Full text
107,626 characters
· extracted from
preprint-html
· click to expand
Dissecting Medullary Raphe Neurons Regulating Multiple Thermogenic Pathways | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Dissecting Medullary Raphe Neurons Regulating Multiple Thermogenic Pathways View ORCID Profile Shuntaro Uchida , Mitsue Hagihara , Kenichi Inoue , View ORCID Profile Takaya Abe , View ORCID Profile Takeshi Sakurai , View ORCID Profile Kazunari Miyamichi doi: https://doi.org/10.1101/2025.09.01.673572 Shuntaro Uchida 1 Laboratory for Comparative Connectomics, RIKEN Center for Biosystems Dynamics Research , Kobe, Hyogo 650-0047, Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Shuntaro Uchida For correspondence: shuntaro.uchida{at}riken.jp kazunari.miyamichi{at}riken.jp Mitsue Hagihara 1 Laboratory for Comparative Connectomics, RIKEN Center for Biosystems Dynamics Research , Kobe, Hyogo 650-0047, Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site Kenichi Inoue 2 Laboratory for Animal Resources and Genetic Engineering, RIKEN Center for Biosystems Dynamics Research , Kobe, Hyogo 650-0047, Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site Takaya Abe 2 Laboratory for Animal Resources and Genetic Engineering, RIKEN Center for Biosystems Dynamics Research , Kobe, Hyogo 650-0047, Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Takaya Abe Takeshi Sakurai 3 Institute of Medicine/International Institute for Integrative Sleep Medicine (WPI-IIIS), University of Tsukuba , Tsukuba, Ibaraki, Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Takeshi Sakurai Kazunari Miyamichi 1 Laboratory for Comparative Connectomics, RIKEN Center for Biosystems Dynamics Research , Kobe, Hyogo 650-0047, Japan 4 CREST, Japan Science and Technology Agency , Kawaguchi, Saitama 332-0012, Japan Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Kazunari Miyamichi For correspondence: shuntaro.uchida{at}riken.jp kazunari.miyamichi{at}riken.jp Abstract Full Text Info/History Metrics Supplementary material Preview PDF Summary Thermogenesis is critical for survival and health in mammals. Although the thermoregulatory systems in the preoptic area are well documented, the downstream processing of these central signals—particularly by medullary neurons involved in the control of shivering and sympathetic activation of brown adipose tissue (BAT)—remains incompletely understood. Here we show that vesicular glutamate transporter type 3 ( vGluT3 )-expressing neurons in the medullary raphe pallidus (RPa) become active immediately before a spontaneous increase in body temperature. These neurons remain inactive under experimentally induced hypometabolic conditions and are necessary for rapid recovery from hypothermia. Furthermore, they communicate with multiple brainstem systems involved in the integration of thermal cues. Notably, RPa- vGluT3 neurons can drive shivering via specific brainstem premotor neurons, in addition to regulating sympathetic outflows for BAT thermogenesis and heat-conserving piloerection. These data indicate that RPa- vGluT3 neurons function as medullary hubs, coordinating sympathetic and somatic motor outputs to increase body temperature. Download figure Open in new tab Highlights Raphe pallidus- vGluT3 neurons are active immediately preceding a spontaneous rise in body temperature. They are suppressed during the state of Q-neuron–induced hypothermia and hypometabolism (QIH). They connect with multiple brainstem pathways involved in thermoregulation. They control shivering via brainstem somatic premotor neurons. Introduction Mammals possess a remarkable capacity to tightly regulate their core body temperature (T c ) within a specific range, typically maintaining it above that of the surrounding environment. The preoptic area (POA) is instrumental in the thermal regulation process. It receives and integrates diverse inputs from various thermosensory systems located in the skin, abdominal organs, and spinal cord, and directly measures local brain temperature 1 – 3 . When POA neurons detect deviations in T c from their set point or anticipate thermal changes based on environmental cues, they adjust thermogenesis by activating or inactivating brown adipose tissue (BAT), skeletal muscle shivering, and vasoconstriction 1 , 2 . These regulatory responses are primarily governed by neural pathways connecting the POA to the medullary regions that control autonomic and/or skeletal thermogenic functions 2 . Over the past decade, studies in rodent models have revealed the molecular identities of central thermoregulatory neurons in the POA and mapped their input/output neural circuit organizations. However, our understanding of medullary thermoregulatory systems—particularly their cellular organization, activity dynamics, and neural networks—remains limited. Specifically, recent advancements in viral genetic tools in mice 4 have greatly enhanced our knowledge of central thermoregulatory neurons in the POA 1 , 5 . For instance, specific subsets of POA neurons, such as those expressing the prostaglandin E type 3 receptor (EP3R), are implicated in fever responses triggered by lipopolysaccharides or endogenous pyrogenic mediators such as prostaglandin E2 (PGE2) 6 – 10 . In this context, immune signals triggered by lipopolysaccharides are critically mediated through a defined inhibitory neural population located in the ventral medial preoptic area 11 . POA neurons expressing the transient receptor potential cation channel M-type 2 (TRPM2) may play a role in detecting local POA temperature 12 . Warmth-sensing POA neurons coexpressing pituitary adenylate cyclase-activating polypeptide (PACAP) and brain-derived neurotrophic factor (BDNF) can induce hypothermia upon activation 13 . Moreover, POA neurons expressing the leptin receptor (LeptR) 14 , violet light-sensitive opsin 5 (OPN5) 15 , pyroglutamylated RFamide peptide (QRFP) 16 , and those active during daily torpor 17 can induce a prolonged torpor-like state, with QRFP neurons (Q neurons, for simplicity) specifically contributing to an intensive hypothermic condition known as Q neuron-induced hypometabolic/hypothermic state (QIH) 16 . In addition, cold-sensitive POA neurons expressing bombesin-like receptor 3 (BSR3) are involved in inducing thermogenesis 18 . The identification of these molecularly defined neural populations facilitates the monitoring of their activities during thermal challenges 13 , 18 and torpor periods 17 , manipulation of their functions 11 , 15 – 19 , and mapping of their input/output neural circuitry 11 , 16 . Regarding the thermosensory input to the POA, extensive research has revealed that ascending cold and warm signals are mediated by two anatomically distinct subdivisions of the lateral parabrachial nuclei (LPB) in the brainstem: cold signals in the external lateral LPB (LPBel) and warm signals in the dorsal LPB (LPBd) 20 – 24 . Although the detailed circuit mechanisms remain incompletely understood, these signals are thought to be integrated into POA neurons. POA neurons project to downstream neural circuits extending from the dorsomedial hypothalamus (DMH) to the medullary RPa 2 . DMH neurons are activated by cold stimuli in vivo 25 , and the genetic activation of DMH neurons expressing vesicular glutamate transporter 2 (vGluT2), LeptR, and BRS3 induces thermogenesis 13 , 26 , 27 . RPa neurons receive input from the DMH, and optogenetic activation of this pathway induces BAT thermogenesis 26 , 28 , 29 . Exposure to cold or pyrogens induces c-Fos expression, used as a proxy for neural activation, in RPa neurons expressing vGluT3 30 , 31 . These vGluT3 -expressing (+) neurons project axons to the spinal cord to modulate sympathetic outflow to the BAT. Pharmacological inhibition of the RPa impairs both BAT and shivering thermogenesis 28 , 30 , 32 . In contrast to the substantial progress made in the characterization of thermoregulatory neurons in the POA and DMH, research on medullary thermoregulatory systems has lagged behind. Although recent seminal studies have utilized vGluT3-Cre mice to genetically access vGluT3+ neurons in the RPa, demonstrating their capacity to drive lipolysis 33 and thermogenesis 34 through chemogenetic activation, these studies have not elucidated the precise neural activity dynamics of these neurons or mapped their input/output neural circuit organization. To address this gap and facilitate Cre-based neural manipulations, we generated vGluT3-Flpo mice, which allow fiber photometry monitoring 35 of vGluT3 + neuron activity in conjunction with Cre-mediated targeted modulation of upstream Q neurons 16 . Additionally, we utilized rabies virus-mediated monosynaptic tracing 36 along with axonal projection mapping to comprehensively characterize the inputs and outputs of vGluT3+ neurons in the RPa, shedding light on their activity dynamics, functions, and neural circuitry in the context of thermoregulation in mice. Results Generation of vGluT3-Flpo knock-in mice To genetically target vGluT3 + neurons, vGluT3-Flpo knock-in mice were generated using CRISPR-mediated genome editing ( Fig. S1 ) 37 . To test the efficiency and specificity of Flpo activity, we injected an Flpo-dependent adeno-associated virus (AAV) vector encoding GCaMP6s 38 into the RPa of vGluT3-Flpo mice ( Fig. 1A ). Brain sections were stained with a vGluT3 RNA probe by in situ hybridization (ISH), combined with immunostaining, for green fluorescent protein (GFP) ( Fig. 1B ). We found that 95.4 ± 2.4% (mean ± standard deviation) of GCaMP6s+ neurons expressed vGluT3 and the efficiency of viral targeting was approximately 40% ( Fig. 1C ). Sections were also stained with tryptophan hydroxylase 2 (TPH2), a marker for serotonergic neurons within the RPa, which are implicated in regulating the respiratory systems 39 – 41 and exhibit an inverse correlation with vGluT3 42 mRNA expression levels. We found that only 2.3 ± 2.8% of GCaMP6s+ neurons expressed TPH2. These data indicate that Flpo expression is specific to a subpopulation of non-serotonergic vGluT3 + neurons within the RPa (hereafter referred to as RPa- vGluT3 neurons). Download figure Open in new tab Figure 1: Fiber photometry-based Ca 2+ imaging of RPa- vGluT3 neurons (A) Schematic of the experiment. (B) Representative coronal section of the RPa showing vGluT3 (magenta), GCaMP6s (yellow), and TPH2 (cyan) expression. Scale bars, 100 µm. (C) Targeting specificity ( vGluT3 +/GCaMP6s+ and TPH2+/GCaMP6s+) and targeting efficiency (GCaMP6s+/ vGluT3 +TPH2−, GCaMP6s+/ vGluT3 +TPH2+, and GCaMP6s+/ vGluT3 −TPH2+). N = 4 mice. (D) Representative photometry (top) and T c (bottom) traces. Gray and magenta shading represent the pre-up and up phases, respectively. Right panels show 25-min magnified views of the red-boxed region. (E) AUC of 3SD signals (left) and mean Z-score (right). Friedman rank sum test with pairwise comparisons using the Wilcoxon signed-rank sum test with Bonferroni correction, * p < 0.05, N = 9 mice. (F) Correlation between the mean Z-score or normalized maximum Z-score during the pre-up phase (left) and T c increase per episode. n = 86 episodes from 9 mice. Adjusted coefficient of determination (R 2 ) is shown; p-value calculated using a t-test under the null hypothesis of no correlation. (G) Representative photometry traces under control room temperature (left) and cold exposure (right) conditions. (H) AUC of 3SD signals. * p < 0.05 by exact Wilcoxon signed-rank sum test. N = 7 mice. (I) Schematic of the experimental procedure (left) and timeline (right) for chemogenetic inhibition of RPa- vGluT3 neurons. (J) Representative coronal sections showing hM4Di (magenta) expression in the RPa, with DAPI nuclear counterstaining (blue). Scale bars, 1 mm (left) and 100 µm (right). (K) Group mean traces of T c in hM4Di+ mice following administration of saline (gray) or CNO (red) at time 0. Repeated-measures two-way ANOVA shows significant solution ( p < 0.01), time course ( p < 0.01), and interaction ( p < 0.01) effects. (L) T c at 120 min following saline or CNO injection (left) and AUC for T c from 0 to 240 min (right). *, p < 0.05 by Wilcoxon signed-rank sum test. N = 12. (M) Correlation between the number of hM4Di-mCherry+ cells and the change in T c at 120 min following saline or CNO injection. Adjusted coefficient of determination (R 2 ) is shown, with the p -value calculated using a t -test under the null hypothesis of no correlation. Error bars indicate standard deviation (SD). For additional data, see Figs. S1 – S3 . Phasic activity of RPa- vGluT3 neurons during thermogenesis To visualize the activity of RPa- vGluT3 neurons, we used fiber photometry-based in vivo Ca 2+ imaging 35 . We injected AAV -fDIO-GCaMP6s into the RPa and placed optical fibers over the RPa of vGluT3-Flpo mice ( Fig. S2A ). Post hoc histology confirmed the expression of GCaMP6s and the locations of the optic fibers ( Fig. S2B ). We used a telemetry system to monitor T c in freely moving mice ( Fig. 1D ). The representative trace in Fig. 1D shows the phasic elevations in photometric signals. To correlate these signals with T c variations, we defined the “up phase” or “down phase” as periods during which the T c continuously increased or decreased for ≥5 min, with a change of at least 0.3°C. When analyzing the area under the curve (AUC) of the photometric signals showing peak amplitudes exceeding +3 standard deviations (hereafter referred to as 3SD signals for simplicity), no differences were found among the up, down, and other phases ( Fig. S2C and S2D ). Conversely, when the pre-up phase was defined as the 4-min window preceding the onset of the up phase, both the AUC of the 3SD signals and the mean Z-scored signal intensity were significantly larger during the pre-up phase than during the up and other phases ( Fig. 1E ). Furthermore, a significant positive correlation was found between the mean or maximum Z-score signal intensity during the pre-up phase and the increase in T c ( Fig. 1F ). These findings suggest that RPa- vGluT3 neuron activity is phasically upregulated before a spontaneous rise in T c and that this activity may influence the magnitude of the T c increase. Next, we investigated whether cold exposure induces Ca 2+ responses in RPa- vGluT3 neurons. To address this, the floor temperature was lowered to below 15°C by placing an ice pack beneath the home cage, while a room-temperature pack served as the control ( Fig. 1G ). Cooling the floor significantly increased the AUC of the 3SD signals ( Fig. 1H ), supporting the notion that cold sensory signals activate RPa- vGluT3 neurons to drive thermogenesis. Silencing RPa- vGluT3 neurons decreases T c and delays recovery from QIH To assess whether the basal activity of RPa- vGluT3 neurons is required to maintain T c , we utilized a chemogenetic inhibition strategy. AAV8- hSyn-fDIO-hM4Di-mCherry was bilaterally injected into the RPa, followed by the implantation of a telemetry probe ( Fig. 1I ). Post hoc histological analysis confirmed the localized expression of hM4Di within the RPa ( Fig. 1J ). Intraperitoneal injections of either saline or clozapine-N-oxide (CNO) were administered to the mice on consecutive days. Administration of CNO significantly reduced both T c and BAT surface temperature (T BAT ) ( Fig. 1K , 1 L, Fig. S3A , and S3B ). Notably, the extent of CNO-induced hypothermia was significantly correlated with the number of hM4Di-mCherry+ cells in the RPa, supporting the role of these neurons in maintaining T c ( Fig. 1M and Fig. S3C ). We further examined whether RPa- vGluT3 neurons are required for cold tolerance. First, we assessed the effects of their inhibition during acute cold exposure. Intraperitoneal injections of either saline or CNO were administered to the mice, and 30 min later, their home cages were placed on an ice pack. CNO administration to inhibit RPa- vGluT3 neurons slightly but significantly reduced T c ( Fig. S3D ), further supporting the idea that RPa- vGluT3 neurons are needed to drive cold-defense thermogenesis. T BAT remained unchanged under this condition ( Fig. S3E ), implying that cold-induced thermogenesis in BAT can be activated through sympathetic-independent mechanisms 43 . Recent studies have demonstrated that the activation of specific neuronal populations within the POA induces hypothermic states, likely through a reduction in the T c set point 10 , 12 , 13 , 15 – 17 . For instance, activation of Q neurons in the anteroventral periventricular nucleus (AVPe), a POA subregion, has been shown to induce QIH 16 . To investigate the activity dynamics of RPa- vGluT3 neurons during QIH, we generated vGluT3-Flpo ; Qrfp-iCre 16 double-heterozygous mice. AAV5 -EF1a-DIO-hChR2-eYFP was injected into the AVPe, whereas AAV9- CAG-fDIO-GCaMP6s was delivered to the RPa, followed by the implantation of optical fibers above these regions ( Fig. 2A ). Post hoc histological analysis confirmed the expression of ChR2-YFP and GCaMP6s, as well as proper fiber placement ( Fig. 2B ). One week after telemetry implantation, we monitored Ca 2+ responses in RPa- vGluT3 neurons using fiber photometry while inducing hypothermia via laser stimulation of Q neurons for 3 h ( Fig. 2C ). Before QIH induction, the photometric signals exhibited high variability. During QIH, RPa- vGluT3 neuronal activity was markedly suppressed. Notably, upon termination of hChR2 stimulation, the photometric signals resumed. The AUC of the 3SD signals was significantly reduced during QIH, with no differences observed before and after QIH ( Fig. 2D ). A detailed temporal analysis revealed that the decline in T c preceded a reduction in RPa- vGluT3 neuronal activity ( Fig. 2E and 2F ), whereas the reactivation of RPa- vGluT3 neurons occurred prior to T c recovery ( Fig. 2G and 2H ). These data indicate that RPa- vGluT3 neuron activity is dynamically regulated throughout the QIH process. Download figure Open in new tab Figure 2: Silencing RPa- vGluT3 neurons delays recovery from QIH (A) Schematic of the experimental procedure (left) and timeline (right) for fiber photometry of RPa- vGluT3 neurons combined with optogenetically induced QIH. (B) Representative coronal sections showing ChR2-eYFP (green) expression in the AVPe (left) and GCaMP (green) expression in the RPa (right), with DAPI nuclear counterstaining (blue). Scale bar, 100 µm. (C) Representative photometry (top) and T c (bottom) traces during QIH. Blue bar indicates the period of laser stimulation. Arrow indicates T c rise point. (D) AUC of 3SD signals. *, p < 0.05 by pairwise t-tests with Bonferroni correction. N = 6 mice. (E, G) 3SD signal durations (top) and change in T c (bottom) relative to QIH induction (E) or the T c rise point following cessation of laser stimulation (G). Bold lines indicate group means; gray shading represents SD. (F, H) AUC of 3SD signals within designated 4- or 10-min time windows. *, p < 0.05 by Wilcoxon signed-rank sum test. N = 6 mice. (I) Schematic of virus injection (left) and experimental timeline for chemogenetic inhibition of RPa- vGluT3 neurons during QIH (right). (J) Representative coronal sections showing ChR2-eYFP (green) expression in the AVPe (left) and hM4Di-mCherry (magenta) expression in the RPa (right), with DAPI staining (blue). Scale bar, 100 µm. (K) T c (top) and T BAT (bottom) traces following laser stimulation (blue bar). CNO (red) or saline (gray) was administered 2.5 h before laser cessation. Lines represent group means; shading denotes SD. N = 8 each. (L–N) Rewarming speed (L), latency to reach 35°C (M), and minimum temperature (N) for T c (top) or T BAT (bottom) after saline or CNO injection. * p < 0.05, Wilcoxon signed-rank sum test. N = 8 each. Error bars indicate SD. For more data, see Fig. S3 . To further investigate the role of RPa- vGluT3 neurons in rewarming after QIH, we chemogenetically inhibited these neurons using hM4Di in combination with optogenetically induced QIH ( Fig. 2I and 2J ). If RPa- vGluT3 neurons facilitate thermogenesis during rewarming, then their inactivation delays recovery. Following AAV injection and fiber/telemetry implantation, intraperitoneal injections of either saline or CNO were administered to the mice 30 min after the onset of laser stimulation. Laser illumination was terminated 2.5 h later, and the subsequent recovery of T c was assessed. CNO administration significantly slowed the rewarming rate of both T c and T BAT ( Fig. 2K and 2L ), and prolonged the latency for T c and T BAT to reach 35°C ( Fig. 2M ). Conversely, the minimum T c attained during QIH remained unchanged in the saline- and CNO-injected groups ( Fig. 2N ). Notably, the CNO-induced delay in T c recovery was positively correlated with the number of hM4Di+ neurons in the RPa ( Figs. S3F and S3G ); CNO administration did not affect rewarming in mice with limited hM4Di expression ( Fig. S3H – S3K ). These data demonstrate that RPa- vGluT3 neurons facilitate thermogenesis during recovery from QIH. Input and output architecture of RPa- vGluT3 neurons Previous studies have suggested that RPa- vGluT3 neurons receive excitatory inputs from glutamatergic neurons in the DMH 26 and project to sympathetic preganglionic neurons within the thoracic spinal cord 31 , 44 . However, the precise organization of their afferent and efferent connectivity remains unclear. To systematically map the input connections of RPa- vGluT3 neurons, we utilized rabies virus (RV)- mediated retrograde trans-synaptic tracing 36 ( Fig. 3A ). Starter neurons, defined by the overlap of TVA-mCherry and RV-derived nuclear GFP (nGFP), were primarily located in the RPa ( Fig. 3B ). Retrogradely labeled input neurons were distributed across various regions, including the DMH and ventrolateral periaqueductal gray (vlPAG) ( Fig. 3C – 3F ). A negative control experiment, in which AAV -fDIO-RG was omitted, showed nGFP+ mCherry− cells as nonspecific RV labeling 36 , with the vast majority located near the injection site, particularly within the gigantocellular reticular nucleus (Gi) ( Fig. S4 ). To ensure the accuracy of our analysis, regions with substantial nonspecific labeling were excluded. We further characterized the cell types of the nGFP-labeled input neurons in the DMH and vlPAG by immunostaining for RV-nGFP combined with ISH using excitatory ( vGluT2 ) or inhibitory ( vGat ) neuronal markers. We found that 83.6 ± 10.5% of the input neurons in the DMH were vGluT2+ , while 92.1 ± 0.6% of input neurons in the vlPAG were vGat+ ( Fig. 3G – 3I ). While glutamatergic neurons in the DMH in promoting thermogenesis is well established 26 , 28 , 29 , inhibitory neurons in the vlPAG and the adjacent dorsal raphe nucleus have been reported to suppress thermogenesis 45 . These data indicate that RPa- vGluT3 neurons receive prominent excitatory inputs from the DMH while integrating diverse brainstem inputs, particularly inhibitory inputs from the vlPAG. Download figure Open in new tab Figure 3: Input map to RPa- vGluT3 neurons (A) Experimental procedure for RV-mediated trans-synaptic tracing. (B) Representative coronal section of the RPa showing GFP expression from RV (green) and TVA-mCherry labeling from AAV (magenta) with DAPI nuclear counterstaining (blue). Right panels show a magnified view of the white-boxed region. Scale bars, 1 mm (left) and 100 µm (right). (C) Convergence index (number of input cells normalized to the number of starter cells) across eight broader anatomical categories. N = 4 mice. (D–F) Convergence indices for various brain regions in the hypothalamus (D), midbrain (E), and pons and medulla (F). N = 4 mice. (G) Representative coronal sections showing labeled input neurons in the DMH (left) and vlPAG (right). Scale bars, 500 µm. (H) Representative coronal sections of the DMH (left) and vlPAG (right) showing vGluT2 (magenta) and vGat (cyan) mRNA expression along with anti-GFP immunostaining (yellow). Bottom panels show magnified views of the corresponding white-boxed regions. Scale bar, 100 µm. (I) Fraction of vGluT2+ , vGat+ , and dual-negative neurons among GFP-labeled input neurons in the DMH (left) and vlPAG (right). N = 4 mice. Error bars indicate SD. For more details, see Fig. S4 . For brain region abbreviations, see Table S1. To delineate the efferent projections of RPa- vGluT3 neurons, we injected AAV- EF1a - fDIO- mCherry into the RPa of vGluT3-Flpo mice and mapped the distribution of mCherry-positive axons in both the brain and spinal cord ( Fig. 4A and 4B ). Dense mCherry+ axonal projections were observed in the intermediolateral nucleus (IML) of the upper thoracic spinal cord ( Fig. 4C and 4E ), consistent with previous studies 31 , 44 . mCherry+ axons were detected in various brainstem regions ( Fig. 4C and 4D ). Notably, projections were observed in the ventral brainstem nuclei, such as the supratrigeminal nucleus (Su5), intermediate reticular formation (IRT), and ventral (MdV) and dorsal (MdD) medullary reticular nuclei, which are regions associated with somatic premotor control and the regulation of intrinsic behaviors 46 – 49 . In the dorsal brainstem, we observed the axonal projections of RPa- vGluT3 neurons in the LPB, a region implicated in the transmission of cold sensory information to the hypothalamus and limbic structures 22 , 23 . These findings demonstrate previously uncharacterized efferent pathways of RPa- vGluT3 neurons, suggesting a broader functional role beyond their proposed function as sympathetic premotor neurons mediating non-shivering thermogenesis 31 . Download figure Open in new tab Figure 4: Axonal projections of RPa- vGluT3 neurons (A) Schematic of AAV injection. (B) Representative coronal section of the RPa showing mCherry expression. Right panel shows a magnified view of the white-boxed area. Scale bar, 500 µm. (C) Representative coronal sections of the brainstem (top) and spinal cord areas (bottom). Right images show magnified views of the white-boxed regions. Green, anti-ChAT immunostaining; magenta, anti-mCherry immunostaining; blue, DAPI nuclear staining. Scale bars, 1 mm (top) and 100 µm (bottom). Th, thoracic segment. (D, E) Quantification of mCherry+ axons in the brain (D) and spinal cord (E). Axonal projections were quantified and normalized to the maximum value per mouse. N = 3 mice. Error bars indicate SD. For brain region abbreviations, see Table S1. RPa- vGluT3 neurons regulate multiple thermo-effector pathways To examine whether RPa- vGluT3 neurons regulate multiple thermogenic responses, we targeted hChR2 in these neurons using a multimodal physiological monitoring approach. T c was measured via telemetry, T BAT was assessed using infrared thermography, and thermogenic shivering was evaluated using electromyography (EMG) recordings of nuchal muscle activity ( Fig. 5A and 5B ). Mice were connected to a laser system and subjected to optogenetic stimulation for 10 min. This procedure significantly increased both T c and T BAT in hChR2+ mice compared to mCherry+ controls ( Fig. 5C and 5D ), confirming that RPa- vGluT3 neurons promote thermogenesis via BAT 34 . We also confirmed that the chemogenetic activation of RPa- vGluT3 neurons led to an increase in T c ( Fig. S5 ). In addition to thermogenesis, the hChR2+ mice exhibited cervicothoracic piloerection during photostimulation ( Fig. 5E and Movie S1), suggesting the recruitment of additional sympathetic effectors. Consistent with this view, optogenetic activation of RPa- vGluT3 neurons significantly induced c-Fos expression, a proxy for neural activation, in postganglionic neurons projecting to both the BAT and cervical skin ( Fig. S6A – S6C ). Thus, RPa- vGluT3 neurons engage in multiple sympathetic outputs to drive non-shivering thermogenesis via BAT and heat retention via piloerection. Download figure Open in new tab Figure 5: Optogenetic activation of RPa- vGluT3 neurons induces multiple thermogenic responses (A) Schematic of the experimental procedures (left) and timeline (right). (B) Representative coronal sections of the RPa showing ChR2-eYFP (green) expression with DAPI nuclear counterstaining (blue). Right panel shows the magnified view of the white-boxed region. Scale bars, 500 µm (left) and 100 µm (right). (C, D) Change in T c (C) and T BAT (D) following laser stimulation (blue shading). Green traces denote data from hChR2+ mice; magenta traces represent mCherry+ control mice. Lines represent group means; shading denotes SD. Two-way ANOVA: AAV effect, p < 0.01; time effect, p < 0.01; interaction effect, p < 0.01. Right panels show ΔT c (C) and ΔT BAT (D) at 10 min post-stimulation. **, p < 0.01 by Wilcoxon rank sum test. N = 6 for the mCherry group; N = 7 for hChR2 group. (E) Representative images of cervicothoracic piloerection before and during laser stimulation in mCherry+ control (left) and hChR2+ (right) mice. Right panel shows quantification of hair angle changes. *, p < 0.05 by two-sided unpaired t -test. N = 6 for the mCherry group and N = 7 for hChR2 group. (F) Quantification of cervical muscle twitching. Two-way ANOVA: AAV effect, p < 0.01; time effect, p < 0.01; interaction effect, p < 0.01. Right panel shows total number of twitch episodes during the laser stimulation. *, p < 0.05 by Wilcoxon rank sum test. N = 6 for the mCherry group and N = 7 for the hChR2 group. (G) Representative EMG traces from the mCherry (upper) and hChR2 (lower) groups during laser stimulation (blue shading) under isoflurane anesthesia. (H) Quantification of EMG integrals per 10 s bin during laser stimulation. Magenta (mCherry) and green (hChR2) lines represent group means; shading denotes SD. Two-way ANOVA: AAV effect, p < 0.01; time effect, p < 0.01; interaction effect, p < 0.01. Right panel shows EMG integrals during laser stimulation. *, p < 0.05 by two-sided unpaired t -test. N = 6 for the mCherry group and N = 5 for the hChR2 group. For further data, see Figs. S5 and S6 . In addition to sympathetic output, RPa- vGluT3 neuron stimulation triggered shivering-like twitches in the cervical muscles ( Fig. 5F and Movie S1). EMG recordings revealed a significant increase in integrated neck muscle activity following optogenetic stimulation of RPa- vGluT3 neurons ( Fig. 5G , 5H ), implicating activation of the somatic thermo-effector pathway independent of the sympathetic nervous system. In addition, optical stimulation increased locomotor activity in hChR2+ mice ( Fig. S6D ). We hypothesized that RPa- vGluT3 neurons mediate thermogenic shivering via descending projections to brainstem premotor areas ( Fig. 4D ), particularly the caudal IRT (cIRT), a known regulator of neck muscle movement 47 , 50 . To test this hypothesis, we injected AAV9- EF1a-fDIO- hChR2-eYFP into the RPa and AAV8- CaMKIIa-hM4D(Gi)-mCherry into the cIRT, followed by optical fiber implantation above the RPa ( Fig. 6A , 6B ). Optogenetic stimulation consistently elevated T c and T BAT and triggered piloerection, regardless of CNO administration ( Fig. 6C – 6E ). In contrast, CNO-mediated inhibition of cIRT neurons tended to reduce cervical muscle twitches ( Fig. 6F ) and significantly suppressed EMG activity ( Fig. 6G , 6H). Thus, the shivering-like activity of nuchal muscles triggered by RPa- vGluT3 neurons is at least partly mediated by cIRT neurons. Download figure Open in new tab Figure 6: Optogenetic activation of RPa- vGluT3 neurons induces shivering via brainstem premotor neurons (A) Schematic of the experimental procedures (left) and timeline (right). (B) Representative coronal sections. Upper panel shows the RPa with ChR2-eYFP (green) expression and DAPI nuclear counterstaining (blue). The bottom panel shows hM4Di-mCherry (magenta) expression in the cIRT with DAPI (blue). Scale bars, 500 µm. (C, D) Change in T c (C) and T BAT (D) following laser stimulation (blue shading). CNO (red) or saline (gray) was administered 45–60 min before laser stimulation. Lines represent group means; shading denotes SD. N = 6 each. Repeated-measures two-way ANOVA: Drug effect, n.s.; time effect, p < 0.01; interaction effect, n.s. Right panels show ΔT c (C) and ΔT BAT (D) during the 10-min before (−10 to 0 min) and during (0 to 10 min) laser stimulation. (E) Representative images of cervicothoracic piloerection before and during laser stimulation in saline- (left) and CNO- (right) treated mouse. Right panel shows quantification of hair angle changes. (F) Quantification of cervical muscle twitching. Left panel shows the total number of twitch episodes during laser stimulation. Repeated-measures two-way ANOVA: Drug effect, p < 0.05; time effect, p < 0.01; interaction effect, n.s. Right panel shows total number of twitch episodes per minute before and during the laser stimulation. (G) Representative EMG traces from saline- (upper) and CNO- (lower) treated mice during laser stimulation (blue shading) under anesthesia. (H) Quantification of EMG integrals per 10 s bin during laser stimulation. Black (saline) and magenta (CNO) lines represent group means; shading denotes SD. Repeated-measures two-way ANOVA: Drug effect, p < 0.05.; time effect, p < 0.01; interaction effect, p < 0.01. Right panel shows EMG integrals for 40 s before and during laser stimulation. In all panels, different letters (a, b) indicate significant differences at p < 0.05, as determined by one-way repeated-measures ANOVA followed by Tukey–Kramer post hoc test. N = 6 per group. Collectively, these data support the idea that RPa- vGluT3 neurons recruit multiple thermo-effector pathways, including sympathetic outputs to BAT and skin, and descending projections to somatic premotor regions, such as the cIRT, to drive coordinated thermogenic responses. Discussion In the present study, we generated vGluT3-Flpo mice, facilitating targeted viral-genetic approaches to monitor the activity dynamics and map the input-output architecture of RPa- vGluT3 neurons ( Fig. S7 ). Below, we discuss the biological insights derived from this study and its limitations. Activity dynamics of RPa- vGluT3 neurons While classical c-Fos mapping has implicated RPa- vGluT3 neurons in cold exposure and PGE 2 -induced thermoregulatory responses 31 , the technique’s limitation of temporal resolution has precluded precise characterization of their activity dynamics. Our fiber photometry data demonstrated that RPa- vGluT3 neurons exhibited sharp phasic activity immediately preceding a spontaneous T c increase ( Fig. 1D ), during cold exposure ( Fig. 1G ), and before recovery from QIH ( Fig. 2C ). Notably, there was a consistent delay of several minutes between peak neural activity and the onset of T c elevation. This temporal gap likely reflects the time required to recruit thermogenic and heat-retention systems (e.g., BAT activation, shivering, and piloerection) and the intrinsic thermal inertia of the body. By the time T c begins to rise (the up phase in Fig. 1 ), RPa- vGluT3 neuron activity has already declined, suggesting the presence of a rapid shutoff mechanism that may prevent overshooting of T c . Taken together, our data highlight the phasic nature of RPa- vGluT3 neuron activity. Given that chemogenetic silencing of these neurons reduced both the baseline T c and cold-evoked thermogenesis ( Fig. 1I – 1M and Fig. S3A – S3E ), their phasic activity seems to be critical for maintaining thermal homeostasis. During QIH, the metabolic demand, as indicated by oxygen consumption, is markedly reduced, leading to a subsequent drop in T 16 . This presumed decrease in the central T c set point is thought to suppress medullary thermogenic systems, preventing BAT activity and shivering even when T c falls to 25°C. However, this hypothesis has not yet been tested experimentally. Our data provide direct evidence of a pronounced suppression of RPa- vGluT3 neuron activity, aligned with the optogenetic activation of Q neurons in the AVPe ( Fig. 2C ). Furthermore, the chemogenetic silencing of RPa- vGluT3 neurons resulted in a significant delay in T c recovery following QIH, reinforcing their role in thermogenic reactivation. The neural circuit mechanisms by which Q neurons exert this rapid and potent inhibitory effect on RPa- vGluT3 neurons remain unclear and require further investigation. Neural circuit organizations of RPa- vGluT3 neurons The prevailing model of the medullary thermogenic system assumes that it acts as a relay, transmitting thermal commands from the preoptic and hypothalamic regions to downstream sympathetic circuits that drive BAT activation 1 , 2 . Our data support this framework by providing anatomical evidence that RPa- vGluT3 neurons receive direct excitatory synaptic inputs from DMH neurons ( Fig. 3H ), a key hypothalamic output, and project to the IML of the thoracic spinal cord for sympathetic activation of BAT thermogenesis ( Fig. 4E and Fig. S6 ). However, our data also demonstrate that RPa- vGluT3 neurons play a broader role in thermoregulation, coordinating input from diverse brainstem regions and engaging multiple thermo-effectors to elevate T c ( Fig. S7 ). First, RPa- vGluT3 neurons can induce piloerection ( Fig. 5E ), a critical sympathetic heat-retention response 51 , 52 , in addition to their previously suggested regulatory roles in BAT thermogenesis, cutaneous vasoconstriction, and lipolysis in white adipose tissue 31 , 33 , 53 – 55 . Therefore, RPa- vGluT3 neurons appear to orchestrate multiple systemic thermogenic responses. Second, extending a previous study implicating the role of RPa neurons in shivering 32 , our study identified a pathway from RPa- vGluT3 neurons to cIRT, a brainstem structure containing somatic premotor neurons 47 , 56 , 57 that contributes to shivering generation ( Figs. 5 and 6 ). Shivering involves rapid alternations between muscle fiber contraction and relaxation, a process that likely requires a premotor pattern-generating network 58 , 59 ; however, the precise circuit mechanisms remain to be elucidated. As RPa- vGluT3 neurons also project to other premotor nuclei, such as the rostral IRT and Su5 ( Fig.4 ), these brain regions are implicated in the regulation of the masseter 60 , 61 and facial muscles 62 . These premotor nuclei also send descending projections to spinal motoneurons 56 , suggesting that RPa- vGluT3 neurons may contribute to shivering in multiple skeletal muscle groups by engaging distinct brainstem premotor circuits. How do RPa- vGluT3 neurons regulate diverse thermogenic and heat-retaining mechanisms? Regarding the sympathetic pathways, both piloerection and BAT activation are regulated by postganglionic neurons in the upper thoracic sympathetic trunk 51 , 63 , 64 . One possibility is that RPa- vGluT3 neurons regulate a shared sympathetic outflow that simultaneously drives piloerection and the activation of BAT. Alternatively, distinct subpopulations of RPa- vGluT3 neurons may regulate these two pathways independently. Identifying the precise neuronal subtypes responsible for piloerection and BAT activation is essential to resolving this question. Similarly, it is important to ask whether there is a specific subpopulation of RPa- vGluT3 neurons responsible for shivering or whether common RPa- vGluT3 neurons send bifurcated axonal collaterals projecting to both the premotor areas and the spinal cord. Future studies utilizing projection target-initiated axonal mapping 65 may provide deeper insights into the circuit logic underlying the diverse functions of RPa- vGluT3 neurons. Limitations While our vGluT3-Flpo mice specifically labeled vGluT3 + neurons in the RPa, their targeting efficiency was relatively low (approximately 40%; Fig. 1C ). This limited efficiency might account for the relatively small effect sizes observed in our experiments. For example, microinjection of bicuculline into the RPa increased T BAT by approximately 3°C in rats 31 , whereas optogenetic or chemogenetic activation of RPa- vGluT3 neurons in our study led to a 1–2°C increase ( Fig. 5D , Fig. S5 ), although this increase was consistent with a previous study utilizing vGluT3-Cre mice 34 . Similarly, chemogenetic inactivation of RPa- vGluT3 neurons only decreased T c by approximately 1°C ( Fig. 1L ) and delayed recovery from QIH by approximately 15 min ( Fig. 2M ), eventually returning to a normal range. This moderate phenotype may be attributed to the limited targeting efficiency of vGluT3-Flpo mice, likely due to limited Flpo activity from the bicistronic expression system ( Fig. S1 ). Future studies with a more comprehensive targeting of RPa- vGluT3 neurons could clarify their relative contributions to thermoregulation. However, we cannot rule out the involvement of additional thermogenic pathways, such as those originating from the paraventricular hypothalamus, in directly targeting sympathetic neurons 66 , 67 . In addition, our Flpo mice did not specifically target serotonergic vGluT3 + Tph2+ neurons in the RPa, reflecting the low expression levels of vGluT3 in this population. While most serotonergic neurons are distinct from the vGluT3 + population in the RPa 68 – 70 , some have been implicated in BAT-mediated thermogenesis 63 , 71 . Thus, their potential contributions to thermogenesis and interaction with vGluT3 + Tph2− population warrant further investigation. Furthermore, our circuit mapping excluded local connectivity because of technical limitations ( Fig. S4 ), highlighting the need for future studies to elucidate functional interactions among diverse neuronal subtypes within the RPa. The imaging and manipulation tools established in this study are expected to facilitate molecular- and circuit-level investigations of medullary systems involved in thermoregulation and other homeostatic processes under various conditions, including aging and pathological states. Methods Key resources table View this table: View inline View popup Animals All animal experiments were approved by the Institutional Animal Care and Use Committee of the RIKEN Kobe Branch. Qrfp-iCre mice have been described previously 16 . vGluT3-Flpo mice were originally generated in this study (detailed below). Animals were housed at the animal facility of the RIKEN Center for Biosystems Dynamics Research (BDR) and were fed ad libitum under a 12-h light–dark cycle at an ambient temperature of 20–22°C and humidity levels of 43–57%. Generation of vGluT3-Flpo knock-in mice A vGluT3-Flpo knock-in mouse line (accession no. CDB0224E, listed at https://large.riken.jp/distribution/mutant-list.html ) was generated using CRISPR/Cas9-mediated knock-in techniques in zygotes, as previously described 37 . A donor vector containing T2A-Flpo was inserted immediately before the stop codon of Vglut3 exon 10. The SV40 nuclear localization signal ( NLS ) was added to the 5′ end of the Flpo open reading frame by polymerase chain reaction (PCR) primers 5′- GGCGCGCCACCATGGCTCCTAAGAAGAAGAGGAAGGTGATGAGCCAGTTCGACATCCTG ; 5′-GTCGACTCAGATCCGCCTGTTGATGTAG. The plasmid pTCAV-FLEx(loxP)FlpO (#67829; Addgene) was used as the PCR template. To construct a microhomology-mediated end-joining (MMEJ)-based donor vector, Flpo was cloned into a plasmid harboring a synthetic T2A ( Thoseaasigna virus 2A) sequence 74 , homology arms, and guide RNA (gRNA) sites (PITCh crRNA3). The gRNA sites were designed using CRISPRdirect 75 to target regions upstream and downstream of the stop codon ( Fig. S1A ). For microinjection, a mixture of two CRISPR RNAs (crRNAs) (50 ng/µL), trans-activating crRNA (tracrRNA) (200 ng/µL), donor vector (10 ng/µL), and Cas9 protein (100 ng/µL) was injected into the pronucleus of a C57BL/6 one-cell stage zygote. Vglut3 crRNA (5′- TCAGAAACATCCTAAATGTCguuuuagagcuaugcuguuuug), PITCh crRNA3 (5′- GCAUCGUACGCGUACGUGUUguuuuagagcuaugcuguuuug), and tracrRNA (5′-AAACAGCAU AGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGG UGCU) were purchased from FASMAC (Atsugi, Japan). Therefore, 46 F0 founder mice were obtained. Of these, 13 (seven males and six females) were identified as Flpo -positive by PCR ( Fig. S1B ). Further analysis of the 5′ and 3′ junctions and full-length sequencing were conducted on three males and one female ( Fig. S1C ). The following primers were used for PCR and sequencing analyses. For the detection of Flpo internal sequence: Flpo-F: 5′-CTGGCCACATTCATCAACTGCGG; Flpo-R: 5′ CTTCTTCAGGGCCTTGTTGTAGCTG. For the 5′ junction: Vglut3-F: 5′- ACAGGACTGGGCTGACCCAGAGAATC; Flpo5′-R: 5′- GTCTTGCACAGGATGTCGAACTGGCTC. For the 3′ junction: FLPo3′-F: 5′- AGCATCAGATACCCCGCCTGGAACG; Vglut3-R: 5′- TGAGAGAAGGCTCAACGGCCAATGC. For the sequence analysis, the PCR products were obtained using the primers vGlut3-F and vGlut3-3′ junc-R: 5′- GTAAGCTGAGGTGAAGCCAGACATgtcgac or vGlut3-5′ junc-F: 5′- AAGGAGACTTCTCAGAAACATCCggctctg and vGlut3-R. The PCR products were subcloned into the pCR Blunt II TOPO vector (Zero Blunt TOPO PCR Cloning Kit, Thermo Fisher Scientific) and sequenced using the M13-Forward and M13-Reverse primers ( Fig. S1D ). Germline transmission of the vGlut3-Flpo allele was confirmed by genotyping the F1 mice ( Fig. S1E ). The line was established using a male that harbored the target sequence, as verified by PCR and sequencing. Genotyping PCR was performed using Flpo-F and Flpo-R internal primers, as described above. Viral preparations AAV vectors were purchased from Addgene, with titers represented as genome particles (gp) per mL: AAV serotype 8 Ef1a-fDIO-mCherry-WPREpA (1.8 × 10 13 gp/mL, #114471-AAV8) AAV serotype 8 hSyn-fDIO-hM4D(Gi)-mCherry (5.0 × 10 12 gp/mL, #154867-AAV8). AAV serotype 8 CaMKIIa-hM4D(Gi)-mCherry (2.4 × 10 13 gp/mL, # 50477-AAV8). AAV vectors were generated by the University of North Carolina Vector Core, using plasmids purchased from Addgene. AAV serotype 5 CAG-fDIO-TVA-mCherry (2.4 × 10 13 gp/mL, # 67827) AAV serotype 8 CAG-fDIO-RG (1.0 × 10 12 gp/mL, #67828). AAV vectors were purchased from the Canadian Neurophotonics Platform Viral Vector Core Facility (RRID: SCR_016477). AAV serotype 9 CAG-fDIO-GcaMP6s (6.9 × 10 12 gp/mL, construct-1347-aav2-9); AAV serotype 8 hSyn-fDIO-hM3D(Gq)-mCherry (4.7 × 10 12 gp/mL, construct-1457-aav2-8). RV ΔG-nGFP preparation was carried out using cell lines as previously described 73 . The histone-GFP fragment was amplified from the pAAV-TRE-HTG plasmid (Addgene # 27437) using the following primers: H2B-arm-F: 5′- atccctcaaaggacctgcaggGCCACCATGCCAGAGCCAG; EGFP-arm-R: 5′- gactgaaaagctaccgcggTTACTTGTACAGCTCGTCCATGCCGA. The PCR product was subcloned into the pSAD-dG-F3 vector (a gift from Ed Callaway) 73 , which was treated with SbfI and SacII restriction enzymes using the In-Fusion HD Cloning Kit (639648, Takara) to yield the pSAD-dG-F3-nGFP plasmid. RV Δ G-nGFP was generated de novo using the B7GG cell line (a gift from Ed Callaway) along with pCAG-B19N , pCAG-B19P , pCAG-B19L , pCAG-B19G (gifts from Ed Callaway), and pSAD-dG-F3-nGFP . Viral particles were pseudotyped using BHK-EnvA cells (a gift from Ed Callaway). The titer of RV Δ G-nGFP+EnvA used in this study was estimated to be 3.7×10 9 infectious particles per mL, based on serial dilutions of the virus stock followed by infection of the HEK293-TVA800 cell line (a gift from Ed Callaway). Virus injection Mice were deeply anesthetized by intraperitoneal injection of 65 mg/kg ketamine (4987081519033, Daiichi Sankyo) and 13 mg/kg xylazine (X1251, Sigma-Aldrich) and then positioned in a stereotactic frame (cat#68045, RWD). The skull was positioned such that the dorsal surface was level with the heights of the Bregma and Lambda aligned. For cIRT injections, the skull was angled such that Lambda was positioned 0.6 mm lower than Bregma. A glass micropipette filled with AAV was then placed into the target region using the following coordinates: AVPe, 0.8 mm anterior, 0.25 mm lateral, and 5.5 mm ventral from the Bregma; RPa, 6.2 mm posterior, 0.0 mm lateral from the Bregma, and 5.3 mm ventral from the brain surface; cIRT, 6.4 mm posterior and 1.2 mm lateral from the Bregma, and 5.3 mm ventral from the brain surface. A 240 nl solution of AAV was injected at a speed of 80 nl/min using a micropump (World Precision Instruments, UMP3T-1). After the viral injection, the animals were returned to their home cages. In Fig. 4 , a cocktail of AAV5- CAG-fDIO-TVA-mCherry and AAV8- CAG-fDIO-RG (240 nl, mixed at a 1:4 ratio) was injected into the RPa of vGluT3-Flpo mice. Three weeks after the injection, 240 nl of SAD ΔG-nGFP +EnvA was injected into the same region. The mice were kept in their home cages for 7 days before perfusion. For the control experiment ( Fig. S4 ), AAV8 -CAG-fDIO-RG was omitted to assess the extent of glycoprotein-independent nonspecific labeling of the RV. Injection of cholera toxin subunit B To retrogradely label iBAT-projecting and piloerector muscle-projecting sympathetic postganglionic neurons ( Fig. S6A and S6B ), cholera toxin subunit B (CTB) was injected into the target organs of vGluT3-Flpo mice following optogenetic activation experiments ( Fig. 5 ). CTB Alexa Fluor™ 488 Conjugate (CTB488; C22841, Thermo Fisher Scientific) or CTB Alexa Fluor™ 647 Conjugate (CTB647; C34778, Thermo Fisher Scientific) was prepared as a 0.1% solution in phosphate buffered saline (PBS). Throughout the procedure, the animals were maintained under anesthesia using intraperitoneal injections of ketamine and xylazine, as described in the virus injection section. For iBAT tracing, the iBAT was exposed via an intrascapular incision, and 4 μl of CTB647 (1 μl per injection, two injections per side) was delivered using a pulled glass pipette. For piloerector muscle tracing, 6 μl of CTB488 (1 μl per injection, six injections in total) was injected intradermally. The injection sites were distributed along the dorsal midline of the cervical skin, spanning spinal levels C4 to Th2, with approximately 2 mm spacing between adjacent sites. After surgery, the mice were single-housed and sacrificed six days later. Fiber implantation At least two days after virus injection, the mice were anesthetized and placed in a stereotactic apparatus, as mentioned above. An optical fiber (R-FOC-BL400C-50NA, RWD) for imaging experiments or an optic cannula (R-FOC-BL200C-50NA, RWD) for optogenetic manipulation was placed above the RPa (midline, 6.2 mm posterior and 6.3 mm ventral from the Bregma) or AVPe (midline, 0.8 mm anterior and 5.2 mm ventral from the Bregma) and affixed to the skull with dental cement. Cold challenge To examine the photometric signals of RPa- vGluT3 neurons when mice were exposed to a cold environment, the cooled plates (0°C; 188 mm × 98 mm × 24 mm, DAISO) were placed beneath the cage for 25 min. This reduced the temperature of the cage floor to 15°C within 15 min. The last 10 min of exposure were analyzed. For control experiments, identical plates were maintained at room temperature. Body temperature and locomotor activity monitoring To monitor T c and locomotor activity, telemetry devices (G2 E-Mitter, Starr Life Sciences Corp.) were surgically implanted in mice following a two-week recovery period after AAV injection or fiber implantation. For surgical implantation, mice were anesthetized by intraperitoneal injection of 65 mg/kg ketamine and 13 mg/kg xylazine. A medial incision was made in the abdominal cavity, and a telemetry temperature transmitter was placed inside. After filling the abdominal cavity with saline (Ootsuka), the peritoneum and abdominal skin were sutured with coated Vicryl sutures (D5893; Johnson & Johnson). Gentamicin (5 mg/kg; Takata Pharmaceutical) was administered intraperitoneally immediately after surgery. Mice were kept in their home cages for at least 5 days before recording. The day before recording, the mice and their home cages were placed on a recording receiver (ER-4000, Starr Life Science). For imaging or optogenetic experiments, the mice were transferred to acrylic cages (27 cm × 19 cm × 25 cm; Sanplatic, Japan) and positioned on the recording receiver. Body temperature and locomotor activity were recorded every minute using recording software (Vital View, Starr Life Science). To monitor T BAT , the mice were monitored using a thermography camera (InfReC R500EX, Nippon Avionics) placed 20 cm above the cage floor. The back hair of each mouse was shaved to facilitate T BAT detection. Thermograms were recorded every minute and the maximum temperature in each frame was used as the T BAT of the mouse. Mice with T BAT values below 34°C were excluded from analysis. In Fig. S3 , T BAT data from one mouse were unavailable because of a recording failure caused by battery depletion, whereas the T c data were successfully recorded. Consequently, the number of animals included in the analyses differed between the T c and T BAT . Section preparation Mice were deeply anesthetized with isoflurane and perfused with 10 mL PBS, followed by 50 mL 4% PFA. The brains were extracted, and the thoracic spines were removed from the mediastinal organs and adipose tissues. The specimens were post-fixed overnight at 4°C in 4% PFA and then immersed in a 30% sucrose solution in PBS at 4°C until they sank. The spinal cord was dissected from the vertebrae using micro-scissors. The stellate ganglion attached to the vertebrae was decalcified by immersion in 0.5 M ethylenediaminetetraacetic acid (EDTA) (pH 8.0) overnight at 4°C, followed by cryoprotection in 30% sucrose. The level of the thoracic spinal cord was determined based on the vertebrae position, as previously reported 76 . The specimens were embedded in optimal cutting temperature compound (#4583, Tissue-Tek) and sectioned serially at 60 µm for immunohistochemistry or 30 µm for in situ hybridization using a cryostat (Leica, Germany). Immunohistochemistry Serial brain and spinal cord sections were collected in 24-well plates, and every third section was processed to immunohistochemistry. Sections were washed three times with PBS, then immersed in 1% Triton in PBS at room temperature for 3 h. The sections were blocked with 10% Blocking One (cat#03953-95, Nacalai Tesque) in PBS containing 0.3% Triton X-100 (blocking solution) at room temperature for 1 h. They were then incubated with the primary antibody in a blocking solution at 4°C overnight. Following this, sections were rinsed three times with PBS and incubated with the secondary antibody at 4°C overnight. Finally, the sections were rinsed with PBS, mounted, and cover slipped using Fluoromount (cat#K024; Diagnostic BioSystems). The primary antibodies used in this study were: Goat anti-mCherry (1:1000; cat#AB0040-200, SICGEN, RRID: AB_2333092); Rabbit anti-red fluorescent protein (1:1000; cat#600-401-379, Rockland, RRID: AB_2209751); Goat anti-choline acetyltransferase (1:500; cat#AB144P, Millipore, RRID: AB_2079751); Rabbit anti-tryptophan hydroxylase 2 (1:500; cat#ab111828, Abcam, RRID: AB_10862137); Chicken anti-GFP (1:2000, cat#GFP-1010, Aves Labs, RRID: AB_2307313); and Rabbit anti-cFos (1:2000; cat#2250, Cell Signaling, RRID:AB_2247211). The secondary antibodies were: Alexa Fluor 488 donkey anti-chicken (1:500; cat# 703-545-155, Jackson ImmunoResearch Labs, RRID: AB_2340375); Alexa Fluor 488 donkey anti-rabbit (1:500; cat# A32790, Thermo Fisher Scientific, RRID: AB_2762833); Alexa Fluor 488 donkey anti-goat (1:500; cat# A32814, Thermo Fisher Scientific, RRID: AB_2762838); Alexa Fluor 555 donkey anti-goat (1:500; cat# A32816, Thermo Fisher Scientific, RRID: AB_2762839); Alexa Fluor 555 donkey anti-rabbit (1:500; cat# A32794, Thermo Fisher Scientific, RRID: AB_2762834); Alexa Fluor 647 donkey anti-rabbit (1:500; cat# A-31573, Thermo Fisher Scientific, RRID: AB_2536183); and Alexa Fluor 647 donkey anti-goat (1:500; cat# A32849, Thermo Fisher Scientific, RRID: AB_2762840). Representative images were obtained using a confocal microscope (Zeiss Axioscan7 or Leica SP8). In situ hybridization To generate cRNA probes, DNA templates were amplified from spinal cord cDNA using PCR (cat#MD-23; Genostaff). A T3 RNA polymerase recognition site (5′- AATTAACCCTCACTAAAGGG) was added to the 3′ end of the reverse primers. The primer sets and sequences of the probe targets were as follows. Vglut3 -1: 5′-CACAACCGCTGTCAGAAAGA; 5′-GTGATGGCAACCACCATGTA Vglut3 -2: 5′-AAGCAGGTTCAGGGGAGACT; 5′-GCCAATGCATGAAATGACAC Vglut2 -1: 5′-TAGCTTCCTCTGTCCGTGGT; 5′-GGGCCAAAATCCTTTGTTTT Vglut2 -2: 5′-CCACCAAATCTTACGGTGCT; 5′-GGAGCATACCCCTCCCTTTA Vglut2 -3: 5′-CTCCCCCATTCACTACCTGA; 5′- GGTCAGGAGTGGTTTGCATT Vgat -1: 5′-GCTTCCGAAACCTTTGGTG; 5′-GTACAGGCACGCGATGAG Vgat -2: 5′-GAAGACGGGGAGGTGGTG; 5′-ATGGCCACATCGAAGAAGAC In vitro transcription reactions were performed according to the manufacturer’s instructions (Roche Applied Sciences). First, 600–1000 ng of DNA for these genes was incubated with Dig (Digoxigenin) (cat#11277073910)- or fluorescein (cat#11685619910)-RNA labeling mix, T3 RNA polymerase (cat#11031163001), and Rnase inhibitor (cat#3335399001) at 37°C for 6 h. After incubation with Dnase I (Promega, cat#M6101) for another 20 min at 37°C, followed by EDTA treatment (cat#AM9260G, Life Technologies), cRNA probes were purified using ProbeQuant G-50 Micro Columns (cat#28-9034-08, Cytiva). Fluorescent in situ hybridization (ISH) combined with anti-GFP and anti-TPH2 immunohistochemical staining was performed as previously reported 77 . For detecting Vglut3 mRNA ( Fig. 1B – 1D ), after hybridization and washing, brain sections were incubated with horseradish peroxidase (HRP)-conjugated anti-Dig (1:500; cat#1120773390, Roche Applied Science) antibody overnight at 4 °C. The following day, the signals were amplified with TSA-plus Cyanine 3 (1:70 in 1x plus amplification diluent; cat#NEL744001KT; Akoya Biosciences) for 25 min. After washing with PBS containing 0.1% Tween-20 (PBST) for 5 min, the sections were incubated with anti-GFP (1:2000; cat#GFP-1010, Aves Labs) and anti-TPH2 (1:500; cat#ab111828, Abcam, RRID: AB_10862137) at 4°C overnight. GFP-positive and TPH2-positive cells were visualized using anti-chicken Alexa Fluor 488 (cat#703-545-155, Jackson ImmunoResearch, 1:250) and Alexa Fluor 647 donkey anti-rabbit antibodies (1:500; cat# A-31573, Thermo Fisher Scientific, RRID: AB_2536183). For dual-color ISH combined with anti-GFP staining ( Fig. 3I ), an HRP-conjugated anti-flu antibody (1:250; cat#NEF710001EA, Akoya Biosciences) was used to detect Flu-labeled RNA probes using TSA-plus Cyanine 3 (1:70 in 1× plus amplification diluent; cat#NEL744001KT, Akoya Biosciences) for 25 min. After a 5-min PBST wash, HRP was inactivated with a 2% sodium azide solution in PBS for 15 min at room temperature, followed by five 5-min washes with PBST. The sections were then incubated with HRP-conjugated anti-Dig (1:500) and anti-GFP (cat#GFP-1010, Aves Labs, 1:1000) antibodies at 4°C overnight. Signals were amplified using TSA-plus Cyanine 5 (cat#NEL744001KT, Akoya Biosciences; 1:70 in 1× plus amplification diluent) for 25 min, followed by washing. GFP-positive cells were visualized using anti-chicken Alexa Fluor 488 antibody (1:250, cat#703-545-155, Jackson ImmunoResearch). Nuclei were counterstained with PBS containing 50 ng/mL 4’, 6-diamidino-2-phenylindole dihydrochloride (DAPI; cat #D8417, Sigma-Aldrich). Images were acquired using an Olympus BX53 microscope equipped with a 10x (N.A. 0.4) objective lens. The cells were then counted manually. Optogenetic stimulation and chemogenetic manipulations The fiberoptic cannulas implanted in the mice were connected to a fiberoptic patch cable (200 µm diameter, NA: 0.22, 1.0 m length, Doric Lenses) using ceramic sleeves (Thorlabs). The mice were allowed to habituate for at least 1 h before stimulation. Diode-pumped solid-state lasers (465 nm blue, IOS-465, RWD) were used for optogenetic manipulation. The laser output at the optical fiber tip was measured using a laser checker (PM100D, Thorlabs) and was adjusted to 6–8 mW. Laser stimulation was applied at 2 Hz with a 10-ms pulse width for 3 h in the QIH experiment ( Fig. 2 ) and at 40 Hz with a 10-ms pulse width for 10 min to stimulate the RPa- vGluT3 neurons ( Figs. 5 and 6 ). In Fig. 1I – 1M , mice received either saline or CNO (2 mg/kg, #4936, Tocris Bioscience) and their T c was monitored at room temperature or 4°C as indicated in the figure panel. As shown in Fig. 2 , the mice received either saline or CNO 30 min after the induction of QIH by laser stimulation on day 1, with treatment conditions counterbalanced on day 2. One mouse showing the spontaneous T c recovery and two mice that failed to reach a minimum T c below 27°C were excluded from the analysis. Rewarming speed was calculated from the time of the laser termination to the point at which T c reached 35°C. As shown in Fig. 6 , the mice were injected with either saline or CNO (2 mg/kg) 45–60 min after optogenetic stimulation on day 1, with the treatment conditions counterbalanced on day 2. The CNO was dissolved in saline at a concentration of 0.5 mg/mL. Fiber photometry recording Fiber photometry recordings were performed by delivering excitation lights (465 nm modulated at 309.944 Hz and 405 nm modulated at 208.616 Hz) and collecting the emitted fluorescence using an integrated fluorescence mini-cube (Doric, iFMC4_AE(405)_E(460–490)_F(500–550)_S). Light collection and demodulation were performed using a Doric Photometry Setup and Doric Neuroscience Studio Software (Doric Lenses). The 405 nm signal was recorded as an isosbestic signal (non–calcium-dependent), and the 465-nm signal was recorded as a calcium-dependent GCaMP6s signal. The power output at the fiber tip was approximately 5–10 µW. The signals were initially acquired at 12 kHz and then decimated to 120 Hz for recording. All optical components were purchased from Doric Lenses (Quebec, Canada). Analysis of Ca 2+ imaging data Data processing was performed using custom-made R-code following the methodologies outlined in previous study 78 , 79 . Both the 405-nm and 465-nm signals were subjected to low-pass filtering at 5 Hz and high-pass filtering at 0.001 Hz. In the QIH Ca 2+ recording experiment ( Fig. 2 ), both signals were high-pass filtered at 0.005 Hz owing to temperature-induced baseline fluctuations in the fluorescent signals 80 . To remove motion noise, a control signal was calculated by fitting the Ca 2+ -independent 405-nm signal to the Ca 2+ -dependent 465-nm signal using least squares linear regression. This fitted control signal was subtracted from the 465-nm signals, and the resulting residual was normalized to the Z-score. An “upregulated signal” was defined as a peak that surpassed 3 SD and was sustained above 0 SD for at least 3 s. “Up” or “Down” phases were defined as periods during which temperature continuously rose or fell ≥5 min, with a minimum temperature change of 0.3°C. The pre-up phase was defined as the 4 min preceding the up phase; if it overlapped with the up phase, it was considered part of the up phase. The AUC for upregulated signals during each phase was measured. Mice exhibiting upregulated signals lasting <3 min/h were excluded from the analysis. Time zero in the T c analysis following the termination of QIH ( Fig. 2G ) was defined as the moment when the regression line of increasing T c intersected the baseline T c during QIH. Counting input neurons to RPa- vGluT3 neurons Images of every third 60 µm whole-brain sections were obtained by slide scanner (Zess Axioscan7, Zeiss) after immunostaining. The number of starter (GFP and mCherry double-positive) and input neurons (GFP-positive) were counted manually and assigned to brain areas based on the classification of the Allen Mouse Brain Atlas. The convergence index was calculated by dividing the number of input neurons in each brain area by the total number of starter neurons. Axon density analysis Every third 60 µm coronal section of the whole brain, as well as spinal cord sections spanning from the thoracic segment 1 (Th1) to the lumbar segment 1 (L1), was imaged using a slide scanner (Zeiss Axioscan 7) after immunostaining. To quantify the density of mCherry-positive axons originating from RPa- vGluT3 neurons ( Fig. 4 ), regions of interest (ROIs) were manually delineated for the relevant brain and spinal cord regions. The mCherry channel in each image was binarized using the Renyi entropy thresholding plug-in function in the ImageJ (Fiji). For each mouse, the mCherry-positive area within each ROI was normalized to the region with the maximum signal to calculate relative axon density. Although mCherry-positive axons were detected in white matter tracts such as the ventral spinocerebellar tract in the brainstem and the lateral funiculus in the spinal cord, these areas were excluded from the analysis because they likely represent passing fibers rather than terminal projections. EMG recording A handmade EMG electrode was implanted at the same time as fiber implantation. Three silver wires including a ground electrode were placed under the nuchal muscles and fixed with dental cement. On the recording day, the mouse with the implanted EMG electrode was connected to a recorder (ELG-2, Bioresearch Center) and habituated for at least 1 h before laser stimulation. To improve the signal-to-noise ratio, EMG was performed under anesthesia. The mice were initially anesthetized with 3% isoflurane for 5 min in an anesthesia box (Natsume, Cat#KN-1010-S) and transferred to an anesthesia apparatus (Natsume, Cat#KN-1019-1) containing 0.6% isoflurane. Throughout the recording, mice were placed on a digital hot plate (Corning, PC-420D) to maintain body temperature at 35°C. The optical fiber was connected to a patch cable, and laser stimulation was applied 1 min after 0.6% isoflurane anesthesia. Data were recorded at a sampling rate of 100 Hz and converted to text format using the EDF- converter software (Bioresearch Center). The recordings were high-pass filtered at 10 Hz and rectified to absolute values using R software. The integral of the EMG amplitude was calculated in 10-s bins, and the EMG values were normalized to the minimum amplitude observed during the 1-min baseline period prior to laser stimulation. Mice exhibiting excessive baseline noise in EMG recordings, defined as average EMG amplitudes exceeding 100 µV even under isoflurane anesthesia, were excluded from the analysis because of poor signal quality. Measurement of cervical twitching behavior and piloerection For the optogenetic activation of RPa -vGluT3 neurons ( Fig. 5 ), video recordings of the mice were taken for 12 min, including 10 min of laser stimulation and 1 min before and after stimulation. The number of cervical twitching behaviors was manually counted every minute. Cervical twitching was defined as bending of the cervical lordosis (Movie S1), excluding movements related to grooming or eating pellets. Piloerection was assessed by measuring changes in the angles of the cervicothoracic hair before and after stimulation ( Fig. 6E ). Specifically, hair snapshots were taken and angle changes were analyzed using the “Find Edges” function in ImageJ (Fiji). For the pre-laser stimulation condition, angle changes were calculated over a baseline window from −45 s to −15 s relative to the onset of laser stimulation. For the laser stimulation condition, changes were measured between −15 s and +15 s. From each mouse, five individual hairs were selected for measurement and subsequent analysis. Statistical analysis The statistical analyses for each experiment, including the specific statistical tests used and the exact number of animals, are detailed in each figure legend. P-values are reported in figure legends or panels; non-significant values are not noted. Normality and homogeneity of variance were assessed using the Shapiro–Wilk normality test and F-test, respectively. For the details of the statistics, please see the Statistical Table. Data and materials availability All fiber photometry data will be deposited in the SSBD repository and will be publicly accessible upon publication. All other data are available in the main manuscript and supplementary material. All materials, including vGluT3-Flpo mice, are available from the corresponding authors upon request. Author contributions S.U. and K.M. conceived the experiments. S.U. performed the experiments and analyzed the data with technical support from M.H. Qrfp-iCre mice were provided by T.S. vGluT3-Flpo mice were generated by T.A. and K.I. with technical support from M.H. S.U. and K.M. wrote the paper with contributions from all co-authors. Competing interests The authors declare that they have no competing interests. Supplementary Figures Download figure Open in new tab Figure S1: Generation of vGluT3-Flpo mice, related to Fig. 1 (A) Schematic of the knock-in (KI) strategy. A T2A-Flpo cassette was inserted into the coding end located in exon 10 of the vGluT3 ( Slc17a8 ) locus. Primer locations are indicated by arrows. (B) Screening of vGluT3-Flpo founder mice. The initial screening was performed using an internal Flpo sequence. The size (base pair, bp) of the PCR product is indicated to the right of the gel images. (C) Flpo -positive mice were further screened by amplifying the 5′ and 3′ boundaries. PCR primers used were as follows: vGluT3-F : Flpo-5′R for the 5′ boundary and Flpo-3′F : vGluT3-R for the 3′ boundary. (D) Confirmation of the 5′ and 3′ boundary sequences. (E) Representative electrophoresis gel image to examine the KI allele (left) and the WT allele (right). PCR primers vGluT3-F : Flpo-3′F : vGluT3-R were used. Download figure Open in new tab Figure S2: Quantification of photometric signals from RPa- vGluT3 neurons, related to Fig. 1 (A) Schematic of virus injection. (B) Representative coronal section of the RPa showing GCaMP6s expression (green) and fiber location, with DAPI nuclear staining (blue). Scale bars, 100 µm. (C) Representative 7-h photometry trace (top) and T c trace (bottom). Magenta- and blue-shaded regions represent up and Down phases, respectively. This panel presents the same dataset as shown in Fig. 1D . (D) AUC of 3SD signals (left) and mean Z-score (right). No significant differences were observed among the states, as determined by the Wilcoxon signed-rank test with Bonferroni correction. These data indicate that RPa- vGluT3 neurons are not active during the Up phase. Error bars indicates SD. Download figure Open in new tab Figure S3: Additional data on chemogenetic inhibition of RPa- vGluT3 neurons during basal state and QIH, related to Figs. 1 and Fig. 2 (A) Group mean traces of T BAT in hM4Di+ mice following administration of saline (gray) or CNO (red) at time 0. Repeated-measures two-way ANOVA shows significant solution ( p < 0.01), time course ( p < 0.01), and interaction ( p < 0.01) effects. (B) T BAT at 120 min following saline or CNO injection (left) and AUC for T c from 0 to 240 min (right). Unexcluded data showed no significant difference between saline and CNO injections; however, a statistically significant difference emerged when the two mice with fewer than 40 hM4Di-expressing cells were excluded. † p < 0.05, Wilcoxon signed-rank test. N = 10. (C) Correlation between the number of hM4Di-mCherry+ cells and the change in T BAT at 120 min following saline or CNO injection. Adjusted coefficient of determination (R 2 ) is shown, with the p -value calculated using a t -test under the null hypothesis of no correlation. (D, E) Group mean traces of T c (D) and T BAT (E) following cold exposure (blue bar). CNO (red) or saline (gray) was administered 30 min before cold exposure. Lines represent group means; shading denotes SD. N = 12. Right panels show T c (D) and T BAT (E) at 25 min following saline or CNO injection. *, p < 0.05 by Wilcoxon signed-rank sum test. N = 12. (F) Representative T c curve during recovery from QIH. The delay was defined as the difference in the latency to reach 35°C between saline- and CNO-injected conditions. (G) Correlation between the number of hM4Di-mCherry+ cells and the rewarming delay. The adjusted coefficient of determination (R 2 ) is shown, with the p-value calculated using a t -test under the null hypothesis of no correlation. (H–K) Same analyses as in Fig. 2K–N , but using animals with ≤ 40 hM4Di-mCherry+ neurons in the RPa. In these mice, CNO administration had no significant effect on the recovery from QIH. N = 6 for T c data, and N = 5 for BAT data. (H) T c (top) and T BAT (bottom) traces after laser stimulation (blue bar). CNO (red) or saline (gray) was administered 2.5 h before laser cessation. Lines represent group means; shading denotes SD. Repeated-measures two-way ANOVA: Drug effect, n.s.; time effect, p < 0.01; interaction effect, n.s. (I–K) Rewarming speed (I), latency to reach 35°C (J), and minimum temperature (K) of T c (top) and T BAT (bottom) after saline or CNO injection. ns: non-significant using a two-sided paired t-test. Error bars indicates SD. Download figure Open in new tab Figure S4: Control experiments for RV-mediated trans-synaptic tracing, related to Fig. 3 (A) Experimental procedure for RV-mediated trans-synaptic tracing and the control experiments. AAV8- CAG-fDIO-RG was omitted in the control experiment to assess the degree of RG-independent nonspecific infection 36 of RV ΔG-nGFP +EnvA within and near the injection site. (B) The distribution of nGFP+ neurons found in both the control and RV-tracing experiments. *, p < 0.05 by two-sided exact rank sum test. N = 4 mice. For brain region abbreviations, see Table S1. Notably, we did not observe RV-nGFP labeling in the RG-omitted control group away from the injection site, such as in the hypothalamus, midbrain, or pons. In the medulla, we excluded areas with substantial nonspecific labeling from the analysis in Fig. 3 , while utilizing the PCRT, GiA, LPGi, and RMg because trans-synaptically labeled neurons predominated in these areas. Download figure Open in new tab Figure S5: Chemogenetic activation of RPa- vGluT3 neurons induces hyperthermia, related to Fig. 5. (A) Schematic of the virus injection and experimental timeline. AAV8 -hSyn-fDIO-hM3Dq-mCherry or AAV8 -EF1a-fDIO-mCherry was injected into the RPa of vGluT3-Flpo mice. (B) Representative image of hM3Dq expression in the RPa. The right panel shows an enlarged image. Scale bars, 1 mm (left) and 100 µm (right). (C, F) Group mean T c traces in hM3Dq+ mice (C) or mCherry+ mice (F) following administration of saline (gray) or CNO (blue) at time 0. In panel C, repeated-measures two-way ANOVA showed significant solution ( p < 0.01), time course ( p < 0.01), and interaction ( p < 0.01) effects. In panel F, only the significant time course effect ( p < 0.01) is found. (D, G) T c at 120 min (left) and AUC for T c from 0 to 240 min (right) in hM3Dq+ mice (D) or mCherry+ (G) mice following saline or CNO injection. *, p < 0.05 by two-sided paired t -test. N = 8 for hM3Dq+ mice and N = 7 for mCherry+ mice. (E, H) Correlation between the number of hM3Dq-mCherry+ cells (E) or mCherry+ cells (H) and the change in T c at 120 min following saline or CNO injection. The adjusted coefficient of determination (R 2 ) is shown, with the p -value calculated using a t -test under the null hypothesis of no correlation. Error bars indicates SD. Download figure Open in new tab Figure S6: Additional information on activation of RPa- vGluT3 neurons, related to Fig. 5. (A) Schematics for virus injections and the experimental timeline for c-Fos assay combined with retrograde labeling of the BAT-projecting and piloerector muscle-projecting sympathetic postganglionic neurons. This experiment is conducted following the data collection for Fig. 5 . (B) Representative coronal section of the postganglionic neurons in the stellate ganglia. Magenta showing c-Fos immunostaining, while yellow and cyan denoting CTB-488 and CTB-647 labeling, respectively. Scale bars, 100 µm. (C) Fraction of c-Fos+ neurons among CTB-labeled neurons. *, p < 0.05 by two-sided unpaired student t- test. N = 3 for each group. (D) Count of locomotor activities following the laser stimulation. Right panel shows the total count of locomotor activities during the laser stimulation. *, p < 0.05 by Wilcoxon rank sum test. N = 6 for the mCherry group and N = 7 for the hChR2 group. Error bars, SD. Download figure Open in new tab Figure S7: Proposed circuit model for thermogenesis regulated by RPa- vGluT3 neurons. RPa- vGluT3 neurons drive non-shivering thermogenesis in brown adipose tissue (BAT) and facilitate heat retention by engaging the piloerector muscle (PEM) via activation of the sympathetic nervous system. Concurrently, they recruit premotor neurons in the brainstem to initiate shivering thermogenesis through skeletal muscles. Although the RPa- vGluT3 to LPB pathway, implicated in thermoregulatory behaviors, may contribute to feed-forward modulation of hypothalamic thermal centers, this specific circuit was not directly investigated in the present study. Acknowledgments We thank the staff at the RIKEN BDR animal facility for animal care and in vitro fertilization; Shigefumi Yokota and members of the Miyamichi Laboratory for critically reading the manuscript; Addgene, the University of North Carolina Vector Core, and the Canadian Neurophotonics Platform Viral Vector Core Facility for AAV production; and Satsuki Irie for technical assistance. This study was supported by the RIKEN Special Postdoctoral Researchers Program and JSPS KAKENHI (22K15237, 25K18589) to S. U., and the JST CREST Program (JPMJCR2021) and JSPS Transformative Research Areas (A) (23H04945, 23H04939) to K. M. Funder Information Declared Japan Society for the Promotion of Science, https://ror.org/00hhkn466 , 22K15237 , 25K18589 , 23H04945 , 23H04939 Japan Science and Technology Agency , JPMJCR2021 Footnotes ↵ 5 Read Contact References 1. ↵ Tan , C.L. , and Knight , Z.A . ( 2018 ). Regulation of Body Temperature by the Nervous System . Neuron 98 , 31 – 48 . doi: 10.1016/j.neuron.2018.02.022 . OpenUrl CrossRef PubMed 2. ↵ Morrison , S.F. , and Nakamura , K . ( 2019 ). Central Mechanisms for Thermoregulation . Annu Rev Physiol 81 , 285 – 308 . doi: 10.1146/annurev-physiol-020518-114546 . OpenUrl CrossRef PubMed 3. ↵ Boulant , J.A . ( 2000 ). Role of the preoptic-anterior hypothalamus in thermoregulation and fever . Clin Infect Dis 31 Suppl 5 , S157 – 161 . doi: 10.1086/317521 . OpenUrl CrossRef PubMed Web of Science 4. ↵ Luo , L. , Callaway , E.M. , and Svoboda , K . ( 2018 ). Genetic Dissection of Neural Circuits: A Decade of Progress . Neuron 98 , 865 . doi: 10.1016/j.neuron.2018.05.004 . OpenUrl CrossRef PubMed 5. ↵ Machado , N.L.S. , and Saper , C.B . ( 2022 ). Genetic identification of preoptic neurons that regulate body temperature in mice . Temperature (Austin ) 9 , 14 – 22 . doi: 10.1080/23328940.2021.1993734 . OpenUrl CrossRef 6. ↵ Lazarus , M. , Yoshida , K. , Coppari , R. , Bass , C.E. , Mochizuki , T. , Lowell , B.B. , and Saper , C.B . ( 2007 ). EP3 prostaglandin receptors in the median preoptic nucleus are critical for fever responses . Nat Neurosci 10 , 1131 – 1133 . doi: 10.1038/nn1949 . OpenUrl CrossRef PubMed Web of Science 7. Nakamura , Y. , Yahiro , T. , Fukushima , A. , Kataoka , N. , Hioki , H. , and Nakamura , K . ( 2022 ). Prostaglandin EP3 receptor-expressing preoptic neurons bidirectionally control body temperature via tonic GABAergic signaling . Sci Adv 8 , eadd5463 . doi: 10.1126/sciadv.add5463 . OpenUrl CrossRef PubMed 8. Ushikubi , F. , Segi , E. , Sugimoto , Y. , Murata , T. , Matsuoka , T. , Kobayashi , T. , Hizaki , H. , Tuboi , K. , Katsuyama , M. , Ichikawa , A. , et al. ( 1998 ). Impaired febrile response in mice lacking the prostaglandin E receptor subtype EP3 . Nature 395 , 281 – 284 . doi: 10.1038/26233 . OpenUrl CrossRef PubMed Web of Science 9. ↵ Machado , N.L.S. , Bandaru , S.S. , Abbott , S.B.G. , and Saper , C.B . ( 2020 ). EP3R-Expressing Glutamatergic Preoptic Neurons Mediate Inflammatory Fever . J Neurosci 40 , 2573 – 2588 . doi: 10.1523/JNEUROSCI.2887-19.2020 . OpenUrl Abstract / FREE Full Text 10. ↵ Machado , N.L.S. , Lynch , N. , Costa , L.H.A. , Melville , D. , Kucukdereli , H. , Kaur , S. , Banks , A.S. , Raffin , F. , Ramirez-Plascencia , O.D. , Aten , S. , et al. ( 2025 ). Preoptic EP3R neurons constitute a two-way switch for fever and torpor . Nature . doi: 10.1038/s41586-025-09056-1 . OpenUrl CrossRef 11. ↵ Osterhout , J.A. , Kapoor , V. , Eichhorn , S.W. , Vaughn , E. , Moore , J.D. , Liu , D. , Lee , D. , DeNardo , L.A. , Luo , L. , Zhuang , X. , and Dulac , C . ( 2022 ). A preoptic neuronal population controls fever and appetite during sickness . Nature 606 , 937 – 944 . doi: 10.1038/s41586-022-04793-z . OpenUrl CrossRef PubMed 12. ↵ Song , K. , Wang , H. , Kamm , G.B. , Pohle , J. , Reis , F.C. , Heppenstall , P. , Wende , H. , and Siemens , J . ( 2016 ). The TRPM2 channel is a hypothalamic heat sensor that limits fever and can drive hypothermia . Science 353 , 1393 – 1398 . doi: 10.1126/science.aaf7537 . OpenUrl Abstract / FREE Full Text 13. ↵ Tan , C.L. , Cooke , E.K. , Leib , D.E. , Lin , Y.C. , Daly , G.E. , Zimmerman , C.A. , and Knight , Z.A . ( 2016 ). Warm-Sensitive Neurons that Control Body Temperature . Cell 167 , 47 – 59 e15. doi: 10.1016/j.cell.2016.08.028 . OpenUrl CrossRef PubMed 14. ↵ Yu , S. , Qualls-Creekmore , E. , Rezai-Zadeh , K. , Jiang , Y. , Berthoud , H.R. , Morrison , C.D. , Derbenev , A.V. , Zsombok , A. , and Munzberg , H . ( 2016 ). Glutamatergic Preoptic Area Neurons That Express Leptin Receptors Drive Temperature-Dependent Body Weight Homeostasis . J Neurosci 36 , 5034 – 5046 . doi: 10.1523/JNEUROSCI.0213-16.2016 . OpenUrl Abstract / FREE Full Text 15. ↵ Zhang , K.X. , D’Souza , S. , Upton , B.A. , Kernodle , S. , Vemaraju , S. , Nayak , G. , Gaitonde , K.D. , Holt , A.L. , Linne , C.D. , Smith , A.N. , et al. ( 2020 ). Violet-light suppression of thermogenesis by opsin 5 hypothalamic neurons . Nature 585 , 420 – 425 . doi: 10.1038/s41586-020-2683-0 . OpenUrl CrossRef PubMed 16. ↵ Takahashi , T.M. , Sunagawa , G.A. , Soya , S. , Abe , M. , Sakurai , K. , Ishikawa , K. , Yanagisawa , M. , Hama , H. , Hasegawa , E. , Miyawaki , A. , et al. ( 2020 ). A discrete neuronal circuit induces a hibernation-like state in rodents . Nature 583 , 109 – 114 . doi: 10.1038/s41586-020-2163-6 . OpenUrl CrossRef PubMed 17. ↵ Hrvatin , S. , Sun , S. , Wilcox , O.F. , Yao , H. , Lavin-Peter , A.J. , Cicconet , M. , Assad , E.G. , Palmer , M.E. , Aronson , S. , Banks , A.S. , et al. ( 2020 ). Neurons that regulate mouse torpor . Nature 583 , 115 – 121 . doi: 10.1038/s41586-020-2387-5 . OpenUrl CrossRef PubMed 18. ↵ Pinol , R.A. , Mogul , A.S. , Hadley , C.K. , Saha , A. , Li , C. , Skop , V. , Province , H.S. , Xiao , C. , Gavrilova , O. , Krashes , M.J. , and Reitman , M.L . ( 2021 ). Preoptic BRS3 neurons increase body temperature and heart rate via multiple pathways . Cell Metab 33 , 1389 – 1403 e1386. doi: 10.1016/j.cmet.2021.05.001 . OpenUrl CrossRef PubMed 19. ↵ Takahashi , T.M. , Hirano , A. , Kanda , T. , Saito , V.M. , Ashitomi , H. , Tanaka , K.Z. , Yokoshiki , Y. , Masuda , K. , Yanagisawa , M. , Vogt , K.E. , et al. ( 2022 ). Optogenetic induction of hibernation-like state with modified human Opsin4 in mice . Cell Rep Methods 2 , 100336 . doi: 10.1016/j.crmeth.2022.100336 . OpenUrl CrossRef 20. ↵ Geerling , J.C. , Kim , M. , Mahoney , C.E. , Abbott , S.B. , Agostinelli , L.J. , Garfield , A.S. , Krashes , M.J. , Lowell , B.B. , and Scammell , T.E. ( 2016 ). Genetic identity of thermosensory relay neurons in the lateral parabrachial nucleus . Am J Physiol Regul Integr Comp Physiol 310 , R41 – 54 . doi: 10.1152/ajpregu.00094.2015 . OpenUrl CrossRef PubMed 21. Nakamura , K. , and Morrison , S.F . ( 2008 ). A thermosensory pathway that controls body temperature . Nat Neurosci 11 , 62 – 71 . doi: 10.1038/nn2027 . OpenUrl CrossRef PubMed Web of Science 22. ↵ Yang , W.Z. , Xie , H. , Du , X. , Zhou , Q. , Xiao , Y. , Zhao , Z. , Jia , X. , Xu , J. , Zhang , W. , Cai , S. , et al. ( 2023 ). A parabrachial-hypothalamic parallel circuit governs cold defense in mice . Nat Commun 14 , 4924 . doi: 10.1038/s41467-023-40504-6 . OpenUrl CrossRef PubMed 23. ↵ Yahiro , T. , Kataoka , N. , and Nakamura , K . ( 2023 ). Two Ascending Thermosensory Pathways from the Lateral Parabrachial Nucleus That Mediate Behavioral and Autonomous Thermoregulation . J Neurosci 43 , 5221 – 5240 . doi: 10.1523/JNEUROSCI.0643-23.2023 . OpenUrl Abstract / FREE Full Text 24. ↵ Lee , H. , Hor , C.C. , Horwitz , L.R. , Xiong , A. , Su , X.Y. , Soden , D.R. , Yang , S. , Cai , W. , Zhang , W. , Li , C. , et al. ( 2025 ). A dedicated skin-to-brain circuit for cool sensation in mice . Nat Commun 16 , 6731 . doi: 10.1038/s41467-025-61562-y . OpenUrl CrossRef 25. ↵ Zhao , Z.D. , Yang , W.Z. , Gao , C. , Fu , X. , Zhang , W. , Zhou , Q. , Chen , W. , Ni , X. , Lin , J.K. , Yang , J. , et al. ( 2017 ). A hypothalamic circuit that controls body temperature . Proc Natl Acad Sci U S A 114 , 2042 – 2047 . doi: 10.1073/pnas.1616255114 . OpenUrl Abstract / FREE Full Text 26. ↵ Machado , N.L.S. , Abbott , S.B.G. , Resch , J.M. , Zhu , L. , Arrigoni , E. , Lowell , B.B. , Fuller , P.M. , Fontes , M.A.P. , and Saper , C.B . ( 2018 ). A Glutamatergic Hypothalamomedullary Circuit Mediates Thermogenesis, but Not Heat Conservation, during Stress-Induced Hyperthermia . Curr Biol 28 , 2291 – 2301 e2295. doi: 10.1016/j.cub.2018.05.064 . OpenUrl CrossRef PubMed 27. ↵ Rezai-Zadeh , K. , Yu , S. , Jiang , Y. , Laque , A. , Schwartzenburg , C. , Morrison , C.D. , Derbenev , A.V. , Zsombok , A. , and Munzberg , H . ( 2014 ). Leptin receptor neurons in the dorsomedial hypothalamus are key regulators of energy expenditure and body weight, but not food intake . Mol Metab 3 , 681 – 693 . doi: 10.1016/j.molmet.2014.07.008 . OpenUrl CrossRef PubMed 28. ↵ Kataoka , N. , Hioki , H. , Kaneko , T. , and Nakamura , K . ( 2014 ). Psychological stress activates a dorsomedial hypothalamus-medullary raphe circuit driving brown adipose tissue thermogenesis and hyperthermia . Cell Metab 20 , 346 – 358 . doi: 10.1016/j.cmet.2014.05.018 . OpenUrl CrossRef PubMed 29. ↵ Pinol , R.A. , Zahler , S.H. , Li , C. , Saha , A. , Tan , B.K. , Skop , V. , Gavrilova , O. , Xiao , C. , Krashes , M.J. , and Reitman , M.L . ( 2018 ). Brs3 neurons in the mouse dorsomedial hypothalamus regulate body temperature, energy expenditure, and heart rate, but not food intake . Nat Neurosci 21 , 1530 – 1540 . doi: 10.1038/s41593-018-0249-3 . OpenUrl CrossRef PubMed 30. ↵ Nakamura , K. , Matsumura , K. , Kaneko , T. , Kobayashi , S. , Katoh , H. , and Negishi , M . ( 2002 ). The rostral raphe pallidus nucleus mediates pyrogenic transmission from the preoptic area . J Neurosci 22 , 4600 – 4610 . doi: 10.1523/JNEUROSCI.22-11-04600.2002 . OpenUrl Abstract / FREE Full Text 31. ↵ Nakamura , K. , Matsumura , K. , Hubschle , T. , Nakamura , Y. , Hioki , H. , Fujiyama , F. , Boldogkoi , Z. , Konig , M. , Thiel , H.J. , Gerstberger , R. , et al. ( 2004 ). Identification of sympathetic premotor neurons in medullary raphe regions mediating fever and other thermoregulatory functions . J Neurosci 24 , 5370 – 5380 . doi: 10.1523/JNEUROSCI.1219-04.2004 . OpenUrl Abstract / FREE Full Text 32. ↵ Nakamura , K. , and Morrison , S.F . ( 2011 ). Central efferent pathways for cold-defensive and febrile shivering . J Physiol 589 , 3641 – 3658 . doi: 10.1113/jphysiol.2011.210047 . OpenUrl CrossRef PubMed 33. ↵ Li , E. , Wang , L. , Wang , D. , Chi , J. , Lin , Z. , Smith , G.I. , Klein , S. , Cohen , P. , and Rosen , E.D . ( 2024 ). Control of lipolysis by a population of oxytocinergic sympathetic neurons . Nature 625 , 175 – 180 . doi: 10.1038/s41586-023-06830-x . OpenUrl CrossRef 34. ↵ Zeng , X. , Ye , M. , Resch , J.M. , Jedrychowski , M.P. , Hu , B. , Lowell , B.B. , Ginty , D.D. , and Spiegelman , B.M . ( 2019 ). Innervation of thermogenic adipose tissue via a calsyntenin 3beta-S100b axis . Nature 569 , 229 – 235 . doi: 10.1038/s41586-019-1156-9 . OpenUrl CrossRef PubMed 35. ↵ Gunaydin , L.A. , Grosenick , L. , Finkelstein , J.C. , Kauvar , I.V. , Fenno , L.E. , Adhikari , A. , Lammel , S. , Mirzabekov , J.J. , Airan , R.D. , Zalocusky , K.A. , et al. ( 2014 ). Natural neural projection dynamics underlying social behavior . Cell 157 , 1535 – 1551 . doi: 10.1016/j.cell.2014.05.017 . OpenUrl CrossRef PubMed Web of Science 36. ↵ Miyamichi , K. , Shlomai-Fuchs , Y. , Shu , M. , Weissbourd , B.C. , Luo , L. , and Mizrahi , A . ( 2013 ). Dissecting local circuits: parvalbumin interneurons underlie broad feedback control of olfactory bulb output . Neuron 80 , 1232 – 1245 . doi: 10.1016/j.neuron.2013.08.027 . OpenUrl CrossRef PubMed Web of Science 37. ↵ Abe , T. , Inoue , K.I. , Furuta , Y. , and Kiyonari , H . ( 2020 ). Pronuclear Microinjection during S-Phase Increases the Efficiency of CRISPR-Cas9-Assisted Knockin of Large DNA Donors in Mouse Zygotes . Cell Rep 31 , 107653 . doi: 10.1016/j.celrep.2020.107653 . OpenUrl CrossRef PubMed 38. ↵ Chen , T.W. , Wardill , T.J. , Sun , Y. , Pulver , S.R. , Renninger , S.L. , Baohan , A. , Schreiter , E.R. , Kerr , R.A. , Orger , M.B. , Jayaraman , V. , et al. ( 2013 ). Ultrasensitive fluorescent proteins for imaging neuronal activity . Nature 499 , 295 – 300 . doi: 10.1038/nature12354 . OpenUrl CrossRef PubMed Web of Science 39. ↵ Ray , R.S. , Corcoran , A.E. , Brust , R.D. , Kim , J.C. , Richerson , G.B. , Nattie , E. , and Dymecki , S.M . ( 2011 ). Impaired respiratory and body temperature control upon acute serotonergic neuron inhibition . Science 333 , 637 – 642 . doi: 10.1126/science.1205295 . OpenUrl Abstract / FREE Full Text 40. Bradley , S.R. , Pieribone , V.A. , Wang , W. , Severson , C.A. , Jacobs , R.A. , and Richerson , G.B . ( 2002 ). Chemosensitive serotonergic neurons are closely associated with large medullary arteries . Nat Neurosci 5 , 401 – 402 . doi: 10.1038/nn848 . OpenUrl CrossRef PubMed Web of Science 41. ↵ Bhandare , A. , van de Wiel , J. , Roberts , R. , Braren , I. , Huckstepp , R. , and Dale , N. ( 2022 ). Analyzing the brainstem circuits for respiratory chemosensitivity in freely moving mice . Elife 11 . doi: 10.7554/eLife.70671 . OpenUrl CrossRef PubMed 42. ↵ Okaty , B.W. , Freret , M.E. , Rood , B.D. , Brust , R.D. , Hennessy , M.L. , deBairos , D. , Kim , J.C. , Cook , M.N. , and Dymecki , S.M. ( 2015 ). Multi-Scale Molecular Deconstruction of the Serotonin Neuron System . Neuron 88 , 774 – 791 . doi: 10.1016/j.neuron.2015.10.007 . OpenUrl CrossRef PubMed 43. ↵ Ye , L. , Wu , J. , Cohen , P. , Kazak , L. , Khandekar , M.J. , Jedrychowski , M.P. , Zeng , X. , Gygi , S.P. , and Spiegelman , B.M . ( 2013 ). Fat cells directly sense temperature to activate thermogenesis . Proc Natl Acad Sci U S A 110 , 12480 – 12485 . doi: 10.1073/pnas.1310261110 . OpenUrl Abstract / FREE Full Text 44. ↵ Nakamura , K. , Nakamura , Y. , and Kataoka , N . ( 2022 ). A hypothalamomedullary network for physiological responses to environmental stresses . Nat Rev Neurosci 23 , 35 – 52 . doi: 10.1038/s41583-021-00532-x . OpenUrl CrossRef PubMed 45. ↵ Schneeberger , M. , Parolari , L. , Das Banerjee , T. , Bhave , V. , Wang , P. , Patel , B. , Topilko , T. , Wu , Z. , Choi , C.H.J. , Yu , X. , et al. ( 2019 ). Regulation of Energy Expenditure by Brainstem GABA Neurons . Cell 178 , 672 – 685 e612. doi: 10.1016/j.cell.2019.05.048 . OpenUrl CrossRef PubMed 46. ↵ Takatoh , J. , Park , J.H. , Lu , J. , Li , S. , Thompson , P.M. , Han , B.X. , Zhao , S. , Kleinfeld , D. , Friedman , B. , and Wang , F . ( 2021 ). Constructing an adult orofacial premotor atlas in Allen mouse CCF . Elife 10 . doi: 10.7554/eLife.67291 . OpenUrl CrossRef 47. ↵ Stanek , E.t. , Cheng , S. , Takatoh , J. , Han , B.X. , and Wang , F. ( 2014 ). Monosynaptic premotor circuit tracing reveals neural substrates for oro-motor coordination . Elife 3 , e02511 . doi: 10.7554/eLife.02511 . OpenUrl CrossRef PubMed 48. Sreenivasan , V. , Karmakar , K. , Rijli , F.M. , and Petersen , C.C . ( 2015 ). Parallel pathways from motor and somatosensory cortex for controlling whisker movements in mice . Eur J Neurosci 41 , 354 – 367 . doi: 10.1111/ejn.12800 . OpenUrl CrossRef PubMed 49. ↵ Yang , W. , Kanodia , H. , and Arber , S . ( 2023 ). Structural and functional map for forelimb movement phases between cortex and medulla . Cell 186 , 162 – 177 e118. doi: 10.1016/j.cell.2022.12.009 . OpenUrl CrossRef PubMed 50. ↵ Han , W. , Tellez , L.A. , Rangel , M.J. , Jr. , Motta , S.C. , Zhang , X. , Perez , I.O. , Canteras , N.S. , Shammah-Lagnado , S.J. , van den Pol , A.N. , and de Araujo , I.E. ( 2017 ). Integrated Control of Predatory Hunting by the Central Nucleus of the Amygdala . Cell 168 , 311 – 324 e318. doi: 10.1016/j.cell.2016.12.027 . OpenUrl CrossRef PubMed 51. ↵ Furlan , A. , La Manno , G. , Lubke , M. , Haring , M. , Abdo , H. , Hochgerner , H. , Kupari , J. , Usoskin , D. , Airaksinen , M.S. , Oliver , G. , et al. ( 2016 ). Visceral motor neuron diversity delineates a cellular basis for nipple- and pilo-erection muscle control . Nat Neurosci 19 , 1331 – 1340 . doi: 10.1038/nn.4376 . OpenUrl CrossRef PubMed 52. ↵ Fujiwara , H. , Ferreira , M. , Donati , G. , Marciano , D.K. , Linton , J.M. , Sato , Y. , Hartner , A. , Sekiguchi , K. , Reichardt , L.F. , and Watt , F.M . ( 2011 ). The basement membrane of hair follicle stem cells is a muscle cell niche . Cell 144 , 577 – 589 . doi: 10.1016/j.cell.2011.01.014 . OpenUrl CrossRef PubMed Web of Science 53. ↵ Blessing , W.W. , and Nalivaiko , E . ( 2001 ). Raphe magnus/pallidus neurons regulate tail but not mesenteric arterial blood flow in rats . Neuroscience 105 , 923 – 929 . doi: 10.1016/s0306-4522(01)00251-2 . OpenUrl CrossRef PubMed Web of Science 54. Rathner , J.A. , and McAllen , R.M . ( 1999 ). Differential control of sympathetic drive to the rat tail artery and kidney by medullary premotor cell groups . Brain Res 834 , 196 – 199 . doi: 10.1016/s0006-8993(99)01568-1 . OpenUrl CrossRef PubMed Web of Science 55. ↵ Ootsuka , Y. , and Blessing , W.W . ( 2005 ). Activation of slowly conducting medullary raphe-spinal neurons, including serotonergic neurons, increases cutaneous sympathetic vasomotor discharge in rabbit . Am J Physiol Regul Integr Comp Physiol 288 , R909 – 918 . doi: 10.1152/ajpregu.00564.2004 . OpenUrl CrossRef PubMed Web of Science 56. ↵ Esposito , M.S. , Capelli , P. , and Arber , S . ( 2014 ). Brainstem nucleus MdV mediates skilled forelimb motor tasks . Nature 508 , 351 – 356 . doi: 10.1038/nature13023 . OpenUrl CrossRef PubMed Web of Science 57. ↵ Capelli , P. , Pivetta , C. , Soledad Esposito , M. , and Arber , S . ( 2017 ). Locomotor speed control circuits in the caudal brainstem . Nature 551 , 373 – 377 . doi: 10.1038/nature24064 . OpenUrl CrossRef PubMed 58. ↵ Toor , R. , Sun , Q.J. , Kumar , N.N. , Le , S. , Hildreth , C.M. , Phillips , J.K. , and McMullan , S . ( 2019 ). Neurons in the Intermediate Reticular Nucleus Coordinate Postinspiratory Activity, Swallowing, and Respiratory-Sympathetic Coupling in the Rat . J Neurosci 39 , 9757 – 9766 . doi: 10.1523/JNEUROSCI.0502-19.2019 . OpenUrl Abstract / FREE Full Text 59. ↵ Kaku , H. , Liu , L.D. , Gao , R. , West , S. , Liao , S.-M. , Finkelstein , A. , Kleinfeld , D. , Thomas , A. , Tipparaju , S.L. , Svoboda , K. , and Li , N . ( 2025 ). A brainstem map of orofacial rhythms . bioRxiv , 2025.2001.2027.635041. doi: 10.1101/2025.01.27.635041 . OpenUrl Abstract / FREE Full Text 60. ↵ Nakamura , Y. , Yanagawa , Y. , Morrison , S.F. , and Nakamura , K . ( 2017 ). Medullary Reticular Neurons Mediate Neuropeptide Y-Induced Metabolic Inhibition and Mastication . Cell Metab 25 , 322 – 334 . doi: 10.1016/j.cmet.2016.12.002 . OpenUrl CrossRef PubMed 61. ↵ Stanek , E.t. , Rodriguez , E. , Zhao , S. , Han , B.X. , and Wang , F. ( 2016 ). Supratrigeminal Bilaterally Projecting Neurons Maintain Basal Tone and Enable Bilateral Phasic Activation of Jaw-Closing Muscles . J Neurosci 36 , 7663 – 7675 . doi: 10.1523/JNEUROSCI.0839-16.2016 . OpenUrl Abstract / FREE Full Text 62. ↵ Minkels , R.F. , Juch , P.J. , and van Willigen , J.D. ( 1995 ). Interneurones of the supratrigeminal area mediating reflex inhibition of trigeminal and facial motorneurones in the rat . Arch Oral Biol 40 , 275 – 284 . doi: 10.1016/0003-9969(94)00178-e . OpenUrl CrossRef PubMed Web of Science 63. ↵ Cano , G. , Passerin , A.M. , Schiltz , J.C. , Card , J.P. , Morrison , S.F. , and Sved , A.F . ( 2003 ). Anatomical substrates for the central control of sympathetic outflow to interscapular adipose tissue during cold exposure . J Comp Neurol 460 , 303 – 326 . doi: 10.1002/cne.10643 . OpenUrl CrossRef PubMed Web of Science 64. ↵ Francois , M. , Torres , H. , Huesing , C. , Zhang , R. , Saurage , C. , Lee , N. , Qualls-Creekmore , E. , Yu , S. , Morrison , C.D. , Burk , D. , et al. ( 2019 ). Sympathetic innervation of the interscapular brown adipose tissue in mouse . Ann N Y Acad Sci 1454 , 3 – 13 . doi: 10.1111/nyas.14119 . OpenUrl CrossRef PubMed 65. ↵ Schwarz , L.A. , Miyamichi , K. , Gao , X.J. , Beier , K.T. , Weissbourd , B. , DeLoach , K.E. , Ren , J. , Ibanes , S. , Malenka , R.C. , Kremer , E.J. , and Luo , L . ( 2015 ). Viral-genetic tracing of the input-output organization of a central noradrenaline circuit . Nature 524 , 88 – 92 . doi: 10.1038/nature14600 . OpenUrl CrossRef PubMed 66. ↵ Hosoya , Y . ( 1980 ). The distribution of spinal projection neurons in the hypothalamus of the rat, studied with the HRP method . Exp Brain Res 40 , 79 – 87 . doi: 10.1007/BF00236665 . OpenUrl CrossRef PubMed Web of Science 67. ↵ Winter , C.C. , Jacobi , A. , Su , J. , Chung , L. , van Velthoven , C.T.J. , Yao , Z. , Lee , C. , Zhang , Z. , Yu , S. , Gao , K. , et al. ( 2023 ). A transcriptomic taxonomy of mouse brain-wide spinal projecting neurons . Nature 624 , 403 – 414 . doi: 10.1038/s41586-023-06817-8 . OpenUrl CrossRef PubMed 68. ↵ Rathner , J.A. , Owens , N.C. , and McAllen , R.M . ( 2001 ). Cold-activated raphe-spinal neurons in rats . J Physiol 535 , 841 – 854 . doi: 10.1111/j.1469-7793.2001.t01-1-00841.x . OpenUrl CrossRef PubMed Web of Science 69. Stornetta , R.L. , Rosin , D.L. , Simmons , J.R. , McQuiston , T.J. , Vujovic , N. , Weston , M.C. , and Guyenet , P.G . ( 2005 ). Coexpression of vesicular glutamate transporter-3 and gamma-aminobutyric acidergic markers in rat rostral medullary raphe and intermediolateral cell column . J Comp Neurol 492 , 477 – 494 . doi: 10.1002/cne.20742 . OpenUrl CrossRef PubMed Web of Science 70. ↵ Nakamura , K. , Wu , S.X. , Fujiyama , F. , Okamoto , K. , Hioki , H. , and Kaneko , T . ( 2004 ). Independent inputs by VGLUT2- and VGLUT3-positive glutamatergic terminals onto rat sympathetic preganglionic neurons . Neuroreport 15 , 431 – 436 . doi: 10.1097/00001756-200403010-00010 . OpenUrl CrossRef PubMed Web of Science 71. ↵ Lkhagvasuren , B. , Nakamura , Y. , Oka , T. , Sudo , N. , and Nakamura , K . ( 2011 ). Social defeat stress induces hyperthermia through activation of thermoregulatory sympathetic premotor neurons in the medullary raphe region . Eur J Neurosci 34 , 1442 – 1452 . doi: 10.1111/j.1460-9568.2011.07863.x . OpenUrl CrossRef PubMed 72. Runegaard , A.H. , Sorensen , A.T. , Fitzpatrick , C.M. , Jorgensen , S.H. , Petersen , A.V. , Hansen , N.W. , Weikop , P. , Andreasen , J.T. , Mikkelsen , J.D. , Perrier , J.F. , et al. ( 2018 ). Locomotor- and Reward-Enhancing Effects of Cocaine Are Differentially Regulated by Chemogenetic Stimulation of Gi-Signaling in Dopaminergic Neurons . eNeuro 5 . doi: 10.1523/ENEURO.0345-17.2018 . OpenUrl Abstract / FREE Full Text 73. ↵ Osakada , F. , and Callaway , E.M . ( 2013 ). Design and generation of recombinant rabies virus vectors . Nat Protoc 8 , 1583 – 1601 . doi: 10.1038/nprot.2013.094 . OpenUrl CrossRef PubMed 74. ↵ Kim , J.H. , Lee , S.R. , Li , L.H. , Park , H.J. , Park , J.H. , Lee , K.Y. , Kim , M.K. , Shin , B.A. , and Choi , S.Y . ( 2011 ). High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice . PLoS One 6 , e18556 . doi: 10.1371/journal.pone.0018556 . OpenUrl CrossRef PubMed 75. ↵ Naito , Y. , Hino , K. , Bono , H. , and Ui-Tei , K . ( 2015 ). CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites . Bioinformatics 31 , 1120 – 1123 . doi: 10.1093/bioinformatics/btu743 . OpenUrl CrossRef PubMed 76. ↵ Harrison , M. , O’Brien , A. , Adams , L. , Cowin , G. , Ruitenberg , M.J. , Sengul , G. , and Watson , C . ( 2013 ). Vertebral landmarks for the identification of spinal cord segments in the mouse . Neuroimage 68 , 22 – 29 . doi: 10.1016/j.neuroimage.2012.11.048 . OpenUrl CrossRef PubMed 77. ↵ Ishii , K.K. , Osakada , T. , Mori , H. , Miyasaka , N. , Yoshihara , Y. , Miyamichi , K. , and Touhara , K . ( 2017 ). A Labeled-Line Neural Circuit for Pheromone-Mediated Sexual Behaviors in Mice . Neuron 95 , 123 – 137 e128. doi: 10.1016/j.neuron.2017.05.038 . OpenUrl CrossRef PubMed 78. ↵ Sherathiya , V.N. , Schaid , M.D. , Seiler , J.L. , Lopez , G.C. , and Lerner , T.N . ( 2021 ). GuPPy, a Python toolbox for the analysis of fiber photometry data . Sci Rep 11 , 24212 . doi: 10.1038/s41598-021-03626-9 . OpenUrl CrossRef PubMed 79. ↵ Simpson , E.H. , Akam , T. , Patriarchi , T. , Blanco-Pozo , M. , Burgeno , L.M. , Mohebi , A. , Cragg , S.J. , and Walton , M.E . ( 2024 ). Lights, fiber, action! A primer on in vivo fiber photometry . Neuron 112 , 718 – 739 . doi: 10.1016/j.neuron.2023.11.016 . OpenUrl CrossRef PubMed 80. ↵ Nakano , M. , Arai , Y. , Kotera , I. , Okabe , K. , Kamei , Y. , and Nagai , T . ( 2017 ). Genetically encoded ratiometric fluorescent thermometer with wide range and rapid response . PLoS One 12 , e0172344 . doi: 10.1371/journal.pone.0172344 . OpenUrl CrossRef PubMed View the discussion thread. Back to top Previous Next Posted September 05, 2025. Download PDF Supplementary Material Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Dissecting Medullary Raphe Neurons Regulating Multiple Thermogenic Pathways Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Dissecting Medullary Raphe Neurons Regulating Multiple Thermogenic Pathways Shuntaro Uchida , Mitsue Hagihara , Kenichi Inoue , Takaya Abe , Takeshi Sakurai , Kazunari Miyamichi bioRxiv 2025.09.01.673572; doi: https://doi.org/10.1101/2025.09.01.673572 Share This Article: Copy Citation Tools Dissecting Medullary Raphe Neurons Regulating Multiple Thermogenic Pathways Shuntaro Uchida , Mitsue Hagihara , Kenichi Inoue , Takaya Abe , Takeshi Sakurai , Kazunari Miyamichi bioRxiv 2025.09.01.673572; doi: https://doi.org/10.1101/2025.09.01.673572 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Neuroscience Subject Areas All Articles Animal Behavior and Cognition (7636) Biochemistry (17697) Bioengineering (13896) Bioinformatics (41957) Biophysics (21457) Cancer Biology (18595) Cell Biology (25522) Clinical Trials (138) Developmental Biology (13381) Ecology (19903) Epidemiology (2067) Evolutionary Biology (24323) Genetics (15612) Genomics (22511) Immunology (17738) Microbiology (40401) Molecular Biology (17184) Neuroscience (88624) Paleontology (667) Pathology (2833) Pharmacology and Toxicology (4825) Physiology (7644) Plant Biology (15158) Scientific Communication and Education (2046) Synthetic Biology (4296) Systems Biology (9825) Zoology (2271)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.