles of O 2 consumed per second per milligram of protein (pmol oxygen/s/mg protein). Measurement of enzyme activities Cells were harvested and stored at -80°C in PBS supplemented with protease inhibitor cocktail (PIC) and benzonase. A day before the measurement, cells were subjected to two freeze-thaw cycles; the final thaw was performed on the day of the measurement. Protein concentration was assessed, and samples were diluted to 1 mg/mL. Measurement of SDH (succinate: coenzyme Q oxidoreductase) activity SDH activity was measured by adapting the protocol from[ 29 ]. For each measurement, 190 µL of the reaction mix (composition detailed in Table 2 ) was added to a 96-well plate, followed by the addition of 10 µL of the sample (1 mg/mL). The assay was carried out in the plate reader TECAN infinite M200 (Schoeller). Baseline absorbance at 600 nm was recorded for 2 minutes at 30°C. The reaction was initiated by adding Coenzyme Q1 (40 µM). Afterward, the plate was shaken (5 s), left to settle (5 s), and the absorbance was recorded at 600 nm for 7 minutes. A parallel set of reactions containing malonate (SDH inhibitor) was included as a negative control. All samples were run in technical triplicates to ensure consistency. Table 2 Reaction mix (200µl per well): Reagent Final concentration Potassium Phosphate Buffer (pH 7.5) 25 mM Bovine Serum Albumin (BSA) 1 mg/mL Potassium cyanide (KCN) 300 µM Succinate 20 mM 2,6-Dichlorophenolindophenol (DCPIP) 43 µM H 2 0 To fill 200 µL (+/-) Malonate 10 mM Measurement of citrate synthase activity Citrate synthase was used for normalization of the SDH activity assay, following the previously described method in [ 29 ]. Briefly, 190 µL of reaction mix (composition detailed in Table 3 ) was added to a 96-well plate, followed by 10 µL of sample (1 mg/mL). In the plate reader, the plate was shaken for 5 seconds, and baseline absorbance at 412 nm was recorded for 3 minutes. The reaction was initiated by adding 10 µL of oxaloacetate, followed by shaking (5 s), left to settle (5 s), and the absorbance was recorded at 412 nm every 30 seconds for 10 minutes. All samples were run in technical triplicates to ensure consistency. Table 3 Reaction mix (200µl per well): Reagent Final concentration Tris-HCl pH 8 + 0.2% Triton X-100 100 mM 5,5′-Dithiobis(2-nitrobenzoic acid) – DTNB in Tris-HCl pH 8.0 100 µM Acetyl - CoA 300 µM H2O To fill 200 µl per well Detection of covalently bound flavin Covalently bound flavin was measured as previously described [ 53 ]. Briefly, proteins were separated by SDS-PAGE. After electrophoresis, the gel was rinsed with distilled water and then incubated for 20 minutes in 10% acetic acid. The autofluorescence of FAD bound to SDHA was detected using an Amersham Typhoon 5 imaging system (Cytiva), with the Cy2 channel (excitation: 488 nm, emission band-pass filter 525/20 nm). To ensure that the lack of flavinylation observed was not due to a low protein amount, 50 µg of protein was loaded per slot. NAD + /NADH To determine the NAD + /NADH ratio, we used the NAD + /NADH-Glo™ Assay (Promega) according to the manufacturer’s instructions. Experiments were independently replicated a minimum of three times to confirm consistency across biological samples. Metabolomic and lipidomic analysis Sample preparation and extraction HEK-derived cells were seeded in triplicate on 6-well plates and cultured in growth media (see above) for 24 hours. Cells were seeded according to their growth rate: SDHA KO (600,000 cells/well); R171H, R451C and R589W (550,000 cells/well); WT, SDHA RES and R554W (450,000 cells/well). For profiling, the cells were rinsed twice in ice-cold PBS, the medium was aspirated, and the cells were immediately frozen at -80°C. Cells were processed using the LIMeX workflow, and polar metabolites were extracted with a biphasic solvent system composed of cold methanol, methyl tert-butyl ether, and 10% methanol, followed by liquid chromatography-mass spectrometry (LC–MS) analysis [ 54 ]. Specifically, an aliquot of the upper organic phase was evaporated, resuspended in methanol with the internal standard [12-[(cyclohexylamino) carbonyl]amino]-dodecanoic acid (CUDA), and analysed using lipidomics platforms in positive and negative ion modes. Another aliquot of the upper organic phase was hydrolysed using potassium hydroxide in methanol. The solution was neutralised with hydrochloric acid, and the fatty acids were isolated using hexane. After evaporation, the dry extracts were resuspended in methanol with CUDA and analysed using the lipidomics platform in negative ion mode. Next, one aliquot from the bottom aqueous phase was evaporated and resuspended in an acetonitrile/water (4:1, v/v) mixture containing CUDA and Val-Tyr-Val as internal standards. This sample was analysed using the hydrophilic interaction chromatography (HILIC) metabolomics platform in positive electrospray ionisation mode. Another aliquot of the bottom phase was mixed with an acetonitrile/isopropanol (1:1, v/v) mixture, evaporated, then resuspended in 5% methanol with 0.2% formic acid, again including CUDA and Val-Tyr-Val as internal standards. This sample was analysed using the reversed-phase liquid chromatography (RPLC) platform in negative electrospray ionisation mode. LC – MS analysis and data processing Six different LC-MS platforms (LIMeX-6D) in positive and negative ionisation modes were used [ 55 ]. The LC–MS analysis was conducted using a Vanquish UHPLC system (Thermo Fisher Scientific) coupled to an Orbitrap Exploris 480 mass spectrometer (Thermo Fisher Scientific). Detailed chromatographic and detection parameters are provided in [ 56 ]. The data from metabolite and lipid profiling were analysed in Metaboanalyst 5.0 as described in [ 57 ]. Label-free quantification mass spectrometry analysis Label-free quantification mass spectrometry analysis (LFQ-MS) of cell pellets was performed in triplicate by the Proteomics Service Laboratory at the Institute of Physiology and the Institute of Molecular Genetics of the Czech Academy of Sciences, following the SP4 no glass bead protocol [ 58 ]. Briefly, cellular pellets (100 µg of protein) were solubilized in 1% SDS prepared in 100 mM triethylammonium bicarbonate (TEAB) buffer, reduced with 10 mM tris(2-carboxyethyl)phosphine (TCEP), and alkylated with 40 mM chloroacetamide (performed together at 95°C for 10 min). Proteins were digested overnight at 37°C with MS-grade trypsin (Trypsin Gold, MS Grade, Promega, Cat# V5280) at a 1:40 enzyme-to-protein ratio. The resulting peptides were desalted using C18 StageTips, dried in a SpeedVac, and reconstituted in 0.1% trifluoroacetic acid with 2% acetonitrile. Approximately 500 ng of peptide digest per sample was separated on a Aurora Ultimate TS 25 cm x 75 µm C18 column (IonOpticks; Cat# AUR3-25075C18-TS) using a 90 min elution gradient on nanoUHPLC (Dionex Ultimate 3000, flow rate 300 nL/min) and analyzed in data-independent acquisition (DIA) mode on an Orbitrap Exploris 480 mass spectrometer equipped with a FAIMS unit set to CV -45 V. DIA MS Thermo raw files were processed in Spectronaut (v. 20.3, Biognosys) using direct DIA mode and human proteome UP000005640_9606.fasta (UniProt release 2025_01) and default setting with Precursor and Protein Q-value and PEP cutoff set at 0.01. Protein group quantities (PG.Quantity, MS2 level) from Spectronaut's protein report were analyzed in Perseus software (version 2.1.5.0) after log2 transformation, filtering for 67% of valid values, and imputation (from normal distribution, width 0.3, downshift 1.8). Perseus data were visualized in GraphPad Prism. Data analysis, visualisation, and statistics Quantitative data were processed and plotted using GraphPad Prism 10.4. Statistical tests were selected according to the structure of each dataset. Comparisons against a defined reference value were assessed with a one-sample t-test, whereas differences between experimental groups were evaluated using either unpaired t-tests or one-way ANOVA. Two-way ANOVA was applied when two experimental factors were examined simultaneously. Significance thresholds and post hoc tests are reported in the respective figure legends. Graphs display mean values with standard deviation unless stated otherwise. Structural illustrations were generated with ChimeraX [ 59 , 60 ]. Abbreviations BN-PAGE Blue-native polyacrylamide gel electrophoresis BSA Bovine serum albumin cI Complex I cII low Complex II low molecular weight assembly intermediates cIV Complex IV CL Cardiolipin CS Citrate synthase DG Diacylglycerol DMEM/F-12 Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 FAD Flavin adenine dinucleotide FADS1/2 Fatty acid desaturase 1/2 FBS Fetal bovine serum FTL Ferritin light chain GIST Gastrointestinal stromal tumor GPX4 Glutathione peroxidase 4 HEK293 Human embryonic kidney 293 cell line HexCer Hexosylceramide HIF-1α Hypoxia-inducible factor 1-alpha KCN Potassium cyanide KO Knockout LC–MS Liquid chromatography–mass spectrometry LFQ-MS Label-free quantitative mass spectrometry LS Leigh syndrome NAD + /NADH Nicotinamide adenine dinucleotide (oxidized/reduced forms) NDAXOA Neurodegeneration with ataxia and late-onset optic atrophy OXPHOS Oxidative phosphorylation PC Phosphatidylcholine PE Phosphatidylethanolamine PI Phosphatidylinositol PM Pyruvate and malate PS Phosphatidylserine PUFA Polyunsaturated fatty acid RES Rescue ROS Reactive oxygen species SDH Succinate dehydrogenase SDHA Succinate dehydrogenase complex subunit A SDHAF1–4 Succinate dehydrogenase assembly factors 1–4 SDHB Succinate dehydrogenase complex subunit B SDHC Succinate dehydrogenase complex subunit C SDHD Succinate dehydrogenase complex subunit D SDS-PAGE Sodium dodecyl sulfate–polyacrylamide gel electrophoresis SM Sphingomyelin SQR Succinate:coenzyme Q oxidoreductase TCA Tricarboxylic acid cycle TG Triacylglycerol WB Western blot WT Wild-type Declarations Competing interests The authors declare that they have no conflict of interest. Funding This work was supported by the Czech Science Foundation (GACR 21-18993S), Czech Health Research Council (NU22-01-00499), the National Institute for Research of Metabolic and Cardiovascular Diseases (Programme EXCELES, ID Project No. LX22NPO5104) – Funded by the European Union-Next Generation EU (JH and TM) and the Grant Agency of Charles University (GA UK 283423/2023, MJS). The authors would like to acknowledge the Laboratory of Metabolomics at the Institute of Physiology of the Czech Academy of Sciences and the Proteomics Service Laboratory at the Institute of Physiology (supported by RVO, ID 67985823) and the Institute of Molecular Genetics (supported by RVO, ID 68378050) of the Czech Academy of Sciences. Author Contribution Conceptualization, M.J.S., T.M. and A.P.; Methodology, P.P., M.V., T.C., T.M. and A.P.; Investigation, M.J.S., P.P., K.T., K.Č.; Writing – Original draft, M.J.S. and A.P.; Writing – Review & Editing, M.J.S., P.P., K.Č., T.M. and A.P.; Visualization, M.J.S., and A.P.; Supervision, J.H., T.M. and A.P.; Project Administration, T.M. and A.P.; Funding acquisition, M.J.S., P.P., T.M. and A.P. Data Availability All data described, analysed, and represented in the figures present in this study are available from the corresponding authors upon reasonable request. The mass spectrometry proteomics data have been deposited in the ProteomeXchange Consortium via the PRIDE [61] partner repository with the dataset identifier PXD072792. Reviewer access details to log in to the PRIDE website are: Project accession: PXD072792, Token: LyUnvKoWmjkq References Cecchini G: Function and structure of complex II of the respiratory chain. Annu Rev Biochem 2003, 72:77–109. Chance B, Williams GR: A Method for the Localization of Sites for Oxidative Phosphorylation. Nature 1955, 176(4475):250–254. Bezawork-Geleta A, Rohlena J, Dong L, Pacak K, Neuzil J: Mitochondrial Complex II: At the Crossroads. Trends in Biochemical Sciences 2017, 42(4):312–325. Mitchell P: Coupling of Phosphorylation to Electron and Hydrogen Transfer by a Chemi-Osmotic type of Mechanism. Nature 1961, 191(4784):144–148. Sharma P, Maklashina E, Cecchini G, Iverson TM: The roles of SDHAF2 and dicarboxylate in covalent flavinylation of SDHA, the human complex II flavoprotein. Proceedings of the National Academy of Sciences 2020, 117(38):23548–23556. Sharma P, Maklashina E, Cecchini G, Iverson TM: Maturation of the respiratory complex II flavoprotein. Curr Opin Struct Biol 2019, 59:38–46. Sharma P, Maklashina E, Voehler M, Balintova S, Dvorakova S, Kraus M, Hadrava Vanova K, Nahacka Z, Zobalova R, Boukalova S et al : Disordered-to-ordered transitions in assembly factors allow the complex II catalytic subunit to switch binding partners. Nat Commun 2024, 15(1):473. Rustin P, Bourgeron T, Parfait B, Chretien D, Munnich A, Rötig A: Inborn errors of the Krebs cycle: a group of unusual mitochondrial diseases in human. Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease 1997, 1361(2):185–197. Hoekstra AS, Bayley J-P: The role of complex II in disease. Biochimica et Biophysica Acta (BBA) - Bioenergetics 2013, 1827(5):543–551. Van Vranken JG, Na U, Winge DR, Rutter J: Protein-mediated assembly of succinate dehydrogenase and its cofactors. Crit Rev Biochem Mol Biol 2015, 50(2):168–180. Renkema GH, Wortmann SB, Smeets RJ, Venselaar H, Antoine M, Visser G, Ben-Omran T, van den Heuvel LP, Timmers HJ, Smeitink JA et al : SDHA mutations causing a multisystem mitochondrial disease: novel mutations and genetic overlap with hereditary tumors. Eur J Hum Genet 2015, 23(2):202–209. Niemann S, Müller U: Mutations in SDHC cause autosomal dominant paraganglioma, type 3. Nat Genet 2000, 26(3):268–270. Astuti D, Latif F, Dallol A, Dahia PLM, Douglas F, George E, Sköldberg F, Husebye ES, Eng C, Maher ER: Gene Mutations in the Succinate Dehydrogenase Subunit SDHB Cause Susceptibility to Familial Pheochromocytoma and to Familial Paraganglioma. The American Journal of Human Genetics 2001, 69(1):49–54. King A, Selak MA, Gottlieb E: Succinate dehydrogenase and fumarate hydratase: linking mitochondrial dysfunction and cancer. Oncogene 2006, 25(34):4675–4682. Aspuria P-JP, Lunt SY, Väremo L, Vergnes L, Gozo M, Beach JA, Salumbides B, Reue K, Wiedemeyer WR, Nielsen J et al : Succinate dehydrogenase inhibition leads to epithelial-mesenchymal transition and reprogrammed carbon metabolism. Cancer & Metabolism 2014, 2(1):21. Bourgeron T, Rustin P, Chretien D, Birch-Machin M, Bourgeois M, Viegas-Péquignot E, Munnich A, Rötig A: Mutation of a nuclear succinate dehydrogenase gene results in mitochondrial respiratory chain deficiency. Nature Genetics 1995, 11(2):144–149. Rustin P, Rötig A: Inborn errors of complex II – Unusual human mitochondrial diseases. Biochimica et Biophysica Acta (BBA) - Bioenergetics 2002, 1553(1):117–122. Birch-Machin MA, Taylor RW, Cochran B, Ackrell BA, Turnbull DM: Late-onset optic atrophy, ataxia, and myopathy associated with a mutation of a complex II gene. Ann Neurol 2000, 48(3):330–335. Courage C, Jackson CB, Hahn D, Euro L, Nuoffer J-M, Gallati S, Schaller A: SDHA mutation with dominant transmission results in complex II deficiency with ocular, cardiac, and neurologic involvement. American Journal of Medical Genetics Part A 2017, 173(1):225–230. Pantaleo MA, Urbini M, Schipani A, Nannini M, Indio V, De Leo A, Vincenzi B, Brunello A, Grignani G, Casagrande M et al : SDHA Germline Variants in Adult Patients With SDHA-Mutant Gastrointestinal Stromal Tumor. Front Oncol 2021, 11:778461. Burnichon N, Brière JJ, Libé R, Vescovo L, Rivière J, Tissier F, Jouanno E, Jeunemaitre X, Bénit P, Tzagoloff A et al : SDHA is a tumor suppressor gene causing paraganglioma. Hum Mol Genet 2010, 19(15):3011–3020. Lussey-Lepoutre C, Hollinshead KER, Ludwig C, Menara M, Morin A, Castro-Vega L-J, Parker SJ, Janin M, Martinelli C, Ottolenghi C et al : Loss of succinate dehydrogenase activity results in dependency on pyruvate carboxylation for cellular anabolism. Nature Communications 2015, 6(1):8784. Guzy RD, Sharma B, Bell E, Chandel NS, Schumacker PT: Loss of the SdhB, but Not the SdhA, subunit of complex II triggers reactive oxygen species-dependent hypoxia-inducible factor activation and tumorigenesis. Mol Cell Biol 2008, 28(2):718–731. Selak MA, Armour SM, MacKenzie ED, Boulahbel H, Watson DG, Mansfield KD, Pan Y, Simon MC, Thompson CB, Gottlieb E: Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase. Cancer Cell 2005, 7(1):77–85. Vamecq J, Masso V, Bancel L-P, Jannin A, Dessein A-F, Cardot-Bauters C, Pigny P: Serum fatty acid profiling in patients with SDHx mutations: New advances on cellular metabolism in SDH deficiency. Biochimie 2022, 201:196–203. Čunátová K, Vrbacký M, Puertas-Frias G, Alán L, Vanišová M, Saucedo-Rodríguez MJ, Houštěk J, Fernández-Vizarra E, Neužil J, Pecinová A et al : Mitochondrial translation is the primary determinant of secondary mitochondrial complex I deficiencies. iScience 2024, 27(8). Bezawork-Geleta A, Wen H, Dong L, Yan B, Vider J, Boukalova S, Krobova L, Vanova K, Zobalova R, Sobol M et al : Alternative assembly of respiratory complex II connects energy stress to metabolic checkpoints. Nat Commun 2018, 9(1):2221. Iverson TM, Singh PK, Cecchini G: An evolving view of complex II-noncanonical complexes, megacomplexes, respiration, signaling, and beyond. J Biol Chem 2023, 299(6):104761. Brischigliaro M, Frigo E, Fernandez-Vizarra E, Bernardi P, Viscomi C: Measurement of mitochondrial respiratory chain enzymatic activities in Drosophila melanogaster samples. STAR Protoc 2022, 3(2):101322. Maklashina E, Iverson TM, Cecchini G: How an assembly factor enhances covalent FAD attachment to the flavoprotein subunit of complex II. J Biol Chem 2022, 298(10):102472. Puertas-Frias G, José-Saucedo-Rodríguez M, Čunátová K, Alán L, Hrbáč P, Knězů M, Koníčková S, Schimmer J, Krakovková M, Vrbacký M et al : Sequestration of the polyunsaturated fatty acids protects the cells with oxidative phosphorylation deficiency from ferroptosis. bioRxiv 2025:2025.2010.2014.682423. Liang D, Minikes AM, Jiang X: Ferroptosis at the intersection of lipid metabolism and cellular signaling. Mol Cell 2022, 82(12):2215–2227. Kent JD, Klug LR, Heinrich MC: A Novel Human SDHA-Knockout Cell Line Model for the Functional Analysis of Clinically Relevant SDHA Variants. Clin Cancer Res 2024, 30(23):5399–5412. Milenkovic D, Blaza JN, Larsson NG, Hirst J: The Enigma of the Respiratory Chain Supercomplex. Cell Metab 2017, 25(4):765–776. Schagger H, Pfeiffer K: Supercomplexes in the respiratory chains of yeast and mammalian mitochondria. EMBO J 2000, 19(8):1777–1783. Acín-Pérez R, Bayona-Bafaluy MP, Fernández-Silva P, Moreno-Loshuertos R, Pérez-Martos A, Bruno C, Moraes CT, Enríquez JA: Respiratory complex III is required to maintain complex I in mammalian mitochondria. Mol Cell 2004, 13(6):805–815. Diaz F, Fukui H, Garcia S, Moraes CT: Cytochrome c oxidase is required for the assembly/stability of respiratory complex I in mouse fibroblasts. Mol Cell Biol 2006, 26(13):4872–4881. Vercellino I, Sazanov LA: The assembly, regulation and function of the mitochondrial respiratory chain. Nat Rev Mol Cell Biol 2022, 23(2):141–161. Protasoni M, Pérez-Pérez R, Lobo-Jarne T, Harbour ME, Ding S, Peñas A, Diaz F, Moraes CT, Fearnley IM, Zeviani M et al : Respiratory supercomplexes act as a platform for complex III-mediated maturation of human mitochondrial complexes I and IV. Embo j 2020, 39(3):e102817. Čunátová K, Reguera DP, Vrbacký M, Fernández-Vizarra E, Ding S, Fearnley IM, Zeviani M, Houštěk J, Mráček T, Pecina P: Loss of COX4I1 Leads to Combined Respiratory Chain Deficiency and Impaired Mitochondrial Protein Synthesis. Cells 2021, 10(2). Hao HX, Khalimonchuk O, Schraders M, Dephoure N, Bayley JP, Kunst H, Devilee P, Cremers CW, Schiffman JD, Bentz BG et al : SDH5, a gene required for flavination of succinate dehydrogenase, is mutated in paraganglioma. Science 2009, 325(5944):1139–1142. Bezawork-Geleta A, Dong L, Rohlena J, Neuzil J: The Assembly Factor SDHAF2 Is Dispensable for Flavination of the Catalytic Subunit of Mitochondrial Complex II in Breast Cancer Cells. J Biol Chem 2016, 291(41):21414–21420. Iverson TM, Maklashina E, Cecchini G: Structural basis for malfunction in complex II. J Biol Chem 2012, 287(42):35430–35438. Bannon AE, Kent J, Forquer I, Town A, Klug LR, McCann K, Beadling C, Harismendy O, Sicklick JK, Corless C et al : Biochemical, Molecular, and Clinical Characterization of Succinate Dehydrogenase Subunit A Variants of Unknown Significance. Clin Cancer Res 2017, 23(21):6733–6743. Hart ML, Quon E, Vigil ABG, Engstrom IA, Newsom OJ, Davidsen K, Hoellerbauer P, Carlisle SM, Sullivan LB: Mitochondrial redox adaptations enable alternative aspartate synthesis in SDH-deficient cells. Elife 2023, 12. Ast T, Itoh Y, Sadre S, McCoy JG, Namkoong G, Wengrod JC, Chicherin I, Joshi PR, Kamenski P, Suess DLM et al : METTL17 is an Fe-S cluster checkpoint for mitochondrial translation. Mol Cell 2024, 84(2):359–374 e358. Cardaci S, Zheng L, MacKay G, van den Broek NJ, MacKenzie ED, Nixon C, Stevenson D, Tumanov S, Bulusu V, Kamphorst JJ et al : Pyruvate carboxylation enables growth of SDH-deficient cells by supporting aspartate biosynthesis. Nat Cell Biol 2015, 17(10):1317–1326. Han J, Back SH, Hur J, Lin YH, Gildersleeve R, Shan J, Yuan CL, Krokowski D, Wang S, Hatzoglou M et al : ER-stress-induced transcriptional regulation increases protein synthesis leading to cell death. Nat Cell Biol 2013, 15(5):481–490. Mick E, Titov DV, Skinner OS, Sharma R, Jourdain AA, Mootha VK: Distinct mitochondrial defects trigger the integrated stress response depending on the metabolic state of the cell. Elife 2020, 9. Pajuelo Reguera D, Čunátová K, Vrbacký M, Pecinová A, Houštěk J, Mráček T, Pecina P: Cytochrome c Oxidase Subunit 4 Isoform Exchange Results in Modulation of Oxygen Affinity. In: Cells. vol. 9; 2020. Wittig I, Braun HP, Schägger H: Blue native PAGE. Nat Protoc 2006, 1(1):418–428. Gnaiger E, Kuznetsov A, Schneeberger S, Seiler R, Brandacher G, Steurer W, Margreiter R: Life in the Cold. In: Eleventh International Hibernation Symposium: 2000 . Springer Nature: 431–442. Bafunno V, Giancaspero TA, Brizio C, Bufano D, Passarella S, Boles E, Barile M: Riboflavin uptake and FAD synthesis in Saccharomyces cerevisiae mitochondria: involvement of the Flx1p carrier in FAD export. J Biol Chem 2004, 279(1):95–102. Cajka T, Hricko J, Rudl Kulhava L, Paucova M, Novakova M, Kuda O: Optimization of Mobile Phase Modifiers for Fast LC-MS-Based Untargeted Metabolomics and Lipidomics. Int J Mol Sci 2023, 24(3). Lopes M, Brejchova K, Riecan M, Novakova M, Rossmeisl M, Cajka T, Kuda O: Metabolomics atlas of oral 13C-glucose tolerance test in mice. Cell Rep 2021, 37(2):109833. Brejchova K, Rahm M, Benova A, Domanska V, Reyes-Gutierez P, Dzubanova M, Trubacova R, Vondrackova M, Cajka T, Tencerova M et al : Uncovering mechanisms of thiazolidinediones on osteogenesis and adipogenesis using spatial fluxomics. Metabolism 2025, 166:156157. Pecina P, Cunatova K, Kaplanova V, Puertas-Frias G, Silhavy J, Tauchmannova K, Vrbacky M, Cajka T, Gahura O, Hlavackova M et al : Haplotype variability in mitochondrial rRNA predisposes to metabolic syndrome. Commun Biol 2024, 7(1):1116. Johnston HE, Yadav K, Kirkpatrick JM, Biggs GS, Oxley D, Kramer HB, Samant RS: Solvent Precipitation SP3 (SP4) Enhances Recovery for Proteomics Sample Preparation without Magnetic Beads. Anal Chem 2022, 94(29):10320–10328. Meng EC, Goddard TD, Pettersen EF, Couch GS, Pearson ZJ, Morris JH, Ferrin TE: UCSF ChimeraX: Tools for structure building and analysis. Protein Sci 2023, 32(11):e4792. Pettersen EF, Goddard TD, Huang CC, Meng EC, Couch GS, Croll TI, Morris JH, Ferrin TE: UCSF ChimeraX: Structure visualization for researchers, educators, and developers. Protein Sci 2021, 30(1):70–82. Perez-Riverol Y, Bandla C, Kundu DJ, Kamatchinathan S, Bai J, Hewapathirana S, John NS, Prakash A, Walzer M, Wang S et al : The PRIDE database at 20 years: 2025 update. Nucleic Acids Res 2025, 53(D1):D543-D553. Du Z, Zhou X, Lai Y, Xu J, Zhang Y, Zhou S, Feng Z, Yu L, Tang Y, Wang W et al : Structure of the human respiratory complex II. Proceedings of the National Academy of Sciences 2023, 120(18):e2216713120. Additional Declarations No competing interests reported. Supplementary Files SDHAmutantssupplementaryBMC.docx Cite Share Download PDF Status: Under Review Version 1 posted Reviewers agreed at journal 02 May, 2026 Reviews received at journal 20 Apr, 2026 Reviewers agreed at journal 23 Mar, 2026 Reviewers agreed at journal 08 Feb, 2026 Reviewers invited by journal 15 Jan, 2026 Editor assigned by journal 13 Jan, 2026 Submission checks completed at journal 12 Jan, 2026 First submitted to journal 10 Jan, 2026 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8568560","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":575136688,"identity":"9096923f-66d2-4bc4-a3dc-0e488debf116","order_by":0,"name":"María José Saucedo-Rodríguez","email":"","orcid":"","institution":"Institute of Physiology, Czech Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"María","middleName":"José","lastName":"Saucedo-Rodríguez","suffix":""},{"id":575136689,"identity":"f5706d7b-46a1-434b-9544-2c5c1e529e05","order_by":1,"name":"Petr Pecina","email":"","orcid":"","institution":"Institute of Physiology, Czech Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Petr","middleName":"","lastName":"Pecina","suffix":""},{"id":575136690,"identity":"1a100aeb-cd8e-43b1-8c81-e8b9f426719d","order_by":2,"name":"Kateřina Tauchmannová","email":"","orcid":"","institution":"Institute of Physiology, Czech Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Kateřina","middleName":"","lastName":"Tauchmannová","suffix":""},{"id":575136691,"identity":"aa0f6787-c9e2-4c3b-80e6-8d4841809892","order_by":3,"name":"Kristýna Čunátová","email":"","orcid":"","institution":"Institute of Physiology, Czech Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Kristýna","middleName":"","lastName":"Čunátová","suffix":""},{"id":575136692,"identity":"43411f9d-b110-4bd6-bcc7-acc6d72ab20a","order_by":4,"name":"Marek Vrbacký","email":"","orcid":"","institution":"Institute of Physiology, Czech Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Marek","middleName":"","lastName":"Vrbacký","suffix":""},{"id":575136693,"identity":"d1d0bbc4-ef33-4225-ad8d-7413865a808c","order_by":5,"name":"Tomáš Čajka","email":"","orcid":"","institution":"Institute of Physiology, Czech Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Tomáš","middleName":"","lastName":"Čajka","suffix":""},{"id":575136694,"identity":"e60ac287-632b-4eb6-be1d-4650d15ff651","order_by":6,"name":"Josef Houštěk","email":"","orcid":"","institution":"Institute of Physiology, Czech Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Josef","middleName":"","lastName":"Houštěk","suffix":""},{"id":575136695,"identity":"dc5102ab-aefb-4871-bcd8-bcae849cbfe1","order_by":7,"name":"Tomáš Mráček","email":"","orcid":"","institution":"Institute of Physiology, Czech Academy of Sciences","correspondingAuthor":false,"prefix":"","firstName":"Tomáš","middleName":"","lastName":"Mráček","suffix":""},{"id":575136699,"identity":"cd7307fb-91dc-4e81-9707-5195af3a847e","order_by":8,"name":"Alena Pecinová","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDklEQVRIiWNgGAWjYDACdhiDGUza8BPWwozKSJNsIF4LBBwmrIW/mfnYgx8Md+T423kPPuapOS8hH5HA+OHHHwZ5eRyaJQ6zpRv2MDwzljjMl2zMc+y2hOGNBGbJ3jYGw0Zc9h3mMZPgYTicuIGZx0xyBtvtOsMZCWwMvA0MCcw4dMgf5v8m+YfhcD1Ey79zEiAtjH/+MAA1YgcGh3nYpIG2JBgAtUh8bDsgIS+RwMbMw8aQwINDi+FhNjNpGYNnhjMO8xgbfOxLljDgedgsLdsGtA2HFrnjzc8k31TckefvP2P4IOGbnYR8e/LBj2/+2OAMMajzDiCzGUFqJfCpBwEkLfgNHwWjYBSMgpEIAM71TmYgRXQ8AAAAAElFTkSuQmCC","orcid":"","institution":"Institute of Physiology, Czech Academy of Sciences","correspondingAuthor":true,"prefix":"","firstName":"Alena","middleName":"","lastName":"Pecinová","suffix":""}],"badges":[],"createdAt":"2026-01-10 13:38:18","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8568560/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8568560/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":100748113,"identity":"d24637db-681b-4db2-8dd7-b6c6d9fd4ee4","added_by":"auto","created_at":"2026-01-21 04:00:44","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":2733151,"visible":true,"origin":"","legend":"","description":"","filename":"SDHAmutantsmanuscriptBMC.docx","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/f23690ed2ec94aa26761b452.docx"},{"id":100748095,"identity":"395eb26e-dea5-4979-b55f-a74d0ef9bbaf","added_by":"auto","created_at":"2026-01-21 04:00:39","extension":"json","order_by":1,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":9987,"visible":true,"origin":"","legend":"","description":"","filename":"5d8afa43e60d41a696bb7aa0434aef73.json","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/7a8f1dba68d4b04f5bd8b257.json"},{"id":100748183,"identity":"788e432e-97cd-487c-8dec-f70a3cbf1f79","added_by":"auto","created_at":"2026-01-21 04:01:05","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1213660,"visible":true,"origin":"","legend":"","description":"","filename":"SDHAmutantssupplementaryBMC.docx","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/3362b64be52bcd498fc5884e.docx"},{"id":100748071,"identity":"ed3b262b-6978-4d8e-bff4-6ee4fb03b25a","added_by":"auto","created_at":"2026-01-21 04:00:34","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":190445,"visible":true,"origin":"","legend":"","description":"","filename":"5d8afa43e60d41a696bb7aa0434aef731enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/40b97ebeb2233896a383e340.xml"},{"id":100748074,"identity":"64545d20-6322-46cf-9777-b61055e1edda","added_by":"auto","created_at":"2026-01-21 04:00:35","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":842754,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage1.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/88c2af41e8433e0989abbf73.jpeg"},{"id":100748160,"identity":"eb714af4-bc0a-453e-9458-272f614af791","added_by":"auto","created_at":"2026-01-21 04:00:59","extension":"jpeg","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":521510,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage2.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/aa4dfc4286f68d0087b88b37.jpeg"},{"id":100748105,"identity":"af7e9dc7-44f2-413b-9bba-905016f439aa","added_by":"auto","created_at":"2026-01-21 04:00:41","extension":"jpeg","order_by":6,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":467210,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage3.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/6828dccc954d73b227d1997a.jpeg"},{"id":100748189,"identity":"8ce6fdcc-01b1-4dec-a686-4f9d337867ee","added_by":"auto","created_at":"2026-01-21 04:01:07","extension":"jpeg","order_by":7,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":453108,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage4.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/7e7625592a9a3a1691491685.jpeg"},{"id":100748141,"identity":"ea7a8ea3-cdf8-46e9-a659-813c15873a2e","added_by":"auto","created_at":"2026-01-21 04:00:52","extension":"jpeg","order_by":8,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":796580,"visible":true,"origin":"","legend":"","description":"","filename":"floatimage5.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/d52f61604814a2dbbf456820.jpeg"},{"id":100748181,"identity":"76330dcb-b85f-4f79-9f93-7b089a3a599f","added_by":"auto","created_at":"2026-01-21 04:01:04","extension":"png","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":115305,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/61f400e87dde19deacdfdb16.png"},{"id":100748096,"identity":"64b76cd6-29b4-4f2a-b27b-c4d2d6d0d52e","added_by":"auto","created_at":"2026-01-21 04:00:39","extension":"png","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":87812,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/f91fa8289a6a8bb38c1ee09e.png"},{"id":100748142,"identity":"e33cf15c-c052-4002-aa56-093525a96fe6","added_by":"auto","created_at":"2026-01-21 04:00:52","extension":"png","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":45372,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/a1a6c85a24193404860ea4f0.png"},{"id":100748212,"identity":"d0938836-fb8e-420c-a989-07125acc1df9","added_by":"auto","created_at":"2026-01-21 04:01:20","extension":"png","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":56942,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/d57904e498133e0d8a37fc3b.png"},{"id":100748150,"identity":"fdb4a247-bda7-41ea-9edb-c14abf281ebe","added_by":"auto","created_at":"2026-01-21 04:00:56","extension":"png","order_by":13,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":76268,"visible":true,"origin":"","legend":"","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/250b8d3cec6eaa2f08f7eb2c.png"},{"id":100748101,"identity":"e6b7e181-144a-4c01-a50c-feefde908508","added_by":"auto","created_at":"2026-01-21 04:00:40","extension":"xml","order_by":14,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":189351,"visible":true,"origin":"","legend":"","description":"","filename":"5d8afa43e60d41a696bb7aa0434aef731structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/42922777a363706690c8c16a.xml"},{"id":100748136,"identity":"27429cbf-4640-4254-aa1f-f4ec0c6ab04f","added_by":"auto","created_at":"2026-01-21 04:00:49","extension":"html","order_by":15,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":203581,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/08a44b1009c66eeccaddbc2c.html"},{"id":100748127,"identity":"1476d3e5-25a5-41a4-81d5-fc9a99e6ffb5","added_by":"auto","created_at":"2026-01-21 04:00:46","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":473023,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSpatial distribution of SDHA residues affected by patient-derived variants.\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe structure shown corresponds to the human succinate dehydrogenase cryo EM structure (PDB 8GS8) [62]. The SDHA subunit is represented by a gray ribbon, SDHB by a purple ribbon, SDHC by a blue ribbon, and SDHD by a pink ribbon. Cofactors are shown in cyan, including the FAD cofactor bound to SDHA. The zoomed view focuses on the SDHA subunit and highlights WT amino acid residues that are mutated in patients. These residues are shown in red and labeled (R171, R451, R554, R589) to illustrate their positions within the SDHA fold. The figure serves as a structural reference and does not depict modeled mutant conformations. The images were created using UCSF ChimeraX.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/c48bcf406e8d7626dd1a4c52.png"},{"id":100748076,"identity":"01f25c30-278a-4002-9e43-f4a6b91e705c","added_by":"auto","created_at":"2026-01-21 04:00:35","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":771878,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSDHA pathogenic variants differentially alter SDH complex abundance and mitochondrial protein profiles\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Volcano plots summarizing LFQ-MS results from SDHA KO, SDHA RES, and SDHA mutant cell lines (R171H, R451C, R554W, R589W) shown as log₂ difference relative to WT versus −log₁₀ p value. Each point represents a quantified protein. All MitoCarta3.0 annotated mitochondrial proteins are highlighted in dark grey. Subunits of SDH, complex I, and complex IV are shown in orange, green, and blue, respectively. Dashed lines indicate reference thresholds of p 0.05 and log₂ difference ± 1.\u003cbr\u003e\n \u003cstrong\u003e(B)\u003c/strong\u003e Representative immunoblots showing subunit levels SDHA, SDHB, and the SDHA assembly factor SDHAF2 across all models. Citrate synthase (CS) served as a loading control.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C)\u003c/strong\u003e Densitometric quantification of SDHA, SDHB, and SDHAF2 protein abundance normalised to CS and compared to WT. Bar graphs represent mean ± SD (n = 3). Statistical comparisons were performed using one-way ANOVA.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/ad9277176fff1e10da33459c.png"},{"id":100748192,"identity":"b5881962-2deb-49b8-8af9-bcc2e2af9b7e","added_by":"auto","created_at":"2026-01-21 04:01:09","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":443845,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSDHA pathogenic variants alter SDH complex assembly and lead to the accumulation of assembly intermediates\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBN-PAGE/WB analysis of SDHA \u003cstrong\u003e(A)\u003c/strong\u003e, SDHA assembly factor SDHAF2 \u003cstrong\u003e(B),\u003c/strong\u003e and SDHB \u003cstrong\u003e(C)\u003c/strong\u003e across WT, SDHA KO, and cell lines expressing healthy or pathogenic SDHA variants.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D)\u003c/strong\u003e Merged image of SDHA and SDHAF2 signals illustrating their relative migration patterns on the native gel. SDHA and SDHA assembly intermediates are shown in green, and SDHAF2 is shown in red.\u003c/p\u003e","description":"","filename":"floatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/191bf91cb4aa0d53d9db22ae.png"},{"id":100748068,"identity":"340d57a6-ccc5-4dc3-8bbf-dc6867a933c4","added_by":"auto","created_at":"2026-01-21 04:00:33","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":567770,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFunctional analysis of SDHA variants\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A)\u003c/strong\u003e Succinate: coenzyme Q oxidoreductase (SQR) activity measured using DCPIP reduction as a readout of electron transfer from succinate to CoQ1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B)\u003c/strong\u003e SQR activity normalized to the activity of citrate synthase (CS) to account for differences in mitochondrial content. Bars represent mean ± SD (n = 3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C)\u003c/strong\u003e Representative oxygen consumption trace showing substrate and inhibitor injections used to assess complex I and SDH-linked respiration in permeabilized cells. Dig – digitonin, PM – pyruvate and malate, ROT – rotenone, SUC – succinate, Oligo – oligomycin, Mln – malonate, AA – antimycin A, A+T – ascorbate and TMPD, KCN – potassium cyanide.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D)\u003c/strong\u003e Complex I-dependent respiration measured following the addition of pyruvate (10 mM) and malate (2 mM) with ADP (1 mM). Bars represent mean ± SD (n ≥ 5).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E)\u003c/strong\u003e SDH-dependent respiration measured after inhibition of complex I with rotenone (0.5 µM) and addition of succinate (10 mM). Bars represent mean ± SD (n ≥ 5).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F)\u003c/strong\u003e Ratio of SDH-dependent to complex I-dependent respiration. Bars represent mean ± SD (n ≥ 5).\u003c/p\u003e\n\u003cp\u003eStatistical analyses were performed using one-way ANOVA relative to WT.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(G) \u003c/strong\u003eIn-gel detection of covalently bound flavin in SDHA.\u003c/p\u003e","description":"","filename":"floatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/0d6566af154483889258e704.png"},{"id":100748135,"identity":"d480aafe-293a-43f8-b2f5-13d043ef076e","added_by":"auto","created_at":"2026-01-21 04:00:48","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":810060,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eMetabolic and lipidomic profiling of SDHA mutant cell lines\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(A) \u003c/strong\u003eCellular NAD⁺/NADH ratio measured in WT, rescue, SDHA KO, and SDHA mutant cell lines using Promega NAD/NADH-Glo assay. Bars represent mean ± SD (n = 3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(B) \u003c/strong\u003eLC-MS analysis of cellular lactate abundance shown relative to WT. Bars represent mean ± SD (n = 3).\u003c/p\u003e\n\u003cp\u003eStatistical analyses were performed using one-way ANOVA relative to WT.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(C) \u003c/strong\u003eHeatmap of TCA cycle intermediates displayed as log₂ differences relative to WT. Asterisks indicate significantly altered proteins (p-value \u0026lt; 0.05).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(D) \u003c/strong\u003eRelative abundance of major lipid classes obtained from lipidomic profiling. Each bar represents the mean ± SD (n = 3) of one lipid class. TG – triacylglycerol, DG – diacylglycerol, PC – phosphatidylcholine, PC – phosphatidylethanolamine, PI – phosphatidylinositol, PS – phosphatidylserine, Cer – ceramide, HexCer – hexosylceramide, SM - sphingomyelin, CL-cardiolipin.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(E) \u003c/strong\u003eTriacylglycerol (TG) levels grouped according to the number of double bonds measured by LC-MS. Each bar represents the mean ± SD of the relative abundance compared to the WT \u0026nbsp;(n = 3).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e(F) \u003c/strong\u003eHeatmap of ferroptosis-related protein levels (KEGG pathway: hsa04216) shown as log₂ differences relative to WT. Asterisks indicate significantly altered proteins (p-value \u0026lt; 0.05).\u003c/p\u003e","description":"","filename":"floatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/8b600764a81201770e642e14.png"},{"id":100748229,"identity":"4ea1ba67-0a81-4cfd-872b-bcbf2d48c159","added_by":"auto","created_at":"2026-01-21 04:01:50","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":4339506,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/aace6a33-ed28-4143-8a54-fda661a86087.pdf"},{"id":100748114,"identity":"2aa6aa1e-32b8-401d-9a4b-788567cf2004","added_by":"auto","created_at":"2026-01-21 04:00:44","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":1213660,"visible":true,"origin":"","legend":"","description":"","filename":"SDHAmutantssupplementaryBMC.docx","url":"https://assets-eu.researchsquare.com/files/rs-8568560/v1/0c7340254900d90b72265b9b.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Molecular Consequences of Pathogenic SDHA Variants: From Defective Flavinylation and Assembly to Lipid Remodeling","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSuccinate dehydrogenase (SDH, complex II) connects the tricarboxylic acid cycle (TCA) to oxidative phosphorylation (OXPHOS) [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], the key pathway of energy transduction. Embedded in the inner mitochondrial membrane, SDH oxidizes succinate to fumarate and transfers the released electrons to ubiquinone [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. This dual role places SDH at the intersection of energy transduction and metabolic regulation. SDH differs in several aspects from other complexes of the OXPHOS system, as it is entirely nuclear-encoded and, unlike the other respiratory complexes, does not directly contribute to the formation of the proton gradient used by ATP synthase to generate ATP [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eSDH function within mitochondrial metabolism depends on the coordinated assembly of its four subunits: SDHA, a flavoprotein with covalently bound FAD; SDHB, an iron-sulfur protein; and the membrane-anchored SDHC and SDHD, which contain heme b and mediate electron transfer to ubiquinone. The assembly of this multisubunit enzyme proceeds through a stepwise process that requires dedicated assembly factors (SDHAF1-4). A key early checkpoint in this process is the covalent flavinylation of SDHA [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], which depends on SDHAF2, FAD, and a bound dicarboxylate ligand. Following flavinylation, SDHB binds SDHA to form a soluble dimer, which subsequently integrates with SDHC and SDHD to generate the functional enzyme. This ordered assembly pathway ensures that only properly matured subunits are incorporated, thereby maintaining SDH stability and activity [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eDefects in SDH assembly or function have profound pathological consequences. Once considered incompatible with life because of its central role in metabolism [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], SDH deficiency is now well documented in humans and can result from germline mutations in either SDH subunits or assembly factors. These mutations give rise primarily to two classes of disease: cancer or severe encephalomyopathies that are typically associated with primary mitochondrial disorders [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. SDHB, SDHC, and SDHD variants are strongly associated with tumorigenesis, particularly paragangliomas, pheochromocytomas, and gastrointestinal stromal tumors (GIST) [\u003cspan additionalcitationids=\"CR13 CR14\" citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. In contrast, mutations affecting SDHA are more commonly associated with mitochondrial disease, most notably Leigh syndrome (LS) [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The C-to-T transition at nucleotide 1684 in the \u003cem\u003eSDHA\u003c/em\u003e gene (p. Arg554Trp, R554W), causing LS, was the first reported mutation in a nuclear gene associated with mitochondrial deficiency [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Besides LS, the SDHA pathogenic variants were linked to multisystem mitochondrial disease [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e], such as neurodegeneration with ataxia and late-onset optic atrophy (NDAXOA, p. Arg451Cys, R451C) [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]. However, certain SDHA pathogenic variants were also linked to the most common SDH-related cancer types, such as GIST (p. Arg171His, R171H) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e] or paraganglioma (p. Arg589Trp, R589W) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Interestingly, the SDHA variant resulting in a stop codon at position 31 of the protein (R31*) was reported in patients with LS, but also associated with paraganglioma or GIST [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. Additional reports describe infantile leukodystrophy in patients with SDHB mutations and progressive encephalomyopathy in those with SDHD variants [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. Together, these clinical phenotypes highlight the dual consequences of SDH dysfunction, underscoring its dual roles as both a tumor suppressor and an essential element in neurological development and mitochondrial function.\u003c/p\u003e \u003cp\u003eThe mechanisms underlying the contrasting clinical outcomes associated with SDH deficiency remain poorly understood, yet accumulating evidence suggests that SDH mutations drive distinct metabolic adaptations. Loss of SDH activity constrains TCA cycle-derived oxaloacetate, limiting aspartate synthesis and promoting compensatory anaplerosis through pyruvate carboxylase to sustain anabolic growth [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e]. In parallel, SDH dysfunction alters redox-dependent and hypoxia-associated signaling, as loss of SDHB but not SDHA increases reactive oxygen species (ROS) and stabilizes the transcription factor HIF-1α \u0026ndash; a key driver of hypoxic signaling and tumorigenesis [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. In addition, succinate accumulation can promote HIF-1α stabilization independently of detectable ROS through inhibition of prolyl-hydroxylase-dependent degradation, leading to pseudohypoxia and epigenetic changes [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Beyond effects on central metabolism and signaling, SDH mutations are also associated with remodeling of lipid metabolism, as patient serum profiling reveals alterations in the length and saturation of polyunsaturated fatty acid (PUFA) chains. These changes are thought to reflect adjustments in the cellular NAD\u003csup\u003e+\u003c/sup\u003e/NADH balance, indicating an adaptive remodeling of lipid pathways [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eTogether, these studies demonstrate how SDH dysfunction alters cellular metabolism through multiple, context-dependent mechanisms, which may account for the spectrum of associated disease phenotypes. Notably, most of this mechanistic insight derives from studies of SDHB, SDHC, and SDHD, reflecting their strong links to tumorigenesis. In contrast, the consequences of SDHA mutations remain comparatively underexplored. Although SDHA variants are increasingly recognized in both mitochondrial disease and cancer, the mechanisms by which these mutations disrupt SDH structure, function, and downstream metabolic pathways remain poorly defined. To bridge this knowledge gap, we established a panel of patient-derived SDHA mutations in HEK293 cells. By integrating structural, biochemical, and multi-omics analyses, we define the variant-specific mechanisms that underline the diverse clinical outcomes associated with SDHA deficiency.\u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eMutations in SDHA lead to distinct changes in OXPHOS protein expression\u003c/h2\u003e \u003cp\u003eMutations in the SDHA subunit of succinate dehydrogenase (SDH) are associated with a wide spectrum of clinical outcomes, ranging from mitochondrial disease to cancer. To explore how selected SDHA mutations drive these phenotypes, we generated four patient-derived SDHA mutant models by re-expressing \u003cem\u003eSDHA\u003c/em\u003e mutant variants in HEK293 cells, lacking the SDHA subunit (SDHA KO) [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). We investigated the variant R171H (GIST) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], R451C (NDAXOA) [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e], R554W (LS) [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e] and R589W (paraganglioma) [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. To have relevant control, we also generated a rescue model by re-expressing wild-type SDHA on the SDHA KO background (SDHA RES).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eTo assess the impact of these variants on SDH composition, we performed label-free quantitative mass spectrometry (LFQ-MS). Compared to wild-type, the level of SDHA re-expressed variants was similar, except for the R589W variant, which showed severely reduced SDHA content (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, S1A). SDS-PAGE/WB analysis displayed a comparable SDHA pattern (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB), confirming that the SDHA-specific antibody recognizes modified variants. Further, the LFQ-MS revealed a significant reduction of other SDH subunits in the SHDA KO and R589W cell lines. In contrast, R171H, R451C, and R554W variants showed a modest but significant decrease in SDHB and SDHC abundance, whereas the changes in SDHD levels were less pronounced (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, S1A). These findings were confirmed by SDS-PAGE followed by immunoblotting for SDHA and SDHB, which showed that SDHB was consistently reduced across all mutant cell lines (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, C). In addition to SDH subunits, the levels of complex assembly factors (SDHAF1-4) were changed, notably the abundance of SDHAF2, an assembly factor required for SDHA maturation [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e], closely mirrored the content of SDHA (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, B, S1A). These data suggest that the pathogenic variants interfere with the assembly of the SDHA complex, with the most severe being the R589W variant, which compromises the expression or stability of the SDHA protein.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSevere deficiencies in OXPHOS complexes, including SDHA KO, have been linked to a secondary downregulation of complexes I and IV \u0026ndash; a phenomenon known as interdependence, which is caused by the attenuation of mitochondrial protein synthesis, with its manifestation being strongly associated with the severity of the primary mitochondrial defect [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. To assess whether this effect extends to our models, we quantified subunits of complexes I and IV. As the content of SDH was strongly reduced, we expected a corresponding reduction in cI subunits in R589W cells, similar to SDHA KO [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Notably, cI abundance was also decreased in the R171H and R451C models, despite SDHA protein levels in these models being comparable to those in the control cells (WT). On the contrary, a slight increase in the cI subunits content was observed in R554W cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, S1B). The level of cIV subunits mirrored that of cI subunits, being more pronounced in SDHA mutant models (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, S1C).\u003c/p\u003e \u003cp\u003eIn summary, although each pathogenic SDHA variant altered the profile of SDH subunits to different extents, all variants showed a reduction in cI and cIV subunits. This pattern suggests that these mutations may compromise SDH assembly, stability, or function.\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eImpact of SDHA mutations on the assembly and function of SDH\u003c/h3\u003e\n\u003cp\u003eTo determine how SDHA variants affect the structural integrity of SDH, we assessed SDH content and assembly by blue-native electrophoresis (BN-PAGE). Assembled SDH was not present in SDHA KO and R589W models. In all other cases, a fully assembled enzyme was present, albeit its levels were reduced in the case of the R451C variant (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Across all variants, we also observed an accumulation of assembly intermediates containing SDHA or SDHAF2 (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, B) that were not present in the WT. Such intermediates have been described under bioenergetic stress conditions and are referred to as cII\u003csub\u003elow\u003c/sub\u003e [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Since cII\u003csub\u003elow\u003c/sub\u003e migrates as a broad band at approximately 100 kDa, it is still debated whether it consists of one or more structural entities [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Clearly, one of them is SDHA-SDHAF2 assembly intermediate, which we also observe in our models (SDHA-AF2 in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Additionally, a band at a lower molecular weight is present, which does not contain SDHAF2 but does contain SDHA (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD) \u0026ndash; most likely, this represents free SDHA. Either it indicates a stalled maturation of SDHA variants even before the binding of SDHAF2, or it may relate to higher-than-native expression of recombinant SDHA.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eAnalysis of native complex I and complex IV content (Figures \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eD, E) was consistent with the LFQ-MS proteomics data and the subunit analysis of complex I (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB) and complex IV (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eC), further supporting the concept of interdependence among respiratory complexes [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Specifically, reduced levels of complex I were observed in the SDHA KO model [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], as well as in R171H and R451C, with a more pronounced reduction in R589W. In contrast, R554W exhibited complex I levels comparable to those of the SDHA RES and WT cells (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eD). A similar pattern was observed for complex IV, with decreased levels detected in the KO, R171H, R451C, and R589W models (Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eE).\u003c/p\u003e \u003cp\u003eWe next investigated whether pathogenic variants in the \u003cem\u003eSDHA\u003c/em\u003e gene affect SDH enzymatic activity. To explore this, we measured succinate:coenzyme Q oxidoreductase (SQR) activity as a readout of the isolated SDH catalytic function [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. SQR activity was nearly absent in R171H and R589W, and only partially retained (~\u0026thinsp;50% of WT) in R554W (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Interestingly, the activity was also markedly reduced in R451C, despite the presence of assembled SDH. Normalization to citrate synthase, used as a marker of mitochondrial mass, confirmed that these differences reflected impaired catalytic activity rather than changes in mitochondrial abundance.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eGiven the pronounced defects in isolated SDH activity, we next investigated the extent to which it influences overall OXPHOS function. To test this, we measured oxygen consumption, focusing on individual pathways that feed electrons into the coenzyme Q pool \u0026ndash; complex I and SDH. An example of the experimental trace and substrate additions is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC. Cells were first permeabilized with digitonin to allow access of substrates and inhibitors to mitochondria. Complex I-linked respiration was then assessed in the phosphorylating state using NADH-linked substrates, pyruvate and malate (PM), together with ADP, all in saturating conditions (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). All variants displayed reduced complex I-linked respiration relative to WT, consistent with the secondary decrease of complex I content. R554W retained 77% of WT respiration, R171H60%, R451C 51%, and both R589W and the KO approximately 45%. Following complex I inhibition with rotenone, succinate was added to assess SDH-linked respiration (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE). In agreement with the SQR assay, R171H, R451C, and R589W showed almost no succinate-driven respiration, whereas R554W retained approximately 50% of WT capacity. We also calculated the ratio between SDH and complex I-driven respiration, which revealed a significant reduction across all mutant models (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eF). This demonstrates that despite secondary complex I downregulation, a metabolic shift towards NADH-driven respiration can still be observed, since SDH function is profoundly compromised.\u003c/p\u003e \u003cp\u003eAs SDH enzymatic activity was diminished in three mutant models despite the presence of assembled enzyme, we next investigated whether SDHA mutations affected covalent FAD binding (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eG). Flavinylated SDHA, detected by intrinsic fluorescence [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e], was present in WT, SDHA RES, R171H, and R554W but was absent in R451C and R589W. Notably, R451 cells retained expression of SDHAF2, the assembly factor required for FAD insertion, as well as assembled SDH. This suggests that the R451C variant disrupts FAD binding and that SDH assembly can proceed past the SDHA-AF2 checkpoint even in the absence of flavinylated SDHA.\u003c/p\u003e \u003cp\u003eIn summary, SDHA variants exhibit distinct structural and functional phenotypes. While R589W closely resembles the SDHA KO model and lacks assembled SDH, R554W maintains a partially assembled and functional flavinylated enzyme. In contrast, R171H and R451C form a partially assembled enzyme that is unable to transfer electrons, with loss of FAD binding contributing to the defect in R451C.\u003c/p\u003e\n\u003ch3\u003eMetabolic consequences of mutations in SDHA\u003c/h3\u003e\n\u003cp\u003eWe previously reported that in the absence of SDHA in HEK cells, the cellular redox balance, as measured by the NAD\u003csup\u003e+\u003c/sup\u003e/NADH ratio, remains unchanged [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. To determine whether this also applies to cells expressing pathogenic SDHA variants, we measured the NAD\u003csup\u003e+\u003c/sup\u003e/NADH ratio across all mutant models (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Similar to SDHA KO cells, none of the mutants showed significant changes in the NAD\u003csup\u003e+\u003c/sup\u003e/NADH ratio, indicating that global redox balance is maintained despite impaired SDH function. This likely reflects the combined effect of reduced NADH generation due to a slowed TCA cycle and decreased NADH oxidation resulting from compensatory downregulation of complex I.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWe have previously shown that SDHA KO cells display increased extracellular acidification rate and lactate production, indicative of enhanced glycolytic activity to meet cellular ATP demands [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In addition, loss of SDHA was shown to induce metabolic rewiring [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], including succinate accumulation and increased glutamine anaplerosis of the TCA cycle. To test whether a similar metabolic response occurs in SDHA mutant cells, we performed LC-MS-based metabolic profiling. As observed in SDHA KO cells, the SDH-impaired mutant cells R171H, R451C, and R589W accumulated lactate (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB) and showed depletion of TCA cycle intermediates, except for succinate, which was markedly increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). In accordance with the partially preserved SDH activity in R554W cells, they did not present profound metabolic rearrangements either. The only observed change was a slight decrease in the content of α-ketoglutarate (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eIn addition, the deficiency of ETC triggered a polyunsaturated fatty acid (PUFA) stress response, characterized by the downregulation of cellular desaturases, upregulation of glutathione peroxidase 4 (GPX4), and the accumulation of neutral lipids enriched in PUFAs. Since PUFA-rich membrane phospholipids are particularly susceptible to oxidation, suppression of PUFA synthesis and their sequestration into neutral triacylglycerols represent a protective mechanism that preserves membrane integrity [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Consistent with this, lipidomic profiling revealed accumulation of triacylglycerols (TG) and a reduction in diacylglycerols (DG) in the R171H, R451C, and R589W models, indicating increased neutral lipid storage (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Detailed analysis of TG and two major classes of membrane phospholipids \u0026ndash; phosphatidylcholines (PC) and phosphatidylethanolamines (PE) \u0026ndash; further confirmed the sequestration of PUFAs into TG (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE, S2). Again, this rearrangement was not observed in the R554W model. Notably, LFQ-MS analysis of the ferroptosis-related pathway (KEGG pathway hsa04216) revealed reduced expression of fatty acid desaturases FADS1 and FADS2 and increased abundance of GPX4 and ferritin light chain (FTL) across SDHA KO, all mutant models, and SDHA RES (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eF).\u003c/p\u003e \u003cp\u003eTogether, these findings suggest that loss of SDH function results in a profound reorganization of the TCA cycle, regulation of PUFA formation and their protective storage in TGs, as well as activation of phospholipid hydroperoxide peroxidase. When SDH activity is partially retained, an intermediate adaptive response is observed, which includes a decrease in fatty acid desaturases and activation of the lipid peroxide detoxification enzyme (GPX4).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003ePathogenic variants of SDHA, the catalytic subunit of succinate dehydrogenase (SDH), have been linked to a variety of clinical outcomes that include mitochondrial disease and tumor formation [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. The mechanisms by which these variants alter SDH structure and function, as well as the basis of their divergent phenotypes, remain unclear. To address this, we examined four patient-derived SDHA mutant models, two associated with mitochondrial disease (R451C, R554W) and two associated with cancer (R171H, R589W).\u003c/p\u003e \u003cp\u003eThe abundance of SDH subunits was altered in mutant cells, although no clear pattern distinguished mitochondrial disease-associated from cancer-associated variants. Quantitative proteomics and SDS-PAGE consistently demonstrated that the R589W mutant, associated with paraganglioma [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e], exhibited a phenotype resembling the knockout, characterized by decreased levels of all SDH subunits. In contrast, in R171H, which is associated with GIST [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e], only SDHB and SDHC were slightly decreased. The substitution of arginine 589 with tryptophan results from the c.1765 C\u0026thinsp;\u0026gt;\u0026thinsp;T mutation and affects a conserved region of SDHA located near the protein surface, away from the electron transport pathway and distal to the interface with SDHB. This positioning suggests that tryptophan 589 destabilizes SDHA by eliminating polar contacts and by introducing a bulky side chain into the constrained space formed by residues surrounding arginine 589 [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe R451C mutant, which is associated with optic atrophy and cardiomyopathy, exhibited slightly increased levels of SDHA, consistent with observations from a previous study by Kent et al. [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. The original report describing R451C[\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e] showed that the mutant SDHA protein was stable. Across all mutants, SDHB levels showed a borderline decrease. Since SDHA maturation is considered a prerequisite for SDHB binding [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], this decrease suggests that SDHA mutations may impair SDHA maturation and consequently SDHA-SDHB heterodimerization, leading to SDH destabilization. Supporting this interpretation, SDHAF2 levels paralleled SDHA abundance, consistent with its role in early SDH assembly and stability [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eBeyond SDH itself and consistent with the documented interdependence [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] of OXPHOS complexes, the reduction of complex I and complex IV subunits reflected the severity of SDH dysfunction. It is well established that individual OXPHOS defects can give rise to combined enzymatic deficiencies. The RC complexes may also exist in higher-order assemblies \u0026ndash; supercomplexes \u0026ndash; usually formed by interaction between complexes I, III, and IV [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e, \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. In line with studies showing that a primary defect in one complex can cause a secondary decrease in others [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], our models R171H, R451C, and R589W also showed decreased levels of complex I and IV subunits, despite the fact that SDH is not part of the supercomplexes. Complex IV subunits were consistently more affected than those of complex I. Although reports describing a selective decrease of complex IV in SDH-deficient cells are limited, cross-complex coupling is well supported [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e], and complex IV instability has been observed in diverse mitochondrial impairments, including models in which complex IV defects secondarily compromise complex I [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e, \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]. These observations support the view that SDH dysfunction influences the broader respiratory chain organization rather than acting independently of it. Since SDH is not physically associated with the respirasome, these secondary effects cannot stem from direct interaction between OXPHOS complexes.\u003c/p\u003e \u003cp\u003eAnalysis of native OXPHOS complexes provided further insight into how these mutations affect SDH assembly. Fully assembled SDH was not detected in R589W or in the knockout, consistent with the marked decrease of all SDH subunits in these models. In contrast, fully assembled SDH was detected in R171H and R554W, and notably also in R451C, despite the absence of a covalently bound flavin on the SDHA subunit.\u003c/p\u003e \u003cp\u003ePrevious studies have shown that flavinylation of the catalytic subunit by the assembly factor SDHAF2 (also known as SDH5) is necessary for SDH assembly and stability [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Later work demonstrated that SDHAF2 is dispensable for SDHA flavinylation in MDA-MB-231 cells [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. This was subsequently explained by Sharma et al. [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], who showed that covalent flavinylation of SDHA can occur in the absence of SDHAF2 when dicarboxylate levels are high. Although impaired flavinylation at this residue has been predicted or inferred from non-human models [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e, \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e], to our knowledge, this is the first demonstration in a human cell line that the R451C variant lacks covalently bound FAD, directly linking defective flavinylation to loss of SDH function. Interestingly, FAD-free SDHA can still be assembled into a complete SDH.\u003c/p\u003e \u003cp\u003eIn addition, all mutants in which SDH assembly was detectable showed accumulation of assembly intermediates, partially compatible with the described cII\u003csub\u003elow\u003c/sub\u003e. The cII\u003csub\u003elow\u003c/sub\u003e intermediate consists primarily of SDHA, SDHAF2, and SDHAF4, migrates as a stable 100 kDa band, and has been described in knockdown models of SDHB and SDHC, but not in SDHA knockdown cells [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. In addition to cII\u003csub\u003elow\u003c/sub\u003e, we can also observe free SDHA. The presence of cII\u003csub\u003elow\u003c/sub\u003e and free SDHA suggests a stalling of the SDH assembly at the level of SDHA maturation in our variant models. Despite the accumulation of SDHA assembly intermediates, assembly can also proceed to form the fully mature SDH. This phenomenon also occurs in the case of flavinylation-negative R451C, suggesting that the formation of a covalent bond with flavin is not a strict prerequisite for the subsequent switch in SDHAF2 SDHAF4 binding partners, at least in the context of this pathogenic variant.\u003c/p\u003e \u003cp\u003eStill, the presence of assembled SDH is not sufficient to predict SDH activity, as demonstrated by functional assays. SDH activity was negligible in R171H, R451C, R589W, and the knockout, whereas R554W retained approximately half of WT activity. In R451C and R589W, the loss of activity clearly stems from a lack of covalent flavinylation, which is a prerequisite for the catalytic conversion of succinate to fumarate. In contrast, R171H retained both FAD and assembled SDH, yet exhibited activity levels comparable to those of the non-flavinylated or non-assembled models. This discrepancy suggests that dysfunction in R171H may arise from defects in the electron transfer pathway.\u003c/p\u003e \u003cp\u003eA recent study analyzing a large panel of SDHA variants concluded that most cancer-associated mutations are highly destabilizing and display severe SDH dysfunction [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. This is consistent with our observations for the cancer-associated variants R171H and R589W, both of which showed severe loss of function regardless of SDHA expression level, assembly state, or flavinylation status. Notably, in R171H, SDHA expression was comparable to WT, yet the function was still severely impaired. The same study also proposed that mitochondrial disease-associated variants retain partial SDH function, whereas cancer-associated variants are fully inactivating, which is not entirely consistent with our findings. In our models, R451C, a mitochondrial disease-associated variant, exhibited a defect as severe as those observed in the cancer-associated models. One possible explanation is that patient-derived cells often retain at least one hypomorphic allele, whereas in our knockout-based system, both alleles are replaced, thereby eliminating residual activity. This interpretation is consistent with the original description of R451C, in which patient fibroblasts (heterozygous for the R451C variant) retained residual SDH activity [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eMetabolic profiling revealed adaptive changes that depend on the severity of SDH dysfunction across the mutant models. Despite severe impairment of SDH activity in three out of the four variants, cellular NAD\u003csup\u003e+\u003c/sup\u003e/NADH ratios were not significantly altered, indicating that redox balance is buffered in cells with missing or deficient SDH. Such buffering has been linked to alterations in mitochondrial electron flux, particularly involving complex I activity in SDH deficiency [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Disrupted flux through the TCA cycle in SDH-deficient cells results in an increase in the NAD\u003csup\u003e+\u003c/sup\u003e/NADH ratio. Such an increase is counteracted at the cellular level through adaptive mechanisms, particularly the reduction of complex I activity and, consequently, a decrease in the NADH reoxidation rate [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Indeed, we observed reduced content as well as activity of complex I in our models, which may contribute to the maintained NAD\u003csup\u003e+\u003c/sup\u003e/NADH balance. While downregulation of cI can be directly adaptive, it is unclear how it is regulated. In our models, we observed combined secondary downregulation of cI as well as cIV, which is compatible with the full interdependency phenomenon observed across the panel of OXPHOS complexes deficiencies and not specific for cII models [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Of interest, secondary cIV drop can also be observed in the aforementioned SDHB KO model [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. Therefore, both cI and cIV levels may be regulated through the levels of mitochondrial ribosomes and subsequently mitochondrial translation [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e], possibly by sensing redox imbalance at the level of mitochondrial ribosome biogenesis [\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. In our models, the NAD\u003csup\u003e+\u003c/sup\u003e/NADH ratio was comparable to WT values, presumably thanks to the reduced complex I levels to keep redox balance in SDH dysfunction.\u003c/p\u003e \u003cp\u003eAnother aspect of the disrupted TCA cycle in SDH-deficient models is their dependence on pyruvate carboxylation to sustain aspartate biosynthesis and cell growth [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e]. Further, we and others [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e, \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e] observed increased lactate levels in models with severe SDH loss of function, supporting a shift toward glycolytic ATP production. This metabolic profile closely resembled that of SDHA KO cells, indicating that both cancer-associated variants and the severe mitochondrial disease variant R451C undergo similar rewiring in response to near-complete SDH dysfunction. In contrast, R554W exhibited a milder metabolic phenotype, characterized by partial preservation of oxidative metabolism, which is consistent with its retained SDH activity.\u003c/p\u003e \u003cp\u003eBeyond central carbon metabolism, lipidomic analysis revealed a marked accumulation of triacylglycerols (TGs) and depletion of TCA cycle intermediates in models with severe SDH impairment. This lipid remodeling was accompanied by sequestration of polyunsaturated fatty acids (PUFAs) into TGs, a pattern previously described as a protective adaptation in cells with OXPHOS deficiencies [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. In contrast, TG accumulation was absent in the R554W model, consistent with the higher residual SDH activity in this model. Sequestration of PUFAs into neutral lipid stores reduces their availability in membrane phospholipids and thereby reduces susceptibility to lipid peroxidation and ferroptotic stress. The close similarity between the SDHA KO and the severe SDHA variants indicates that SDH deficiency is sufficient to trigger this adaptive lipid response. Consistent with activation of this PUFA stress response, expression of the fatty acid desaturases FADS1 and FADS2 was downregulated across the mutant models, while glutathione peroxidase 4 (GPX4) was upregulated. We previously demonstrated [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e] that downregulation of desaturases together with increased GPX4 levels reduces the burden of PUFA-derived lipid peroxides in OXPHOS-deficient cells. Within this framework, R554W exhibited an intermediate phenotype, characterized by GPX4 upregulation and a mild yet significant reduction of FADS1 and FADS2. A more pronounced response in R554W cells regarding GPX4 may also result from ATF4-dependent proteostatic stress, as GPX4 is also under the regulation of ATF4 [\u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e, \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e].\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eTogether, these findings show that SDHA mutations exert diverse effects on SDH assembly and function. While variant R589W primarily destabilizes SDH subunits and prevents assembly, others, including R451C and R171H, allow partial assembly but fail at the level of enzymatic activity, implicating defects in SDHA maturation or disrupted electron transfer. R554W emerges as a variant with relatively preserved assembly and function, consistent with its milder biochemical phenotype. The downregulation of SDHB across models suggests a shared bottleneck in SDHA-SDHB heterodimerization, whereas the broader decreases in complex I and IV highlight the interdependence of OXPHOS complexes.\u003c/p\u003e "},{"header":"Methods","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003eGeneration of mutant cell lines\u003c/h2\u003e \u003cdiv id=\"Sec10\" class=\"Section4\"\u003e \u003ch2\u003eSite-Directed mutagenesis\u003c/h2\u003e \u003cp\u003eFour individual SDHA models simulating patients\u0026rsquo; mutations were generated. These variants were selected based on previously reported associations with distinct clinical outcomes. Two are linked to mitochondrial disease and two to cancer (Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). Mutagenic primers were designed using the QuikChange Primer Design tool (Agilent). The wild-type SDHA sequence (reference sequence: NM_004168) from GenScript was used as a reference to identify target sites for single amino acid substitutions.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSummary of modelled SDHA variants\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"6\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c6\" colnum=\"6\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eMutation\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAmino acid change\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eClinical phenotype\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eReference (PMID)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eForward primer\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c6\"\u003e \u003cp\u003eReverse primer\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.512G\u0026thinsp;\u0026gt;\u0026thinsp;A\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ep.(Arg171His)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGastrointestinal stromal tumor\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003ePantaleo et al. [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ectctgtccaccaaatgcatgctgataaatcttcccat\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003eatgggaagatttatcagcatgcatttggtggacagag\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.1351C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ep.(Arg451Cys)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eOptic atrophy and cardiomyopathy\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eCourage et al. [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003egtttgccccgaggcagttggcaccatgta\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003etacatggtgccaactgcctcggggcaaac\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.1660C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ep.(Arg554Trp)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLeigh syndrome\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBourgeron et al. [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003etccagaccattccccagtcgaacgtcttcag\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003ectgaagacgttcgactggggaatggtctgga\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ec.1765C\u0026thinsp;\u0026gt;\u0026thinsp;T\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003ep.Arg589Trp\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eParaganglioma\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eBurnichon et al. [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c5\"\u003e \u003cp\u003ecgcgccccatgactccttccgtgc\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c6\"\u003e \u003cp\u003egcacggaaggagtcatggggcgcg\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003cp\u003eSite-directed mutagenesis was performed on a wild-type plasmid (SDHA pcDNA3.1\u003csup\u003e+\u003c/sup\u003e, Clone ID: OHu28692, GenScript). The construct lacked any protein tags. Mutations were introduced using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, Catalogue #210518), following the manufacturer\u0026rsquo;s instructions. Following bacterial transformation, colonies were selected and grown overnight in LB medium supplemented with ampicillin (100 \u0026micro;g/mL). Plasmids were isolated using the NucleoBond Xtra Midi Kit (MACHEREY-NAGEL) and verified by Sanger sequencing to confirm the incorporation of the intended mutations. Sequencing data was analyzed using SnapGene.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eTransfection and cell culture\u003c/h2\u003e \u003cp\u003eMutated and wild-type constructs were recombinantly expressed in a previously established [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e] SDHA knockout (SDHA KO) model in HEK293 cells. Transfections were performed using Metafectene Pro (Biontex Laboratories GmbH). Stably transfected cells were selected with 1 mg/mL G418. Cells were maintained at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e atmosphere in DMEM/F-12 medium (Biowest) supplemented with 10% (v/v) FBS, 40 mM HEPES, antibiotics (100 U/mL penicillin\u0026thinsp;+\u0026thinsp;100 \u0026micro;g/mL streptomycin), and 50 \u0026micro;M uridine and supplemented with G 418 disulfate salt (1 mg/mL).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eValidation of cellular models\u003c/h2\u003e \u003cp\u003eStable clones were screened for expression of mutant SDHA by SDS-PAGE followed by Western blotting as described in the section below.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eSDS-PAGE\u003c/h2\u003e \u003cp\u003eTricine - sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE) was used for protein separation under denaturing conditions. Samples were prepared from frozen cellular pellets as described [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Samples containing 25 \u0026micro;g of protein were separated on a 12% gel using a Mini-PROTEAN III Cell apparatus (Bio-Rad). Experiments were performed at least three times to assess the statistical significance of the results.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eNative electrophoresis\u003c/h2\u003e \u003cp\u003eBlue-native gel electrophoresis (BN \u0026ndash; PAGE) was used for the separation of native protein complexes. Mitochondrial pellets were isolated from freshly harvested cells by hypotonic shock followed by differential centrifugation [\u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e] and solubilized using 8 grams of digitonin per 1 gram of protein. Samples (30 \u0026micro;g of protein) were separated on a 5\u0026ndash;16% polyacrylamide gradient gel using the Mini-Protean III apparatus (Bio-Rad).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eWestern blotting\u003c/h2\u003e \u003cp\u003eProteins separated by SDS-PAGE or BN-PAGE were transferred to polyvinylidene difluoride (PVDF) membranes as previously described [\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. The following primary antibodies were used: SDHA (Abcam 14715), SDHB (Abcam 14714), SDH5 (for SDHAF2, Proteintech 19906-1-AP), citrate synthase (Abcam 129095), NDUFA9 (Abcam 14713), and MTCO1 (Abcam 14705). For quantitative detection: donkey anti-Mouse IgG (H\u0026thinsp;+\u0026thinsp;L) Highly Cross-Adsorbed Secondary Antibody Alexa Fluor 680 and donkey anti-Rabbit IgG (H\u0026thinsp;+\u0026thinsp;L) Highly Cross-Adsorbed Secondary Antibody Alexa Fluor 680 (Thermo Fisher Scientific A10038 and A10043); IRDye 800CW Donkey anti-Mouse IgG and IRDye 800CW Donkey anti-Rabbit IgG (LI-COR Biosciences 926\u0026ndash;32212 and 926\u0026ndash;32213) were used. Detection was performed using the Odyssey fluorescence scanner (LI-COR Biosciences). The resulting signals were analyzed and quantified using the Image Lab software (Bio-Rad).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eHigh-resolution respirometry\u003c/h2\u003e \u003cp\u003eOxygen consumption was measured at 37\u0026deg;C using Oxygraph-2K high-resolution respirometer (Oroboros). Oxygen sensors were air-calibrated in MiR05 respiration medium (0.5 mM EGTA, 3 mM MgCl2, 60 mM lactobionic acid, 20 mM taurine, 10 mM KH2PO4, 20 mM HEPES, 110 mM D-sucrose, and 1 g/l of BSA) [\u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. Freshly harvested cells were resuspended in PBS and added to pre-calibrated oxygraph chambers containing 2.14 mL of MiR05. Cells were permeabilized with digitonin (0.05 g/ g protein) to allow access to mitochondrial substrates and inhibitors.\u003c/p\u003e \u003cp\u003eTo assess cellular respiration, a specific protocol of sequential substrate-uncoupler-inhibitor titrations was applied (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC). Complex I-linked respiration was measured by adding pyruvate (10 mM) and malate (2 mM), followed by ADP (1 mM) and cytochrome \u003cem\u003ec\u003c/em\u003e (5 \u0026micro;M). Then, rotenone (0.5 \u0026micro;M) was added to inhibit complex I. Subsequently, SDH-linked respiration was measured by adding succinate (10 mM). ATP synthase activity was inhibited with oligomycin (0.25 \u0026micro;M), and the respiratory chain capacity was measured via stepwise titrations of uncoupler carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP; maximal 0.5 \u0026micro;M). SDH was then inhibited by the addition of malonate (10 mM), followed by antimycin A (0.25 \u0026micro;M) to inhibit complex III. Finally, complex IV was measured by adding artificial substrates ascorbate (2 mM) and TMPD (1 mM) and subsequently inhibited with potassium cyanide (KCN; 0.5 mM), to subtract non-specific oxygen consumption due to substrate autooxidation. Oxygen consumption rates were normalized to total protein content and expressed as picomoles of O\u003csub\u003e2\u003c/sub\u003e consumed per second per milligram of protein (pmol oxygen/s/mg protein).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of enzyme activities\u003c/h2\u003e \u003cp\u003eCells were harvested and stored at -80\u0026deg;C in PBS supplemented with protease inhibitor cocktail (PIC) and benzonase. A day before the measurement, cells were subjected to two freeze-thaw cycles; the final thaw was performed on the day of the measurement. Protein concentration was assessed, and samples were diluted to 1 mg/mL.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of SDH (succinate: coenzyme Q oxidoreductase) activity\u003c/h2\u003e \u003cp\u003eSDH activity was measured by adapting the protocol from[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. For each measurement, 190 \u0026micro;L of the reaction mix (composition detailed in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e) was added to a 96-well plate, followed by the addition of 10 \u0026micro;L of the sample (1 mg/mL). The assay was carried out in the plate reader TECAN infinite M200 (Schoeller). Baseline absorbance at 600 nm was recorded for 2 minutes at 30\u0026deg;C. The reaction was initiated by adding Coenzyme Q1 (40 \u0026micro;M). Afterward, the plate was shaken (5 s), left to settle (5 s), and the absorbance was recorded at 600 nm for 7 minutes. A parallel set of reactions containing malonate (SDH inhibitor) was included as a negative control. All samples were run in technical triplicates to ensure consistency.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eReaction mix (200\u0026micro;l per well):\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReagent\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFinal concentration\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePotassium Phosphate Buffer (pH 7.5)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e25 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eBovine Serum Albumin (BSA)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1 mg/mL\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePotassium cyanide (KCN)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e300 \u0026micro;M\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSuccinate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e20 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2,6-Dichlorophenolindophenol (DCPIP)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e43 \u0026micro;M\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH\u003csub\u003e2\u003c/sub\u003e0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTo fill 200 \u0026micro;L\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e(+/-) Malonate\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eMeasurement of citrate synthase activity\u003c/h2\u003e \u003cp\u003eCitrate synthase was used for normalization of the SDH activity assay, following the previously described method in [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Briefly, 190 \u0026micro;L of reaction mix (composition detailed in Table\u0026nbsp;\u003cspan refid=\"Tab3\" class=\"InternalRef\"\u003e3\u003c/span\u003e) was added to a 96-well plate, followed by 10 \u0026micro;L of sample (1 mg/mL). In the plate reader, the plate was shaken for 5 seconds, and baseline absorbance at 412 nm was recorded for 3 minutes. The reaction was initiated by adding 10 \u0026micro;L of oxaloacetate, followed by shaking (5 s), left to settle (5 s), and the absorbance was recorded at 412 nm every 30 seconds for 10 minutes. All samples were run in technical triplicates to ensure consistency.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab3\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eReaction mix (200\u0026micro;l per well):\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eReagent\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eFinal concentration\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTris-HCl pH 8\u0026thinsp;+\u0026thinsp;0.2% Triton X-100\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100 mM\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e5,5\u0026prime;-Dithiobis(2-nitrobenzoic acid) \u0026ndash; DTNB in Tris-HCl pH 8.0\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100 \u0026micro;M\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAcetyl - CoA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e300 \u0026micro;M\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eH2O\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTo fill 200 \u0026micro;l per well\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eDetection of covalently bound flavin\u003c/h2\u003e \u003cp\u003eCovalently bound flavin was measured as previously described [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e]. Briefly, proteins were separated by SDS-PAGE. After electrophoresis, the gel was rinsed with distilled water and then incubated for 20 minutes in 10% acetic acid. The autofluorescence of FAD bound to SDHA was detected using an Amersham Typhoon 5 imaging system (Cytiva), with the Cy2 channel (excitation: 488 nm, emission band-pass filter 525/20 nm). To ensure that the lack of flavinylation observed was not due to a low protein amount, 50 \u0026micro;g of protein was loaded per slot.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eNAD\u003csup\u003e+\u003c/sup\u003e/NADH\u003c/h2\u003e \u003cp\u003eTo determine the NAD\u003csup\u003e+\u003c/sup\u003e/NADH ratio, we used the NAD\u003csup\u003e+\u003c/sup\u003e/NADH-Glo\u0026trade; Assay (Promega) according to the manufacturer\u0026rsquo;s instructions. Experiments were independently replicated a minimum of three times to confirm consistency across biological samples.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003eMetabolomic and lipidomic analysis\u003c/h2\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eSample preparation and extraction\u003c/h2\u003e \u003cp\u003eHEK-derived cells were seeded in triplicate on 6-well plates and cultured in growth media (see above) for 24 hours. Cells were seeded according to their growth rate: SDHA KO (600,000 cells/well); R171H, R451C and R589W (550,000 cells/well); WT, SDHA RES and R554W (450,000 cells/well). For profiling, the cells were rinsed twice in ice-cold PBS, the medium was aspirated, and the cells were immediately frozen at -80\u0026deg;C.\u003c/p\u003e \u003cp\u003eCells were processed using the LIMeX workflow, and polar metabolites were extracted with a biphasic solvent system composed of cold methanol, methyl tert-butyl ether, and 10% methanol, followed by liquid chromatography-mass spectrometry (LC\u0026ndash;MS) analysis [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Specifically, an aliquot of the upper organic phase was evaporated, resuspended in methanol with the internal standard [12-[(cyclohexylamino) carbonyl]amino]-dodecanoic acid (CUDA), and analysed using lipidomics platforms in positive and negative ion modes. Another aliquot of the upper organic phase was hydrolysed using potassium hydroxide in methanol. The solution was neutralised with hydrochloric acid, and the fatty acids were isolated using hexane. After evaporation, the dry extracts were resuspended in methanol with CUDA and analysed using the lipidomics platform in negative ion mode. Next, one aliquot from the bottom aqueous phase was evaporated and resuspended in an acetonitrile/water (4:1, v/v) mixture containing CUDA and Val-Tyr-Val as internal standards. This sample was analysed using the hydrophilic interaction chromatography (HILIC) metabolomics platform in positive electrospray ionisation mode. Another aliquot of the bottom phase was mixed with an acetonitrile/isopropanol (1:1, v/v) mixture, evaporated, then resuspended in 5% methanol with 0.2% formic acid, again including CUDA and Val-Tyr-Val as internal standards. This sample was analysed using the reversed-phase liquid chromatography (RPLC) platform in negative electrospray ionisation mode.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eLC \u0026ndash; MS analysis and data processing\u003c/h2\u003e \u003cp\u003eSix different LC-MS platforms (LIMeX-6D) in positive and negative ionisation modes were used [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. The LC\u0026ndash;MS analysis was conducted using a Vanquish UHPLC system (Thermo Fisher Scientific) coupled to an Orbitrap Exploris 480 mass spectrometer (Thermo Fisher Scientific). Detailed chromatographic and detection parameters are provided in [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. The data from metabolite and lipid profiling were analysed in Metaboanalyst 5.0 as described in [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e].\u003c/p\u003e \u003cdiv id=\"Sec25\" class=\"Section3\"\u003e \u003ch2\u003eLabel-free quantification mass spectrometry analysis\u003c/h2\u003e \u003cp\u003eLabel-free quantification mass spectrometry analysis (LFQ-MS) of cell pellets was performed in triplicate by the Proteomics Service Laboratory at the Institute of Physiology and the Institute of Molecular Genetics of the Czech Academy of Sciences, following the SP4 no glass bead protocol [\u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. Briefly, cellular pellets (100 \u0026micro;g of protein) were solubilized in 1% SDS prepared in 100 mM triethylammonium bicarbonate (TEAB) buffer, reduced with 10 mM tris(2-carboxyethyl)phosphine (TCEP), and alkylated with 40 mM chloroacetamide (performed together at 95\u0026deg;C for 10 min). Proteins were digested overnight at 37\u0026deg;C with MS-grade trypsin (Trypsin Gold, MS Grade, Promega, Cat# V5280) at a 1:40 enzyme-to-protein ratio. The resulting peptides were desalted using C18 StageTips, dried in a SpeedVac, and reconstituted in 0.1% trifluoroacetic acid with 2% acetonitrile. Approximately 500 ng of peptide digest per sample was separated on a Aurora Ultimate TS 25 cm x 75 \u0026micro;m C18 column (IonOpticks; Cat# AUR3-25075C18-TS) using a 90 min elution gradient on nanoUHPLC (Dionex Ultimate 3000, flow rate 300 nL/min) and analyzed in data-independent acquisition (DIA) mode on an Orbitrap Exploris 480 mass spectrometer equipped with a FAIMS unit set to CV -45 V. DIA MS Thermo raw files were processed in Spectronaut (v. 20.3, Biognosys) using direct DIA mode and human proteome UP000005640_9606.fasta (UniProt release 2025_01) and default setting with Precursor and Protein Q-value and PEP cutoff set at 0.01. Protein group quantities (PG.Quantity, MS2 level) from Spectronaut's protein report were analyzed in Perseus software (version 2.1.5.0) after log2 transformation, filtering for 67% of valid values, and imputation (from normal distribution, width 0.3, downshift 1.8). Perseus data were visualized in GraphPad Prism.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec26\" class=\"Section3\"\u003e \u003ch2\u003eData analysis, visualisation, and statistics\u003c/h2\u003e \u003cp\u003eQuantitative data were processed and plotted using GraphPad Prism 10.4. Statistical tests were selected according to the structure of each dataset. Comparisons against a defined reference value were assessed with a one-sample t-test, whereas differences between experimental groups were evaluated using either unpaired t-tests or one-way ANOVA. Two-way ANOVA was applied when two experimental factors were examined simultaneously. Significance thresholds and post hoc tests are reported in the respective figure legends. Graphs display mean values with standard deviation unless stated otherwise. Structural illustrations were generated with ChimeraX [\u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e, \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e60\u003c/span\u003e].\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBN-PAGE\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBlue-native polyacrylamide gel electrophoresis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eBSA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eBovine serum albumin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ecI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eComplex I\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ecII\u003csub\u003elow\u003c/sub\u003e\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eComplex II low molecular weight assembly intermediates\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ecIV\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eComplex IV\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCardiolipin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eCS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eCitrate synthase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDG\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDiacylglycerol\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eDMEM/F-12\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eDulbecco's Modified Eagle Medium/Nutrient Mixture F-12\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFAD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eFlavin adenine dinucleotide\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFADS1/2\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eFatty acid desaturase 1/2\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFBS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eFetal bovine serum\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eFTL\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eFerritin light chain\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGIST\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGastrointestinal stromal tumor\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eGPX4\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eGlutathione peroxidase 4\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHEK293\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHuman embryonic kidney 293 cell line\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHexCer\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHexosylceramide\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eHIF-1α\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eHypoxia-inducible factor 1-alpha\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eKCN\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePotassium cyanide\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eKO\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eKnockout\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLC\u0026ndash;MS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eLiquid chromatography\u0026ndash;mass spectrometry\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLFQ-MS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eLabel-free quantitative mass spectrometry\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eLS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eLeigh syndrome\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNAD\u003csup\u003e+\u003c/sup\u003e/NADH\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNicotinamide adenine dinucleotide (oxidized/reduced forms)\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eNDAXOA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eNeurodegeneration with ataxia and late-onset optic atrophy\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eOXPHOS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eOxidative phosphorylation\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePhosphatidylcholine\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePE\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePhosphatidylethanolamine\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePI\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePhosphatidylinositol\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePyruvate and malate\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePhosphatidylserine\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003ePUFA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003ePolyunsaturated fatty acid\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eRES\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eRescue\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eROS\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eReactive oxygen species\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSDH\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSuccinate dehydrogenase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSDHA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSuccinate dehydrogenase complex subunit A\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSDHAF1\u0026ndash;4\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSuccinate dehydrogenase assembly factors 1\u0026ndash;4\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSDHB\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSuccinate dehydrogenase complex subunit B\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSDHC\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSuccinate dehydrogenase complex subunit C\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSDHD\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSuccinate dehydrogenase complex subunit D\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSDS-PAGE\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSodium dodecyl sulfate\u0026ndash;polyacrylamide gel electrophoresis\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSM\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSphingomyelin\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eSQR\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eSuccinate:coenzyme Q oxidoreductase\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTCA\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTricarboxylic acid cycle\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eTG\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eTriacylglycerol\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eWB\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eWestern blot\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv class=\"DefinitionListEntry\"\u003e \u003cdiv class=\"Term\"\u003eWT\u003c/div\u003e \u003cdiv class=\"Description\"\u003e \u003cp\u003eWild-type\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eCompeting interests\u003c/h2\u003e \u003cp\u003eThe authors declare that they have no conflict of interest.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThis work was supported by the Czech Science Foundation (GACR 21-18993S), Czech Health Research Council (NU22-01-00499), the National Institute for Research of Metabolic and Cardiovascular Diseases (Programme EXCELES, ID Project No. LX22NPO5104) \u0026ndash; Funded by the European Union-Next Generation EU (JH and TM) and the Grant Agency of Charles University (GA UK 283423/2023, MJS). The authors would like to acknowledge the Laboratory of Metabolomics at the Institute of Physiology of the Czech Academy of Sciences and the Proteomics Service Laboratory at the Institute of Physiology (supported by RVO, ID 67985823) and the Institute of Molecular Genetics (supported by RVO, ID 68378050) of the Czech Academy of Sciences.\u003c/p\u003e\u003ch2\u003eAuthor Contribution\u003c/h2\u003e\u003cp\u003eConceptualization, M.J.S., T.M. and A.P.; Methodology, P.P., M.V., T.C., T.M. and A.P.; Investigation, M.J.S., P.P., K.T., K.Č.; Writing \u0026ndash; Original draft, M.J.S. and A.P.; Writing \u0026ndash; Review \u0026amp; Editing, M.J.S., P.P., K.Č., T.M. and A.P.; Visualization, M.J.S., and A.P.; Supervision, J.H., T.M. and A.P.; Project Administration, T.M. and A.P.; Funding acquisition, M.J.S., P.P., T.M. and A.P.\u003c/p\u003e\u003ch2\u003eData Availability\u003c/h2\u003e\u003cp\u003eAll data described, analysed, and represented in the figures present in this study are available from the corresponding authors upon reasonable request. The mass spectrometry proteomics data have been deposited in the ProteomeXchange Consortium via the PRIDE [61] partner repository with the dataset identifier PXD072792. Reviewer access details to log in to the PRIDE website are: Project accession: PXD072792, Token: LyUnvKoWmjkq\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eCecchini G: Function and structure of complex II of the respiratory chain. \u003cem\u003eAnnu Rev Biochem\u003c/em\u003e 2003, 72:77\u0026ndash;109.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChance B, Williams GR: A Method for the Localization of Sites for Oxidative Phosphorylation. \u003cem\u003eNature\u003c/em\u003e 1955, 176(4475):250\u0026ndash;254.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBezawork-Geleta A, Rohlena J, Dong L, Pacak K, Neuzil J: Mitochondrial Complex II: At the Crossroads. \u003cem\u003eTrends in Biochemical Sciences\u003c/em\u003e 2017, 42(4):312\u0026ndash;325.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMitchell P: Coupling of Phosphorylation to Electron and Hydrogen Transfer by a Chemi-Osmotic type of Mechanism. \u003cem\u003eNature\u003c/em\u003e 1961, 191(4784):144\u0026ndash;148.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma P, Maklashina E, Cecchini G, Iverson TM: The roles of SDHAF2 and dicarboxylate in covalent flavinylation of SDHA, the human complex II flavoprotein. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e 2020, 117(38):23548\u0026ndash;23556.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma P, Maklashina E, Cecchini G, Iverson TM: Maturation of the respiratory complex II flavoprotein. \u003cem\u003eCurr Opin Struct Biol\u003c/em\u003e 2019, 59:38\u0026ndash;46.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSharma P, Maklashina E, Voehler M, Balintova S, Dvorakova S, Kraus M, Hadrava Vanova K, Nahacka Z, Zobalova R, Boukalova S \u003cem\u003eet al\u003c/em\u003e: Disordered-to-ordered transitions in assembly factors allow the complex II catalytic subunit to switch binding partners. \u003cem\u003eNat Commun\u003c/em\u003e 2024, 15(1):473.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRustin P, Bourgeron T, Parfait B, Chretien D, Munnich A, R\u0026ouml;tig A: Inborn errors of the Krebs cycle: a group of unusual mitochondrial diseases in human. \u003cem\u003eBiochimica et Biophysica Acta (BBA) - Molecular Basis of Disease\u003c/em\u003e 1997, 1361(2):185\u0026ndash;197.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHoekstra AS, Bayley J-P: The role of complex II in disease. \u003cem\u003eBiochimica et Biophysica Acta (BBA) - Bioenergetics\u003c/em\u003e 2013, 1827(5):543\u0026ndash;551.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Vranken JG, Na U, Winge DR, Rutter J: Protein-mediated assembly of succinate dehydrogenase and its cofactors. \u003cem\u003eCrit Rev Biochem Mol Biol\u003c/em\u003e 2015, 50(2):168\u0026ndash;180.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRenkema GH, Wortmann SB, Smeets RJ, Venselaar H, Antoine M, Visser G, Ben-Omran T, van den Heuvel LP, Timmers HJ, Smeitink JA \u003cem\u003eet al\u003c/em\u003e: SDHA mutations causing a multisystem mitochondrial disease: novel mutations and genetic overlap with hereditary tumors. \u003cem\u003eEur J Hum Genet\u003c/em\u003e 2015, 23(2):202\u0026ndash;209.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiemann S, M\u0026uuml;ller U: Mutations in SDHC cause autosomal dominant paraganglioma, type 3. \u003cem\u003eNat Genet\u003c/em\u003e 2000, 26(3):268\u0026ndash;270.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAstuti D, Latif F, Dallol A, Dahia PLM, Douglas F, George E, Sk\u0026ouml;ldberg F, Husebye ES, Eng C, Maher ER: Gene Mutations in the Succinate Dehydrogenase Subunit SDHB Cause Susceptibility to Familial Pheochromocytoma and to Familial Paraganglioma. \u003cem\u003eThe American Journal of Human Genetics\u003c/em\u003e 2001, 69(1):49\u0026ndash;54.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKing A, Selak MA, Gottlieb E: Succinate dehydrogenase and fumarate hydratase: linking mitochondrial dysfunction and cancer. \u003cem\u003eOncogene\u003c/em\u003e 2006, 25(34):4675\u0026ndash;4682.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAspuria P-JP, Lunt SY, V\u0026auml;remo L, Vergnes L, Gozo M, Beach JA, Salumbides B, Reue K, Wiedemeyer WR, Nielsen J \u003cem\u003eet al\u003c/em\u003e: Succinate dehydrogenase inhibition leads to epithelial-mesenchymal transition and reprogrammed carbon metabolism. \u003cem\u003eCancer \u0026amp; Metabolism\u003c/em\u003e 2014, 2(1):21.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBourgeron T, Rustin P, Chretien D, Birch-Machin M, Bourgeois M, Viegas-P\u0026eacute;quignot E, Munnich A, R\u0026ouml;tig A: Mutation of a nuclear succinate dehydrogenase gene results in mitochondrial respiratory chain deficiency. \u003cem\u003eNature Genetics\u003c/em\u003e 1995, 11(2):144\u0026ndash;149.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRustin P, R\u0026ouml;tig A: Inborn errors of complex II \u0026ndash; Unusual human mitochondrial diseases. \u003cem\u003eBiochimica et Biophysica Acta (BBA) - Bioenergetics\u003c/em\u003e 2002, 1553(1):117\u0026ndash;122.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBirch-Machin MA, Taylor RW, Cochran B, Ackrell BA, Turnbull DM: Late-onset optic atrophy, ataxia, and myopathy associated with a mutation of a complex II gene. \u003cem\u003eAnn Neurol\u003c/em\u003e 2000, 48(3):330\u0026ndash;335.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCourage C, Jackson CB, Hahn D, Euro L, Nuoffer J-M, Gallati S, Schaller A: SDHA mutation with dominant transmission results in complex II deficiency with ocular, cardiac, and neurologic involvement. \u003cem\u003eAmerican Journal of Medical Genetics Part A\u003c/em\u003e 2017, 173(1):225\u0026ndash;230.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePantaleo MA, Urbini M, Schipani A, Nannini M, Indio V, De Leo A, Vincenzi B, Brunello A, Grignani G, Casagrande M \u003cem\u003eet al\u003c/em\u003e: SDHA Germline Variants in Adult Patients With SDHA-Mutant Gastrointestinal Stromal Tumor. \u003cem\u003eFront Oncol\u003c/em\u003e 2021, 11:778461.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBurnichon N, Bri\u0026egrave;re JJ, Lib\u0026eacute; R, Vescovo L, Rivi\u0026egrave;re J, Tissier F, Jouanno E, Jeunemaitre X, B\u0026eacute;nit P, Tzagoloff A \u003cem\u003eet al\u003c/em\u003e: SDHA is a tumor suppressor gene causing paraganglioma. \u003cem\u003eHum Mol Genet\u003c/em\u003e 2010, 19(15):3011\u0026ndash;3020.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLussey-Lepoutre C, Hollinshead KER, Ludwig C, Menara M, Morin A, Castro-Vega L-J, Parker SJ, Janin M, Martinelli C, Ottolenghi C \u003cem\u003eet al\u003c/em\u003e: Loss of succinate dehydrogenase activity results in dependency on pyruvate carboxylation for cellular anabolism. \u003cem\u003eNature Communications\u003c/em\u003e 2015, 6(1):8784.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGuzy RD, Sharma B, Bell E, Chandel NS, Schumacker PT: Loss of the SdhB, but Not the SdhA, subunit of complex II triggers reactive oxygen species-dependent hypoxia-inducible factor activation and tumorigenesis. \u003cem\u003eMol Cell Biol\u003c/em\u003e 2008, 28(2):718\u0026ndash;731.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSelak MA, Armour SM, MacKenzie ED, Boulahbel H, Watson DG, Mansfield KD, Pan Y, Simon MC, Thompson CB, Gottlieb E: Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase. \u003cem\u003eCancer Cell\u003c/em\u003e 2005, 7(1):77\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVamecq J, Masso V, Bancel L-P, Jannin A, Dessein A-F, Cardot-Bauters C, Pigny P: Serum fatty acid profiling in patients with SDHx mutations: New advances on cellular metabolism in SDH deficiency. \u003cem\u003eBiochimie\u003c/em\u003e 2022, 201:196\u0026ndash;203.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eČun\u0026aacute;tov\u0026aacute; K, Vrback\u0026yacute; M, Puertas-Frias G, Al\u0026aacute;n L, Vanišov\u0026aacute; M, Saucedo-Rodr\u0026iacute;guez MJ, Houštěk J, Fern\u0026aacute;ndez-Vizarra E, Neužil J, Pecinov\u0026aacute; A \u003cem\u003eet al\u003c/em\u003e: Mitochondrial translation is the primary determinant of secondary mitochondrial complex I deficiencies. \u003cem\u003eiScience\u003c/em\u003e 2024, 27(8).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBezawork-Geleta A, Wen H, Dong L, Yan B, Vider J, Boukalova S, Krobova L, Vanova K, Zobalova R, Sobol M \u003cem\u003eet al\u003c/em\u003e: Alternative assembly of respiratory complex II connects energy stress to metabolic checkpoints. \u003cem\u003eNat Commun\u003c/em\u003e 2018, 9(1):2221.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIverson TM, Singh PK, Cecchini G: An evolving view of complex II-noncanonical complexes, megacomplexes, respiration, signaling, and beyond. \u003cem\u003eJ Biol Chem\u003c/em\u003e 2023, 299(6):104761.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrischigliaro M, Frigo E, Fernandez-Vizarra E, Bernardi P, Viscomi C: Measurement of mitochondrial respiratory chain enzymatic activities in Drosophila melanogaster samples. \u003cem\u003eSTAR Protoc\u003c/em\u003e 2022, 3(2):101322.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMaklashina E, Iverson TM, Cecchini G: How an assembly factor enhances covalent FAD attachment to the flavoprotein subunit of complex II. \u003cem\u003eJ Biol Chem\u003c/em\u003e 2022, 298(10):102472.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePuertas-Frias G, Jos\u0026eacute;-Saucedo-Rodr\u0026iacute;guez M, Čun\u0026aacute;tov\u0026aacute; K, Al\u0026aacute;n L, Hrb\u0026aacute;č P, Knězů M, Kon\u0026iacute;čkov\u0026aacute; S, Schimmer J, Krakovkov\u0026aacute; M, Vrback\u0026yacute; M \u003cem\u003eet al\u003c/em\u003e: Sequestration of the polyunsaturated fatty acids protects the cells with oxidative phosphorylation deficiency from ferroptosis. \u003cem\u003ebioRxiv\u003c/em\u003e 2025:2025.2010.2014.682423.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiang D, Minikes AM, Jiang X: Ferroptosis at the intersection of lipid metabolism and cellular signaling. \u003cem\u003eMol Cell\u003c/em\u003e 2022, 82(12):2215\u0026ndash;2227.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKent JD, Klug LR, Heinrich MC: A Novel Human SDHA-Knockout Cell Line Model for the Functional Analysis of Clinically Relevant SDHA Variants. \u003cem\u003eClin Cancer Res\u003c/em\u003e 2024, 30(23):5399\u0026ndash;5412.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMilenkovic D, Blaza JN, Larsson NG, Hirst J: The Enigma of the Respiratory Chain Supercomplex. \u003cem\u003eCell Metab\u003c/em\u003e 2017, 25(4):765\u0026ndash;776.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSchagger H, Pfeiffer K: Supercomplexes in the respiratory chains of yeast and mammalian mitochondria. \u003cem\u003eEMBO J\u003c/em\u003e 2000, 19(8):1777\u0026ndash;1783.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAc\u0026iacute;n-P\u0026eacute;rez R, Bayona-Bafaluy MP, Fern\u0026aacute;ndez-Silva P, Moreno-Loshuertos R, P\u0026eacute;rez-Martos A, Bruno C, Moraes CT, Enr\u0026iacute;quez JA: Respiratory complex III is required to maintain complex I in mammalian mitochondria. \u003cem\u003eMol Cell\u003c/em\u003e 2004, 13(6):805\u0026ndash;815.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDiaz F, Fukui H, Garcia S, Moraes CT: Cytochrome c oxidase is required for the assembly/stability of respiratory complex I in mouse fibroblasts. \u003cem\u003eMol Cell Biol\u003c/em\u003e 2006, 26(13):4872\u0026ndash;4881.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVercellino I, Sazanov LA: The assembly, regulation and function of the mitochondrial respiratory chain. \u003cem\u003eNat Rev Mol Cell Biol\u003c/em\u003e 2022, 23(2):141\u0026ndash;161.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eProtasoni M, P\u0026eacute;rez-P\u0026eacute;rez R, Lobo-Jarne T, Harbour ME, Ding S, Pe\u0026ntilde;as A, Diaz F, Moraes CT, Fearnley IM, Zeviani M \u003cem\u003eet al\u003c/em\u003e: Respiratory supercomplexes act as a platform for complex III-mediated maturation of human mitochondrial complexes I and IV. \u003cem\u003eEmbo j\u003c/em\u003e 2020, 39(3):e102817.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eČun\u0026aacute;tov\u0026aacute; K, Reguera DP, Vrback\u0026yacute; M, Fern\u0026aacute;ndez-Vizarra E, Ding S, Fearnley IM, Zeviani M, Houštěk J, Mr\u0026aacute;ček T, Pecina P: Loss of COX4I1 Leads to Combined Respiratory Chain Deficiency and Impaired Mitochondrial Protein Synthesis. \u003cem\u003eCells\u003c/em\u003e 2021, 10(2).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHao HX, Khalimonchuk O, Schraders M, Dephoure N, Bayley JP, Kunst H, Devilee P, Cremers CW, Schiffman JD, Bentz BG \u003cem\u003eet al\u003c/em\u003e: SDH5, a gene required for flavination of succinate dehydrogenase, is mutated in paraganglioma. \u003cem\u003eScience\u003c/em\u003e 2009, 325(5944):1139\u0026ndash;1142.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBezawork-Geleta A, Dong L, Rohlena J, Neuzil J: The Assembly Factor SDHAF2 Is Dispensable for Flavination of the Catalytic Subunit of Mitochondrial Complex II in Breast Cancer Cells. \u003cem\u003eJ Biol Chem\u003c/em\u003e 2016, 291(41):21414\u0026ndash;21420.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIverson TM, Maklashina E, Cecchini G: Structural basis for malfunction in complex II. \u003cem\u003eJ Biol Chem\u003c/em\u003e 2012, 287(42):35430\u0026ndash;35438.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBannon AE, Kent J, Forquer I, Town A, Klug LR, McCann K, Beadling C, Harismendy O, Sicklick JK, Corless C \u003cem\u003eet al\u003c/em\u003e: Biochemical, Molecular, and Clinical Characterization of Succinate Dehydrogenase Subunit A Variants of Unknown Significance. \u003cem\u003eClin Cancer Res\u003c/em\u003e 2017, 23(21):6733\u0026ndash;6743.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHart ML, Quon E, Vigil ABG, Engstrom IA, Newsom OJ, Davidsen K, Hoellerbauer P, Carlisle SM, Sullivan LB: Mitochondrial redox adaptations enable alternative aspartate synthesis in SDH-deficient cells. \u003cem\u003eElife\u003c/em\u003e 2023, 12.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAst T, Itoh Y, Sadre S, McCoy JG, Namkoong G, Wengrod JC, Chicherin I, Joshi PR, Kamenski P, Suess DLM \u003cem\u003eet al\u003c/em\u003e: METTL17 is an Fe-S cluster checkpoint for mitochondrial translation. \u003cem\u003eMol Cell\u003c/em\u003e 2024, 84(2):359\u0026ndash;374 e358.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCardaci S, Zheng L, MacKay G, van den Broek NJ, MacKenzie ED, Nixon C, Stevenson D, Tumanov S, Bulusu V, Kamphorst JJ \u003cem\u003eet al\u003c/em\u003e: Pyruvate carboxylation enables growth of SDH-deficient cells by supporting aspartate biosynthesis. \u003cem\u003eNat Cell Biol\u003c/em\u003e 2015, 17(10):1317\u0026ndash;1326.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHan J, Back SH, Hur J, Lin YH, Gildersleeve R, Shan J, Yuan CL, Krokowski D, Wang S, Hatzoglou M \u003cem\u003eet al\u003c/em\u003e: ER-stress-induced transcriptional regulation increases protein synthesis leading to cell death. \u003cem\u003eNat Cell Biol\u003c/em\u003e 2013, 15(5):481\u0026ndash;490.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMick E, Titov DV, Skinner OS, Sharma R, Jourdain AA, Mootha VK: Distinct mitochondrial defects trigger the integrated stress response depending on the metabolic state of the cell. \u003cem\u003eElife\u003c/em\u003e 2020, 9.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePajuelo Reguera D, Čun\u0026aacute;tov\u0026aacute; K, Vrback\u0026yacute; M, Pecinov\u0026aacute; A, Houštěk J, Mr\u0026aacute;ček T, Pecina P: Cytochrome c Oxidase Subunit 4 Isoform Exchange Results in Modulation of Oxygen Affinity. In: \u003cem\u003eCells.\u003c/em\u003e vol. 9; 2020.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWittig I, Braun HP, Sch\u0026auml;gger H: Blue native PAGE. \u003cem\u003eNat Protoc\u003c/em\u003e 2006, 1(1):418\u0026ndash;428.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGnaiger E, Kuznetsov A, Schneeberger S, Seiler R, Brandacher G, Steurer W, Margreiter R: Life in the Cold. In: \u003cem\u003eEleventh International Hibernation Symposium: 2000\u003c/em\u003e. Springer Nature: 431\u0026ndash;442.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBafunno V, Giancaspero TA, Brizio C, Bufano D, Passarella S, Boles E, Barile M: Riboflavin uptake and FAD synthesis in Saccharomyces cerevisiae mitochondria: involvement of the Flx1p carrier in FAD export. \u003cem\u003eJ Biol Chem\u003c/em\u003e 2004, 279(1):95\u0026ndash;102.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCajka T, Hricko J, Rudl Kulhava L, Paucova M, Novakova M, Kuda O: Optimization of Mobile Phase Modifiers for Fast LC-MS-Based Untargeted Metabolomics and Lipidomics. \u003cem\u003eInt J Mol Sci\u003c/em\u003e 2023, 24(3).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopes M, Brejchova K, Riecan M, Novakova M, Rossmeisl M, Cajka T, Kuda O: Metabolomics atlas of oral 13C-glucose tolerance test in mice. \u003cem\u003eCell Rep\u003c/em\u003e 2021, 37(2):109833.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBrejchova K, Rahm M, Benova A, Domanska V, Reyes-Gutierez P, Dzubanova M, Trubacova R, Vondrackova M, Cajka T, Tencerova M \u003cem\u003eet al\u003c/em\u003e: Uncovering mechanisms of thiazolidinediones on osteogenesis and adipogenesis using spatial fluxomics. \u003cem\u003eMetabolism\u003c/em\u003e 2025, 166:156157.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePecina P, Cunatova K, Kaplanova V, Puertas-Frias G, Silhavy J, Tauchmannova K, Vrbacky M, Cajka T, Gahura O, Hlavackova M \u003cem\u003eet al\u003c/em\u003e: Haplotype variability in mitochondrial rRNA predisposes to metabolic syndrome. \u003cem\u003eCommun Biol\u003c/em\u003e 2024, 7(1):1116.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJohnston HE, Yadav K, Kirkpatrick JM, Biggs GS, Oxley D, Kramer HB, Samant RS: Solvent Precipitation SP3 (SP4) Enhances Recovery for Proteomics Sample Preparation without Magnetic Beads. \u003cem\u003eAnal Chem\u003c/em\u003e 2022, 94(29):10320\u0026ndash;10328.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeng EC, Goddard TD, Pettersen EF, Couch GS, Pearson ZJ, Morris JH, Ferrin TE: UCSF ChimeraX: Tools for structure building and analysis. \u003cem\u003eProtein Sci\u003c/em\u003e 2023, 32(11):e4792.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePettersen EF, Goddard TD, Huang CC, Meng EC, Couch GS, Croll TI, Morris JH, Ferrin TE: UCSF ChimeraX: Structure visualization for researchers, educators, and developers. \u003cem\u003eProtein Sci\u003c/em\u003e 2021, 30(1):70\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePerez-Riverol Y, Bandla C, Kundu DJ, Kamatchinathan S, Bai J, Hewapathirana S, John NS, Prakash A, Walzer M, Wang S \u003cem\u003eet al\u003c/em\u003e: The PRIDE database at 20 years: 2025 update. \u003cem\u003eNucleic Acids Res\u003c/em\u003e 2025, 53(D1):D543-D553.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDu Z, Zhou X, Lai Y, Xu J, Zhang Y, Zhou S, Feng Z, Yu L, Tang Y, Wang W \u003cem\u003eet al\u003c/em\u003e: Structure of the human respiratory complex II. \u003cem\u003eProceedings of the National Academy of Sciences\u003c/em\u003e 2023, 120(18):e2216713120.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"bmc-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Biology](https://bmcbiol.biomedcentral.com/)","snPcode":"12915","submissionUrl":"https://submission.springernature.com/new-submission/12915/3","title":"BMC Biology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Succinate dehydrogenase, SDHA, oxidative phosphorylation, mitochondrial metabolism, complex II, metabolomics, lipid metabolism","lastPublishedDoi":"10.21203/rs.3.rs-8568560/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8568560/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eSuccinate dehydrogenase (SDH), also known as complex II, connects the tricarboxylic acid cycle with oxidative phosphorylation, and mutations in its subunits are linked to mitochondrial disease and cancer. However, the molecular consequences of SDHA pathogenic variants remain poorly understood. Here, we generated a panel of patient-derived SDHA variants in an SDHA knockout HEK293 cell model and examined their effects on SDH assembly, function, and cellular metabolism.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eWe found that SDHA mutations differentially affect SDH assembly and stability, yet most variants display severely impaired catalytic activity, despite partial or complete enzyme assembly. Loss of SDH function reduced succinate-driven respiration, altered the content of complexes I and IV, and shifted respiration toward NADH-supported pathways. Metabolomic and lipidomic analyses revealed extensive metabolic remodeling, including reorganization of the tricarboxylic acid cycle, succinate accumulation, and adaptive regulation of polyunsaturated fatty acid metabolism. Variants retaining partial SDH activity exhibited intermediate structural, functional, and metabolic phenotypes.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eThese findings define how different pathogenic variants of SDHA disrupt SDH structure and function, drive divergent metabolic adaptations, and provide mechanistic insight into the heterogeneous disease manifestations associated with SDHA deficiency.\u003c/p\u003e","manuscriptTitle":"Molecular Consequences of Pathogenic SDHA Variants: From Defective Flavinylation and Assembly to Lipid Remodeling","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2026-01-21 03:59:48","doi":"10.21203/rs.3.rs-8568560/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"102103340347709135210933045151910754309","date":"2026-05-02T06:50:08+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2026-04-20T17:04:13+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"93648702904682240171537236086975875966","date":"2026-03-23T09:38:51+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"98531796746853088821888379994623665670","date":"2026-02-08T15:15:13+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2026-01-15T14:48:13+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2026-01-13T12:47:59+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2026-01-12T09:58:33+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Biology","date":"2026-01-10T13:23:25+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"bmc-biology","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Biology](https://bmcbiol.biomedcentral.com/)","snPcode":"12915","submissionUrl":"https://submission.springernature.com/new-submission/12915/3","title":"BMC Biology","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"cb59d9df-53d2-4873-b61a-ffed4e7a8186","owner":[],"postedDate":"January 21st, 2026","published":true,"recentEditorialEvents":[{"type":"reviewerAgreed","content":"102103340347709135210933045151910754309","date":"2026-05-02T06:50:08+00:00","index":61,"fulltext":""}],"rejectedJournal":[],"revision":"","amendment":"","status":"under-review","subjectAreas":[],"tags":[],"updatedAt":"2026-01-21T03:59:48+00:00","versionOfRecord":[],"versionCreatedAt":"2026-01-21 03:59:48","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-8568560","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8568560","identity":"rs-8568560","version":["v1"]},"buildId":"XKTyCvWXoU3ODBz1xrDgd","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.