Glutamic Acid at position 168 is a constitutive activator of Tank Binding Kinase 1 catalytic function

Glutamic Acid at position 168 is a constitutive activator of Tank Binding Kinase 1 catalytic function | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Short Report Glutamic Acid at position 168 is a constitutive activator of Tank Binding Kinase 1 catalytic function Noopur Bhore, Anubhuti Sarkar, Zhi Yao, Susanne Herbst, Patrick A. Lewis This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7357205/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 05 Nov, 2025 Read the published version in NeuroMolecular Medicine → Version 1 posted 14 You are reading this latest preprint version Abstract TANK binding kinase 1 (TBK1) is serine/threonine protein kinase member of the inhibitor of nuclear factor-kB kinase family, with links to the etiology of familial as well as idiopathic Amyotrophic Lateral Sclerosis. It contributes to several regulatory cellular processes such as autophagy, inflammation and apoptosis. Reduction or loss of TBK1 kinase activity is associated with increased risk of ALS, and so understanding the molecular basis of this activity is an important research priority. In this current study, the role of the E168 residue, located adjacent to the active site of TBK1, has been assessed using a combination of artificial and naturally occurring variants found at this codon – evaluated using multiple readouts for TBK1 kinase activity. The results suggest that the negative charge resulting from the presence of a glutamic acid at this codon is a constitutive activator of TBK1 activity. TBK1 ALS Kinase mutations kinase activity p62 RAB7 phosphorylation Figures Figure 1 Figure 2 Introduction Amyotrophic Lateral Sclerosis (ALS) is a progressive, fatal, and multifactorial neurodegenerative disorder characterized by the selective degeneration of upper and lower motor neurons, resulting in the denervation and subsequent atrophy of skeletal muscle fibers, leading to progressive motor impairment and respiratory failure, with a median survival age of 2–5 years following diagnosis (Chio et al. 2009 ; Sacks et al. 2022 ; Peters et al. 2015 ). Mendelian Studies have identified multiple loci with a strong predisposition linked to ALS, including hexanucleotide expansions in chromosome 9 open reading frame 72 ( C9orf72 ),and mutations in superoxide dismutase 1 (SOD1) , TAR DNA-binding protein 43 (TARDBP) , fused in sarcoma (FUS) , Optineurin (OPTN) and TANK-binding kinase 1 (TBK1) (Renton et al. 2011 ; Rosen et al. 1993 ; Sreedharan et al. 2008 ; Vance et al. 2009 ; Maruyama et al. 2010 ; Freischmidt et al. 2015 ). TBK1 is a 729-amino acid, multifunction serine/threonine kinase belonging to the inhibitor of nuclear factor-kB (IKK) family, playing a pivotal role in regulating autophagosome-mediated degradation of ubiquitinated cargo and orchestrating inflammatory responses through substrate phosphorylation of autophagy adaptors (Freischmidt et al. 2015 ; Oakes et al. 2017 ). TBK1 is highly expressed in neuronal and glial cells of brain regions essential for learning and memory, movement, balance and posture, and other executive functions (Oakes et al. 2017 ). Dysfunction of TBK1 is linked to a number of human diseases, most prominently (ALS) and ALS/frontotemporal dementia (ALS/FTD), but also herpes simplex encephalitis (HSE), diabetes, obesity, cancer, and normal tension glaucoma (NTG) (Ahmad et al. 2016 ). TBK1 has multiple roles within the cell, activating immunological response to viral or proteostatic stress stimuli, endosomal response, autophagy, or apoptosis (Oakes et al. 2017 ; Runde et al. 2022 ; Ahmad et al. 2016 ; Shao et al. 2022 ; Talaia et al. 2024 ; Harding et al. 2021 ; Fischer et al. 2025 ; Lu et al. 2021 ). Genetic studies have identified over 90 distinct mutations in Tank-Binding Kinase 1 (TBK1) across sporadic and familial ALS cases, highlighting its critical role in disease pathogenesis (Freischmidt et al. 2017 ; Harding et al. 2021 ). These mutations span nonsense, frameshift, missense, and single amino acid deletions, each exhibiting distinct functional consequences (Oakes et al. 2017 ). While nonsense and frameshift mutations significantly disrupt TBK1 expression at both the mRNA and protein levels—suggesting haploinsufficiency as a potential pathogenic mechanism—missense variants and small deletions exert more nuanced effects that may not necessarily reduce protein abundance (Freischmidt et al. 2015 ; Pottier et al. 2015 ). ALS-associated TBK1 mutations impair key functional attributes, including dimerization, interaction with mitophagy receptor optineurin (OPTN), autoactivation, and substrate phosphorylation (Li et al. 2016 ; Ye et al. 2019 ; de Majo et al. 2018 ). Despite extensive investigation, there are a number of aspects of TBK1 enzymatic function, as well as dysfunction in disease, that remain unclear. Using a combination of homology modelling and directed mutagenesis, in this current study the role of a key glutamic acid residue, E168, located in the activation loop of the kinase domain of TBK1, has been investigated to examine its contribution to TBK1 kinase activity. Materials and Methods Post translational modifications Data for post translational modification of TBK1, IKKa, IKKb and IKKe were accessed through the phosphosite portal (Hornbeck et al. 2015 ). Sequence Alignment The protein sequences of TBK1 (NP_037386.1; 1-729 aa), IKKa (NP_001269.3; 1-745 aa), IKKb (NP_001547.1; 1-756 aa) and IKKe (NP_054721.1; 1-716 aa) were obtained from the National Center for Biotechnology Information (NCBI) and aligned using the Needleman-Wunsch algorithm (Sayers et al. 2024 ). Structural Modelling The orientation of E168 of TBK1 was assessed in a crystal structure of a dimer of full-length, active, S172-phosphorylated TBK1(PDB ID: 4IW0) (Larabi et al. 2013 ). The full-length dimer structure of IKKα phosphorylated at S176 and S180 was modelled using the AlphaFold3 server (Abramson et al. 2024 ) and the highest confidence structure was used to estimate the orientation of pS176. All structures were displayed using Mol*Viewer (Sehnal et al. 2021 ). Plasmids The open reading frame of human TBK1 (NM_013254) cloned into pcDNA3.1(+)-C-HA was obtained from GenScript. Point mutations were introduced by site-directed mutagenesis using the Q5®-site directed mutagenesis kit (E0552S, New England Biolabs). The following plasmids were generated – TBK1-E168A, TBK1-E168S, TBK1-E168K, and TBK1-S172A. The plasmid sequences were verified by Sanger sequencing courtesy of Genewiz (Azenta Life Sciences). The plasmids were maintained in E. coli DH5α (11583117, Thermo Scientific) and isolated using the QIAprep spin miniprep plasmid extraction kit (27106, QIAgen). For transfections, Fugene® HD reagent (E2311, Promega) was used according to the manufacturer’s instructions in a 1:3 DNA: Reagent ratio. Mock controls were treated with the transfection reagent, but no plasmids were used. Primer sequences used for site-directed mutagenesis are as follows: Primer Name Nucleotide Sequence E168A_Forward AGAAGATGATGCGCAGTTTGTTTCTCTGTATG E168A_Reverse AATTCTCTAGCTGCACCAAAATCTG E168S_Forward AGAAGATGATTCGCAGTTTGTTTCTCTGTATG E168S_Reverse AATTCTCTAGCTGCACCAAAATC E168K_Forward AGAAGATGATAAGCAGTTTGTTTCTCTGTATG E168K_Reverse AATTCTCTAGCTGCACCAAAATCT S172A_Forward GCAGTTTGTTGCTCTGTATGGCA S172A_Reverse TCATCATCTTCTAATTCTCTAGCTGC Cell culture Human embryonic kidney derived HEK293T/17 (CRL 11268) [hereafter referred as HEK293] adherent cells procured from American Type Culture Collection (ATCC) were cultured in Dulbecco’s Modified Eagle Medium (DMEM) and 10% fetal bovine serum (FBS) (A5670701, Thermo Scientific) without the addition of any antibiotics. Cells were seeded in a 12-well plate for the western blotting experiments at a density of 2.5x10 5 cells per well. Cells were reverse transfected with the plasmids of interest (1 µg per well) for 48 hours and incubated at 37°C with 5% CO 2 , before being treated with 1µM TBK1-inhibitor GSK8612 (S8872, Sellekchem) in DMEM + 10% FBS, for an hour. The cells were then harvested and processed for immunoblotting. Immunoblotting The harvested cells were lysed in a cell lysis buffer (9803S, Cell Signaling Technology) supplemented with Halt™ protease inhibitor cocktail (1861280, Thermo Scientific) and then treated with a sample loading buffer. The loading samples were denatured at 80°C for 8 minutes, centrifuged at 5000x g for 1 minute, and the supernatant loaded onto a NuPAGE 4–12% precast gel (10338442, Fisher Scientific) for western blotting. The gels were then transferred onto TransBlot® Turbo™ PVDF membranes (1704156, Bio-Rad) and blocked using 5% milk in 1x TBST (Tris-buffered saline, 0.05% Tween 20) for 1 hour. The blocked membranes were subjected to overnight incubation with the antibody preparation as follows: Anti-phospho TBK1 (D5C2, 5483S, Cell Signaling Technology), Anti-TBK1 (3013S, Cell Signaling Technology), Anti-phospho RAB7 (AB302494, Abcam), Anti-RAB7 (E907E, 95746S, Cell Signaling Technology), Anti-β-actin HRP (A3864, Sigma), and Anti-HA tag (H3663, Sigma). All the primary antibodies were diluted 1:1000. The secondary antibodies used were goat Anti-Rabbit HRP (A0545, Sigma) and goat Anti-Mouse HRP (A3682, Sigma) at a concentration of 1:10,000 in 5% milk prepared with 1x TBST for 1 hour at ambient temperature. The blots were imaged using horse-radish peroxidase chemiluminescent substrate on an iBright™ imager (Thermo Fisher Scientific). Statistical Analysis The immunoblot results were analyzed using GraphPad Prism 10.3.1. All statistics employed an ordinary one-way ANOVA test followed by Dunnett’s multiple comparisons post-hoc test. Graphs represent the mean ± standard error of the mean of 4 independent experiments, where each repeat further comprised of technical duplicates. Results To investigate the phosphoregulation of TBK1, post-translational modification data for each of the IKK family was accessed through the phosphosite portal. This revealed distinct patterns of phosphorylation across the family ( figure S1 and S2 , and tables S1-4 ). Focusing on phosphorylation of the kinase domains of the IKKs, a divergence between IKKa and IKKb, and TBK1 and IKKe, was observed – consistent with previous analyses. Dual phosphorylation was observed in IKKa and IKKb, (at residues S176/S180, and S177/S181 respectively), and a single phosphorylation event in TBK1 and IKKe, at S172 residue – with S176 in IKKa, S177 in IKKb and S172 in TBK1/IKKe being conserved across the family (Fig. 1 A). Intriguingly, both TBK1 and IKKe shared a glutamic acid (E168 in both kinases) at the equivalent residue to the S176/S177 residue in IKKa and IKKb. Analysis of the crystal structures for TBK1 and a structural model of phosphorylated IKKa revealed that the S176 and E168 residues are spatially homologous (Fig. 1 B-C). Notably, the glutamic acid at this residue in TBK1 provides a negative charge with some functional overlap with phospho-serine in IKKa/b, with the serine residue in the latter providing modifiable phospho-regulation of this location. Previous studies of S176 and S177 in IKKa/b have tested the role of this residue by mutating it to either an alanine (incapable of phosphorylation) or glutamic acid (acting as a phosphomimetic) (Ling et al. 1998 ; Delhase et al. 1999 ). These data suggest that in IKKa/b, this residue acts as a key regulator of kinase activity – with a glutamic acid phosphomimetic acting to constitutively activate the kinase activity of these proteins. To examine whether the E168 residue is polymorphic in human populations, variation at this codon was assessed using the Gnomad dataset, revealing a single E168K variant. To test the biochemical role of the E168 residue, and the consequences of variation at this codon, HA epitope tagged TBK1 constructs for wildtype, E168A (removing the negative charge), E168S (equivalent to the homologous residue in IKKa/b), and E168K were transfected into HEK293 cells. Phosphorylation of TBK1 at S172, as well as Rab7 at S72 as a validated substrate for TBK1, was evaluated by immunoblot (Fig. 2 ). As expected, inhibition of TBK1 resulted in a dramatic decrease in kinase activity as indicated by phosphorylation of Rab7. Mutation of the S172 residue to an alanine likewise resulted in ablation of kinase activity, as previously reported (Kishore et al. 2002 ). Examining the impact of the E168 variants, all three significantly reduced TBK1 kinase activity. E168A and E168S lowered phosphorylation of the S172 residue by ≈ 80% compared to wild type, with E168K reducing phosphorylation below the threshold of detection. This was also the case for TBK1 kinase activity directed towards Rab7 S72. These data support a critical role for the E168 residue in regulating the kinase activity of TBK1. Discussion The TBK1 gene contributes to risk of developing ALS/FTD as both a monogenic Mendelian locus and via common variation as a risk locus. As such, and coupled to its status as a kinase regulator of signal transduction pathways, it is a strong candidate for modulation as a drug target for these disorders. However, the gaps in our understanding of how TBK1 functions with regard to its enzymatic function and the complexities of its signaling network present substantial obstacles to drug development. There is a particular medicinal chemistry challenge with regard to the genetic data supporting a boosting of TBK1 activity as being potentially beneficial, requiring small molecule allosteric activators rather than inhibitors. In order to better understand the activation of TBK1, in this study a comparative analysis of post-translational modification across the IKK family was carried out, identifying a key glutamic acid residue at codon 168 in TBK1 and IKKe that is homologous to a modifiable – and phosphorylated – serine in IKKa and IKKb. This residue sits within the activation loop of TBK1, critical to kinase regulation and activity (Adams 2003 ; Reinhardt and Leonard 2023 ). Based upon this homology, the role of the E168 residue was tested by mutating it to alanine and serine, as well as to a lysine variant identified in the Gnomad dataset. All three variants significantly reduced TBK1 kinase activity as measured by autophosphorylation, suggesting that the negative charge imparted by the side chain of glutamic acid is a required for the kinase function of TBK1. These data also suggest that naturally occurring loss-of-function variants at this residue, such as the E168K variant, may act as a risk factor for ALS/FTD. The results of this study highlight the critical role of residues around the active site of TBK1 for activity, and supports further investigation as to whether targeting this residue could facilitate modulation of TBK1 kinase. Abbreviations A Alanine amino acid E Glutamate amino acid K Lysine amino acid S Serine amino acid ALS Amyotrophic lateral Sclerosis C9orf72 Chromosome 9 Open Reading Frame 72 FTD Frontotemporal dementia FUS Fused in sarcoma GoF Gain of function mutations HEK293 Human embryonic kidney cells IKK Inhibitor of nuclear factor kappa-B LoF Loss of function mutations Nf-κB Nuclear Factor Kappa-B p- phosphorylated p62 Phosphotyrosine-Independent Ligand For The Lck SH2 Domain Of 62 KDa RAB7 Ras-related protein TBK1 TANK-binding kinase 1 TDP-43 TAR DNA-binding protein 43 Declarations Acknowledgements This study was funded by the My Name’5 Doddie Foundation (grant MN5DF/CAAu23/100008). PAL is a Royal Society Industry research fellow in partnership with LifeArc (IF\R2\222002). Author Contributions PAL conceptualized the study. NB, SH and PAL designed the experiments. AS, NB, SH, and PAL performed the experiments, analyzed the data, and wrote the manuscript. All authors edited the manuscript and approved the final draft for publication. References Abramson, J., Adler, J., Dunger, J., Evans, R., Green, T., Pritzel, A., et al. (2024). Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature, 630 (8016), 493-500, doi:10.1038/s41586-024-07487-w. Adams, J. A. (2003). Activation loop phosphorylation and catalysis in protein kinases: is there functional evidence for the autoinhibitor model? Biochemistry, 42 (3), 601-607, doi:10.1021/bi020617o. Ahmad, L., Zhang, S. Y., Casanova, J. L., & Sancho-Shimizu, V. (2016). Human TBK1: A Gatekeeper of Neuroinflammation. Trends Mol Med, 22 (6), 511-527, doi:10.1016/j.molmed.2016.04.006. Chio, A., Logroscino, G., Hardiman, O., Swingler, R., Mitchell, D., Beghi, E., et al. (2009). Prognostic factors in ALS: A critical review. Amyotroph Lateral Scler, 10 (5-6), 310-323, doi:10.3109/17482960802566824. de Majo, M., Topp, S. D., Smith, B. N., Nishimura, A. L., Chen, H. J., Gkazi, A. S., et al. (2018). ALS-associated missense and nonsense TBK1 mutations can both cause loss of kinase function. Neurobiol Aging, 71 , 266 e261-266 e210, doi:10.1016/j.neurobiolaging.2018.06.015. Delhase, M., Hayakawa, M., Chen, Y., & Karin, M. (1999). Positive and negative regulation of IkappaB kinase activity through IKKbeta subunit phosphorylation. Science, 284 (5412), 309-313, doi:10.1126/science.284.5412.309. Fischer, F. A., Demarco, B., Min, F. C. H., Yeap, H. W., De Nardo, D., Chen, K. W., et al. (2025). TBK1 and IKKepsilon prevent premature cell death by limiting the activity of both RIPK1 and NLRP3 death pathways. Sci Adv, 11 (10), eadq1047, doi:10.1126/sciadv.adq1047. Freischmidt, A., Muller, K., Ludolph, A. C., Weishaupt, J. H., & Andersen, P. M. (2017). Association of Mutations in TBK1 With Sporadic and Familial Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. JAMA Neurol, 74 (1), 110-113, doi:10.1001/jamaneurol.2016.3712. Freischmidt, A., Wieland, T., Richter, B., Ruf, W., Schaeffer, V., Muller, K., et al. (2015). Haploinsufficiency of TBK1 causes familial ALS and fronto-temporal dementia. Nat Neurosci, 18 (5), 631-636, doi:10.1038/nn.4000. Harding, O., Evans, C. S., Ye, J., Cheung, J., Maniatis, T., & Holzbaur, E. L. F. (2021). ALS- and FTD-associated missense mutations in TBK1 differentially disrupt mitophagy. Proc Natl Acad Sci U S A, 118 (24), doi:10.1073/pnas.2025053118. Hornbeck, P. V., Zhang, B., Murray, B., Kornhauser, J. M., Latham, V., & Skrzypek, E. (2015). PhosphoSitePlus, 2014: mutations, PTMs and recalibrations. Nucleic Acids Res, 43 (Database issue), D512-520, doi:10.1093/nar/gku1267. Kishore, N., Huynh, Q. K., Mathialagan, S., Hall, T., Rouw, S., Creely, D., et al. (2002). IKK-i and TBK-1 are enzymatically distinct from the homologous enzyme IKK-2: comparative analysis of recombinant human IKK-i, TBK-1, and IKK-2. J Biol Chem, 277 (16), 13840-13847, doi:10.1074/jbc.M110474200. Larabi, A., Devos, J. M., Ng, S. L., Nanao, M. H., Round, A., Maniatis, T., et al. (2013). Crystal structure and mechanism of activation of TANK-binding kinase 1. Cell Rep, 3 (3), 734-746, doi:10.1016/j.celrep.2013.01.034. Li, F., Xie, X., Wang, Y., Liu, J., Cheng, X., Guo, Y., et al. (2016). Structural insights into the interaction and disease mechanism of neurodegenerative disease-associated optineurin and TBK1 proteins. Nat Commun, 7 , 12708, doi:10.1038/ncomms12708. Ling, L., Cao, Z., & Goeddel, D. V. (1998). NF-kappaB-inducing kinase activates IKK-alpha by phosphorylation of Ser-176. Proc Natl Acad Sci U S A, 95 (7), 3792-3797, doi:10.1073/pnas.95.7.3792. Lu, Y., Almeida, S., & Gao, F. B. (2021). TBK1 haploinsufficiency in ALS and FTD compromises membrane trafficking. Acta Neuropathol, 142 (1), 217-221, doi:10.1007/s00401-021-02331-1. Maruyama, H., Morino, H., Ito, H., Izumi, Y., Kato, H., Watanabe, Y., et al. (2010). Mutations of optineurin in amyotrophic lateral sclerosis. Nature, 465 (7295), 223-226, doi:10.1038/nature08971. Oakes, J. A., Davies, M. C., & Collins, M. O. (2017). TBK1: a new player in ALS linking autophagy and neuroinflammation. Mol Brain, 10 (1), 5, doi:10.1186/s13041-017-0287-x. Peters, O. M., Ghasemi, M., & Brown, R. H., Jr. (2015). Emerging mechanisms of molecular pathology in ALS. J Clin Invest, 125 (5), 1767-1779, doi:10.1172/JCI71601. Pottier, C., Bieniek, K. F., Finch, N., van de Vorst, M., Baker, M., Perkersen, R., et al. (2015). Whole-genome sequencing reveals important role for TBK1 and OPTN mutations in frontotemporal lobar degeneration without motor neuron disease. Acta Neuropathol, 130 (1), 77-92, doi:10.1007/s00401-015-1436-x. Reinhardt, R., & Leonard, T. A. (2023). A critical evaluation of protein kinase regulation by activation loop autophosphorylation. Elife, 12 , doi:10.7554/eLife.88210. Renton, A. E., Majounie, E., Waite, A., Simon-Sanchez, J., Rollinson, S., Gibbs, J. R., et al. (2011). A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD. Neuron, 72 (2), 257-268, doi:10.1016/j.neuron.2011.09.010. Rosen, D. R., Siddique, T., Patterson, D., Figlewicz, D. A., Sapp, P., Hentati, A., et al. (1993). Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature, 362 (6415), 59-62, doi:10.1038/362059a0. Runde, A. P., Mack, R., S, J. P., & Zhang, J. (2022). The role of TBK1 in cancer pathogenesis and anticancer immunity. J Exp Clin Cancer Res, 41 (1), 135, doi:10.1186/s13046-022-02352-y. Sacks, B., Bashford, J., Wijesekera, L., Leigh, P. N., & Sreedharan, J. (2022). Motor Neuron Disease: Amyotrophic Lateral Sclerosis. In D. W. Pfaff, N. D. Volkow, & J. L. Rubenstein (Eds.), Neuroscience in the 21st Century: From Basic to Clinical (pp. 4221-4271). Cham: Springer International Publishing. Sayers, E. W., Beck, J., Bolton, E. E., Brister, J. R., Chan, J., Comeau, D. C., et al. (2024). Database resources of the National Center for Biotechnology Information. Nucleic Acids Res, 52 (D1), D33-D43, doi:10.1093/nar/gkad1044. Sehnal, D., Bittrich, S., Deshpande, M., Svobodova, R., Berka, K., Bazgier, V., et al. (2021). Mol* Viewer: modern web app for 3D visualization and analysis of large biomolecular structures. Nucleic Acids Res, 49 (W1), W431-W437, doi:10.1093/nar/gkab314. Shao, W., Todd, T. W., Wu, Y., Jones, C. Y., Tong, J., Jansen-West, K., et al. (2022). Two FTD-ALS genes converge on the endosomal pathway to induce TDP-43 pathology and degeneration. Science, 378 (6615), 94-99, doi:10.1126/science.abq7860. Sreedharan, J., Blair, I. P., Tripathi, V. B., Hu, X., Vance, C., Rogelj, B., et al. (2008). TDP-43 mutations in familial and sporadic amyotrophic lateral sclerosis. Science, 319 (5870), 1668-1672, doi:10.1126/science.1154584. Talaia, G., Bentley-DeSousa, A., & Ferguson, S. M. (2024). Lysosomal TBK1 responds to amino acid availability to relieve Rab7-dependent mTORC1 inhibition. EMBO J, 43 (18), 3948-3967, doi:10.1038/s44318-024-00180-8. Vance, C., Rogelj, B., Hortobagyi, T., De Vos, K. J., Nishimura, A. L., Sreedharan, J., et al. (2009). Mutations in FUS, an RNA processing protein, cause familial amyotrophic lateral sclerosis type 6. Science, 323 (5918), 1208-1211, doi:10.1126/science.1165942. Ye, J., Cheung, J., Gerbino, V., Ahlsen, G., Zimanyi, C., Hirsh, D., et al. (2019). Effects of ALS-associated TANK binding kinase 1 mutations on protein-protein interactions and kinase activity. Proc Natl Acad Sci U S A, 116 (49), 24517-24526, doi:10.1073/pnas.1915732116. Supplementary Table and Figure Supplementary Table and Figure are not available with this version. Additional Declarations No competing interests reported. Cite Share Download PDF Status: Published Journal Publication published 05 Nov, 2025 Read the published version in NeuroMolecular Medicine → Version 1 posted Editorial decision: Revision requested 24 Sep, 2025 Reviews received at journal 24 Sep, 2025 Reviews received at journal 24 Sep, 2025 Reviews received at journal 19 Sep, 2025 Reviewers agreed at journal 08 Sep, 2025 Reviewers agreed at journal 08 Sep, 2025 Reviewers agreed at journal 08 Sep, 2025 Reviewers agreed at journal 05 Sep, 2025 Reviewers agreed at journal 03 Sep, 2025 Reviewers agreed at journal 03 Sep, 2025 Reviewers invited by journal 03 Sep, 2025 Editor assigned by journal 12 Aug, 2025 Submission checks completed at journal 12 Aug, 2025 First submitted to journal 12 Aug, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7357205","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Short Report","associatedPublications":[],"authors":[{"id":499696177,"identity":"fb6a50ae-ebe4-4cce-a46f-bfb1b9ff6687","order_by":0,"name":"Noopur Bhore","email":"","orcid":"","institution":"Royal Veterinary College","correspondingAuthor":false,"prefix":"","firstName":"Noopur","middleName":"","lastName":"Bhore","suffix":""},{"id":499696179,"identity":"06713db8-5bec-45dd-a2d4-1d8c9d3e6e56","order_by":1,"name":"Anubhuti Sarkar","email":"","orcid":"","institution":"University College London","correspondingAuthor":false,"prefix":"","firstName":"Anubhuti","middleName":"","lastName":"Sarkar","suffix":""},{"id":499696182,"identity":"9c120021-f4d7-4a65-9dc2-770c4992b41f","order_by":2,"name":"Zhi Yao","email":"","orcid":"","institution":"LifeArc","correspondingAuthor":false,"prefix":"","firstName":"Zhi","middleName":"","lastName":"Yao","suffix":""},{"id":499696184,"identity":"8f72d706-c48a-44bf-b82f-7e7b470be8c3","order_by":3,"name":"Susanne Herbst","email":"","orcid":"","institution":"Royal Veterinary College","correspondingAuthor":false,"prefix":"","firstName":"Susanne","middleName":"","lastName":"Herbst","suffix":""},{"id":499696186,"identity":"bdf2e84d-479b-4079-a9a4-43f61fee9e1c","order_by":4,"name":"Patrick A. Lewis","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvElEQVRIiWNgGAWjYDACdiBOYLCB8w0Ia2EGa0kjVQsDw2EStJgzMx+TePDnfL7B8QOMH34wHDYmqMWymS1NIrHttuWGMwnMkj0Mh80IajE4zGN2I7HhtoHkDAYGaaALbYjQwv/tRsKfcyAtzL+J1MLDdiOB7YABvwQDG8gWwg4D+sX8R2JbsgE/T2KbZY9BOmHvm7M3Pzb88cfOgI398OEbPyqsDRsIOgzBZGwgKiKJUjMKRsEoGAUjHQAAueg0YbMjSNoAAAAASUVORK5CYII=","orcid":"","institution":"Royal Veterinary College","correspondingAuthor":true,"prefix":"","firstName":"Patrick","middleName":"A.","lastName":"Lewis","suffix":""}],"badges":[],"createdAt":"2025-08-12 15:08:25","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7357205/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7357205/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s12017-025-08894-6","type":"published","date":"2025-11-05T15:57:18+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":89434768,"identity":"b70b3028-9afc-40a1-b74a-fae16f5cdf72","added_by":"auto","created_at":"2025-08-20 01:32:02","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":449015,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eStructural comparison of the activation loop of the IKK family of kinases. (\u003c/strong\u003ea) Sequence alignment of the activation loop (DLG/DGF motif to APE/HPD motif) of IKKA, IKKB, TBK1 and IKKE. The phosphorylation sites are highlighted in yellow, and the conserved Glutamic acid (E) at position 168 in TBK1 and IKKE is emphasised in bold. (b) AlphaFold3 structural model of S176 and S180 phosphorylated IKKA dimer. The inset shows the activation loop, highlighting the positioning and interactions of the phosphorylated serines. (c) Crystal structure of the S172 phosphorylated TBK1 dimer (PDB ID: 4IW0). The inset shows the activation loop, highlighting the homology in positioning of TBK1 E168 to phosphorylated S176 of IKKA.\u003c/p\u003e","description":"","filename":"floatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-7357205/v1/ad6a8ce7c76bb5e0eb3f65f1.png"},{"id":89434766,"identity":"dd4fa006-4250-4635-a959-138c2828c6b3","added_by":"auto","created_at":"2025-08-20 01:32:02","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":132975,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eVariation at TBK1 E168 results in TBK1 loss-of-function. \u003c/strong\u003eHEK293 cells were transfected with the indicated HA-tagged TBK1 constructs, followed by treatment with the TBK1 kinase inhibitor GSK8612 (1µM for 1 hr). (a) TBK1 kinase activity was assessed by Western Blotting for TBK1 pS172 and Rab7 pS72. (b) Graphs represent TBK1 pS172 and Rab7 pS72 levels adjusted for total TBK1 levels and normalised to WT transfected cells. The data shows the mean +/- SEM of 4 independent experiments. Results were compared to WT transfected cells by one-way ANOVA, followed by Dunnett’s multiple comparisons test. **\u003cem\u003ep\u0026lt;0.01\u003c/em\u003e, ***\u003cem\u003ep\u0026lt;0.001\u003c/em\u003e, ****\u003cem\u003ep\u0026lt;0.0001\u003c/em\u003e.\u003c/p\u003e","description":"","filename":"floatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-7357205/v1/c6e43da178be366ff3266f94.png"},{"id":95563990,"identity":"881e4ea4-69f7-4081-ba59-87dd491471b9","added_by":"auto","created_at":"2025-11-10 16:06:11","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1125834,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7357205/v1/ccdbb812-d117-484d-af8b-534a46065da1.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"Glutamic Acid at position 168 is a constitutive activator of Tank Binding Kinase 1 catalytic function","fulltext":[{"header":"Introduction","content":"\u003cp\u003eAmyotrophic Lateral Sclerosis (ALS) is a progressive, fatal, and multifactorial neurodegenerative disorder characterized by the selective degeneration of upper and lower motor neurons, resulting in the denervation and subsequent atrophy of skeletal muscle fibers, leading to progressive motor impairment and respiratory failure, with a median survival age of 2\u0026ndash;5 years following diagnosis (Chio et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Sacks et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Peters et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Mendelian Studies have identified multiple loci with a strong predisposition linked to ALS, including hexanucleotide expansions in chromosome 9 open reading frame 72 (\u003cem\u003eC9orf72\u003c/em\u003e),and mutations in superoxide dismutase 1 \u003cem\u003e(SOD1)\u003c/em\u003e, TAR DNA-binding protein 43 \u003cem\u003e(TARDBP)\u003c/em\u003e, fused in sarcoma \u003cem\u003e(FUS)\u003c/em\u003e, Optineurin \u003cem\u003e(OPTN)\u003c/em\u003e and TANK-binding kinase 1 \u003cem\u003e(TBK1)\u003c/em\u003e (Renton et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Rosen et al. \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e1993\u003c/span\u003e; Sreedharan et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Vance et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Maruyama et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Freischmidt et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eTBK1 is a 729-amino acid, multifunction serine/threonine kinase belonging to the inhibitor of nuclear factor-kB (IKK) family, playing a pivotal role in regulating autophagosome-mediated degradation of ubiquitinated cargo and orchestrating inflammatory responses through substrate phosphorylation of autophagy adaptors (Freischmidt et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Oakes et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). TBK1 is highly expressed in neuronal and glial cells of brain regions essential for learning and memory, movement, balance and posture, and other executive functions (Oakes et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Dysfunction of TBK1 is linked to a number of human diseases, most prominently (ALS) and ALS/frontotemporal dementia (ALS/FTD), but also herpes simplex encephalitis (HSE), diabetes, obesity, cancer, and normal tension glaucoma (NTG) (Ahmad et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). TBK1 has multiple roles within the cell, activating immunological response to viral or proteostatic stress stimuli, endosomal response, autophagy, or apoptosis (Oakes et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Runde et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Ahmad et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Shao et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Talaia et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Harding et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Fischer et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2025\u003c/span\u003e; Lu et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eGenetic studies have identified over 90 distinct mutations in Tank-Binding Kinase 1 (TBK1) across sporadic and familial ALS cases, highlighting its critical role in disease pathogenesis (Freischmidt et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Harding et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). These mutations span nonsense, frameshift, missense, and single amino acid deletions, each exhibiting distinct functional consequences (Oakes et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). While nonsense and frameshift mutations significantly disrupt TBK1 expression at both the mRNA and protein levels\u0026mdash;suggesting haploinsufficiency as a potential pathogenic mechanism\u0026mdash;missense variants and small deletions exert more nuanced effects that may not necessarily reduce protein abundance (Freischmidt et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Pottier et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). ALS-associated TBK1 mutations impair key functional attributes, including dimerization, interaction with mitophagy receptor optineurin (OPTN), autoactivation, and substrate phosphorylation (Li et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Ye et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; de Majo et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eDespite extensive investigation, there are a number of aspects of TBK1 enzymatic function, as well as dysfunction in disease, that remain unclear. Using a combination of homology modelling and directed mutagenesis, in this current study the role of a key glutamic acid residue, E168, located in the activation loop of the kinase domain of TBK1, has been investigated to examine its contribution to TBK1 kinase activity.\u003c/p\u003e"},{"header":"Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003ePost translational modifications\u003c/h2\u003e\u003cp\u003eData for post translational modification of TBK1, IKKa, IKKb and IKKe were accessed through the phosphosite portal (Hornbeck et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eSequence Alignment\u003c/h3\u003e\n\u003cp\u003eThe protein sequences of TBK1 (NP_037386.1; 1-729 aa), IKKa (NP_001269.3; 1-745 aa), IKKb (NP_001547.1; 1-756 aa) and IKKe (NP_054721.1; 1-716 aa) were obtained from the National Center for Biotechnology Information (NCBI) and aligned using the Needleman-Wunsch algorithm (Sayers et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2024\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003eStructural Modelling\u003c/h3\u003e\n\u003cp\u003eThe orientation of E168 of TBK1 was assessed in a crystal structure of a dimer of full-length, active, S172-phosphorylated TBK1(PDB ID: 4IW0) (Larabi et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). The full-length dimer structure of IKKα phosphorylated at S176 and S180 was modelled using the AlphaFold3 server (Abramson et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2024\u003c/span\u003e) and the highest confidence structure was used to estimate the orientation of pS176. All structures were displayed using Mol*Viewer (Sehnal et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e\n\u003ch3\u003ePlasmids\u003c/h3\u003e\n\u003cp\u003eThe open reading frame of human TBK1 (NM_013254) cloned into pcDNA3.1(+)-C-HA was obtained from GenScript. Point mutations were introduced by site-directed mutagenesis using the Q5\u0026reg;-site directed mutagenesis kit (E0552S, New England Biolabs). The following plasmids were generated \u0026ndash; TBK1-E168A, TBK1-E168S, TBK1-E168K, and TBK1-S172A. The plasmid sequences were verified by Sanger sequencing courtesy of Genewiz (Azenta Life Sciences). The plasmids were maintained in \u003cem\u003eE. coli\u003c/em\u003e DH5α (11583117, Thermo Scientific) and isolated using the QIAprep spin miniprep plasmid extraction kit (27106, QIAgen). For transfections, Fugene\u0026reg; HD reagent (E2311, Promega) was used according to the manufacturer\u0026rsquo;s instructions in a 1:3 DNA: Reagent ratio. Mock controls were treated with the transfection reagent, but no plasmids were used. Primer sequences used for site-directed mutagenesis are as follows:\u003c/p\u003e\u003cp\u003e\u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"No\" id=\"Taba\" border=\"1\"\u003e\u003ccolgroup cols=\"2\"\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e\u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e\u003cthead\u003e\u003ctr\u003e\u003cth align=\"left\" colname=\"c1\"\u003e\u003cp\u003ePrimer Name\u003c/p\u003e\u003c/th\u003e\u003cth align=\"left\" colname=\"c2\"\u003e\u003cp\u003eNucleotide Sequence\u003c/p\u003e\u003c/th\u003e\u003c/tr\u003e\u003c/thead\u003e\u003ctbody\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eE168A_Forward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGAAGATGATGCGCAGTTTGTTTCTCTGTATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eE168A_Reverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAATTCTCTAGCTGCACCAAAATCTG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eE168S_Forward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGAAGATGATTCGCAGTTTGTTTCTCTGTATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eE168S_Reverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAATTCTCTAGCTGCACCAAAATC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eE168K_Forward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAGAAGATGATAAGCAGTTTGTTTCTCTGTATG\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eE168K_Reverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eAATTCTCTAGCTGCACCAAAATCT\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eS172A_Forward\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eGCAGTTTGTTGCTCTGTATGGCA\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003ctr\u003e\u003ctd align=\"left\" colname=\"c1\"\u003e\u003cp\u003eS172A_Reverse\u003c/p\u003e\u003c/td\u003e\u003ctd align=\"left\" colname=\"c2\"\u003e\u003cp\u003eTCATCATCTTCTAATTCTCTAGCTGC\u003c/p\u003e\u003c/td\u003e\u003c/tr\u003e\u003c/tbody\u003e\u003c/colgroup\u003e\u003c/table\u003e\u003c/div\u003e\u003c/p\u003e\n\u003ch3\u003eCell culture\u003c/h3\u003e\n\u003cp\u003eHuman embryonic kidney derived HEK293T/17 (CRL 11268) [hereafter referred as HEK293] adherent cells procured from American Type Culture Collection (ATCC) were cultured in Dulbecco\u0026rsquo;s Modified Eagle Medium (DMEM) and 10% fetal bovine serum (FBS) (A5670701, Thermo Scientific) without the addition of any antibiotics. Cells were seeded in a 12-well plate for the western blotting experiments at a density of 2.5x10\u003csup\u003e5\u003c/sup\u003e cells per well. Cells were reverse transfected with the plasmids of interest (1 \u0026micro;g per well) for 48 hours and incubated at 37\u0026deg;C with 5% CO\u003csub\u003e2\u003c/sub\u003e, before being treated with 1\u0026micro;M TBK1-inhibitor GSK8612 (S8872, Sellekchem) in DMEM\u0026thinsp;+\u0026thinsp;10% FBS, for an hour. The cells were then harvested and processed for immunoblotting.\u003c/p\u003e\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e\u003ch2\u003eImmunoblotting\u003c/h2\u003e\u003cp\u003eThe harvested cells were lysed in a cell lysis buffer (9803S, Cell Signaling Technology) supplemented with Halt\u0026trade; protease inhibitor cocktail (1861280, Thermo Scientific) and then treated with a sample loading buffer. The loading samples were denatured at 80\u0026deg;C for 8 minutes, centrifuged at 5000x\u003cem\u003eg\u003c/em\u003e for 1 minute, and the supernatant loaded onto a NuPAGE 4\u0026ndash;12% precast gel (10338442, Fisher Scientific) for western blotting. The gels were then transferred onto TransBlot\u0026reg; Turbo\u0026trade; PVDF membranes (1704156, Bio-Rad) and blocked using 5% milk in 1x TBST (Tris-buffered saline, 0.05% Tween 20) for 1 hour. The blocked membranes were subjected to overnight incubation with the antibody preparation as follows: Anti-phospho TBK1 (D5C2, 5483S, Cell Signaling Technology), Anti-TBK1 (3013S, Cell Signaling Technology), Anti-phospho RAB7 (AB302494, Abcam), Anti-RAB7 (E907E, 95746S, Cell Signaling Technology), Anti-β-actin HRP (A3864, Sigma), and Anti-HA tag (H3663, Sigma). All the primary antibodies were diluted 1:1000. The secondary antibodies used were goat Anti-Rabbit HRP (A0545, Sigma) and goat Anti-Mouse HRP (A3682, Sigma) at a concentration of 1:10,000 in 5% milk prepared with 1x TBST for 1 hour at ambient temperature. The blots were imaged using horse-radish peroxidase chemiluminescent substrate on an iBright\u0026trade; imager (Thermo Fisher Scientific).\u003c/p\u003e\u003c/div\u003e\u003cdiv id=\"Sec9\" class=\"Section2\"\u003e\u003ch2\u003eStatistical Analysis\u003c/h2\u003e\u003cp\u003eThe immunoblot results were analyzed using GraphPad Prism 10.3.1. All statistics employed an ordinary one-way ANOVA test followed by Dunnett\u0026rsquo;s multiple comparisons post-hoc test. Graphs represent the mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error of the mean of 4 independent experiments, where each repeat further comprised of technical duplicates.\u003c/p\u003e\u003c/div\u003e"},{"header":"Results","content":"\u003cp\u003eTo investigate the phosphoregulation of TBK1, post-translational modification data for each of the IKK family was accessed through the phosphosite portal. This revealed distinct patterns of phosphorylation across the family (\u003cb\u003efigure S1\u003c/b\u003e and \u003cb\u003eS2\u003c/b\u003e, and \u003cb\u003etables S1-4\u003c/b\u003e). Focusing on phosphorylation of the kinase domains of the IKKs, a divergence between IKKa and IKKb, and TBK1 and IKKe, was observed \u0026ndash; consistent with previous analyses. Dual phosphorylation was observed in IKKa and IKKb, (at residues S176/S180, and S177/S181 respectively), and a single phosphorylation event in TBK1 and IKKe, at S172 residue \u0026ndash; with S176 in IKKa, S177 in IKKb and S172 in TBK1/IKKe being conserved across the family (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). Intriguingly, both TBK1 and IKKe shared a glutamic acid (E168 in both kinases) at the equivalent residue to the S176/S177 residue in IKKa and IKKb. Analysis of the crystal structures for TBK1 and a structural model of phosphorylated IKKa revealed that the S176 and E168 residues are spatially homologous (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB-C).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003eNotably, the glutamic acid at this residue in TBK1 provides a negative charge with some functional overlap with phospho-serine in IKKa/b, with the serine residue in the latter providing modifiable phospho-regulation of this location. Previous studies of S176 and S177 in IKKa/b have tested the role of this residue by mutating it to either an alanine (incapable of phosphorylation) or glutamic acid (acting as a phosphomimetic) (Ling et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Delhase et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). These data suggest that in IKKa/b, this residue acts as a key regulator of kinase activity \u0026ndash; with a glutamic acid phosphomimetic acting to constitutively activate the kinase activity of these proteins. To examine whether the E168 residue is polymorphic in human populations, variation at this codon was assessed using the Gnomad dataset, revealing a single E168K variant.\u003c/p\u003e\u003cp\u003eTo test the biochemical role of the E168 residue, and the consequences of variation at this codon, HA epitope tagged TBK1 constructs for wildtype, E168A (removing the negative charge), E168S (equivalent to the homologous residue in IKKa/b), and E168K were transfected into HEK293 cells. Phosphorylation of TBK1 at S172, as well as Rab7 at S72 as a validated substrate for TBK1, was evaluated by immunoblot (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). As expected, inhibition of TBK1 resulted in a dramatic decrease in kinase activity as indicated by phosphorylation of Rab7. Mutation of the S172 residue to an alanine likewise resulted in ablation of kinase activity, as previously reported (Kishore et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Examining the impact of the E168 variants, all three significantly reduced TBK1 kinase activity. E168A and E168S lowered phosphorylation of the S172 residue by \u0026asymp; 80% compared to wild type, with E168K reducing phosphorylation below the threshold of detection. This was also the case for TBK1 kinase activity directed towards Rab7 S72. These data support a critical role for the E168 residue in regulating the kinase activity of TBK1.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThe \u003cem\u003eTBK1\u003c/em\u003e gene contributes to risk of developing ALS/FTD as both a monogenic Mendelian locus and \u003cem\u003evia\u003c/em\u003e common variation as a risk locus. As such, and coupled to its status as a kinase regulator of signal transduction pathways, it is a strong candidate for modulation as a drug target for these disorders. However, the gaps in our understanding of how TBK1 functions with regard to its enzymatic function and the complexities of its signaling network present substantial obstacles to drug development. There is a particular medicinal chemistry challenge with regard to the genetic data supporting a boosting of TBK1 activity as being potentially beneficial, requiring small molecule allosteric activators rather than inhibitors. In order to better understand the activation of TBK1, in this study a comparative analysis of post-translational modification across the IKK family was carried out, identifying a key glutamic acid residue at codon 168 in TBK1 and IKKe that is homologous to a modifiable \u0026ndash; and phosphorylated \u0026ndash; serine in IKKa and IKKb. This residue sits within the activation loop of TBK1, critical to kinase regulation and activity (Adams \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Reinhardt and Leonard \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Based upon this homology, the role of the E168 residue was tested by mutating it to alanine and serine, as well as to a lysine variant identified in the Gnomad dataset. All three variants significantly reduced TBK1 kinase activity as measured by autophosphorylation, suggesting that the negative charge imparted by the side chain of glutamic acid is a required for the kinase function of TBK1. These data also suggest that naturally occurring loss-of-function variants at this residue, such as the E168K variant, may act as a risk factor for ALS/FTD. The results of this study highlight the critical role of residues around the active site of TBK1 for activity, and supports further investigation as to whether targeting this residue could facilitate modulation of TBK1 kinase.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"633\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eA\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eAlanine amino acid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eE\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eGlutamate amino acid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eK\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eLysine amino acid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eS\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eSerine amino acid\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eALS\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eAmyotrophic lateral Sclerosis\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eC9orf72\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eChromosome 9 Open Reading Frame 72\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFTD\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eFrontotemporal dementia\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eFUS\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eFused in sarcoma\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eGoF\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eGain of function mutations\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eHEK293\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eHuman embryonic kidney cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eIKK\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eInhibitor of nuclear factor kappa-B\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eLoF\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eLoss of function mutations\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eNf-\u0026kappa;B\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eNuclear Factor Kappa-B\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ep-\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003ephosphorylated\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003ep62\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003ePhosphotyrosine-Independent Ligand For The Lck SH2 Domain Of 62 KDa\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eRAB7\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eRas-related protein\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTBK1\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eTANK-binding kinase 1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 74px;\"\u003e\n \u003cp\u003e\u003cstrong\u003eTDP-43\u003c/strong\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 559px;\"\u003e\n \u003cp\u003eTAR DNA-binding protein 43\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by the My Name\u0026rsquo;5 Doddie Foundation (grant MN5DF/CAAu23/100008). PAL is a Royal Society Industry research fellow in partnership with LifeArc (IF\\R2\\222002).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor Contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003ePAL conceptualized the study. NB, SH and PAL designed the experiments. AS, NB, SH, and PAL performed the experiments, analyzed the data, and wrote the manuscript. All authors edited the manuscript and approved the final draft for publication.\u0026nbsp;\u003c/p\u003e\n"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAbramson, J., Adler, J., Dunger, J., Evans, R., Green, T., Pritzel, A., et al. (2024). Accurate structure prediction of biomolecular interactions with AlphaFold 3. \u003cem\u003eNature, 630\u003c/em\u003e(8016), 493-500, doi:10.1038/s41586-024-07487-w.\u003c/li\u003e\n\u003cli\u003eAdams, J. A. (2003). Activation loop phosphorylation and catalysis in protein kinases: is there functional evidence for the autoinhibitor model? \u003cem\u003eBiochemistry, 42\u003c/em\u003e(3), 601-607, doi:10.1021/bi020617o.\u003c/li\u003e\n\u003cli\u003eAhmad, L., Zhang, S. Y., Casanova, J. L., \u0026amp; Sancho-Shimizu, V. (2016). Human TBK1: A Gatekeeper of Neuroinflammation. \u003cem\u003eTrends Mol Med, 22\u003c/em\u003e(6), 511-527, doi:10.1016/j.molmed.2016.04.006.\u003c/li\u003e\n\u003cli\u003eChio, A., Logroscino, G., Hardiman, O., Swingler, R., Mitchell, D., Beghi, E., et al. (2009). Prognostic factors in ALS: A critical review. \u003cem\u003eAmyotroph Lateral Scler, 10\u003c/em\u003e(5-6), 310-323, doi:10.3109/17482960802566824.\u003c/li\u003e\n\u003cli\u003ede Majo, M., Topp, S. D., Smith, B. N., Nishimura, A. L., Chen, H. J., Gkazi, A. S., et al. (2018). ALS-associated missense and nonsense TBK1 mutations can both cause loss of kinase function. \u003cem\u003eNeurobiol Aging, 71\u003c/em\u003e, 266 e261-266 e210, doi:10.1016/j.neurobiolaging.2018.06.015.\u003c/li\u003e\n\u003cli\u003eDelhase, M., Hayakawa, M., Chen, Y., \u0026amp; Karin, M. (1999). Positive and negative regulation of IkappaB kinase activity through IKKbeta subunit phosphorylation. \u003cem\u003eScience, 284\u003c/em\u003e(5412), 309-313, doi:10.1126/science.284.5412.309.\u003c/li\u003e\n\u003cli\u003eFischer, F. A., Demarco, B., Min, F. C. H., Yeap, H. W., De Nardo, D., Chen, K. W., et al. (2025). TBK1 and IKKepsilon prevent premature cell death by limiting the activity of both RIPK1 and NLRP3 death pathways. \u003cem\u003eSci Adv, 11\u003c/em\u003e(10), eadq1047, doi:10.1126/sciadv.adq1047.\u003c/li\u003e\n\u003cli\u003eFreischmidt, A., Muller, K., Ludolph, A. C., Weishaupt, J. H., \u0026amp; Andersen, P. M. (2017). Association of Mutations in TBK1 With Sporadic and Familial Amyotrophic Lateral Sclerosis and Frontotemporal Dementia. \u003cem\u003eJAMA Neurol, 74\u003c/em\u003e(1), 110-113, doi:10.1001/jamaneurol.2016.3712.\u003c/li\u003e\n\u003cli\u003eFreischmidt, A., Wieland, T., Richter, B., Ruf, W., Schaeffer, V., Muller, K., et al. (2015). Haploinsufficiency of TBK1 causes familial ALS and fronto-temporal dementia. \u003cem\u003eNat Neurosci, 18\u003c/em\u003e(5), 631-636, doi:10.1038/nn.4000.\u003c/li\u003e\n\u003cli\u003eHarding, O., Evans, C. S., Ye, J., Cheung, J., Maniatis, T., \u0026amp; Holzbaur, E. L. F. (2021). ALS- and FTD-associated missense mutations in TBK1 differentially disrupt mitophagy. \u003cem\u003eProc Natl Acad Sci U S A, 118\u003c/em\u003e(24), doi:10.1073/pnas.2025053118.\u003c/li\u003e\n\u003cli\u003eHornbeck, P. V., Zhang, B., Murray, B., Kornhauser, J. M., Latham, V., \u0026amp; Skrzypek, E. (2015). PhosphoSitePlus, 2014: mutations, PTMs and recalibrations. \u003cem\u003eNucleic Acids Res, 43\u003c/em\u003e(Database issue), D512-520, doi:10.1093/nar/gku1267.\u003c/li\u003e\n\u003cli\u003eKishore, N., Huynh, Q. K., Mathialagan, S., Hall, T., Rouw, S., Creely, D., et al. (2002). IKK-i and TBK-1 are enzymatically distinct from the homologous enzyme IKK-2: comparative analysis of recombinant human IKK-i, TBK-1, and IKK-2. \u003cem\u003eJ Biol Chem, 277\u003c/em\u003e(16), 13840-13847, doi:10.1074/jbc.M110474200.\u003c/li\u003e\n\u003cli\u003eLarabi, A., Devos, J. M., Ng, S. L., Nanao, M. H., Round, A., Maniatis, T., et al. (2013). Crystal structure and mechanism of activation of TANK-binding kinase 1. \u003cem\u003eCell Rep, 3\u003c/em\u003e(3), 734-746, doi:10.1016/j.celrep.2013.01.034.\u003c/li\u003e\n\u003cli\u003eLi, F., Xie, X., Wang, Y., Liu, J., Cheng, X., Guo, Y., et al. (2016). Structural insights into the interaction and disease mechanism of neurodegenerative disease-associated optineurin and TBK1 proteins. \u003cem\u003eNat Commun, 7\u003c/em\u003e, 12708, doi:10.1038/ncomms12708.\u003c/li\u003e\n\u003cli\u003eLing, L., Cao, Z., \u0026amp; Goeddel, D. V. (1998). NF-kappaB-inducing kinase activates IKK-alpha by phosphorylation of Ser-176. \u003cem\u003eProc Natl Acad Sci U S A, 95\u003c/em\u003e(7), 3792-3797, doi:10.1073/pnas.95.7.3792.\u003c/li\u003e\n\u003cli\u003eLu, Y., Almeida, S., \u0026amp; Gao, F. B. (2021). TBK1 haploinsufficiency in ALS and FTD compromises membrane trafficking. \u003cem\u003eActa Neuropathol, 142\u003c/em\u003e(1), 217-221, doi:10.1007/s00401-021-02331-1.\u003c/li\u003e\n\u003cli\u003eMaruyama, H., Morino, H., Ito, H., Izumi, Y., Kato, H., Watanabe, Y., et al. (2010). Mutations of optineurin in amyotrophic lateral sclerosis. \u003cem\u003eNature, 465\u003c/em\u003e(7295), 223-226, doi:10.1038/nature08971.\u003c/li\u003e\n\u003cli\u003eOakes, J. A., Davies, M. C., \u0026amp; Collins, M. O. (2017). TBK1: a new player in ALS linking autophagy and neuroinflammation. \u003cem\u003eMol Brain, 10\u003c/em\u003e(1), 5, doi:10.1186/s13041-017-0287-x.\u003c/li\u003e\n\u003cli\u003ePeters, O. M., Ghasemi, M., \u0026amp; Brown, R. H., Jr. (2015). Emerging mechanisms of molecular pathology in ALS. \u003cem\u003eJ Clin Invest, 125\u003c/em\u003e(5), 1767-1779, doi:10.1172/JCI71601.\u003c/li\u003e\n\u003cli\u003ePottier, C., Bieniek, K. F., Finch, N., van de Vorst, M., Baker, M., Perkersen, R., et al. (2015). Whole-genome sequencing reveals important role for TBK1 and OPTN mutations in frontotemporal lobar degeneration without motor neuron disease. \u003cem\u003eActa Neuropathol, 130\u003c/em\u003e(1), 77-92, doi:10.1007/s00401-015-1436-x.\u003c/li\u003e\n\u003cli\u003eReinhardt, R., \u0026amp; Leonard, T. A. (2023). A critical evaluation of protein kinase regulation by activation loop autophosphorylation. \u003cem\u003eElife, 12\u003c/em\u003e, doi:10.7554/eLife.88210.\u003c/li\u003e\n\u003cli\u003eRenton, A. E., Majounie, E., Waite, A., Simon-Sanchez, J., Rollinson, S., Gibbs, J. R., et al. (2011). A hexanucleotide repeat expansion in C9ORF72 is the cause of chromosome 9p21-linked ALS-FTD. \u003cem\u003eNeuron, 72\u003c/em\u003e(2), 257-268, doi:10.1016/j.neuron.2011.09.010.\u003c/li\u003e\n\u003cli\u003eRosen, D. R., Siddique, T., Patterson, D., Figlewicz, D. A., Sapp, P., Hentati, A., et al. (1993). Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. \u003cem\u003eNature, 362\u003c/em\u003e(6415), 59-62, doi:10.1038/362059a0.\u003c/li\u003e\n\u003cli\u003eRunde, A. P., Mack, R., S, J. P., \u0026amp; Zhang, J. (2022). The role of TBK1 in cancer pathogenesis and anticancer immunity. \u003cem\u003eJ Exp Clin Cancer Res, 41\u003c/em\u003e(1), 135, doi:10.1186/s13046-022-02352-y.\u003c/li\u003e\n\u003cli\u003eSacks, B., Bashford, J., Wijesekera, L., Leigh, P. N., \u0026amp; Sreedharan, J. (2022). Motor Neuron Disease: Amyotrophic Lateral Sclerosis. In D. W. Pfaff, N. D. Volkow, \u0026amp; J. L. Rubenstein (Eds.), \u003cem\u003eNeuroscience in the 21st Century: From Basic to Clinical\u003c/em\u003e (pp. 4221-4271). Cham: Springer International Publishing.\u003c/li\u003e\n\u003cli\u003eSayers, E. W., Beck, J., Bolton, E. E., Brister, J. R., Chan, J., Comeau, D. C., et al. (2024). Database resources of the National Center for Biotechnology Information. \u003cem\u003eNucleic Acids Res, 52\u003c/em\u003e(D1), D33-D43, doi:10.1093/nar/gkad1044.\u003c/li\u003e\n\u003cli\u003eSehnal, D., Bittrich, S., Deshpande, M., Svobodova, R., Berka, K., Bazgier, V., et al. (2021). Mol* Viewer: modern web app for 3D visualization and analysis of large biomolecular structures. \u003cem\u003eNucleic Acids Res, 49\u003c/em\u003e(W1), W431-W437, doi:10.1093/nar/gkab314.\u003c/li\u003e\n\u003cli\u003eShao, W., Todd, T. W., Wu, Y., Jones, C. Y., Tong, J., Jansen-West, K., et al. (2022). Two FTD-ALS genes converge on the endosomal pathway to induce TDP-43 pathology and degeneration. \u003cem\u003eScience, 378\u003c/em\u003e(6615), 94-99, doi:10.1126/science.abq7860.\u003c/li\u003e\n\u003cli\u003eSreedharan, J., Blair, I. P., Tripathi, V. B., Hu, X., Vance, C., Rogelj, B., et al. (2008). TDP-43 mutations in familial and sporadic amyotrophic lateral sclerosis. \u003cem\u003eScience, 319\u003c/em\u003e(5870), 1668-1672, doi:10.1126/science.1154584.\u003c/li\u003e\n\u003cli\u003eTalaia, G., Bentley-DeSousa, A., \u0026amp; Ferguson, S. M. (2024). Lysosomal TBK1 responds to amino acid availability to relieve Rab7-dependent mTORC1 inhibition. \u003cem\u003eEMBO J, 43\u003c/em\u003e(18), 3948-3967, doi:10.1038/s44318-024-00180-8.\u003c/li\u003e\n\u003cli\u003eVance, C., Rogelj, B., Hortobagyi, T., De Vos, K. J., Nishimura, A. L., Sreedharan, J., et al. (2009). Mutations in FUS, an RNA processing protein, cause familial amyotrophic lateral sclerosis type 6. \u003cem\u003eScience, 323\u003c/em\u003e(5918), 1208-1211, doi:10.1126/science.1165942.\u003c/li\u003e\n\u003cli\u003eYe, J., Cheung, J., Gerbino, V., Ahlsen, G., Zimanyi, C., Hirsh, D., et al. (2019). Effects of ALS-associated TANK binding kinase 1 mutations on protein-protein interactions and kinase activity. \u003cem\u003eProc Natl Acad Sci U S A, 116\u003c/em\u003e(49), 24517-24526, doi:10.1073/pnas.1915732116.\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"Supplementary Table and Figure","content":"\u003cp\u003eSupplementary Table and Figure are not available with this version.\u003c/p\u003e\n"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":true,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"neuromolecular-medicine","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nemm","sideBox":"Learn more about [NeuroMolecular Medicine](http://link.springer.com/journal/12017)","snPcode":"12017","submissionUrl":"https://submission.nature.com/new-submission/12017/3","title":"NeuroMolecular Medicine","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"TBK1, ALS, Kinase, mutations, kinase activity, p62, RAB7, phosphorylation","lastPublishedDoi":"10.21203/rs.3.rs-7357205/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7357205/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eTANK binding kinase 1 (TBK1) is serine/threonine protein kinase member of the inhibitor of nuclear factor-kB kinase family, with links to the etiology of familial as well as idiopathic Amyotrophic Lateral Sclerosis. It contributes to several regulatory cellular processes such as autophagy, inflammation and apoptosis. Reduction or loss of TBK1 kinase activity is associated with increased risk of ALS, and so understanding the molecular basis of this activity is an important research priority. In this current study, the role of the E168 residue, located adjacent to the active site of TBK1, has been assessed using a combination of artificial and naturally occurring variants found at this codon \u0026ndash; evaluated using multiple readouts for TBK1 kinase activity. The results suggest that the negative charge resulting from the presence of a glutamic acid at this codon is a constitutive activator of TBK1 activity.\u003c/p\u003e","manuscriptTitle":"Glutamic Acid at position 168 is a constitutive activator of Tank Binding Kinase 1 catalytic function","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-20 01:31:58","doi":"10.21203/rs.3.rs-7357205/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-24T18:19:26+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-24T13:12:43+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-24T09:01:41+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-19T16:54:39+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"107894730228614562990514381463466933114","date":"2025-09-09T02:25:33+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"48442943960338102209204842007175049691","date":"2025-09-08T15:17:52+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"172828213261674018556785137433393540584","date":"2025-09-08T06:53:08+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"102832272632304129202455058781348906846","date":"2025-09-05T06:44:57+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"336137050175488857693863890850025308695","date":"2025-09-03T14:18:34+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"216466256898462735626695829296783561054","date":"2025-09-03T06:38:22+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-09-03T06:33:12+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-13T02:30:01+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-08-13T02:28:51+00:00","index":"","fulltext":""},{"type":"submitted","content":"NeuroMolecular Medicine","date":"2025-08-12T15:05:36+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"neuromolecular-medicine","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"nemm","sideBox":"Learn more about [NeuroMolecular Medicine](http://link.springer.com/journal/12017)","snPcode":"12017","submissionUrl":"https://submission.nature.com/new-submission/12017/3","title":"NeuroMolecular Medicine","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"8238a268-ffd7-4814-8cff-8d60f459fd20","owner":[],"postedDate":"August 20th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-11-10T16:00:05+00:00","versionOfRecord":{"articleIdentity":"rs-7357205","link":"https://doi.org/10.1007/s12017-025-08894-6","journal":{"identity":"neuromolecular-medicine","isVorOnly":false,"title":"NeuroMolecular Medicine"},"publishedOn":"2025-11-05 15:57:18","publishedOnDateReadable":"November 5th, 2025"},"versionCreatedAt":"2025-08-20 01:31:58","video":"","vorDoi":"10.1007/s12017-025-08894-6","vorDoiUrl":"https://doi.org/10.1007/s12017-025-08894-6","workflowStages":[]},"version":"v1","identity":"rs-7357205","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7357205","identity":"rs-7357205","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}