ALDH1A3 serves as a predictor for castration resistance in prostate cancer patients

ALDH1A3 serves as a predictor for castration resistance in prostate cancer patients | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research article ALDH1A3 serves as a predictor for castration resistance in prostate cancer patients Shangqian Wang, Xiang Zhou, Chao Liang, Meiling Bao, Ye Tian, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.2.21612/v2 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 06 May, 2020 Read the published version in BMC Cancer → Version 2 posted 10 You are reading this latest preprint version Show more versions Abstract Aldehyde dehydrogenase 1A3 (ALDH1A3) has been implicated in the survival and proliferation of prostate cancer cells. We retrospectively reviewed our patients with advanced disease on adjuvant hormonal therapy after prostatectomy. Time to castration resistance stage was documented. And Immunohistochemistry analysis for ALDH1A3 was performed for those patient samples on tissue microarray. Using bioinformatics analysis for RNA sequencing data of both primary prostate cancer and metastatic castration resistance prostate cancer (mCRPC) from online datasets, we have found that the expression level of ALDH1A3 is lower in mCRPC group than in primary cancer group. Crispr-Cas9 was used to knock out ALDH1A3 in prostate cancer luminal cells, and morphologic analysis as well as the Gene Set Enrichment Analysis (GSEA) were facilitated to discover the mechanisms of the resistance phenotype. We found that the patients with ALDH1A3 low expression had shorter time to progression to castration resistance compared with those of higher expression group on adjuvant hormonal therapy after radical prostatectomy. The ALDH1A3 knockout cells gradually acquired resistance to androgen deprivation therapy, a few cells have been found in knockout group showing as that the spindle-like luminal cells in charcoal stripped medium. Furthermore, PI3K pathway activation has been confirmed by Western blot. The PI3K pathway inhibitor BEZ235 has been demonstrated that the acquired ADT resistance by ALDH1A3 down regulation could be rescued by PI3K pathway inhibitor. Together, these results suggested a novel function for ALDH1A3 in development of mCRPC, and indicated PI3K pathway inhibitor has the potential in the treatment of a subgroup of mCRPC patients. Cancer Biology Oncology castration resistance prostate cancer survival time aldehyde dehydrogenase androgen deprivation therapy resistance. Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Background Androgen deprivation therapy (ADT) is the standard of care for advanced prostate cancer or progression after localized definitive treatment. However, most patients eventually progress to a condition known as castration-resistant prostate cancer (CRPC), characterized by lack of response to ADT. Despite the several treatment options for this stage of disease, the impact on overall survival is less than optimal and, most importantly, there is no reliable biomarker to predict the response of the treatment or resistance. As a result, no standard guidance is available to optimally sequence approved treatments for individual patients. Since 2005, the next-generation sequencing (NGS) technologies( 1 ) have made it possible for us to better understand the molecular profiles of the cancer, which would provide evidence for clinical practice in oncology, such as diagnosis, prognosis, and treatment decisions. In prostate cancer, the Cancer Genome Atlas (TCGA) has revealed a molecular taxonomy of 333 primary prostate cancer( 2 ). In addition, the Stand Up to Cancer (SU2C) prostate cancer Dream Team also sequenced 150 metastatic castration resistant prostate cancer samples( 3 ), which benefits a lot to investigate the mechanisms of castration resistance in this disease. The aldehyde dehydrogenase family 1 member A3 (ALDH1A3) catalyzes the oxidation of retinal to the pleiotropic factor retinoic acid using nicotinamide adenine dinucleotide (NAD+). The level of ALDHs enzymatic activity has been regarded as a cancer stem cell (CSC) marker and seems to correlate with tumor aggressiveness( 4 ) which has been investigated in pancreatic cancer( 5 ), ovarian cancer( 6 ), breast cancer( 7 ), and high-grade glioma( 8 ). From our previous report( 9 ), we found that ALDH1A3 highly expressed in the human prostate, specially in the luminal compartment. In the primary prostate cancer, the expression of this gene correlated with AR pathway and luminal markers. Furthermore, for those with advanced disease after radical prostatectomy who underwent adjuvant androgen deprivation therapy, negative ALDH1A3 expression predicted as shorter time for castration resistance upon hormonal therapy. We found, surprisingly, that ALDH1A3 was down regulated in metastatic castration resistant prostate cancer from previous sequencing data( 10 ). Combing with our previous report, the low expression of ALDH1A3 might be related with regression of AR signaling pathway at castration condition. Strengthening with the proof reanalyzed from RNA sequencing of 150 mCRPC patients, ALDH1A3-low group seems to be related with lymph nodes metastases, and activation of PI3K pathway signaling. Furthermore, we confirmed this hypothesis with experiments, supporting that ALDH1A3 null could facilitate prostate cancer cells in castrated condition via PI3K pathway, but could be rescued by PI3K pathway inhibitor. These results provide evidence that ALDH1A3 could be a potential biomarker of castration resistant prostate cancer, supporting future clinical trial on overcoming the ADT resistance. Methods Patients and tissue microarrays The protocol to generate the tissue microarrays (TMAs) in this cohort has been described in our previous report( 9 ). We retrospectively reviewed our patients with advanced disease on adjuvant hormonal therapy after prostatectomy. A total of 79 patients in our single center were included in this study. Those who has lost follow-up or benign tissue on the TMA were excluded. All these patients were performed laparoscopic radical prostatectomy followed by adjuvant hormonal therapy between 2012 and 2014 at the urology department of the First Affiliated Hospital of Nanjing Medical University. All patients were recruited following informed consent, the protocol was approved by ethical committee of The First Affiliated Hospital of Nanjing Medical University. Progression to castration resistant prostate cancer (CRPC) defined as biochemical recurrence or metastasis on adjuvant hormonal therapy. For the staining score system, we have described the protocol in our previous report( 9 ). Briefly, For the staining score system ( 11 ), the percentage of positive tumor cells was determined by at least five areas at 400 magnification and assigned to one of the following five categories: 0 75%. The intensity of immunostaining was scored as follows: 1 low, 2, moderate, and 3, strong. The IHC score for ALDH1A3 on prostate cancer slides was: low expression <8, and high expression ≥8. Database and bioinformatics Three datasets (Cornell( 12 ), MSKCC( 13 ), Michigan group( 10 )) on prostate cancer samples sequencing profiles were found and the RNA sequencing data in RPKM format were downloaded. The ALDH1A3 expression value for each samples in mCRPC group and primary cancer group were compared in each dataset. The results were shown by GraphPad software. Gene Set Enrichment Analysis (GSEA) analysis The RNA sequencing data were downloaded from SU2C database. The median value of RPKM for ALDH1A3 was used as cut-off value, any sample which is higher than the median value was determined as ALDH1A3 high , the lower samples as ALDH1A3 low . The GSEA analysis was performed according to the protocol which was previously described( 14 ). The Genesets were downloaded from the Molecular Signatures Database (MSigDB http://software.broadinstitute.org/gsea/msigdb/) Cell culture and Crispr-Cas9 knockout The human prostate cancer cell line (LnCaP, VCaP) were purchased from the Cell Bank Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China) and maintained in RPMI medium with 10% fetal bovine serum within a humidified atmosphere containing 5% CO2 at 37°C. We designed the guide RNA for ALDH1A3 from (http://crispr.mit.edu/), targeting the first exon. The sequence of the guide is as follows—ALDH1A3: 1- AGTTATGGCTACCACCAACG; 2-TAGTCTGCGGCGCACCGGCT; green fluorescent protein (GFP): GGCGAGGAGCTGTTCACCG. Then, we ligated the guide to the LentiCrispr-V2 system followed by Sanger sequencing validation( 15 ). Finally, we produced the lentivirus according to the protocol previously described( 9 ). After 2 days of the infection to the LnCaP and VCaP cells, the puromycin selection was performed. We performed Western Blot assay to validate the knockout efficiency after 14 days of infection. The cell numbers were counted based on the typan blue staining. Western Blotting The protein expression of ALDH1A3 by Western Blot assay was performed according to the protocol previously described. The antibodies against ALDH1A3 (Abcam, USA), Phospho-Akt (Ser473, Cell Signaling Technology, USA) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Bioworld Technology, Inc., USA) were used in Western Blot assay in accordance with the manufacturer’s instructions. Statistical analysis Differences in vitro experiment like cell numbers between groups were subjected to Student’s t test. p<0.05 was considered to be statistically significant. All the statistical calculations were performed using GraphPad Prism v6.0 software (GraphPad Prism version 6.00 for Windows, GraphPad Software, La Jolla California USA, www.graphpad.com). Results ALDH1A3 negative predicted CRPC in patients on adjuvant ADT Our earlier work has demonstrated that ALDH1A3 highly expressed in human prostate, which had a strong correlation with primary prostate cancer luminal signature and could be a potential biomarker of AR signaling pathway. Then we moved on to investigate its expression in the castration resistant prostate cancer. We retrospectively reviewed 79 patients with advanced disease who underwent radical prostatectomy followed by adjuvant hormonal therapy in our center. It was indicated that negative expression of ALDH1A3 predicted shorter time progression to castration resistance on adjuvant hormonal therapy (Fig 1A-C). Besides, its expression is down regulated in three datasets. Beltran et al performed a sequencing profiling on 114 metastatic samples from 51 CRPC and 30 neuroendocrine prostate cancer patients. The ALDH1A3 expression was loweer in neuroendocrine and CRPC group compared with primary cancer (Fig 1D). Another group performed RNA sequencing for primary prostate cancer and mCRPC samples, ALDH1A3 also down regulated in mCRPC samples (Fig 1E). The data from Michigan group showed the same trend (Fig 1F). All expression level of ALDH1A3 in these three datasets are defined as Z score or log2 value. ALDH1A3 signature has a strong correlation with prostate cancer progression, and PI3K signaling pathway A multi-institutional clinical sequencing infrastructure to conduct prospective transcriptome sequencing of bone or soft tissue tumor biopsies from a cohort of 150 mCRPC affected individuals was performed to establish a precision medicine framework for mCRPC. According to the expression level of ALDH1A3 in the dataset, we defined the cases above the median value of ALDH1A3 in the whole cases as ALDH1A3 high , those whose expression level lower than the median as ALDH1A3 low . We compared ALDH1A3 high and ALDH1A3 low cases to generate a differential expression gene list as ALDH1A3 signature (Table S1). The ALDH1A3 ranking the most significant changes in the whole list confirmed the results. The Gene Set Enrichment Analysis (GSEA) finally correlated ALDH1A3 signature with several biologic event. We found the ALDH1A3 signature had significant positive correlation with ERG signature and prostate cancer luminal signature, respectively (Enrichment score: 0.77, 0.5; Both p value: <0.01) (Fig 2A.B), and it had negative correlation with lymph nodes and PI3K-AKT-mTOR signaling pathway, meaning that ALDH1A3 low group might be associated with lymph nodes metastasis and PI3K-AKT-mTOR signaling activation (Fig 2C.D). Down-regulation of ALDH1A3 causes ADT resistance in prostate cancer cells Based on the above results, we aimed to investigate the mechanisms of negative expression of ALDH1A3 in mCRPC samples. We designed small guide RNA targeting the functional exon of ALDH1A3 to knock out this gene on cell level to see the phenotype changes. After validation of the knock out efficiency (Fig 3A), we picked up the most potent sgRNA to target ALDH1A3 in LnCaP and VCaP cells, both of which are sensitive to androgen ablation treatment in vitro. We found that the growth rate of the control cells (targeting GFP) had no significant difference with ALDH1A3 knockout cells in normal medium. But in charcoal stripped medium which has already filtered androgen, the ALDH1A3 knockout cells, growing slowly, could be able to survive. As a result, the growth rate of ALDH1A3 knockout cells was significantly faster than the control cells in charcoal stripped medium (Fig 3B). We also repeated the experiment in VCaP cells, and the results were consistent with those in LnCaP cells (Fig 3B). We did the morphology observation for those LnCaP cells as well to predict the potential mechanisms of the ADT resistance. From Fig 3C, At day 7, the control cells in medium without DHT showed spindle-like morphology and the cell number is low compared with those control cells in normal medium showing in aggregation or in cluster. However, it didn’t show any difference in ALDH1A3 knockout cells in DHT-free medium and in normal medium. At day 14, 95% of the control cells in DHT-free medium had been dead, whereas there were 30-40% of the ALDH1A3 knockout cells still alive. ALDH1A3 knockout facilitates castration resistance through PI3K-AKT-mTOR signaling pathway Based on the above GSEA results, the ALDH1A3 signature negatively correlated with PI3K-AKT-mTOR signaling pathway. We speculate that the ALDH1A3 loss could activate the PI3K pathway. In order to validate this hypothesis, we did Western blot assay to test the PI3K pathway activation to compare the ALDH1A3 wild type cells and knockout cells. The blotting showed that both in LnCaP and VCaP cells, phospho-AKT had been elevated in ALDH1A3 knockout group (Fig 4). Next, in order to determine the relationship between castration resistance and PI3K signaling pathway activation by ALDH1A3 knockout, We performed rescue assay to block PI3K signaling pathway by using PI3K signaling inhibitor BEZ235. The results demonstrated that 500nM BEZ235 treatment after 48 hours could rescue the resistance by ALDH1A3 knockout. In terms of the morphology analysis, LnCaP cells in BEZ235 treatment and DHT-free group showed spindle-like morphology, similar with control cells in the DHT-free medium (Fig 5A). Those cells showed less aggressive phenotype and finally detached from the bottom of the plate. The growth rate of ALDH1A3 knockout cells showed 30% higher than the wild type cells but was inhibited totally by BEZ235 in DHT-free medium (Fig 5B). Discussion Our previous study has demonstrated that ALDH1A3 is specifically expressed in luminal compartment in human prostate epitheliums. From the TCGA data of 333 primary prostate cancer, ALDH1A3 correlated with AR signaling pathway and corresponding luminal signature. It is also suggested that ALDH1A3 has a potential to be a predictor of survival in primary prostate cancer patients. In present study, withour single center follow up database, we performed IHC analysis on tissue microarray for patients with advanced disease upon adjuvant hormonal therapy after radical prostatectomy. The results showed that ALDH1A3 low-expression patients indicated shorter time to progression to castration resistance. The phenotype that we showed at the beginning has implications to understand the mechanisms of this prostate specific gene in the development of cancer progression. From the metastatic prostate cancer samples database, the RNA sequencing data demonstrated that ALDH1A3 was down regulated in mCRPC group compared with the primary prostate cancer. Next-generation sequencing (NGS) analysis has made it possible to reclassify different subtypes in a specific cancer by molecular changes. It indeed could provide benefits for clinical practice in oncology, such as diagnosis, prognosis, and treatment decisions. For example, patients with cancers of unknown primary (CUP), traditionally, are generally assumed to have a poor prognosis with a treatment in cytotoxic chemotherapy guided by histologic features and the pattern of metastatic spread. A new study showed that NGS may provide an opportunity for CUP patients to benefit from individualized therapies according to the targetable genomic alterations identified by tumor molecular profiling( 16 ). In that study, 10% of patients received targeted therapies based on their mutation signatures. Thanks to the RNA sequencing data, we found that the PI3K pathway signature had been highly correlated with ALDH1A3 signature. Then we speculated the PI3K signaling pathway activation might be due to ADT resistance. And we also confirmed this hypothesis by showing the up-regulation of phospho-AKT upon ALDH1A3 knockout. Furthermore, PI3K signaling pathway inhibitor BEZ235 could rescue the ADT resistance following ALDH1A3 knockout. The PI3K/AKT/mTOR pathway is altered in almost 50% of mCRPC through either PTEN inactivation or/and aberrant activation in PIK3CA/B( 13 ). It’s been demonstrated that PI3K-AKT-mTOR signaling pathway deregulation resulting from PTEN loss is associated with androgen insensitivity and the development of CRPC( 17 ). Knocking down PTEN can convert the androgen-dependent Myc-CaP cell into androgen independence, suggesting that PTEN intrinsically controls androgen responsiveness, a critical step in the development of castration resistant prostate cancer( 18 ). Based on these data, phase I/II trials assessing the combination of next-generation AR therapy with a PI3K/AKT/mTOR inhibitor are currently ongoing (ClinicalTrials.gov identifier: NCT02407054 and NCT02215096). ALDH1A3, also as retinoic acid anabolizing enzyme( 19 ) has been proved a potential novel target for triple-negative breast tumors and cancer stem cells( 20 ). Retinoic acid receptor-related orphan receptor γ (RORγ) antagonists are efficacious in re-sensitizing docetaxel and cabazitaxel cross-resistant CRPC cells( 21 ). It demonstrated that targeting retinoid signaling might be a potential approach in the treatment of CRPC( 22 ).In conclusion, the NGS provides multiple new opportunities and tools to accelerate and facilitate the entire process of drug testing toward accelerated drug positioning and approval for precise and personalized medicine. It also allows researchers to discover some hidden pattern of the complex cancer. Such strategies include the development of inhibitors with a higher potency against their intended target, like ADT and Abiraterone, and the use of combination therapies incorporating inhibitors of parallel or alternative signaling pathways mediating acquired resistance, like the mTOR inhibitor BEZ235 in the treatment of PI3K-AKT-mTOR pathway activation. In this paper, we’ve investigated alterations in the targeted gene leading to ADT resistance to mCRPC. Based on the RNA sequencing and experimental results, we found that PI3K pathway alteration or activation might be the cause of the resistance. We, then, rescued the ADT resistance by PI3K pathway inhibitor-BEZ235. The acquired resistance to ADT therapy by some patients with low level of ALDH1A3 could be overcome by combination therapy with PI3K pathway inhibitor, which will provide a new potential approach to the treatment of mCRPC. Declarations Ethics approval and consent to participate All patients were recruited following informed consent, the protocol was approved by ethical committee of The First Affiliated Hospital of Nanjing Medical University. Consent for publication All authors are consent for publication in BMC Urology Authors contributions YJ and Wang Z designed this work. WS, ZX and LC performed the experiment and wrote the manuscript. BM and TY performed the pathology experiment and data review ZJ and ZT performed the follow-up of the patients. Conflict of Interest The authors declare no conflict of interests. Acknowledgements and Fundings This study was funded by Prostate cancer cohort study of Nanjing Medical University (NMUC2018003A). Disclosure Statement The authors declare that they have no competing interests. Availability of data and materials The supplementary file will be downloaded in the online version. Competing interests All authors declare no competing interests in this work. References Margulies M, Egholm M, Altman WE, et al.: Genome sequencing in microfabricated high-density picolitre reactors. Nature 437: 376-380, 2005. Cancer Genome Atlas Research N: The Molecular Taxonomy of Primary Prostate Cancer. Cell 163: 1011-1025, 2015. Robinson D, Van Allen EM, Wu YM, et al.: Integrative clinical genomics of advanced prostate cancer. Cell 161: 1215-1228, 2015. Moretti A, Li J, Donini S, Sobol RW, Rizzi M and Garavaglia S: Crystal structure of human aldehyde dehydrogenase 1A3 complexed with NAD+ and retinoic acid. Scientific reports 6: 35710, 2016. Kong B, Wu W, Cheng T, et al.: A subset of metastatic pancreatic ductal adenocarcinomas depends quantitatively on oncogenic Kras/Mek/Erk-induced hyperactive mTOR signalling. Gut 65: 647-657, 2016. Saw YT, Yang J, Ng SK, et al.: Characterization of aldehyde dehydrogenase isozymes in ovarian cancer tissues and sphere cultures. BMC cancer 12: 329, 2012. Ali HR, Dawson SJ, Blows FM, Provenzano E, Pharoah PD and Caldas C: Cancer stem cell markers in breast cancer: pathological, clinical and prognostic significance. Breast cancer research : BCR 13: R118, 2011. Mao P, Joshi K, Li J, et al.: Mesenchymal glioma stem cells are maintained by activated glycolytic metabolism involving aldehyde dehydrogenase 1A3. Proc Natl Acad Sci U S A 110: 8644-8649, 2013. Wang S, Liang C, Bao M, et al.: ALDH1A3 correlates with luminal phenotype in prostate cancer. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine 39: 1010428317703652, 2017. Grasso CS, Wu YM, Robinson DR, et al.: The mutational landscape of lethal castration-resistant prostate cancer. Nature 487: 239-243, 2012. Tong X, Li K, Luo Z, et al.: Decreased TIP30 expression promotes tumor metastasis in lung cancer. The American journal of pathology 174: 1931-1939, 2009. Beltran H, Prandi D, Mosquera JM, et al.: Divergent clonal evolution of castration-resistant neuroendocrine prostate cancer. Nature medicine 22: 298-305, 2016. Taylor BS, Schultz N, Hieronymus H, et al.: Integrative genomic profiling of human prostate cancer. Cancer cell 18: 11-22, 2010. Gao D, Vela I, Sboner A, et al.: Organoid cultures derived from patients with advanced prostate cancer. Cell 159: 176-187, 2014. Sanjana NE, Shalem O and Zhang F: Improved vectors and genome-wide libraries for CRISPR screening. Nature methods 11: 783-784, 2014. Varghese AM, Arora A, Capanu M, et al.: Clinical and molecular characterization of patients with cancers of unknown primary in the modern era. Annals of oncology : official journal of the European Society for Medical Oncology2017. Wang S, Gao J, Lei Q, et al.: Prostate-specific deletion of the murine Pten tumor suppressor gene leads to metastatic prostate cancer. Cancer cell 4: 209-221, 2003. Jiao J, Wang S, Qiao R, et al.: Murine cell lines derived from Pten null prostate cancer show the critical role of PTEN in hormone refractory prostate cancer development. Cancer research 67: 6083-6091, 2007. Lochbaum R, Schilpp C, Nonnenmacher L, Frick M, Dietl P and Wittekindt OH: Retinoic acid signalling adjusts tight junction permeability in response to air-liquid interface conditions. Cellular signalling 65: 109421, 2020. Vidovic D, Huynh TT, Konda P, et al.: ALDH1A3-regulated long non-coding RNA NRAD1 is a potential novel target for triple-negative breast tumors and cancer stem cells. Cell death and differentiation 27: 363-378, 2020. Wang Y, Huang Z, Chen CZ, et al.: Therapeutic Targeting of MDR1 Expression by RORgamma Antagonists Resensitizes Cross-Resistant CRPC to Taxane via Coordinated Induction of Cell Death Programs. Molecular cancer therapeutics 19: 364-374, 2020. Seed RI, Taurozzi AJ, Wilcock DJ, et al.: The putative tumour suppressor protein Latexin is secreted by prostate luminal cells and is downregulated in malignancy. Scientific reports 9: 5120, 2019. Supporting Information Table S1: A differential expression gene list as ALDH1A3 signature. Supplementary Files TableS1.xlsx FigS1.tif Cite Share Download PDF Status: Published Journal Publication published 06 May, 2020 Read the published version in BMC Cancer → Version 2 posted Review # 3 received at journal 29 Feb, 2020 Reviewer # 3 agreed at journal 28 Feb, 2020 Reviewers invited by journal 25 Feb, 2020 Reviewer # 1 agreed at journal 25 Feb, 2020 Review # 1 received at journal 25 Feb, 2020 Reviewer # 2 agreed at journal 25 Feb, 2020 Review # 2 received at journal 25 Feb, 2020 Editor assigned by journal 24 Feb, 2020 Submission checks completed at journal 23 Feb, 2020 Editor invited by journal 23 Feb, 2020 You are reading this latest preprint version Show more versions Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-12197","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research article","associatedPublications":[],"authors":[{"id":367904,"identity":"6117d433-407e-4c8f-8baf-34b2c2012daa","order_by":1,"name":"Shangqian Wang","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Shangqian","middleName":"","lastName":"Wang","suffix":""},{"id":367905,"identity":"e31a9795-9aa5-4fd8-8614-9b8dc613add4","order_by":2,"name":"Xiang Zhou","email":"","orcid":"","institution":"nanjing medical university","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Xiang","middleName":"","lastName":"Zhou","suffix":""},{"id":367906,"identity":"f3bcc770-87f0-4055-bac7-01db601a5953","order_by":3,"name":"Chao Liang","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Chao","middleName":"","lastName":"Liang","suffix":""},{"id":367907,"identity":"d49b97be-8b79-4c56-b561-5befa310ec0c","order_by":4,"name":"Meiling Bao","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Meiling","middleName":"","lastName":"Bao","suffix":""},{"id":367908,"identity":"b22225f0-5a03-46f5-a9cd-73a5005da151","order_by":5,"name":"Ye Tian","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Ye","middleName":"","lastName":"Tian","suffix":""},{"id":367909,"identity":"ce36b271-f5b8-440c-95b7-f21910b4e35b","order_by":6,"name":"Jundong Zhu","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Jundong","middleName":"","lastName":"Zhu","suffix":""},{"id":367910,"identity":"4e06688e-9b3b-430a-8fe2-c26ea62a30ab","order_by":7,"name":"Tongtong Zhang","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Tongtong","middleName":"","lastName":"Zhang","suffix":""},{"id":367911,"identity":"8b74be30-52b1-4912-9e31-caaf04b675c1","order_by":8,"name":"jie yang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+klEQVRIiWNgGAWjYJACgwQIzXgASMixsTcfIFoLA0ipMR/PsQScSjEASEviPIkcBbyqzNnPHih4uKOWweD24QMHPvw6nN7GkMPA8KNiG04tlj15CQaJZ44zGJxLSzg4s+9wbhvD2QOMPWdu4/bHgRwDg8S2YwwGZ3gMDvP2ALUw9iUwM7bh0XL+DaqWdDZmHgP8Wm6AbamBaOH5cTiBjY2gFrAtBxgkz7AB/dKQbtjGA2Tg9cv5HDPDn211DHxnmA8++PDHWl5+/uODD35U4NYCBGwGDAyH6xtATMa2ZrDQAXzqgYD5AQNDHZT9pw6fylEwCkbBKBihAAACvl9ZPU1VYwAAAABJRU5ErkJggg==","orcid":"https://orcid.org/0000-0002-5835-1669","institution":"nanjing medical university","correspondingAuthor":true,"submittingAuthor":false,"prefix":"","firstName":"jie","middleName":"","lastName":"yang","suffix":""},{"id":367912,"identity":"8a44703b-2fd0-4a37-91c6-7b6dff2bb785","order_by":9,"name":"Zengjun Wang","email":"","orcid":"","institution":"Nanjing Medical University","correspondingAuthor":false,"submittingAuthor":false,"prefix":"","firstName":"Zengjun","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2020-01-21 13:39:17","currentVersionCode":2,"declarations":"","doi":"10.21203/rs.2.21612/v2","doiUrl":"https://doi.org/10.21203/rs.2.21612/v2","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12885-020-06899-x","type":"published","date":"2020-05-06T21:00:33+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":535386,"identity":"9978d679-a445-4ff7-ae53-0cba738770ca","added_by":"auto","created_at":"2020-02-24 15:33:02","extension":"tif","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2059025,"visible":true,"origin":"","legend":"Differences of expression level for ALDH1A3 between primary and CRPC groups.\nA: IHC on TMA demonstrated high expression score of ALDH1A3. B: IHC on TMA demonstrated low expression score of ALDH1A3. C: Kaplan-Meier survival plot was used to indicate the time of progression to castration resistance between high vs low groups. D-F: The relative expression of ALDH1A3 is lower in CRPC compared with primary, but the neuroendocrine group ranking the lowest level. MSKCC group showed the same trend. \nMichigan data showed the same trend.","description":"","filename":"Figure1r.tif","url":"https://assets-eu.researchsquare.com/files/5e21ba9e-db96-41f9-8195-1834172c56df/v2/Figure 1r.tif"},{"id":535392,"identity":"26c397cc-e9c3-4ada-865d-0e1b89b14b69","added_by":"auto","created_at":"2020-02-24 15:33:03","extension":"tif","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":113375,"visible":true,"origin":"","legend":"GSEA analysis for ALDH1A3 signature.\nA: ALDH1A3 has positive correlation with ERG up regulation.\nB: ALDH1A3 has positive correlation with prostate cancer luminal signature. \nC: ALDH1A3 has negative correlation with lymph node.\nD: ALDH1A3 has negative correlation with PI3K-AKT-mTOR signaling.","description":"","filename":"Fig2.tif","url":"https://assets-eu.researchsquare.com/files/5e21ba9e-db96-41f9-8195-1834172c56df/v2/Fig 2.tif"},{"id":535395,"identity":"9bd141cb-ca76-4eef-8bf7-1a97786011f6","added_by":"auto","created_at":"2020-02-24 15:33:03","extension":"tif","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":1190147,"visible":true,"origin":"","legend":"ALDH1A3 knockout facilitated luminal cells resistance to ADT therapy.\nA: Western blot validation for guides RNA of Cripsr-cas9.\nB: The cell numbers reflecting cell growth curve for different groups, sgGFP (control cells in normal medium), sgGFP+DHT(-) (control cells in charcoal stripped medium), sgALDH1A3 (Crispr-cas9 knockout ALDH1A3 cells in normal medium), sgALDH1A3+DHT(-) (Crispr-cas9 knockout ALDH1A3 cells in charcoal stripped medium). Both in LnCaP and VCaP cells, there is significant difference between sgALDH1A3 and sgGFP in charcoal stripped medium at day 14 (p\u003c0.01). \nC: Morphologic observation for different groups.","description":"","filename":"Fig3.tif","url":"https://assets-eu.researchsquare.com/files/5e21ba9e-db96-41f9-8195-1834172c56df/v2/Fig 3.tif"},{"id":535397,"identity":"cab14df3-96e9-4829-a83f-ba6606bef8dc","added_by":"auto","created_at":"2020-02-24 15:33:03","extension":"tif","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":70640,"visible":true,"origin":"","legend":"Western blot for sg-ALDH1A3 in LnCaP and VCaP cells, the pAKT was up regulated in sgALDH1A3 group.","description":"","filename":"Fig4.tif","url":"https://assets-eu.researchsquare.com/files/5e21ba9e-db96-41f9-8195-1834172c56df/v2/Fig 4.tif"},{"id":535399,"identity":"6aed4a68-05e1-4338-9bd0-72b07eba76bf","added_by":"auto","created_at":"2020-02-24 15:33:03","extension":"tif","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":996075,"visible":true,"origin":"","legend":"BEZ235 treatment rescued the resistance through PI3K pathway inhibition.\nA: Morphologic observation for BEZ235 treatment compared with the resistance phenotype.\nB: The growth curve documented the cell numbers of different groups, BEZ235 treatment rescued the ADT resistance in sg-ALDH1A3 group.","description":"","filename":"Fig5.tif","url":"https://assets-eu.researchsquare.com/files/5e21ba9e-db96-41f9-8195-1834172c56df/v2/Fig 5.tif"},{"id":13490368,"identity":"7633b52f-afa7-4241-901a-3664d7a7208b","added_by":"auto","created_at":"2021-09-16 22:23:16","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":5798255,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-12197/v2/bdfb53da-1705-4499-b4c7-8b0a18318ae8.pdf"},{"id":535390,"identity":"2d605f1e-0a7c-4019-86e7-9040efb92acf","added_by":"auto","created_at":"2020-02-24 15:33:03","extension":"xlsx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":602597,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1.xlsx","url":"https://assets-eu.researchsquare.com/files/5e21ba9e-db96-41f9-8195-1834172c56df/v2/Table S1.xlsx"},{"id":535388,"identity":"6f92f0b0-0209-4d6d-9cea-b3c449240681","added_by":"auto","created_at":"2020-02-24 15:33:03","extension":"tif","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":77876,"visible":true,"origin":"","legend":"","description":"","filename":"FigS1.tif","url":"https://assets-eu.researchsquare.com/files/5e21ba9e-db96-41f9-8195-1834172c56df/v2/Fig S1.tif"}],"financialInterests":"","formattedTitle":"ALDH1A3 serves as a predictor for castration resistance in prostate cancer patients","fulltext":[{"header":"Background","content":"\u003cp\u003eAndrogen deprivation therapy (ADT) is the standard of care for advanced prostate cancer or progression after localized definitive treatment. However, most patients eventually progress to a condition known as castration-resistant prostate cancer (CRPC), characterized by lack of response to ADT. Despite the several treatment options for this stage of disease, the impact on overall survival is less than optimal and, most importantly, there is no reliable biomarker to predict the response of the treatment or resistance. As a result, no standard guidance is available to optimally sequence approved treatments for individual patients. Since 2005, the next-generation sequencing (NGS) technologies(\u003ca href=\"#_ENREF_1\"\u003e1\u003c/a\u003e) have made it possible for us to better understand the molecular profiles of the cancer, which would provide evidence for clinical practice in oncology, such as diagnosis, prognosis, and treatment decisions. In prostate cancer, the Cancer Genome Atlas (TCGA) has revealed a molecular taxonomy of 333 primary prostate cancer(\u003ca href=\"#_ENREF_2\"\u003e2\u003c/a\u003e). In addition, the Stand Up to Cancer (SU2C) prostate cancer Dream Team also sequenced 150 metastatic castration resistant prostate cancer samples(\u003ca href=\"#_ENREF_3\"\u003e3\u003c/a\u003e), which benefits a lot to investigate the mechanisms of castration resistance in this disease.\u003c/p\u003e\n\u003cp\u003eThe aldehyde dehydrogenase family 1 member A3 (ALDH1A3) catalyzes the oxidation of retinal to the pleiotropic factor retinoic acid using nicotinamide adenine dinucleotide (NAD+). The level of ALDHs enzymatic activity has been regarded as a cancer stem cell (CSC) marker and seems to correlate with tumor aggressiveness(\u003ca href=\"#_ENREF_4\"\u003e4\u003c/a\u003e) which has been investigated in pancreatic cancer(\u003ca href=\"#_ENREF_5\"\u003e5\u003c/a\u003e), ovarian cancer(\u003ca href=\"#_ENREF_6\"\u003e6\u003c/a\u003e), breast cancer(\u003ca href=\"#_ENREF_7\"\u003e7\u003c/a\u003e), and high-grade glioma(\u003ca href=\"#_ENREF_8\"\u003e8\u003c/a\u003e). From our previous report(\u003ca href=\"#_ENREF_9\"\u003e9\u003c/a\u003e), we found that ALDH1A3 highly expressed in the human prostate, specially in the luminal compartment. In the primary prostate cancer, the expression of this gene correlated with AR pathway and luminal markers. Furthermore, for those with advanced disease after radical prostatectomy who underwent adjuvant androgen deprivation therapy, negative ALDH1A3 expression predicted as shorter time for castration resistance upon hormonal therapy.\u003c/p\u003e\n\u003cp\u003eWe found, surprisingly, that ALDH1A3 was down regulated in metastatic castration resistant prostate cancer from previous sequencing data(\u003ca href=\"#_ENREF_10\"\u003e10\u003c/a\u003e). Combing with our previous report, the low expression of ALDH1A3 might be related with regression of AR signaling pathway at castration condition. Strengthening with the proof reanalyzed from RNA sequencing of 150 mCRPC patients, ALDH1A3-low group seems to be related with lymph nodes metastases, and activation of PI3K pathway signaling. Furthermore, we confirmed this hypothesis with experiments, supporting that ALDH1A3 null could facilitate prostate cancer cells in castrated condition via PI3K pathway, but could be rescued by PI3K pathway inhibitor. These results provide evidence that ALDH1A3 could be a potential biomarker of castration resistant prostate cancer, supporting future clinical trial on overcoming the ADT resistance.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003ePatients and tissue microarrays\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe protocol to generate the tissue microarrays (TMAs) in this cohort has been described in our previous report(\u003ca href=\"#_ENREF_9\"\u003e9\u003c/a\u003e). We retrospectively reviewed our patients with advanced disease on adjuvant hormonal therapy after prostatectomy. A total of 79 patients in our single center were included in this study. Those who has lost follow-up or benign tissue on the TMA were excluded. All these patients were performed laparoscopic radical prostatectomy followed by adjuvant hormonal therapy between 2012 and 2014 at the urology department of the First Affiliated Hospital of Nanjing Medical University. All patients were recruited following informed consent, the protocol was approved by ethical committee of The First Affiliated Hospital of Nanjing Medical University. Progression to castration resistant prostate cancer (CRPC) defined as biochemical recurrence or metastasis on adjuvant hormonal therapy. For the staining score system, we have described the protocol in our previous report(\u003ca href=\"#_ENREF_9\"\u003e9\u003c/a\u003e). Briefly, For the staining score system (\u003ca href=\"#_ENREF_11\"\u003e11\u003c/a\u003e), the percentage of positive tumor cells was determined by at least five areas at 400 magnification and assigned to one of the following five categories: 0 \u0026lt;5%; 1:5-25%; 2: 25-50%; 3: 50-75%, and 4: \u0026gt;75%. The intensity of immunostaining was scored as follows: 1 low, 2, moderate, and 3, strong. The IHC score for ALDH1A3 on prostate cancer slides was: low expression \u0026lt;8, and high expression \u0026ge;8.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDatabase and bioinformatics\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThree datasets (Cornell(\u003ca href=\"#_ENREF_12\"\u003e12\u003c/a\u003e), MSKCC(\u003ca href=\"#_ENREF_13\"\u003e13\u003c/a\u003e), Michigan group(\u003ca href=\"#_ENREF_10\"\u003e10\u003c/a\u003e)) on prostate cancer samples sequencing profiles were found and the RNA sequencing data in RPKM format were downloaded. The ALDH1A3 expression value for each samples in mCRPC group and primary cancer group were compared in each dataset. The results were shown by GraphPad software.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eGene Set Enrichment Analysis (GSEA) analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe RNA sequencing data were downloaded from SU2C database. The median value of RPKM for ALDH1A3 was used as cut-off value, any sample which is higher than the median value was determined as ALDH1A3\u003csup\u003ehigh\u003c/sup\u003e, the lower samples as ALDH1A3\u003csup\u003elow\u003c/sup\u003e. The GSEA analysis was performed according to the protocol which was previously described(\u003ca href=\"#_ENREF_14\"\u003e14\u003c/a\u003e). The Genesets were downloaded from the Molecular Signatures Database (MSigDB http://software.broadinstitute.org/gsea/msigdb/)\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCell culture and Crispr-Cas9 knockout\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe human prostate cancer cell line (LnCaP, VCaP) were purchased from the Cell Bank Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China) and maintained in RPMI medium with 10% fetal bovine serum within a humidified atmosphere containing 5% CO2 at 37\u0026deg;C.\u003c/p\u003e\n\u003cp\u003eWe designed the guide RNA for ALDH1A3 from (http://crispr.mit.edu/), targeting the first exon. The sequence of the guide is as follows\u0026mdash;ALDH1A3: 1- AGTTATGGCTACCACCAACG; 2-TAGTCTGCGGCGCACCGGCT; green fluorescent protein (GFP): GGCGAGGAGCTGTTCACCG. Then, we ligated the guide to the LentiCrispr-V2 system followed by Sanger sequencing validation(\u003ca href=\"#_ENREF_15\"\u003e15\u003c/a\u003e). Finally, we produced the lentivirus according to the protocol previously described(\u003ca href=\"#_ENREF_9\"\u003e9\u003c/a\u003e). After 2 days of the infection to the LnCaP and VCaP cells, the puromycin selection was performed. We performed Western Blot assay to validate the knockout efficiency after 14 days of infection. The cell numbers were counted based on the typan blue staining.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWestern Blotting\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe protein expression of ALDH1A3 by Western Blot assay was performed according to the protocol previously described. The antibodies against ALDH1A3 (Abcam, USA), Phospho-Akt (Ser473, Cell Signaling Technology, USA) and glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Bioworld Technology, Inc., USA) were used in Western Blot assay in accordance with the manufacturer\u0026rsquo;s instructions.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eStatistical analysis\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eDifferences in vitro experiment like cell numbers between groups were subjected to Student\u0026rsquo;s t test. p\u0026lt;0.05 was considered to be statistically significant. All the statistical calculations were performed using GraphPad Prism v6.0 software (GraphPad Prism version 6.00 for Windows, GraphPad Software, La Jolla California USA, www.graphpad.com).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cstrong\u003eALDH1A3 negative predicted CRPC in patients on adjuvant ADT\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eOur earlier work has demonstrated that ALDH1A3 highly expressed in human prostate, which had a strong correlation with primary prostate cancer luminal signature and could be a potential biomarker of AR signaling pathway. Then we moved on to investigate its expression in the castration resistant prostate cancer. We retrospectively reviewed 79 patients with advanced disease who underwent radical prostatectomy followed by adjuvant hormonal therapy in our center. It was indicated that negative expression of ALDH1A3 predicted shorter time progression to castration resistance on adjuvant hormonal therapy (Fig 1A-C). Besides, its expression is down regulated in three datasets. Beltran et al performed a sequencing profiling on 114 metastatic samples from 51 CRPC and 30 neuroendocrine prostate cancer patients. The ALDH1A3 expression was loweer in neuroendocrine and CRPC group compared with primary cancer (Fig 1D). Another group performed RNA sequencing for primary prostate cancer and mCRPC samples, ALDH1A3 also down regulated in mCRPC samples (Fig 1E). The data from Michigan group showed the same trend (Fig 1F). All expression level of ALDH1A3 in these three datasets are defined as Z score or log2 value.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eALDH1A3 signature has a strong correlation with prostate cancer progression, and PI3K signaling pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eA multi-institutional clinical sequencing infrastructure to conduct prospective transcriptome sequencing of bone or soft tissue tumor biopsies from a cohort of 150 mCRPC affected individuals was performed to establish a precision medicine framework for mCRPC. According to the expression level of ALDH1A3 in the dataset, we defined the cases above the median value of ALDH1A3 in the whole cases as ALDH1A3\u003csup\u003ehigh\u003c/sup\u003e, those whose expression level lower than the median as ALDH1A3\u003csup\u003elow\u003c/sup\u003e. We compared ALDH1A3\u003csup\u003ehigh\u003c/sup\u003e and ALDH1A3\u003csup\u003elow\u003c/sup\u003e cases to generate a differential expression gene list as ALDH1A3 signature (Table S1). The ALDH1A3 ranking the most significant changes in the whole list confirmed the results. The Gene Set Enrichment Analysis (GSEA) finally correlated ALDH1A3 signature with several biologic event. We found the ALDH1A3 signature had significant positive correlation with ERG signature and prostate cancer luminal signature, respectively (Enrichment score: 0.77, 0.5; Both p value: \u0026lt;0.01) (Fig 2A.B), and it had negative correlation with lymph nodes and PI3K-AKT-mTOR signaling pathway, meaning that ALDH1A3\u003csup\u003elow\u003c/sup\u003e group might be associated with lymph nodes metastasis and PI3K-AKT-mTOR signaling activation (Fig 2C.D).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDown-regulation of ALDH1A3 causes ADT resistance in prostate cancer cells\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBased on the above results, we aimed to investigate the mechanisms of negative expression of ALDH1A3 in mCRPC samples. We designed small guide RNA targeting the functional exon of ALDH1A3 to knock out this gene on cell level to see the phenotype changes. After validation of the knock out efficiency (Fig 3A), we picked up the most potent sgRNA to target ALDH1A3 in LnCaP and VCaP cells, both of which are sensitive to androgen ablation treatment in vitro. We found that the growth rate of the control cells (targeting GFP) had no significant difference with ALDH1A3 knockout cells in normal medium. But in charcoal stripped medium which has already filtered androgen, the ALDH1A3 knockout cells, growing slowly, could be able to survive. As a result, the growth rate of ALDH1A3 knockout cells was significantly faster than the control cells in charcoal stripped medium (Fig 3B). We also repeated the experiment in VCaP cells, and the results were consistent with those in LnCaP cells (Fig 3B). We did the morphology observation for those LnCaP cells as well to predict the potential mechanisms of the ADT resistance. From Fig 3C, At day 7, the control cells in medium without DHT showed spindle-like morphology and the cell number is low compared with those control cells in normal medium showing in aggregation or in cluster. However, it didn\u0026rsquo;t show any difference in ALDH1A3 knockout cells in DHT-free medium and in normal medium. At day 14, 95% of the control cells in DHT-free medium had been dead, whereas there were 30-40% of the ALDH1A3 knockout cells still alive.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eALDH1A3 knockout facilitates castration resistance through PI3K-AKT-mTOR signaling pathway\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eBased on the above GSEA results, the ALDH1A3 signature negatively correlated with PI3K-AKT-mTOR signaling pathway. We speculate that the ALDH1A3 loss could activate the PI3K pathway. In order to validate this hypothesis, we did Western blot assay to test the PI3K pathway activation to compare the ALDH1A3 wild type cells and knockout cells. The blotting showed that both in LnCaP and VCaP cells, phospho-AKT had been elevated in ALDH1A3 knockout group (Fig 4). Next, in order to determine the relationship between castration resistance and PI3K signaling pathway activation by ALDH1A3 knockout, We performed rescue assay to block PI3K signaling pathway by using PI3K signaling inhibitor BEZ235. The results demonstrated that 500nM BEZ235 treatment after 48 hours could rescue the resistance by ALDH1A3 knockout. In terms of the morphology analysis, LnCaP cells in BEZ235 treatment and DHT-free group showed spindle-like morphology, similar with control cells in the DHT-free medium (Fig 5A). Those cells showed less aggressive phenotype and finally detached from the bottom of the plate. The growth rate of ALDH1A3 knockout cells showed 30% higher than the wild type cells but was inhibited totally by BEZ235 in DHT-free medium (Fig 5B). \u0026nbsp;\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eOur previous study has demonstrated that ALDH1A3 is specifically expressed in luminal compartment in human prostate epitheliums. From the TCGA data of 333 primary prostate cancer, ALDH1A3 correlated with AR signaling pathway and corresponding luminal signature. It is also suggested that ALDH1A3 has a potential to be a predictor of survival in primary prostate cancer patients. In present study, withour single center follow up database, we performed IHC analysis on tissue microarray for patients with advanced disease upon adjuvant hormonal therapy after radical prostatectomy. The results showed that ALDH1A3 low-expression patients indicated shorter time to progression to castration resistance.\u0026nbsp; The phenotype that we showed at the beginning has implications to understand the mechanisms of this prostate specific gene in the development of cancer progression. From the metastatic prostate cancer samples database, the RNA sequencing data demonstrated that ALDH1A3 was down regulated in mCRPC group compared with the primary prostate cancer. Next-generation sequencing (NGS) analysis has made it possible to reclassify different subtypes in a specific cancer by molecular changes. It indeed could provide benefits for clinical practice in oncology, such as diagnosis, prognosis, and treatment decisions. For example, patients with cancers of unknown primary (CUP), traditionally, are generally assumed to have a poor prognosis with a treatment in cytotoxic chemotherapy guided by histologic features and the pattern of metastatic spread. A new study showed that NGS may provide an opportunity for CUP patients to benefit from individualized therapies according to the targetable genomic alterations identified by tumor molecular profiling(\u003ca href=\"#_ENREF_16\"\u003e16\u003c/a\u003e). In that study, 10% of patients received targeted therapies based on their mutation signatures.\u003c/p\u003e\n\u003cp\u003eThanks to the RNA sequencing data, we found that the PI3K pathway signature had been highly correlated with ALDH1A3 signature. Then we speculated the PI3K signaling pathway activation might be due to ADT resistance. And we also confirmed this hypothesis by showing the up-regulation of phospho-AKT upon ALDH1A3 knockout. Furthermore, PI3K signaling pathway inhibitor BEZ235 could rescue the ADT resistance following ALDH1A3 knockout. The PI3K/AKT/mTOR pathway is altered in almost 50% of mCRPC through either PTEN inactivation or/and aberrant activation in PIK3CA/B(\u003ca href=\"#_ENREF_13\"\u003e13\u003c/a\u003e). It\u0026rsquo;s been demonstrated that PI3K-AKT-mTOR signaling pathway deregulation resulting from PTEN loss is associated with androgen insensitivity and the development of CRPC(\u003ca href=\"#_ENREF_17\"\u003e17\u003c/a\u003e). Knocking down PTEN can convert the androgen-dependent Myc-CaP cell into androgen independence, suggesting that PTEN intrinsically controls androgen responsiveness, a critical step in the development of castration resistant prostate cancer(\u003ca href=\"#_ENREF_18\"\u003e18\u003c/a\u003e). Based on these data, phase I/II trials assessing the combination of next-generation AR therapy with a PI3K/AKT/mTOR inhibitor are currently ongoing (ClinicalTrials.gov identifier: NCT02407054 and NCT02215096). ALDH1A3, also as retinoic acid anabolizing enzyme(\u003ca href=\"#_ENREF_19\"\u003e19\u003c/a\u003e) has been proved a potential novel target for triple-negative breast tumors and cancer stem cells(\u003ca href=\"#_ENREF_20\"\u003e20\u003c/a\u003e). Retinoic acid receptor-related orphan receptor \u0026gamma; (ROR\u0026gamma;) antagonists are efficacious in re-sensitizing docetaxel and cabazitaxel cross-resistant CRPC cells(\u003ca href=\"#_ENREF_21\"\u003e21\u003c/a\u003e). It demonstrated that targeting retinoid signaling might be a potential approach in the treatment of CRPC(\u003ca href=\"#_ENREF_22\"\u003e22\u003c/a\u003e).In conclusion, the NGS provides multiple new opportunities and tools to accelerate and facilitate the entire process of drug testing toward accelerated drug positioning and approval for precise and personalized medicine. It also allows researchers to discover some hidden pattern of the complex cancer. Such strategies include the development of inhibitors with a higher potency against their intended target, like ADT and Abiraterone, and the use of combination therapies incorporating inhibitors of parallel or alternative signaling pathways mediating acquired resistance, like the mTOR inhibitor BEZ235 in the treatment of PI3K-AKT-mTOR pathway activation. In this paper, we\u0026rsquo;ve investigated alterations in the targeted gene leading to ADT resistance to mCRPC. Based on the RNA sequencing and experimental results, we found that PI3K pathway alteration or activation might be the cause of the resistance. We, then, rescued the ADT resistance by PI3K pathway inhibitor-BEZ235. The acquired resistance to ADT therapy by some patients with low level of ALDH1A3 could be overcome by combination therapy with PI3K pathway inhibitor, which will provide a new potential approach to the treatment of mCRPC.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll patients were recruited following informed consent, the protocol was approved by ethical committee of The First Affiliated Hospital of Nanjing Medical University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors are consent for publication in BMC Urology\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eYJ and Wang Z designed this work.\u003c/p\u003e\n\u003cp\u003eWS, ZX and LC performed the experiment and wrote the manuscript.\u003c/p\u003e\n\u003cp\u003eBM and TY performed the pathology experiment and data review\u003c/p\u003e\n\u003cp\u003eZJ and ZT performed the follow-up of the patients.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConflict of Interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflict of interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements and Fundings\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis study was funded by Prostate cancer cohort study of Nanjing Medical University (NMUC2018003A).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDisclosure\u003c/strong\u003e \u003cstrong\u003eStatement\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe supplementary file will be downloaded in the online version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors declare no competing interests in this work.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eMargulies M, Egholm M, Altman WE, et al.: Genome sequencing in microfabricated high-density picolitre reactors. Nature 437: 376-380, 2005.\u003c/li\u003e\n\u003cli\u003eCancer Genome Atlas Research N: The Molecular Taxonomy of Primary Prostate Cancer. Cell 163: 1011-1025, 2015.\u003c/li\u003e\n\u003cli\u003eRobinson D, Van Allen EM, Wu YM, et al.: Integrative clinical genomics of advanced prostate cancer. Cell 161: 1215-1228, 2015.\u003c/li\u003e\n\u003cli\u003eMoretti A, Li J, Donini S, Sobol RW, Rizzi M and Garavaglia S: Crystal structure of human aldehyde dehydrogenase 1A3 complexed with NAD+ and retinoic acid. Scientific reports 6: 35710, 2016.\u003c/li\u003e\n\u003cli\u003eKong B, Wu W, Cheng T, et al.: A subset of metastatic pancreatic ductal adenocarcinomas depends quantitatively on oncogenic Kras/Mek/Erk-induced hyperactive mTOR signalling. Gut 65: 647-657, 2016.\u003c/li\u003e\n\u003cli\u003eSaw YT, Yang J, Ng SK, et al.: Characterization of aldehyde dehydrogenase isozymes in ovarian cancer tissues and sphere cultures. BMC cancer 12: 329, 2012.\u003c/li\u003e\n\u003cli\u003eAli HR, Dawson SJ, Blows FM, Provenzano E, Pharoah PD and Caldas C: Cancer stem cell markers in breast cancer: pathological, clinical and prognostic significance. Breast cancer research : BCR 13: R118, 2011.\u003c/li\u003e\n\u003cli\u003eMao P, Joshi K, Li J, et al.: Mesenchymal glioma stem cells are maintained by activated glycolytic metabolism involving aldehyde dehydrogenase 1A3. Proc Natl Acad Sci U S A 110: 8644-8649, 2013.\u003c/li\u003e\n\u003cli\u003eWang S, Liang C, Bao M, et al.: ALDH1A3 correlates with luminal phenotype in prostate cancer. Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine 39: 1010428317703652, 2017.\u003c/li\u003e\n\u003cli\u003eGrasso CS, Wu YM, Robinson DR, et al.: The mutational landscape of lethal castration-resistant prostate cancer. Nature 487: 239-243, 2012.\u003c/li\u003e\n\u003cli\u003eTong X, Li K, Luo Z, et al.: Decreased TIP30 expression promotes tumor metastasis in lung cancer. The American journal of pathology 174: 1931-1939, 2009.\u003c/li\u003e\n\u003cli\u003eBeltran H, Prandi D, Mosquera JM, et al.: Divergent clonal evolution of castration-resistant neuroendocrine prostate cancer. Nature medicine 22: 298-305, 2016.\u003c/li\u003e\n\u003cli\u003eTaylor BS, Schultz N, Hieronymus H, et al.: Integrative genomic profiling of human prostate cancer. Cancer cell 18: 11-22, 2010.\u003c/li\u003e\n\u003cli\u003eGao D, Vela I, Sboner A, et al.: Organoid cultures derived from patients with advanced prostate cancer. Cell 159: 176-187, 2014.\u003c/li\u003e\n\u003cli\u003eSanjana NE, Shalem O and Zhang F: Improved vectors and genome-wide libraries for CRISPR screening. Nature methods 11: 783-784, 2014.\u003c/li\u003e\n\u003cli\u003eVarghese AM, Arora A, Capanu M, et al.: Clinical and molecular characterization of patients with cancers of unknown primary in the modern era. Annals of oncology : official journal of the European Society for Medical Oncology2017.\u003c/li\u003e\n\u003cli\u003eWang S, Gao J, Lei Q, et al.: Prostate-specific deletion of the murine Pten tumor suppressor gene leads to metastatic prostate cancer. Cancer cell 4: 209-221, 2003.\u003c/li\u003e\n\u003cli\u003eJiao J, Wang S, Qiao R, et al.: Murine cell lines derived from Pten null prostate cancer show the critical role of PTEN in hormone refractory prostate cancer development. Cancer research 67: 6083-6091, 2007.\u003c/li\u003e\n\u003cli\u003eLochbaum R, Schilpp C, Nonnenmacher L, Frick M, Dietl P and Wittekindt OH: Retinoic acid signalling adjusts tight junction permeability in response to air-liquid interface conditions. Cellular signalling 65: 109421, 2020.\u003c/li\u003e\n\u003cli\u003eVidovic D, Huynh TT, Konda P, et al.: ALDH1A3-regulated long non-coding RNA NRAD1 is a potential novel target for triple-negative breast tumors and cancer stem cells. Cell death and differentiation 27: 363-378, 2020.\u003c/li\u003e\n\u003cli\u003eWang Y, Huang Z, Chen CZ, et al.: Therapeutic Targeting of MDR1 Expression by RORgamma Antagonists Resensitizes Cross-Resistant CRPC to Taxane via Coordinated Induction of Cell Death Programs. Molecular cancer therapeutics 19: 364-374, 2020.\u003c/li\u003e\n\u003cli\u003eSeed RI, Taurozzi AJ, Wilcock DJ, et al.: The putative tumour suppressor protein Latexin is secreted by prostate luminal cells and is downregulated in malignancy. Scientific reports 9: 5120, 2019.\u003c/li\u003e\n\u003c/ol\u003e\n"},{"header":"Supporting Information","content":"\u003cp\u003e\u003cstrong\u003eTable S1: \u003c/strong\u003eA differential expression gene list as ALDH1A3 signature.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcan","sideBox":"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bcan/default.aspx","title":"BMC Cancer","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"castration resistance prostate cancer; survival time; aldehyde dehydrogenase; androgen deprivation therapy; resistance.","lastPublishedDoi":"10.21203/rs.2.21612/v2","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.2.21612/v2","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Aldehyde dehydrogenase 1A3 (ALDH1A3) has been implicated in the survival and proliferation of prostate cancer cells. We retrospectively reviewed our patients with advanced disease on adjuvant hormonal therapy after prostatectomy. Time to castration resistance stage was documented. And Immunohistochemistry analysis for ALDH1A3 was performed for those patient samples on tissue microarray. Using bioinformatics analysis for RNA sequencing data of both primary prostate cancer and metastatic castration resistance prostate cancer (mCRPC) from online datasets, we have found that the expression level of ALDH1A3 is lower in mCRPC group than in primary cancer group. Crispr-Cas9 was used to knock out ALDH1A3 in prostate cancer luminal cells, and morphologic analysis as well as the Gene Set Enrichment Analysis (GSEA) were facilitated to discover the mechanisms of the resistance phenotype. We found that the patients with ALDH1A3 low expression had shorter time to progression to castration resistance compared with those of higher expression group on adjuvant hormonal therapy after radical prostatectomy. The ALDH1A3 knockout cells gradually acquired resistance to androgen deprivation therapy, a few cells have been found in knockout group showing as that the spindle-like luminal cells in charcoal stripped medium. Furthermore, PI3K pathway activation has been confirmed by Western blot. The PI3K pathway inhibitor BEZ235 has been demonstrated that the acquired ADT resistance by ALDH1A3 down regulation could be rescued by PI3K pathway inhibitor. Together, these results suggested a novel function for ALDH1A3 in development of mCRPC, and indicated PI3K pathway inhibitor has the potential in the treatment of a subgroup of mCRPC patients.","manuscriptTitle":"ALDH1A3 serves as a predictor for castration resistance in prostate cancer patients","msid":"","msnumber":"","nonDraftVersions":[{"code":2,"date":"2020-02-24 15:33:02","doi":"10.21203/rs.2.21612/v2","editorialEvents":[{"type":"communityComments","content":0},{"type":"editorInvitedReview","content":"","date":"2020-02-29T12:00:00+00:00","index":3,"fulltext":"Recommendation: Reviewer's comments unavailable pending editorial decision\n"},{"type":"reviewerAgreed","content":"","date":"2020-02-28T12:00:00+00:00","index":3,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2020-02-25T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-02-25T12:00:00+00:00","index":1,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-02-25T12:00:00+00:00","index":1,"fulltext":"Recommendation: Reviewer's comments unavailable pending editorial decision\n"},{"type":"reviewerAgreed","content":"","date":"2020-02-25T12:00:00+00:00","index":2,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-02-25T12:00:00+00:00","index":2,"fulltext":"Recommendation: Reviewer's comments unavailable pending editorial decision\n"},{"type":"editorAssigned","content":"","date":"2020-02-24T12:00:00+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2020-02-23T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-02-23T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcan","sideBox":"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bcan/default.aspx","title":"BMC Cancer","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}},{"code":1,"date":"2020-01-22 22:03:55","doi":"10.21203/rs.2.21612/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Major revision","date":"2020-02-17T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-02-16T12:00:00+00:00","index":2,"fulltext":"Recommendation: Major revisions required\nForm responses:\n---\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **Not relevant to this manuscript**\n* Quality of written English: **Needs some language corrections before being published**\n* Declaration of competing interests: **General comments\nBy using the clinical samples, in vitro experiments and publically available RNA sequencing database, authors revealed that the low expression of ALDH1A3 was associated with development of castrate resistant prostate cancer, which is possibly mediated by PI3K pathway. Their findings support the possible utility of PI3K pathway inhibitors in treatment of a subset of CRPC patients.\n\nSpecific comments\nMajor comments\n1. The activity of androgen receptor (AR) signaling pathway in ALDH1A3 knock out cells\nNumerous evidences revealed that AR signaling pathway is still activated by multiple mechanism such as AR amplification and AR mutation, which made AR as an important treatment target in CRPC patients. Could you show the effect of ALDH1A3 knock out of AR expression or downstream activity of AR pathway?\n2. The possible role of the retinoic acid in ALDH1A3-low CRPC\nThe retinoic acid has a long history to be investigated as a potential chemoprevention agent for prostate cancer or a therapeutic agent for CRPC. As ALDH1A3 is an enzyme which produces the retinoic acid, the discussion on the possible effect of retinoic acid therapy on ALDH1A3-low CRPC would be interest of many readers.\n\nMinor comments\n1. The detail of androgen deprivation therapy\nCould you show the specific information regarding androgen deprivation therapy which your patients received? Are there any patients received new generation anti-androgens?\n2. The confirmation of the effect of BEZ235\nHow could you assure that 500 nm of BEZ235 efficiently blocked PI3K pathway in vitro experiments? Western blot analysis showing the effect of BEZ235 on pAKT expression will be supportive.**\n\nComments to Author:\n---\nGeneral comments\nBy using the clinical samples, in vitro experiments and publically available RNA sequencing database, authors revealed that the low expression of ALDH1A3 was associated with development of castrate resistant prostate cancer, which is possibly mediated by PI3K pathway. Their findings support the possible utility of PI3K pathway inhibitors in treatment of a subset of CRPC patients.\n\nSpecific comments\nMajor comments\n1. The activity of androgen receptor (AR) signaling pathway in ALDH1A3 knock out cells\nNumerous evidences revealed that AR signaling pathway is still activated by multiple mechanism such as AR amplification and AR mutation, which made AR as an important treatment target in CRPC patients. Could you show the effect of ALDH1A3 knock out of AR expression or downstream activity of AR pathway?\n2. The possible role of the retinoic acid in ALDH1A3-low CRPC\nThe retinoic acid has a long history to be investigated as a potential chemoprevention agent for prostate cancer or a therapeutic agent for CRPC. As ALDH1A3 is an enzyme which produces the retinoic acid, the discussion on the possible effect of retinoic acid therapy on ALDH1A3-low CRPC would be interest of many readers.\n\nMinor comments\n1. The detail of androgen deprivation therapy\nCould you show the specific information regarding androgen deprivation therapy which your patients received? Are there any patients received new generation anti-androgens?\n2. The confirmation of the effect of BEZ235\nHow could you assure that 500 nm of BEZ235 efficiently blocked PI3K pathway in vitro experiments? Western blot analysis showing the effect of BEZ235 on pAKT expression will be supportive."},{"type":"editorInvitedReview","content":"","date":"2020-02-13T12:00:00+00:00","index":3,"fulltext":"Recommendation: Major revisions required\nForm responses:\n---\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **No**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I am able to assess the statistics**\n* Quality of written English: **Needs some language corrections before being published**\n* Declaration of competing interests: **I declare that I have no competing interests**\n\nComments to Author:\n---\nIn this study, the authors want to elucidate the roles of ALDH1A3 in castration resistance prostate cancer. They found that ALDH1A3 signature has a strong correlation with prostate cancer progression and PI3K signaling pathway. ALDH1A3 knockout facilitates castration resistance through PI3K-AKT-mTOR signaling pathway. They also noted that PI3K pathway inhibitor has the potential in the treatment of a subgroup of mCRPC patients. Some comment are as follows.\n\n\n1. The authors found that HIGH ALDH1A3 is associated cell proliferation and invasion, in the PC-3 cell and poor progression-free survival in the prostate ca cohort(reference 9). But in the present study, they found patients with LOW ALDH1A3 have worse clinical outcome. ALDH1A3 can promote prostate cancer progression but prevent CRPC development? Why?\n2. VCaP is a hormone refractory cell line. LnCaP is a androgen-sensitive cell line. But the results of biology studies are similar after ALDH1A3 knockout. Why?\n3. Please describe the ALDH1A3 IHC protocol and score system in the Materials and Methods.\n4. How do you select patients who need adjuvant hormonal therapy? Please describe the inclusion criteria.\n5. Please describe the regimen and duration of adjuvant hormonal therapy.\n6. Please describe the follow-up protocol after operation .\n7. Please provide an additional maker of PI3K pathway after ALDH1A3 knockout in vitro . Dose ALDH1A3 regulate AR and ERG expression in vitro?\n"},{"type":"reviewerAgreed","content":"","date":"2020-02-07T12:00:00+00:00","index":3,"fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-02-02T12:00:00+00:00","index":2,"fulltext":""},{"type":"editorInvitedReview","content":"","date":"2020-02-01T12:00:00+00:00","index":1,"fulltext":"Recommendation: Reject\nForm responses:\n---\n* Are the methods appropriate and well described?: **Yes**\n* Does the work include the necessary controls?: **Yes**\n* Are the conclusions drawn adequately supported by the data shown?: **Yes**\n* Are you able to assess any statistics in the manuscript or would you recommend an additional statistical review?: **I recommend additional statistical review**\n* Quality of written English: **Acceptable**\n* Declaration of competing interests: **N/A**\n\nComments to Author:\n---\nThe expression level of ALDH1A3 is marker of prostate cancer, especially in prostate with the acquired resistance. The patients with ALDH1A3 low expression had shorter time to progression to castration resistance compared with those of higher expression group on adjuvant hormonal therapy after radical prostatectomy. This story is interesting with clinical relevance."},{"type":"editorAssigned","content":"","date":"2020-01-30T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewersInvited","content":"","date":"2020-01-30T12:00:00+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2020-01-30T12:00:00+00:00","index":1,"fulltext":""},{"type":"checksComplete","content":"","date":"2020-01-21T12:00:00+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2020-01-20T12:00:00+00:00","index":"","fulltext":""},{"type":"submitted","content":"","date":"2020-01-15T12:00:00+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-cancer","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"bcan","sideBox":"Learn more about [BMC Cancer](http://bmccancer.biomedcentral.com/)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/bcan/default.aspx","title":"BMC Cancer","twitterHandle":"BMC_series","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"em","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7a2bdb99-fd41-4fa4-9ce7-c396be982ccb","owner":[],"postedDate":"February 24th, 2020","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":52307,"name":"Cancer Biology"},{"id":52308,"name":"Oncology"}],"tags":[],"updatedAt":"2021-07-27T21:00:33+00:00","versionOfRecord":{"articleIdentity":"rs-12197","link":"https://doi.org/10.1186/s12885-020-06899-x","journal":{"identity":"bmc-cancer","isVorOnly":false,"title":"BMC Cancer"},"publishedOn":"2020-05-06 21:00:33","publishedOnDateReadable":"May 6th, 2020"},"versionCreatedAt":"2020-02-24 15:33:02","video":"","vorDoi":"10.1186/s12885-020-06899-x","vorDoiUrl":"https://doi.org/10.1186/s12885-020-06899-x","workflowStages":[]},"version":"v2","identity":"rs-12197","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"identity":"rs-12197","version":["v2"]},"buildId":"7rjqhiLT3MXkJMwkYKINL","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}