A label-free electrochemical aptamer sensor for sensitive detection of cardiac troponin I based on AuNPs/PB/PS/GCE

A label-free electrochemical aptamer sensor for sensitive detection of cardiac troponin I based on AuNPs/PB/PS/GCE | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article A label-free electrochemical aptamer sensor for sensitive detection of cardiac troponin I based on AuNPs/PB/PS/GCE Liying Jiang, Dongyang Li, Mingxing Su, Fenghua Chen, Xiaomei Qin, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4794692/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Monitoring cardiac troponin I (cTnI) is of great value in the clinical diagnosis of acute myocardial infarction (AMI). In this paper, a highly sensitive electrochemical aptamer sensor was demonstrated by using polystyrene (PS) microspheres as the electrode substrate material, combined with Prussian blue (PB) and gold nanoparticles (AuNPs) for the sensitive and label-free determination of cTnI. PS microspheres were synthesized by emulsion polymerization and then dropped onto the glassy carbon electrode, PB and AuNPs were electrodeposited on the electrode in corresponding electrolyte solution step by step. The PS microsphere substrate provided a large surface area for loading mass of the biological affinity aptamers, while the PB layer improved the electrical conductivity of the modified electrode and the electroactive AuNPs exhibited excellent catalytic performance for subsequent electrochemical measurements. In view of the above-mentioned sensing platform, the fabricated label-free electrochemical aptamer sensor showed a wide detection range of 10 fg/mL ~ 1.0 µg/mL and a low limit of detection of 2.03 fg/mL under the optimal conditions. Furthermore, this biosensor provided an effective detection platform for the analysis of cTnI in serum samples. The introduction of this sensitive electrochemical aptamer sensor provides a reference for clinical sensitive detection of cTnI. Electrochemical sensors cardiac troponin I aptamer Prussian blue gold nanoparticles Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1 Introduction Cardiovascular disease (CVD) is the leading cause of death worldwide, accounting for approximately 31% of all deaths, which includes angina, acute myocardial infarction (AMI), unstable angina, and heart failure[ 1 , 2 ]. Specifically, AMI is believed to be the leading cause of death in people with cardiovascular disease [ 3 ]. The "golden" window for thrombolysis and interventional therapy is 1 ~ 3 hours after AMI onset, which means that rapid diagnosis of early AMI is key to treatment [ 4 ]. Traditional diagnosis of AMI is based on angina symptoms, electrocardiography, and biomarker testing [ 5 ], with biomarkers being particularly important in identifying patients with atypical presentation ( i.e. , no chest pain or no ST-segment elevation on the electrocardiographic) [ 6 ]. A number of indicators, including myoglobin, c-reactive protein, lactate dehydrogenase, and cardiac troponin I (cTnI), have proved useful in the assessment of AMI [ 7 , 8 ]. Among various biomarkers, cTnI is considered the "gold standard" for early diagnosis of AMI because of its high clinical sensitivity and specificity for cardiac tissue, as well as its ability to reflect small areas of myocardial necrosis or ischemia [ 9 – 11 ]. When an AMI occurs, serum cTnI concentrations rise within 12 hours and remain elevated level for 5 ~ 9 days [ 12 ]. In healthy individuals, cTnI concentrations are typically below 0.4 ng/mL, while levels above 2.0 ng/mL are associated with an increased risk of possible future major cardiac events [ 9 ]. Numerous techniques, including fluorescent [ 13 ], colorimetric [ 14 ], and electrochemical [ 15 ], have been developed for the detection of cTnI. One of the most commonly used clinical techniques is the enzyme-linked immunosorbent assay (ELISA), which is specific and sensitive, but has a long detection time and results are affected by many factors [ 16 ]. While electrochemical methods have the advantages of rapid response, low cost, time savings and high sensitivity [ 15 ]. The majority of electrochemical methods for cTnI detection rely on antibody-antigen interactions, but suffer from poor stability, low robustness, and high cost. Dorraj et al. [ 17 ] screened four DNA aptamers against the cTnI protein through a systematic evolution of ligands by exponential enrichment (SELEX) method which has high binding affinity with dissociation constants ( K d ) in the nanomolar range. Jo et al . [ 8 ] further selected the Tro4 aptamer for cTnI with a very low K d value (270 pM) compared with that of a cTnI antibody (20.8 nM). Aptamer can be used as an alternative to antibody in the determination of cTnI because they overcome the limitations of antibodies, eliminate the ethical concerns associated with animal or human products, ensure no batch-to-batch variation, and allow selection under non-physiological conditions [ 18 , 19 ]. Prussian blue (PB, ferric hexacyanoferrate) is often used as a signal indicator because of its ease of synthesis, low cost, no electroactive molecules kinetic diffusion, and high physical stability. In addition, as a metal complex, PB has higher chemical stability and can ensure the continuous output of the signal, thereby improving the durability and reproducibility of the sensor. PB is typically chemically synthesized in a conventional manufacturing process by a mixed reaction of ferric and hexacyanoferrates with different oxidation state of iron ions [ 20 ]. The reaction proceeds too fast, resulting in an inability to regulate the size and shape of the formed PB crystals to guarantee high reproducibility [ 21 ]. It was found that some carbon nanomaterials, such as carbon nanotubes [ 22 ], graphene [ 23 ], and carbon nanospheres [ 24 ], have proven to be effective platforms to support PB synthesis. The present work attempts to explore polystyrene (PS) microspheres as a substrate to support the electrodeposition of PB, as well as provide a large surface area to overcome aggregation and improve biopolymer stabilization. In order to improve the catalytic ability and amplify the electrochemical signals, gold nanoparticles (AuNPs) are widely used in the construction of electrochemical biosensors due to their good biocompatibility and ease of functionalization [ 25 , 26 ]. Various bioreceptors such as DNA, enzyme, antibody could be attached to the surface of gold nanomaterials through Au-S bond or chelation with amino and carboxyl groups. Herein, we designed a label-free electrochemical aptamer sensor for the sensitive detection of cTnI based on AuNPs/PB/PS modified glassy carbon electrode (GCE), where PB and AuNPs were successively electrodeposited on the PS microspheres modified GCE (Scheme 1 ). The thiol-functionalized aptamer Tro4 was chemically linked to the AuNPs/PB/PS/GCE through Au-S bond. The constructed electrochemical aptamer sensor was then subjected to sensitive detection of cTnI with a wide detection range of 10 fg/mL ~ 1.0 µg/mL and a low limit of detection of 2.03 fg/mL under the optimal conditions. Furthermore, the reliable anti-interference and detectability in serum samples were confirmed, indicating its promising application toward early diagnosis of cardiovascular diseases. 2 Experimental section 2.1 Chemicals and apparatus Cardiac troponin I (cTnI), cardiac troponin T (cTnT), hemoglobin (Hb), myoglobin (Myo) were obtained from Wuhan Yunclone Technology Co Ltd. Aptamer (Tro4, SH-(C6)-5'- CGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCCCTCTTA), was purchased from Shanghai Sangong Bioengineering Co. Ltd. Tris (hydroxymethyl) aminomethane (Tris-HCl) was supplied by Sinopharm Chemical Reagent Co. Ltd. Styrene (C 8 H 8 ) was purchased from Shanghai McLean Biochemistry & Technology Co. Ltd. Chloroauric acid (HAuCl 4 ), 6-mercaptohexanol (MCH), sodium hydroxide (NaOH), polyvinylpyrrolidone (PVP), K 3 [Fe(CN) 6 ], FeCl 3 ∙6H 2 O, KCl, KNO 3 , HCl, ethanol, and MgCl 2 were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Ultrapure water with resistivity > 18 ΩM was provided by an ELGA Biochemistry ultrapure water machine. All the chemical reagents used in this experiment were analytically pure and used as received. All data in the paper were measured three times to obtain error bars. All electrochemical measurements were performed on a CH Instruments model 760E electrochemical analyzer (CH Instruments, Inc., Shanghai). For electrochemical detection, the traditional three-electrode system was used: GCE with a diameter of 6 mm was used as the working electrode, the reference electrode was Ag/AgCl, the auxiliary electrode was platinum column plate. The electrochemical measurement methods used included cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), and differential pulse voltammetry (DPV). The electrochemical measurements of CV were carried out in 0.1 M PBS containing 5 mM [Fe(CN) 6 ] 3-/4- solution (pH = 7.4), a potential range of -0.2 ~ 0.6 V was selected for the measurements to observe the redox peaks, with a step potential of 0.01 V and a potential scanning rate of 100 mV/s. EIS was performed in 0.1 M PBS with 5 mM [Fe(CN) 6 ] 3-/4- (pH = 7.4), with a frequency range of 0.1 Hz to 100 kHz, an amplitude of 5 mV and an open-circuit potential of -0.2 V. The morphology of the modified electrodes was characterized by scanning electron microscopy (SEM, JSM-60, JEOL, Japan) operating at the accelerating voltage of 20 kV. Energy dispersive X-ray analysis (EDAX) was performed using a JSM-60 equipped with an Oxford Extreme windowless EDX detector. XRD was carried out using a Rigaku Dmax-2500 X-ray diffractometer with Cu Ka radiation (λ = 1.54 Å) at 50 kV and 200 mA at a scanning rate of 5 °/min. A Fourier transform infrared spectrometer (vertex70, Brock instruments, Germany) was employed to obtain Fourier transform infrared spectra (FT-IR). 2.2 Preparation of PS microspheres PS microspheres were synthesized by emulsion polymerization method. In a three-necked flask, 80 g of ethanol was added, and then 1.44 g of PVP was added. After the PVP was completely dissolved, the temperature was raised to 70°C, and 15 g of styrene monomer was added, and after stirring for 10 min to disperse the styrene uniformly, the initiator azobisisobutyronitrile (AIBN) was added to initiate the polymerization of the styrene monomer, and the temperature was kept constant under a nitrogen atmosphere for 10 h. The prepared PS solution was centrifuged (8000 rpm) for 5 min to remove the float, and the resulting precipitate was added to 50 mL of ethanol to redisperse by ultrasonic treatment. The precipitates were collected, weighed, and dispersed in ethanol with a mass concentration of 1 mg/mL. 2.3 Preparation of AuNPs/PB/PS/GCE Prior to modification, the bare GCE was successively polished with 1.0 µm, 0.3 µm, and 0.05 µm Al 2 O 3 powder. It was then subjected to 15 CV scans in 0.5 M H 2 SO 4 with a potential window of -0.5 V ~ 1.8 V at a scan rate of 100 mV/s to activate the electrode. Finally, the electrode surface was dried with a N 2 blow dryer. To obtain PS/GCE, 5 µL of PS solution was applied dropwise to the GCE, dried in a desiccator, and then the surface was cleaned with ultrapure water. The PS/GCE was immersed in a mixed solution consisting of 1 mM K 3 [Fe(CN) 6 ], 1 mM FeCl 3 ∙6H 2 O, 0.1 M KCl, 0.92 mM CTAB and 0.02 mM HCl. The PB film was electrodeposited by conducting CV scanning for 15 runs in the potential range of 0 V ~ 1.0 V at a rate of 50 mV/s. The obtained PB/PS/GCE was then placed in 1 mM HAuCl 4 solution and subjected to 20 runs of CV cycles scanning from − 0.5 V to 0 V for the electrodeposition of AuNPs on the electrode at a scanning rate of 100 mV/s. The electrode was rinsed with ultrapure water to obtain AuNPs/PB/PS/GCE. 2.4 Preparation of Tro4/AuNPs/PB/PS/GCE The AuNPs/PB/PS/GCE was immersed in a buffer solution (20 mM Tris-HCl, 5 mM MgCl 2 , and 50 mM NaCl, pH = 7.4) containing 1 µM Tro4 and incubated at 4℃ for 6 h to produce Tro4/AuNPs/PB/GCE. Then, the modified electrode was washed with 20 mM Tris-HCl buffer to remove the unbound aptamer, and then 10 µL of 1 mM MCH solution was added to the surface of the Tro4/AuNPs/PB/GCE to block the non-specific active site on the electrode surface. 2.5 Electrochemical detection of cTnI An immersion method was used to investigate the sensing performance of the Tro4/AuNPs/PB/PS/GCE aptamer sensor in this experiment for the target cTnI. The constructed sensors were immersed in various cTnI concentrations ranging from 10 fg/mL to 1.0 µg/mL and incubated at 37°C for 1 h. Then, the electrodes were washed with deionized water and the electrochemical signals were recorded using DPV analysis mode in 0. 8 M KNO 3 solution with a potential range from − 0.2 to 0.6 V, a modulation amplitude of 50 mV, a step potential of 4 mV, an experimental pulse period of 0.5 s, and an experimental pulse width of 0.05 s. 2.6 Real sample analysis To further investigate the ability of the aptamer sensor to analyze real samples, we used the standard addition method in serum for further investigation the sensing performance. Human serum albumin samples were obtained from Beijing Solarbio Life Sciences Ltd. 20 mM Tris-HCl, 150 mM NaCl (pH 7.4) were used to dilute the serum to 10% as a buffer for the detection of cTnI. Then various concentrations of cTnI were spiked to the serum dilution to simulate AMI patients and healthy individuals. The constructed Tro4/AuNPs/PB/PS/GCE aptamer sensors were immersed in the spiked serum dilution and incubated at 37°C for 1 h. Then, the electrodes were washed with deionized water and the electrochemical signals were recorded using the DPV method as described above. 3 Results and Discussion 3.1 Characterization of AuNPs/PB/PS/GCE SEM and EDAX were employed to investigate the morphology and element distribution of the modified electrodes. Figure 1 A exhibited the smooth PS microspheres with diameters ranging from 4 to 9 µm. Figure 1 B displayed the morphology of the PS-modified electrode after an electrodeposition treatment in a mixed solution of ferric chloride and potassium ferricyanide, and the localized zoomed image shown in the red dashed box indicated that the smooth surface of the PS microsphere was uniformly covered with a layer of rough PB nanoparticles. The EDAX spectrum and elemental mapping images further indicated the successful fabrication of PB/PS as shown in Figure S1 , where Fe element was adhered to the electrode surface. The morphology obtained by further electrodeposition of AuNPs on PB/PS/GCE is shown in Fig. 1 C, where denser nanoparticles covering the microsphere surface can be observed. Due to the better conductivity of the AuNPs, the obtained AuNPs/PB/PS product has a better contrast, resulting in a sharper image. Figure 1 D exhibited the EDAX spectrum of AuNPs/PB/PS, indicating the presence of C, N, O, Fe, and Au elements. The elemental mapping images for Au, Fe, C, O were collected as shown in Fig. 1 E, from which Au can be found on the surface of the sphere, further confirming the successful preparation of AuNPs/PB/PS nanostructure. The XRD pattern and FT-IR spectra of the modified electrode are shown in Fig. 2 to characterize the structure and surface chemical state. As shown in Fig. 2 A, the presence of PS microspheres resulted in a strong and broad background peak around ~ 21° in the XRD pattern of AuNPs/PB/PS, attributed to the amorphous carbon structure. It can be observed that the diffraction peaks at 38°, 44°, 65°, and 78° can be assigned to (111), (200), (220), and (311) faces of metallic Au (PDF#04-0784). The peaks around 28°, 55° were attributed to PB [ 27 ]. The FT-IR spectra of PS, PB/PS, AND AuNPs/PB/PS were shown in Fig. 2 B. The absorption peaks at 2976 cm − 1 , 2846 cm − 1 , and 1463 cm − 1 can be assigned to the asymmetric, symmetric stretching vibration, and bending vibration of C-H in the PS, respectively. The moderate peak at 720 cm − 1 was a typical out-of-plane bending vibration of C-H in the –(CH 2 ) n – chain in PS. Compared with PS, PB/PS and AuNPs/PB/PS exhibited an additional absorption peak at 2363 cm − 1 , which can be attributed to the C ≡ N stretching vibration in the formed [Fe(II)-CN-Fe(III)] structure, indicating the successful electrodeposition of PB on the PS surface. The broad and moderately intensity absorption peak at ~ 3393 cm − 1 can be attributed to the -NH stretching vibration, which disappeared after the deposition of AuNPs, suggesting that the additional AuNPs can be anchored on the PB/PS surface by bonding of Au with -NH leads to the disappearance of this peak. Based on the XRD and FT-IR results, it was shown that both PB and AuNPs were successfully electrodeposited on the PS surface. 3.2. Characterization of the electrochemical aptamer sensor As shown in Fig. 3 , electrochemical measurements using CV and EIS techniques were performed on bare and modified GCEs in 0.1 M PBS solution containing 5 mM [Fe(CN) 6 ] 3−/4− as the redox-active couple to evaluate the modification processes of the modified electrodes. It can be observed that after modification of PS microspheres (curve b), the redox peak current was significantly decreased compared to the bare GCE (curve a) due to the poor conductivity of PS to hinder the charge transfer between the redox ions and the electrode (Fig. 3 A). The electrodeposition of PB layer on PS/GCE (curve c) resulted in an increase of the peak current because of the good electrical conductivity of PB. Further electrodeposition of AuNPs (curve d) greatly increased the peak current from 0.068 mA (PB/PS/GCE) to 0.178 mA (AuNPs/PB/PS/GCE), indicating that the prepared modified electrode has a sensitive response due to the excellent conductivity of AuNPs and a more continuous microsurface to ensure the unobstructed electron transport path. The surface of the AuNPs/PB/PS/GCE was immobilized with the 5′-thiol-Tro4 aptamer (curve e) probes through Au-S bonds and subsequently blocked with MCH (curve f) to prevent non-specific binding (Fig. 3 B). The insulating organic matter would impede the electron transfer and cause a current decrease in the redox peaks, and the sealer MCH further decrease the peak current. The feasibility of the electrochemical aptamer sensor was illustrated by incubating the MCH/Tro4/AuNPs/PB/PS/GCE with the target. In the presence of cTnI (curve g), Tro4 specifically bonded to the protein molecule, thereby preventing the access of [Fe(CN) 6 ] 3− /[Fe(CN) 6 ] 4− to the electrode surface. Consequently, a decrease of the redox peak current was observed, which reflected the existence of the target cTnI. Therefore, the designed aptamer sensor is capable of highly sensitive electrochemical detection of cTnI. EIS serves as a common technique to assess electron transfer capabilities. Nyquist plots accompanied with a Randles model equivalent circuit were shown in the inset in Fig. 3 C and D, where R ct , R s , C dl and Z W represent the charge transfer resistance, the solution resistance, the double-layer capacitance and the Warburg resistance, respectively. In the Nyquist plot, the diameter of the semicircular portion appearing in the high-frequency region indicates the electron-transfer-limited process, whose diameter is equal to the charge-transfer resistance. It can be included that the Nyquist plot analysis validated the CV results. AuNPs/PB/PS/GCE (curve d) had the best electrical conductivity and the lowest R ct value compared to bare GCE (curve a), PS/GCE (curve b), and PB/PS/GCE (curve c). The introduction of AuNPs also provided efficient anchoring sites for aptamer to capture target protein. When Tro4, MCH and cTnI (curve e-g) were sequentially modified on the AuNPs/PB/PS/GCE surface, electron transfer between the solution and the electrode was delayed and their corresponding R ct values increased. In order to investigate the electrochemical active area of the modified electrodes, we performed the CV measurements on Au/PB/PS/GCE and Au/PB/GCE electrodes in 0.1 M PBS containing 5 mM [Fe(CN) 6 ] 3−/4− with increasing sweep rates from 10 mV s − 1 to 500 mV s − 1 (Fig. 4 A, B). As scanning speed increased, the redox peak current signal increased as well. The data presented in Fig. 4 C indicated that the oxidation peak current I p was directly proportional to the quadratic root of the scanning speed v 1/2 . This suggested that a diffusion-controlled process both existed in the Au/PB/PS/GCE and Au/PB/GCE electrodes. The Randles-Sevcik equation can be used to determine the constructed electrode's electrochemically active area [ 28 ]: 𝐼𝑝 = 2.69 × 10 5 𝑛 3/2 A𝐷 1/2 𝑣 1/2 where I p is the peak current (A), n is the number of transferred electrons ( n = 1), A is the electrochemically active area of the electrode (cm 2 ), D is the diffusion coefficient of [Fe(CN) 6 ] 3−/4− (cm 2 /s), C is the concentration of the reactant (mol/L), and ν is the scan rate (V/s). As shown in Figure S2 , the current response of the bare GCE electrode was the smallest and become larger after modification of PB and AuNPs due to their excellent conductivity. Figure 4 D compared the electrochemically active areas in a histogram for bare GCE, AuNPs/PB/GCE, and AuNPs/PB/PS/GCE, from which we could find that AuNPs/PB/PS/GCE performs best. The AuNPs/PB/GCE exhibited higher electrochemically active area of 0.0622 cm 2 than that of bare GCE of 0.055 cm 2 . Additional PS microspheres further introduced a larger electrochemically active area of 0.0759 cm 2 , suggesting that the introduction of PS microspheres in the modified electrode would increase the surface roughness and provide a larger surface area. 3.3. Optimization of experimental conditions The electrodeposition cycles for PB and AuNPs on the PS/GCE were investigated to optimize the preparation parameters. Figure S3 displayed the CV plot for a cycle number of 25 turns in the electrodeposition of PB, illustrating the good redox peak signals of the PB electrodeposited on the electrode surface. As the number of cycles increased, the redox peak current also increased. The responses that take place during the process are, 4 FeCl + 3 K[Fe(CN)] → Fe[Fe(CN)] (PB)↓ + 12 KCl The redox peak current did not increase and retained a strong electrochemical signal after 15 cycles of scanning. Consequently, electrodeposition of 15 cycles was determined to be the ideal condition for electrodeposited PB in this experiment. The performance of the modified electrode was also influenced by the quantity of the electrodeposited AuNPs at different cycles, as shown in Figure S4. As the number of electrodeposition cycles increased, the AuNPs continued to grow on the electrode surface and the redox current became larger and larger. However, when the number of AuNPs increased until the nanoparticles were clustered together, the specific surface area began to decrease, resulting in a decrease in the active area of the electrode as well. This was why the peak current was biggest when 15 cycles, and it decreased when the number of gold plating cycles was 20 cycles. Therefore, electrodeposition of 15 cycles was determined to be the ideal condition for electrodeposited AuNPs in this experiment. In order to obtain the best performance of the electrochemical biosensor, the following experimental conditions were optimized, including the concentration of K + , the incubation time of Tro4, MCH, and the target cTnI. As shown in Scheme 1 , the sensing mechanism of cTnI was based on an ion barrier effect that the specific binding of cTnI could block the electrode surface and hinder the reaction between K + and PB to form Prussian white (PW) following the reaction below, Fe 4 [Fe(CN) 6 ] 3 (PB) + 4e − + 4K + → K 4 Fe 4 [Fe(CN) 6 ] 3 (PW) Therefore, the concentration of K + should be optimized to get a more sensitive detection signal. As shown in Fig. 5 A, as the concentration of the KNO 3 solution increased, the redox peak current increased while the potential difference decreased due to the redox reaction between PB and PW. With the increasement of K + concentration, more Fe 3+ ions participated in the reaction, which then accelerated the chemical reaction rate and improved the redox reversibility. Finally, the current signal increased. According to the Nernst formula, E = E θ + (0.0592/ n ) ln([Fe 3+ ]/[Fe 2+ ]) with the increasement of the concentration of K + , the concentration of Fe 3+ involved in the reaction increased, the value of [Fe 3+ ]/[Fe 2+ ] became larger, and the potential moved forward, so that the potential difference of the redox peak decreased. When the concentration of KNO 3 was above 0.8 M, the redox peak signal reached the maximum, indicating that the reaction has reached the saturation state. The potential difference of the redox peak was less than 60 mV, demonstrating the good redox reversibility of PB. Therefore, 0.8 M KNO 3 solution was selected as the detection medium for cTnI. The AuNPs/PB/PS/GCE were immersed in 1 µM Tro4 buffer solution for different durations to optimize the Tro4 incubation time. As shown in Fig. 5 B, the DPV response signal of the modified electrode gradually decreased with increasing immersion time. The peak current reached a plateau and remained when the incubation time exceeded 6 hours. Therefore, 6 hours of incubation with Tro4 was selected for the following sensing measurements. Similarly, the incubation time of MCH to block the non-specific active site on the electrode surface was also investigated by immersing Tro4/AuNPs/PB/PS/GCE in 1 mM MCH solution. As shown in Fig. 5 C, the DPV signals decreased with increasing immersion time. The optimal blocking time for MCH was selected to be 60 minutes based on timesaving and acceptable sensitivity. The ideal hybridization time between Tro4/AuNPs/PB/PS/GCE and cTnI was investigated as shown in Fig. 5 D. The DPV signals decreased continuously with the incubation time of cTnI and remained unchanged after 60 minutes. Therefore, 60 minutes of incubation with cTnI was chosen for the following sensing measurements. 3.4. Detection of cTnI With the optimized parameters, electrochemical analyses were performed in triplicate for each concentration of cTnI. The constructed Tro4/AuNPs/PB/PS/GCE that prehybridized with different concentrations of cTnI were placed in 0.8 M KNO 3 solution to detect the electrochemical signal by DPV, as shown in Fig. 6 A. The peak currents of DPV gradually decreased as the concentration of cTnI increased, and this was explained by the fact that the specific binding of Tro4 to cTnI would further inhibit the K + reaction with PB, thereby blocking the reduction of PB (Fe 3+ ) to PW (Fe 2+ ). The plotted calibration curve presented in Fig. 6 B exhibited that a linear relationship between the peak value of DPV and the negative logarithm of the concentration of the cTnI in the range of 10 fg/mL to 1.0 µg/mL. The linear equation can be described as I = -2.99🞨10 − 5 lg C -7.21🞨10 − 5 (R 2 = 0.996), and the detection of limit (LOD) was determined to be 2.03 fg/mL (S/N = 3). The analytical performance of the constructed Tro4/AuNPs/PB/PS/GCE sensor was compared with previously reported literature in Table 1 [ 18 , 29 – 34 ]. It can be concluded that our sensor was easy to prepare and exhibited comparable analytical performance with previously reported electroanalytical methods. To investigate the selectivity of the developed aptamer sensor, a series of proteins such as hemoglobin (HB), bovine serum albumin (BSA), myoglobin (MYO), and cTnT were used for comparison. The concentration of all the interferents was chosen as 1 ng/mL, while cTnI was selected as 0.1 ng/mL. As shown in Fig. 6 C, the aptamer sensor for interferers showed negligible change in current response compared to cTnI, indicating good selectivity for cTnI detection. Furthermore, the anti-interference performance of the aptamer sensor was also investigated by analyzing Tro4/AuNPs/PB/GCE in different mixed solutions of cTnI (0.1 ng/mL) with other interferents (1 ng/mL). As presented in the plotted histogram in the latter part of Fig. 6 C, there was no significant change in the current signal of the sensor after incubation of these mixtures compared to the target cTnI alone, indicating a good anti-interference performance for the determination of cTnI. In addition, the reproducibility of the Tro4/AuNPs/PB/PS/GCE sensor was evaluated for five separately fabricated aptamer sensors on consecutive 15 days. As shown in Fig. 6 D, intra-assay reproducibility was confirmed by the fact that the five sensors showed almost identical current response to a 10 ng/mL cTnI under the same experimental conditions with a relative standard deviation (RSD) of 3.6%. The sensors were then stored at 4°C for 15 days, and the DPV responses were collected every two days. The data show that the current response decreased only slightly after 15 days, and the aptamer sensor retained approximately 96% of the initial current response compared to freshly prepared electrodes, confirming the satisfactory stability of the proposed sensor. Table 1 Comparison of the sensing performance of various biosensors for the detection of cTnI. Electrode material Linear range LOD Ref. PDA-Au-Pb 2+ /Cu 2+ /Tro6 1 µg/mL-0.01 pg/mL 3.8 fg/mL [ 18 ] Tro4-CC/Au/MIL-53(Fe) 2 pg/mL-150 ng /mL 0.5 pg/mL [ 29 ] Fe 3 O 4 -Au-TAPT-TDNs 0.05 ng/mL-100 ng/mL 27 pg/mL [ 30 ] HMCS@PDA@AuNPs PtCu DNs/MUN-CuO-TiO 2 0.01 pg/mL-500.0 ng/mL 2.3 fg/mL [ 31 ] AuNPs/Ti 3 C 2 -MXene 24.24 fg/mL-3 ng/mL 0.14 fg/mL [ 32 ] CSA/MCH/Fc-COFNs-MBA/AuE 10 fg/mL-10 ng/mL 2.6 fg/mL [ 33 ] Au/Zr–C/PtCuNi 100 ng/mL-0.01 pg/mL 1.24×10 − 3 pg/mL [ 34 ] Tro4/AuNPs/PB/PS/GCE 10 fg/mL − 1ug/mL 2.03 fg /mL This work 3.5 Real sample analysis To validate the practical application of the proposed aptamer sensor for the determination of the cTnI in the real samples, the Tro4/AuNPs/PB/PS/GCE-based sensing system was analyzed in spiked human serum samples by using the standard addition method. Different amounts of cTnI were added to the serum samples to simulate the healthy individuals, mild cases, and severe patients. As shown in Fig. 7 , there was a clear demarcation of peak current values between patients and normal subjects. The spike recovery assays of the cTnI were also performed using human serum samples diluted 10-fold with 20 mM Tris-HCl (pH 7.4) solution. The results presented in Table 2 demonstrated that the proposed aptamer sensor exhibited excellent capability in determining cTnI in the real samples. Meanwhile, the recovery rates were in the range of 101.3–104%, and the RSD ranges were from 2.7–4.7%. Table 2 cTnI recovery test in diluted human serum samples. Samples No. Added(ng/mL) Measured(ng/mL) Recovery rate(%,n = 3) RSD (%,n = 3) 1 0.1 0.10 102.0% 2.7% 2 1 1.04 104.0% 4.7% 3 10 10.13 101.3% 4.5% 4 Conclusion In conclusion, an aptamer sensor for the detection of cTnI was constructed by a two-step electrodeposition of PB and AuNPs on the PS microspheres modified electrode. The modification layer of PS microspheres could help to disperse PB and AuNPs homogeneously and increase the active area of the electrode to enhance the sensitivity of the sensor. The proposed Tro4/AuNPs/PB/PS/GCE aptamer sensor exhibited a wide linear range of 10 fg/mL ~ 1 µg/mL, and a LOD of 2.03 fg/mL under optimized experimental conditions. In addition, the aptamer sensor has high selectivity and anti-interference, long stability, and good reproducibility, which could be a promising sensor platform for detection of cTnI in clinical samples. As a result, the sensor holds great promise to aid in the early detection and prognostic assessment of AMI. Declarations The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Data availability All data that support the fndings of this study are included within the article and any supplementary files. Contributions Liying Jiang : Methodology, Writing – original draft preparation. Dongyang Li : Data curation, Writing – Review & Editing. Mingxing Su: Investigation. Fenghua Chen : Investigation. Xiaomei Qin : Investigation. Lan Wang : Investigation. Y anghai Gui : Investigation. Jianbo Zhao : Investigation. Huishi Guo : Investigation. Xiaoyun Qin : Supervision, Fund acquisition, Reviewing & Editing, Proof reading. Zhen Zhang : Supervision, Fund acquisition, Reviewing & Editing, Proof reading. Funding The authors acknowledge the financial support from the National Natural Science Foundation of China (62073299, 21904120), the Key Research and Development Projects of Henan Province under grant (241111222900), and the Ministry of Science and Technology of China (2022YFF1202700). Ethical approval Not applicable. Clinical Trial Number Not applicable. Conflict of interest The authors declare no competing interests. References Müller L, Caris-Veyrat C, Lowe G, Böhm V (2016) Lycopene and its antioxidant role in the prevention of cardiovascular diseases—a critical review. Crit Rev Food Sci Nutr 56(11):1868–1879. https://doi.org/10.1080/10408398.2013.801827 Ettehad D, Emdin CA, Kiran A, Anderson SG, Callender T, Emberson J, Chalmers J, Rodgers A, Rahimi K (2016) Blood pressure lowering for prevention of cardiovascular disease and death: a systematic review and meta-analysis. Lancet 387(10022):957–967. https://doi.org/10.1016/S0140-6736(15)01225-8 Lopa NS, Rahman MM, Ahmed F, Ryu T, Sutradhar SC, Lei J, Kim J, Kim DH, Lee YH, Kim W (2019) Simple, low-cost, sensitive and label-free aptasensor for the detection of cardiac troponin I based on a gold nanoparticles modified titanium foil. Biosens Bioelectron 126:381–388. https://doi.org/https://doi.org/10.1016/j.bios.2018.11.012 Amsterdam EA, Wenger NK, Brindis RG, Casey DE, Ganiats TG, Holmes DR, Jaffe AS, Jneid H, Kelly RF, Kontos MC, Levine GN, Liebson PR, Mukherjee D, Peterson ED, Sabatine MS, Smalling RW, Zieman SJ (2014) 2014 AHA/ACC guideline for the management of patients with non–ST-elevation acute coronary syndromes. Exec Summary 130(25):2354–2394. https://doi.org/doi:10.1161/CIR.0000000000000133 Antman E, Bassand J-P, Klein W, Ohman M, Sendon JLL, Rydén L, Simoons M, Tendera M (2000) Myocardial infarction redefined—a consensus document of the joint european society of cardiology/american college of cardiology committee for the redefinition of myocardial infarction. 36(3):959–969. https://doi.org/doi:10.1016/S0735-1097(00)00804-4 Roffi M, Patrono C, Collet J-P, Mueller C, Valgimigli M, Andreotti F, Bax JJ, Borger MA, Brotons C, Chew DP, Gencer B, Hasenfuss G, Kjeldsen K, Lancellotti P, Landmesser U, Mehilli J, Mukherjee D, Storey RF, Windecker S (2015) 2015 ESC guidelines for the management of acute coronary syndromes in patients presenting without persistent ST-segment elevation. Kardiologia Polska 73(12):1207–1294. https://doi.org/10.5603/kp.2015.0243 Feng S, Yan M, Xue Y, Huang J, Yang X (2021) Electrochemical immunosensor for cardiac troponin I detection based on covalent organic framework and enzyme-catalyzed signal amplification. Anal Chem 93(40):13572–13579. https://doi.org/10.1021/acs.analchem.1c02636 Jo H, Gu H, Jeon W, Youn H, Her J, Kim S-K, Lee J, Shin JH, Ban C (2015) Electrochemical aptasensor of cardiac troponin I for the early diagnosis of acute myocardial infarction. Anal Chem 87(19):9869–9875. https://doi.org/10.1021/acs.analchem.5b02312 Yan H, Tang X, Zhu X, Zeng Y, Lu X, Yin Z, Lu Y, Yang Y, Li L (2018) Sandwich-type electrochemical immunosensor for highly sensitive determination of cardiac troponin I using carboxyl-terminated ionic liquid and helical carbon nanotube composite as platform and ferrocenecarboxylic acid as signal label. Sens Actuators B 277:234–240. https://doi.org/https://doi.org/10.1016/j.snb.2018.09.010 Wang N, Wang J, Zhao X, Chen H, Xu H, Bai L, Wang W, Yang H, Wei D, Yuan B (2021) Highly sensitive electrochemical immunosensor for the simultaneous detection of multiple tumor markers for signal amplification. Talanta 226:122133. https://doi.org/https://doi.org/10.1016/j.talanta.2021.122133 Liu X, Wen Y, Wang W, Zhao Z, Han Y, Tang K, Wang D (2020) Nanobody-based electrochemical competitive immunosensor for the detection of AFB1 through AFB1-HCR as signal amplifier. Microchim Acta 187(6):352. https://doi.org/10.1007/s00604-020-04343-2 Anaya P, Moliterno DJ (2013) The evolving role of cardiac troponin in the evaluation of cardiac disorders. Curr Cardiol Rep 15(11):420. https://doi.org/10.1007/s11886-013-0420-0 Li J, Lv Y, Li N, Wu R, Li J, You J, Shen H, Chen X, Li LS (2021) Dual protecting encapsulation synthesis of ultrastable quantum-dot nanobeads for sensitive and accurate detection of cardiac biomarkers. Sens Actuators B 344:130275. https://doi.org/https://doi.org/10.1016/j.snb.2021.130275 Zhao H, Zheng J, Liang H, Liu H-F, Liu F, Zhang Y-P, Li C-P (2023) Electrochemical/colorimetric dual-mode sensing strategy for cardiac troponin I detection based on zirconium nitride functionalized covalent organic frameworks. Sens Actuators B 391:134026. https://doi.org/https://doi.org/10.1016/j.snb.2023.134026 Eshlaghi SN, Syedmoradi L, Amini A, Omidfar K (2023) A label-free electrochemical aptasensor based on screen printed carbon electrodes with gold nanoparticles-polypyrrole composite for detection of cardiac troponin I. IEEE Sens J 23(4):3439–3445. https://doi.org/10.1109/JSEN.2023.3235740 Jiao L, Zhang L, Du W, Li H, Yang D, Zhu C (2019) Au@Pt nanodendrites enhanced multimodal enzyme-linked immunosorbent assay. Nanoscale 11(18):8798–8802. https://doi.org/10.1039/C8NR08741E Dorraj GS, Rassaee MJ, Latifi AM, Pishgoo B, Tavallaei M (2015) Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J Biotechnol 208:80–86. https://doi.org/https://doi.org/10.1016/j.jbiotec.2015.05.002 Chen K, Zhao H, Wang Z, Zhou F, Lan M (2023) Sandwich-type electrochemical aptasensor based on polydopamine-Au-metal ions as signal label and coralloid Au-conductive carbon architecture-modified electrode for the simultaneous detection of cardiac troponin I and myoglobin. Sens Actuators B 390:134044. https://doi.org/https://doi.org/10.1016/j.snb.2023.134044 Mi X, Li H, Tan R, Feng B, Tu Y (2021) The TDs/aptamer cTnI biosensors based on HCR and Au/Ti 3 C 2 -MXene amplification for screening serious patient in COVID-19 pandemic. Biosens Bioelectron 192:113482. https://doi.org/https://doi.org/10.1016/j.bios.2021.113482 Karyakin AA (2001) Prussian blue and its analogues: Electrochemistry and Analytical Applications, 13(10) 813–819. https://doi.org/https://doi.org/10.1002/1521-4109(200106)13:10 Chu Z, Liu Y, Jin W (2017) Recent progress in Prussian blue films: Methods used to control regular nanostructures for electrochemical biosensing applications. Biosens Bioelectron 96:17–25. https://doi.org/https://doi.org/10.1016/j.bios.2017.04.036 Zhai J, Zhai Y, Wen D, Dong S, Behavior (2009) 21(20) 2207–2212. https://doi.org/https://doi.org/10.1002/elan.200904680 Jin E, Lu X, Cui L, Chao D, Wang C (2010) Fabrication of graphene/prussian blue composite nanosheets and their electrocatalytic reduction of H 2 O 2 . Electrochim Acta 55(24):7230–7234. https://doi.org/https://doi.org/10.1016/j.electacta.2010.07.029 Lai G, Zhang H, Yu A, Ju H (2015) situ deposition of Prussian blue on mesoporous carbon nanosphere for sensitive electrochemical immunoassay. Biosens Bioelectron 74:660–665. https://doi.org/https://doi.org/10.1016/j.bios.2015.07.026 Yang M, Wu X, Hu X, Wang K, Zhang C, Gyimah E, Yakubu S, Zhang Z (2019) Electrochemical immunosensor based on Ag + -dependent CTAB-AuNPs for ultrasensitive detection of sulfamethazine. Biosens Bioelectron 144:111643. https://doi.org/https://doi.org/10.1016/j.bios.2019.111643 Fan Y, Shi S, Ma J, Guo Y (2019) A paper-based electrochemical immunosensor with reduced graphene oxide/thionine/gold nanoparticles nanocomposites modification for the detection of cancer antigen 125. Biosens Bioelectron 135:1–7. https://doi.org/https://doi.org/10.1016/j.bios.2019.03.063 Aparicio C, Filip J, Machala L (2017) From Prussian blue to iron carbides: high-temperature XRD monitoring of thermal transformation under inert gases. Powder Diffr 32:S207–S212. https://doi.org/10.1017/S0885715617000471 Karastogianni S, Diamantidou D, Girousi S Selective voltammetric detection of ascorbic acid from rosa canina on a modified graphene oxide paste electrode by a manganese(II) complex, Biosensors 2021, 11(9), 294; https://doi.org/10.3390/bios11090294 Momeni F, Khoshfetrat SM, Zarei K (2023) Electrochemical sandwich-type aptasensor based on the multifunctional catechol-loaded Au/MIL-53(Fe) for detection of cardiac troponin I. ACS Appl Nano Mater 6(20):19239–19248. https://doi.org/10.1021/acsanm.3c03705 Zeng L, Lin C, Liu P, Sun D, Lu J (2023) Anisotropic aptamer-modified DNA tetrahedra/MOF nanoprobes for enhanced colorimetric aptasensing of cardiac troponin I. Chem Eng J 474:145525. https://doi.org/https://doi.org/10.1016/j.cej.2023.145525 Wang Z, Zhao H, Chen K, Cao S, Lan M (2023) Sandwich-type electrochemical aptasensor based on HMCS@PDA@AuNPs and PtCu DNs/MUN-CuO-TiO2 for ultrasensitive detection of cardiac troponin I. Sens Actuators B 393:134275. https://doi.org/https://doi.org/10.1016/j.snb.2023.134275 Mi X, Li H, Tu Y (2023) An aptamer biosensing strategy for label-free assay of dual acute myocardial infarction biomarkers built upon AuNPs/Ti 3 C 2 -MXenes. Chemosensors 11(3):157. https://doi.org/10.3390/chemosensors11030157 Song Z, Song J, Gao F, Chen X, Wang Q, Zhao Y, Huang X, Yang C, Wang Q (2022) Novel electroactive ferrocene-based covalent organic frameworks towards electrochemical label-free aptasensors for the detection of Cardiac Troponin I. Sens Actuators B 368:132205. https://doi.org/https://doi.org/10.1016/j.snb.2022.132205 Chen K, Zhao H, Wang Z, Zhou F, Shi Z, Cao S, Lan M (2022) Sandwich-type electrochemical aptasensor based on Au-modified conductive octahedral carbon architecture and snowflake-like PtCuNi for the sensitive detection of cardiac troponin I. Biosens Bioelectron 212:114431. https://doi.org/https://doi.org/10.1016/j.bios.2022.114431 Schemes Scheme 1 is available in the Supplementary Files section Additional Declarations No competing interests reported. Supplementary Files SupportingInformation.docx supplementaryfiles.docx Scheme1.png Scheme 1. Schematic diagram of the construction procedure of the Tro4/AuNPs/PB/PS/GCE aptamer sensor and its electrochemical sensing for cTnI. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4794692","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":340172391,"identity":"9eff1130-a6b3-4bd8-82ff-1aed06dca433","order_by":0,"name":"Liying Jiang","email":"","orcid":"","institution":"Zhengzhou University of Light Industry","correspondingAuthor":false,"prefix":"","firstName":"Liying","middleName":"","lastName":"Jiang","suffix":""},{"id":340172397,"identity":"70cc5564-df99-4f85-94c0-0c87ee4639a1","order_by":1,"name":"Dongyang Li","email":"","orcid":"","institution":"Zhengzhou University of Light Industry","correspondingAuthor":false,"prefix":"","firstName":"Dongyang","middleName":"","lastName":"Li","suffix":""},{"id":340172398,"identity":"fd364db3-10ed-4ce1-9000-8edca66e63f1","order_by":2,"name":"Mingxing Su","email":"","orcid":"","institution":"Zhengzhou University of Light Industry","correspondingAuthor":false,"prefix":"","firstName":"Mingxing","middleName":"","lastName":"Su","suffix":""},{"id":340172399,"identity":"ad1869b8-a4a4-4150-b38c-4c19e18841d2","order_by":3,"name":"Fenghua Chen","email":"","orcid":"","institution":"Zhengzhou University of Light Industry","correspondingAuthor":false,"prefix":"","firstName":"Fenghua","middleName":"","lastName":"Chen","suffix":""},{"id":340172400,"identity":"6eeb31cc-73ba-488d-b4b7-ea3ed26021db","order_by":4,"name":"Xiaomei Qin","email":"","orcid":"","institution":"Zhengzhou University of Light Industry","correspondingAuthor":false,"prefix":"","firstName":"Xiaomei","middleName":"","lastName":"Qin","suffix":""},{"id":340172401,"identity":"604617c2-00e3-418b-bec7-0f157ae1f5d2","order_by":5,"name":"Lan Wang","email":"","orcid":"","institution":"Zhengzhou University of Light Industry","correspondingAuthor":false,"prefix":"","firstName":"Lan","middleName":"","lastName":"Wang","suffix":""},{"id":340172402,"identity":"b3aafcbf-7e38-42e6-8f7b-10d292ab50b0","order_by":6,"name":"Yanghai Gui","email":"","orcid":"","institution":"Zhengzhou University of Light Industry","correspondingAuthor":false,"prefix":"","firstName":"Yanghai","middleName":"","lastName":"Gui","suffix":""},{"id":340172403,"identity":"4d77d23e-b8b1-4c72-9782-a09b9b2c8598","order_by":7,"name":"Jianbo Zhao","email":"","orcid":"","institution":"Zhengzhou University of Light Industry","correspondingAuthor":false,"prefix":"","firstName":"Jianbo","middleName":"","lastName":"Zhao","suffix":""},{"id":340172404,"identity":"d89b27d9-5ca0-4510-ae72-1facb2fb814c","order_by":8,"name":"Huishi Guo","email":"","orcid":"","institution":"Zhengzhou University of Light Industry","correspondingAuthor":false,"prefix":"","firstName":"Huishi","middleName":"","lastName":"Guo","suffix":""},{"id":340172405,"identity":"ea122249-0476-4f18-aed8-ea591055760a","order_by":9,"name":"Xiaoyun Qin","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA0UlEQVRIiWNgGAWjYJCCAwwVQJKdsYGBgY1oLWeAJDMpWhgY20BaQCxitBjcSN54uHBenb3BYeYGhg9lhxn4Zzfg1yI5I63g8MxtbMwGhxkbGGecO8wgcecAfi38EjkGh3m38bCBtDDzth1mMJBIwK+FDaxljgQPWMtfYrRAbGkwkABrYSRGi2TPs4LDPMcSDCSBWg72nEvnkbhBQIvB8eTNn3lq6uz5jrc/fPCjzFqOfwYBLQwCCQZw9gEg5iGgHgj4DxgQVjQKRsEoGAUjGwAAltg/DrQsH9gAAAAASUVORK5CYII=","orcid":"","institution":"Zhengzhou University of Light Industry","correspondingAuthor":true,"prefix":"","firstName":"Xiaoyun","middleName":"","lastName":"Qin","suffix":""},{"id":340172406,"identity":"8d2546c5-a18a-42e4-9b1f-ff00d0f52ab3","order_by":10,"name":"Zhen Zhang","email":"","orcid":"","institution":"Tianjin University","correspondingAuthor":false,"prefix":"","firstName":"Zhen","middleName":"","lastName":"Zhang","suffix":""}],"badges":[],"createdAt":"2024-07-24 10:44:11","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4794692/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4794692/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":63064768,"identity":"f7d91b95-cbe2-427c-bb13-fdd73f09c393","added_by":"auto","created_at":"2024-08-22 17:20:28","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":746949,"visible":true,"origin":"","legend":"\u003cp\u003eSEM images of (A) PS, (B) PB/PS, and (C) AuNPs/PB/PS microspheres. (D) EDAX spectrum of AuNPs/PB/PS. (E) The mapping images of a single sphere for AuNPs/PB/PS, (magenta) Au, (green) Fe, (red) C, and (yellow) O elemental spectra.\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-4794692/v1/d4bd62b72af3e4ba938ebc89.png"},{"id":63064451,"identity":"84b26167-a014-4a97-ac0e-f28ce8d531cf","added_by":"auto","created_at":"2024-08-22 17:12:28","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":49294,"visible":true,"origin":"","legend":"\u003cp\u003e(A) XRD pattern of AuNPs/PB/PS. (B) FT-IR spectra of PS, PB/PS, and AuNPs/PB/PS.\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-4794692/v1/2bcad169041e789052d71742.png"},{"id":63064454,"identity":"5c050d71-cea2-467f-aed6-337106ae8948","added_by":"auto","created_at":"2024-08-22 17:12:29","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":142679,"visible":true,"origin":"","legend":"\u003cp\u003e(A, B) CV curves and (C, D) EIS plots of (a) GCE, (b) PS/GCE, (c) PB/PS/GCE, (d) AuNPs/PB/PS/GCE. (C) CV curves and (D) EIS plots of (e) Tro4/AuNPs/PB/PS/GCE, (f) MCH/Tro4/AuNPs/PB/PS/GCE, and (g) cTnI/MCH/Tro4/AuNPs/PB/PS/GCE.\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-4794692/v1/c2184f37c90bdc77eb770694.png"},{"id":63064769,"identity":"0e5dd2ea-b146-40f9-b123-30011830b754","added_by":"auto","created_at":"2024-08-22 17:20:29","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":173953,"visible":true,"origin":"","legend":"\u003cp\u003eCV plots of (A) AuNPs/PB/PS/GCE and (B) AuNPs/PB/GCE at different scanning rates. From inward to outward: 10, 20, 40, 60, 80, 100, 150, 200, 300, 400, and 500 mV s\u003csup\u003e-1\u003c/sup\u003e. (C) Plot of the oxidation peak current versus the square root of the sweep rate (ν\u003csup\u003e1/2\u003c/sup\u003e) for the (a) AuNPs/PB/PS/GCE and (b) AuNPs/PB/GCE. (D) A histogram to compare the corresponding electrochemically active areas of GCE, AuNPs/PB/GCE, and AuNPs/PB/PS/GCE.\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-4794692/v1/bfec85f11b19c3c7ee10abc3.png"},{"id":63064452,"identity":"f2db7eb6-a8b1-4e9a-afce-5ae67c1acade","added_by":"auto","created_at":"2024-08-22 17:12:29","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":62937,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of different concentrations of KNO\u003csub\u003e3\u003c/sub\u003e on the peak current. (B) Effect of different incubation time of Tro4 on the peak current. (C) Effect of different blocking time of MCK on the peak current. (D) Effect of binding time between Tro4/AuNPs/PB/PS/GCE and cTnI on the peak current.\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-4794692/v1/44273ecd118441722037f156.png"},{"id":63064455,"identity":"bab033d7-7610-483b-83a6-f6d03efdbbbe","added_by":"auto","created_at":"2024-08-22 17:12:29","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":151029,"visible":true,"origin":"","legend":"\u003cp\u003e(A) Typical DPV current response of Tro4/AuNPs/PB/PS/GCE to a series of cTnI concentrations in 0.8 M KNO\u003csub\u003e3\u003c/sub\u003e solution (from inside to outside, 10 fg/mL, 0.1 pg/mL,1 pg/mL,10 pg/mL,0.1 ng/mL,1 ng/mL,10 ng/mL, 0.1 μg/mL,1.0 μg/mL). (B) The linear correlation between the current value and the negative logarithm of the cTnI concentration (-lg \u003cem\u003eC\u003c/em\u003e\u003csub\u003e[cTnI]\u003c/sub\u003e). (C) Selectivity and anti-interference performance of the aptamer sensor. (D) Stability of the sensor over a period of 15 days, with the error bars indicate the standard deviation (n = 5).\u003c/p\u003e","description":"","filename":"image7.png","url":"https://assets-eu.researchsquare.com/files/rs-4794692/v1/3f97a3068e3f5f6acfeac53c.png"},{"id":63065363,"identity":"05081c50-ef2a-49d6-a475-5261f5356293","added_by":"auto","created_at":"2024-08-22 17:28:29","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":140239,"visible":true,"origin":"","legend":"\u003cp\u003eThe feasibility of the aptamer sensor in simulated AMI samples.\u003c/p\u003e","description":"","filename":"image8.png","url":"https://assets-eu.researchsquare.com/files/rs-4794692/v1/782a6b073c81b518886a2363.png"},{"id":63187274,"identity":"92f1017e-a913-4ac8-b2a2-40655bbfddc4","added_by":"auto","created_at":"2024-08-24 13:41:46","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2055263,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4794692/v1/1b9cc029-d24b-4c89-a5f7-f99726c0f5ef.pdf"},{"id":63064771,"identity":"4b0cadb3-8b23-47b2-8bb9-6528d79c28a8","added_by":"auto","created_at":"2024-08-22 17:20:29","extension":"docx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":3322793,"visible":true,"origin":"","legend":"","description":"","filename":"SupportingInformation.docx","url":"https://assets-eu.researchsquare.com/files/rs-4794692/v1/b31f2917423cfdf18830b005.docx"},{"id":63064459,"identity":"0293a8c7-80c6-4332-8346-1ea7cadb566b","added_by":"auto","created_at":"2024-08-22 17:12:29","extension":"docx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":3322793,"visible":true,"origin":"","legend":"","description":"","filename":"supplementaryfiles.docx","url":"https://assets-eu.researchsquare.com/files/rs-4794692/v1/e0c4ff0f1757a25e3164de35.docx"},{"id":63064453,"identity":"2eb62eed-aba5-41b2-9427-f53b06a8e69d","added_by":"auto","created_at":"2024-08-22 17:12:29","extension":"png","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":193107,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eScheme 1\u003c/strong\u003e. Schematic diagram of the construction procedure of the Tro4/AuNPs/PB/PS/GCE aptamer sensor and its electrochemical sensing for cTnI.\u003c/p\u003e","description":"","filename":"Scheme1.png","url":"https://assets-eu.researchsquare.com/files/rs-4794692/v1/ae30dd9617d8b8a2fc885858.png"}],"financialInterests":"No competing interests reported.","formattedTitle":"A label-free electrochemical aptamer sensor for sensitive detection of cardiac troponin I based on AuNPs/PB/PS/GCE","fulltext":[{"header":"1 Introduction","content":"\u003cp\u003eCardiovascular disease (CVD) is the leading cause of death worldwide, accounting for approximately 31% of all deaths, which includes angina, acute myocardial infarction (AMI), unstable angina, and heart failure[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Specifically, AMI is believed to be the leading cause of death in people with cardiovascular disease [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The \"golden\" window for thrombolysis and interventional therapy is 1\u0026thinsp;~\u0026thinsp;3 hours after AMI onset, which means that rapid diagnosis of early AMI is key to treatment [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Traditional diagnosis of AMI is based on angina symptoms, electrocardiography, and biomarker testing [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], with biomarkers being particularly important in identifying patients with atypical presentation (\u003cem\u003ei.e.\u003c/em\u003e, no chest pain or no ST-segment elevation on the electrocardiographic) [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. A number of indicators, including myoglobin, c-reactive protein, lactate dehydrogenase, and cardiac troponin I (cTnI), have proved useful in the assessment of AMI [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Among various biomarkers, cTnI is considered the \"gold standard\" for early diagnosis of AMI because of its high clinical sensitivity and specificity for cardiac tissue, as well as its ability to reflect small areas of myocardial necrosis or ischemia [\u003cspan additionalcitationids=\"CR10\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. When an AMI occurs, serum cTnI concentrations rise within 12 hours and remain elevated level for 5\u0026thinsp;~\u0026thinsp;9 days [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. In healthy individuals, cTnI concentrations are typically below 0.4 ng/mL, while levels above 2.0 ng/mL are associated with an increased risk of possible future major cardiac events [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eNumerous techniques, including fluorescent [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e], colorimetric [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e], and electrochemical [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e], have been developed for the detection of cTnI. One of the most commonly used clinical techniques is the enzyme-linked immunosorbent assay (ELISA), which is specific and sensitive, but has a long detection time and results are affected by many factors [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. While electrochemical methods have the advantages of rapid response, low cost, time savings and high sensitivity [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. The majority of electrochemical methods for cTnI detection rely on antibody-antigen interactions, but suffer from poor stability, low robustness, and high cost. Dorraj \u003cem\u003eet al.\u003c/em\u003e [\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e] screened four DNA aptamers against the cTnI protein through a systematic evolution of ligands by exponential enrichment (SELEX) method which has high binding affinity with dissociation constants (\u003cem\u003eK\u003c/em\u003e\u003csub\u003ed\u003c/sub\u003e) in the nanomolar range. Jo \u003cem\u003eet al\u003c/em\u003e. [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e] further selected the Tro4 aptamer for cTnI with a very low \u003cem\u003eK\u003c/em\u003e\u003csub\u003ed\u003c/sub\u003e value (270 pM) compared with that of a cTnI antibody (20.8 nM). Aptamer can be used as an alternative to antibody in the determination of cTnI because they overcome the limitations of antibodies, eliminate the ethical concerns associated with animal or human products, ensure no batch-to-batch variation, and allow selection under non-physiological conditions [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003ePrussian blue (PB, ferric hexacyanoferrate) is often used as a signal indicator because of its ease of synthesis, low cost, no electroactive molecules kinetic diffusion, and high physical stability. In addition, as a metal complex, PB has higher chemical stability and can ensure the continuous output of the signal, thereby improving the durability and reproducibility of the sensor. PB is typically chemically synthesized in a conventional manufacturing process by a mixed reaction of ferric and hexacyanoferrates with different oxidation state of iron ions [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. The reaction proceeds too fast, resulting in an inability to regulate the size and shape of the formed PB crystals to guarantee high reproducibility [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. It was found that some carbon nanomaterials, such as carbon nanotubes [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], graphene [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], and carbon nanospheres [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e], have proven to be effective platforms to support PB synthesis. The present work attempts to explore polystyrene (PS) microspheres as a substrate to support the electrodeposition of PB, as well as provide a large surface area to overcome aggregation and improve biopolymer stabilization. In order to improve the catalytic ability and amplify the electrochemical signals, gold nanoparticles (AuNPs) are widely used in the construction of electrochemical biosensors due to their good biocompatibility and ease of functionalization [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Various bioreceptors such as DNA, enzyme, antibody could be attached to the surface of gold nanomaterials through Au-S bond or chelation with amino and carboxyl groups.\u003c/p\u003e \u003cp\u003eHerein, we designed a label-free electrochemical aptamer sensor for the sensitive detection of cTnI based on AuNPs/PB/PS modified glassy carbon electrode (GCE), where PB and AuNPs were successively electrodeposited on the PS microspheres modified GCE (Scheme \u003cspan refid=\"Sch1\" class=\"InternalRef\"\u003e1\u003c/span\u003e). The thiol-functionalized aptamer Tro4 was chemically linked to the AuNPs/PB/PS/GCE through Au-S bond. The constructed electrochemical aptamer sensor was then subjected to sensitive detection of cTnI with a wide detection range of 10 fg/mL\u0026thinsp;~\u0026thinsp;1.0 \u0026micro;g/mL and a low limit of detection of 2.03 fg/mL under the optimal conditions. Furthermore, the reliable anti-interference and detectability in serum samples were confirmed, indicating its promising application toward early diagnosis of cardiovascular diseases.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"2 Experimental section","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Chemicals and apparatus\u003c/h2\u003e \u003cp\u003eCardiac troponin I (cTnI), cardiac troponin T (cTnT), hemoglobin (Hb), myoglobin (Myo) were obtained from Wuhan Yunclone Technology Co Ltd. Aptamer (Tro4, SH-(C6)-5'- CGTGCAGTACGCCAACCTTTCTCATGCGCTGCCCCCCTCTTA), was purchased from Shanghai Sangong Bioengineering Co. Ltd. Tris (hydroxymethyl) aminomethane (Tris-HCl) was supplied by Sinopharm Chemical Reagent Co. Ltd. Styrene (C\u003csub\u003e8\u003c/sub\u003eH\u003csub\u003e8\u003c/sub\u003e) was purchased from Shanghai McLean Biochemistry \u0026amp; Technology Co. Ltd. Chloroauric acid (HAuCl\u003csub\u003e4\u003c/sub\u003e), 6-mercaptohexanol (MCH), sodium hydroxide (NaOH), polyvinylpyrrolidone (PVP), K\u003csub\u003e3\u003c/sub\u003e[Fe(CN)\u003csub\u003e6\u003c/sub\u003e ], FeCl\u003csub\u003e3\u003c/sub\u003e∙6H\u003csub\u003e2\u003c/sub\u003eO, KCl, KNO\u003csub\u003e3\u003c/sub\u003e, HCl, ethanol, and MgCl\u003csub\u003e2\u003c/sub\u003e were purchased from Shanghai Aladdin Biochemical Technology Co., Ltd. Ultrapure water with resistivity\u0026thinsp;\u0026gt;\u0026thinsp;18 ΩM was provided by an ELGA Biochemistry ultrapure water machine. All the chemical reagents used in this experiment were analytically pure and used as received. All data in the paper were measured three times to obtain error bars.\u003c/p\u003e \u003cp\u003eAll electrochemical measurements were performed on a CH Instruments model 760E electrochemical analyzer (CH Instruments, Inc., Shanghai). For electrochemical detection, the traditional three-electrode system was used: GCE with a diameter of 6 mm was used as the working electrode, the reference electrode was Ag/AgCl, the auxiliary electrode was platinum column plate. The electrochemical measurement methods used included cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS), and differential pulse voltammetry (DPV). The electrochemical measurements of CV were carried out in 0.1 M PBS containing 5 mM [Fe(CN)\u003csub\u003e6\u003c/sub\u003e]\u003csup\u003e3-/4-\u003c/sup\u003e solution (pH\u0026thinsp;=\u0026thinsp;7.4), a potential range of -0.2\u0026thinsp;~\u0026thinsp;0.6 V was selected for the measurements to observe the redox peaks, with a step potential of 0.01 V and a potential scanning rate of 100 mV/s. EIS was performed in 0.1 M PBS with 5 mM [Fe(CN)\u003csub\u003e6\u003c/sub\u003e]\u003csup\u003e3-/4-\u003c/sup\u003e (pH\u0026thinsp;=\u0026thinsp;7.4), with a frequency range of 0.1 Hz to 100 kHz, an amplitude of 5 mV and an open-circuit potential of -0.2 V.\u003c/p\u003e \u003cp\u003eThe morphology of the modified electrodes was characterized by scanning electron microscopy (SEM, JSM-60, JEOL, Japan) operating at the accelerating voltage of 20 kV. Energy dispersive X-ray analysis (EDAX) was performed using a JSM-60 equipped with an Oxford Extreme windowless EDX detector. XRD was carried out using a Rigaku Dmax-2500 X-ray diffractometer with Cu Ka radiation (λ\u0026thinsp;=\u0026thinsp;1.54 \u0026Aring;) at 50 kV and 200 mA at a scanning rate of 5 \u0026deg;/min. A Fourier transform infrared spectrometer (vertex70, Brock instruments, Germany) was employed to obtain Fourier transform infrared spectra (FT-IR).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Preparation of PS microspheres\u003c/h2\u003e \u003cp\u003ePS microspheres were synthesized by emulsion polymerization method. In a three-necked flask, 80 g of ethanol was added, and then 1.44 g of PVP was added. After the PVP was completely dissolved, the temperature was raised to 70\u0026deg;C, and 15 g of styrene monomer was added, and after stirring for 10 min to disperse the styrene uniformly, the initiator azobisisobutyronitrile (AIBN) was added to initiate the polymerization of the styrene monomer, and the temperature was kept constant under a nitrogen atmosphere for 10 h. The prepared PS solution was centrifuged (8000 rpm) for 5 min to remove the float, and the resulting precipitate was added to 50 mL of ethanol to redisperse by ultrasonic treatment. The precipitates were collected, weighed, and dispersed in ethanol with a mass concentration of 1 mg/mL.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Preparation of AuNPs/PB/PS/GCE\u003c/h2\u003e \u003cp\u003ePrior to modification, the bare GCE was successively polished with 1.0 \u0026micro;m, 0.3 \u0026micro;m, and 0.05 \u0026micro;m Al\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e3\u003c/sub\u003e powder. It was then subjected to 15 CV scans in 0.5 M H\u003csub\u003e2\u003c/sub\u003eSO\u003csub\u003e4\u003c/sub\u003e with a potential window of -0.5 V\u0026thinsp;~\u0026thinsp;1.8 V at a scan rate of 100 mV/s to activate the electrode. Finally, the electrode surface was dried with a N\u003csub\u003e2\u003c/sub\u003e blow dryer. To obtain PS/GCE, 5 \u0026micro;L of PS solution was applied dropwise to the GCE, dried in a desiccator, and then the surface was cleaned with ultrapure water. The PS/GCE was immersed in a mixed solution consisting of 1 mM K\u003csub\u003e3\u003c/sub\u003e[Fe(CN)\u003csub\u003e6\u003c/sub\u003e ], 1 mM FeCl\u003csub\u003e3\u003c/sub\u003e∙6H\u003csub\u003e2\u003c/sub\u003eO, 0.1 M KCl, 0.92 mM CTAB and 0.02 mM HCl. The PB film was electrodeposited by conducting CV scanning for 15 runs in the potential range of 0 V\u0026thinsp;~\u0026thinsp;1.0 V at a rate of 50 mV/s. The obtained PB/PS/GCE was then placed in 1 mM HAuCl\u003csub\u003e4\u003c/sub\u003e solution and subjected to 20 runs of CV cycles scanning from \u0026minus;\u0026thinsp;0.5 V to 0 V for the electrodeposition of AuNPs on the electrode at a scanning rate of 100 mV/s. The electrode was rinsed with ultrapure water to obtain AuNPs/PB/PS/GCE.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Preparation of Tro4/AuNPs/PB/PS/GCE\u003c/h2\u003e \u003cp\u003eThe AuNPs/PB/PS/GCE was immersed in a buffer solution (20 mM Tris-HCl, 5 mM MgCl\u003csub\u003e2\u003c/sub\u003e, and 50 mM NaCl, pH\u0026thinsp;=\u0026thinsp;7.4) containing 1 \u0026micro;M Tro4 and incubated at 4℃ for 6 h to produce Tro4/AuNPs/PB/GCE. Then, the modified electrode was washed with 20 mM Tris-HCl buffer to remove the unbound aptamer, and then 10 \u0026micro;L of 1 mM MCH solution was added to the surface of the Tro4/AuNPs/PB/GCE to block the non-specific active site on the electrode surface.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Electrochemical detection of cTnI\u003c/h2\u003e \u003cp\u003eAn immersion method was used to investigate the sensing performance of the Tro4/AuNPs/PB/PS/GCE aptamer sensor in this experiment for the target cTnI. The constructed sensors were immersed in various cTnI concentrations ranging from 10 fg/mL to 1.0 \u0026micro;g/mL and incubated at 37\u0026deg;C for 1 h. Then, the electrodes were washed with deionized water and the electrochemical signals were recorded using DPV analysis mode in 0. 8 M KNO\u003csub\u003e3\u003c/sub\u003e solution with a potential range from \u0026minus;\u0026thinsp;0.2 to 0.6 V, a modulation amplitude of 50 mV, a step potential of 4 mV, an experimental pulse period of 0.5 s, and an experimental pulse width of 0.05 s.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Real sample analysis\u003c/h2\u003e \u003cp\u003eTo further investigate the ability of the aptamer sensor to analyze real samples, we used the standard addition method in serum for further investigation the sensing performance. Human serum albumin samples were obtained from Beijing Solarbio Life Sciences Ltd. 20 mM Tris-HCl, 150 mM NaCl (pH 7.4) were used to dilute the serum to 10% as a buffer for the detection of cTnI. Then various concentrations of cTnI were spiked to the serum dilution to simulate AMI patients and healthy individuals. The constructed Tro4/AuNPs/PB/PS/GCE aptamer sensors were immersed in the spiked serum dilution and incubated at 37\u0026deg;C for 1 h. Then, the electrodes were washed with deionized water and the electrochemical signals were recorded using the DPV method as described above.\u003c/p\u003e \u003c/div\u003e"},{"header":"3 Results and Discussion","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e3.1 Characterization of AuNPs/PB/PS/GCE\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eSEM and EDAX were employed to investigate the morphology and element distribution of the modified electrodes. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA exhibited the smooth PS microspheres with diameters ranging from 4 to 9 \u0026micro;m. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB displayed the morphology of the PS-modified electrode after an electrodeposition treatment in a mixed solution of ferric chloride and potassium ferricyanide, and the localized zoomed image shown in the red dashed box indicated that the smooth surface of the PS microsphere was uniformly covered with a layer of rough PB nanoparticles. The EDAX spectrum and elemental mapping images further indicated the successful fabrication of PB/PS as shown in Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e, where Fe element was adhered to the electrode surface. The morphology obtained by further electrodeposition of AuNPs on PB/PS/GCE is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC, where denser nanoparticles covering the microsphere surface can be observed. Due to the better conductivity of the AuNPs, the obtained AuNPs/PB/PS product has a better contrast, resulting in a sharper image. Figure\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD exhibited the EDAX spectrum of AuNPs/PB/PS, indicating the presence of C, N, O, Fe, and Au elements. The elemental mapping images for Au, Fe, C, O were collected as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, from which Au can be found on the surface of the sphere, further confirming the successful preparation of AuNPs/PB/PS nanostructure.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe XRD pattern and FT-IR spectra of the modified electrode are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e to characterize the structure and surface chemical state. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA, the presence of PS microspheres resulted in a strong and broad background peak around ~\u0026thinsp;21\u0026deg; in the XRD pattern of AuNPs/PB/PS, attributed to the amorphous carbon structure. It can be observed that the diffraction peaks at 38\u0026deg;, 44\u0026deg;, 65\u0026deg;, and 78\u0026deg; can be assigned to (111), (200), (220), and (311) faces of metallic Au (PDF#04-0784). The peaks around 28\u0026deg;, 55\u0026deg; were attributed to PB [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. The FT-IR spectra of PS, PB/PS, AND AuNPs/PB/PS were shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB. The absorption peaks at 2976 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, 2846 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, and 1463 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e can be assigned to the asymmetric, symmetric stretching vibration, and bending vibration of C-H in the PS, respectively. The moderate peak at 720 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was a typical out-of-plane bending vibration of C-H in the \u0026ndash;(CH\u003csub\u003e2\u003c/sub\u003e)\u003csub\u003en\u003c/sub\u003e\u0026ndash; chain in PS. Compared with PS, PB/PS and AuNPs/PB/PS exhibited an additional absorption peak at 2363 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, which can be attributed to the C\u0026thinsp;\u0026equiv;\u0026thinsp;N stretching vibration in the formed [Fe(II)-CN-Fe(III)] structure, indicating the successful electrodeposition of PB on the PS surface. The broad and moderately intensity absorption peak at ~\u0026thinsp;3393 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e can be attributed to the -NH stretching vibration, which disappeared after the deposition of AuNPs, suggesting that the additional AuNPs can be anchored on the PB/PS surface by bonding of Au with -NH leads to the disappearance of this peak. Based on the XRD and FT-IR results, it was shown that both PB and AuNPs were successfully electrodeposited on the PS surface.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Characterization of the electrochemical aptamer sensor\u003c/h2\u003e \u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e, electrochemical measurements using CV and EIS techniques were performed on bare and modified GCEs in 0.1 M PBS solution containing 5 mM [Fe(CN)\u003csub\u003e6\u003c/sub\u003e]\u003csup\u003e3\u0026minus;/4\u0026minus;\u003c/sup\u003e as the redox-active couple to evaluate the modification processes of the modified electrodes. It can be observed that after modification of PS microspheres (curve b), the redox peak current was significantly decreased compared to the bare GCE (curve a) due to the poor conductivity of PS to hinder the charge transfer between the redox ions and the electrode (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). The electrodeposition of PB layer on PS/GCE (curve c) resulted in an increase of the peak current because of the good electrical conductivity of PB. Further electrodeposition of AuNPs (curve d) greatly increased the peak current from 0.068 mA (PB/PS/GCE) to 0.178 mA (AuNPs/PB/PS/GCE), indicating that the prepared modified electrode has a sensitive response due to the excellent conductivity of AuNPs and a more continuous microsurface to ensure the unobstructed electron transport path. The surface of the AuNPs/PB/PS/GCE was immobilized with the 5\u0026prime;-thiol-Tro4 aptamer (curve e) probes through Au-S bonds and subsequently blocked with MCH (curve f) to prevent non-specific binding (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). The insulating organic matter would impede the electron transfer and cause a current decrease in the redox peaks, and the sealer MCH further decrease the peak current. The feasibility of the electrochemical aptamer sensor was illustrated by incubating the MCH/Tro4/AuNPs/PB/PS/GCE with the target. In the presence of cTnI (curve g), Tro4 specifically bonded to the protein molecule, thereby preventing the access of [Fe(CN)\u003csub\u003e6\u003c/sub\u003e]\u003csup\u003e3\u0026minus;\u003c/sup\u003e/[Fe(CN)\u003csub\u003e6\u003c/sub\u003e]\u003csup\u003e4\u0026minus;\u003c/sup\u003e to the electrode surface. Consequently, a decrease of the redox peak current was observed, which reflected the existence of the target cTnI. Therefore, the designed aptamer sensor is capable of highly sensitive electrochemical detection of cTnI.\u003c/p\u003e \u003cp\u003eEIS serves as a common technique to assess electron transfer capabilities. Nyquist plots accompanied with a Randles model equivalent circuit were shown in the inset in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC and D, where R\u003csub\u003ect\u003c/sub\u003e, R\u003csub\u003es\u003c/sub\u003e, C\u003csub\u003edl\u003c/sub\u003e and Z\u003csub\u003eW\u003c/sub\u003e represent the charge transfer resistance, the solution resistance, the double-layer capacitance and the Warburg resistance, respectively. In the Nyquist plot, the diameter of the semicircular portion appearing in the high-frequency region indicates the electron-transfer-limited process, whose diameter is equal to the charge-transfer resistance. It can be included that the Nyquist plot analysis validated the CV results. AuNPs/PB/PS/GCE (curve d) had the best electrical conductivity and the lowest R\u003csub\u003ect\u003c/sub\u003e value compared to bare GCE (curve a), PS/GCE (curve b), and PB/PS/GCE (curve c). The introduction of AuNPs also provided efficient anchoring sites for aptamer to capture target protein. When Tro4, MCH and cTnI (curve e-g) were sequentially modified on the AuNPs/PB/PS/GCE surface, electron transfer between the solution and the electrode was delayed and their corresponding R\u003csub\u003ect\u003c/sub\u003e values increased.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn order to investigate the electrochemical active area of the modified electrodes, we performed the CV measurements on Au/PB/PS/GCE and Au/PB/GCE electrodes in 0.1 M PBS containing 5 mM [Fe(CN)\u003csub\u003e6\u003c/sub\u003e ]\u003csup\u003e3\u0026minus;/4\u0026minus;\u003c/sup\u003e with increasing sweep rates from 10 mV s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e to 500 mV s\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, B). As scanning speed increased, the redox peak current signal increased as well. The data presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC indicated that the oxidation peak current \u003cem\u003eI\u003c/em\u003e\u003csub\u003ep\u003c/sub\u003e was directly proportional to the quadratic root of the scanning speed \u003cem\u003ev\u003c/em\u003e\u003csup\u003e1/2\u003c/sup\u003e. This suggested that a diffusion-controlled process both existed in the Au/PB/PS/GCE and Au/PB/GCE electrodes. The Randles-Sevcik equation can be used to determine the constructed electrode's electrochemically active area [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]:\u003c/p\u003e \u003cp\u003e\u0026#119868;\u0026#119901; = 2.69 \u0026times; 10\u003csup\u003e5\u003c/sup\u003e\u0026#119899;\u003csup\u003e3/2\u003c/sup\u003eA\u0026#119863;\u003csup\u003e1/2\u003c/sup\u003e\u0026#119907;\u003csup\u003e1/2\u003c/sup\u003e\u003c/p\u003e \u003cp\u003ewhere \u003cem\u003eI\u003c/em\u003e\u003csub\u003ep\u003c/sub\u003e is the peak current (A), \u003cem\u003en\u003c/em\u003e is the number of transferred electrons (\u003cem\u003en\u003c/em\u003e\u0026thinsp;=\u0026thinsp;1), \u003cem\u003eA\u003c/em\u003e is the electrochemically active area of the electrode (cm\u003csup\u003e2\u003c/sup\u003e), \u003cem\u003eD\u003c/em\u003e is the diffusion coefficient of [Fe(CN)\u003csub\u003e6\u003c/sub\u003e] \u003csup\u003e3\u0026minus;/4\u0026minus;\u003c/sup\u003e (cm\u003csup\u003e2\u003c/sup\u003e/s), \u003cem\u003eC\u003c/em\u003e is the concentration of the reactant (mol/L), and \u003cem\u003eν\u003c/em\u003e is the scan rate (V/s). As shown in Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e, the current response of the bare GCE electrode was the smallest and become larger after modification of PB and AuNPs due to their excellent conductivity. Figure\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD compared the electrochemically active areas in a histogram for bare GCE, AuNPs/PB/GCE, and AuNPs/PB/PS/GCE, from which we could find that AuNPs/PB/PS/GCE performs best. The AuNPs/PB/GCE exhibited higher electrochemically active area of 0.0622 cm\u003csup\u003e2\u003c/sup\u003e than that of bare GCE of 0.055 cm\u003csup\u003e2\u003c/sup\u003e. Additional PS microspheres further introduced a larger electrochemically active area of 0.0759 cm\u003csup\u003e2\u003c/sup\u003e, suggesting that the introduction of PS microspheres in the modified electrode would increase the surface roughness and provide a larger surface area.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Optimization of experimental conditions\u003c/h2\u003e \u003cp\u003eThe electrodeposition cycles for PB and AuNPs on the PS/GCE were investigated to optimize the preparation parameters. Figure S3 displayed the CV plot for a cycle number of 25 turns in the electrodeposition of PB, illustrating the good redox peak signals of the PB electrodeposited on the electrode surface. As the number of cycles increased, the redox peak current also increased. The responses that take place during the process are,\u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003e4 FeCl + 3 K[Fe(CN)] → Fe[Fe(CN)] (PB)↓ + 12 KCl\u003c/h3\u003e\n\u003cp\u003eThe redox peak current did not increase and retained a strong electrochemical signal after 15 cycles of scanning. Consequently, electrodeposition of 15 cycles was determined to be the ideal condition for electrodeposited PB in this experiment. The performance of the modified electrode was also influenced by the quantity of the electrodeposited AuNPs at different cycles, as shown in Figure S4. As the number of electrodeposition cycles increased, the AuNPs continued to grow on the electrode surface and the redox current became larger and larger. However, when the number of AuNPs increased until the nanoparticles were clustered together, the specific surface area began to decrease, resulting in a decrease in the active area of the electrode as well. This was why the peak current was biggest when 15 cycles, and it decreased when the number of gold plating cycles was 20 cycles. Therefore, electrodeposition of 15 cycles was determined to be the ideal condition for electrodeposited AuNPs in this experiment.\u003c/p\u003e \u003cp\u003eIn order to obtain the best performance of the electrochemical biosensor, the following experimental conditions were optimized, including the concentration of K\u003csup\u003e+\u003c/sup\u003e, the incubation time of Tro4, MCH, and the target cTnI. As shown in Scheme \u003cspan refid=\"Sch1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, the sensing mechanism of cTnI was based on an ion barrier effect that the specific binding of cTnI could block the electrode surface and hinder the reaction between K\u003csup\u003e+\u003c/sup\u003e and PB to form Prussian white (PW) following the reaction below,\u003c/p\u003e \u003cp\u003eFe\u003csub\u003e4\u003c/sub\u003e[Fe(CN)\u003csub\u003e6\u003c/sub\u003e]\u003csub\u003e3\u003c/sub\u003e (PB)\u0026thinsp;+\u0026thinsp;4e\u003csup\u003e\u0026minus;\u003c/sup\u003e + 4K\u003csup\u003e+\u003c/sup\u003e \u0026rarr; K\u003csub\u003e4\u003c/sub\u003eFe\u003csub\u003e4\u003c/sub\u003e[Fe(CN)\u003csub\u003e6\u003c/sub\u003e]\u003csub\u003e3\u003c/sub\u003e (PW)\u003c/p\u003e \u003cp\u003eTherefore, the concentration of K\u003csup\u003e+\u003c/sup\u003e should be optimized to get a more sensitive detection signal. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA, as the concentration of the KNO\u003csub\u003e3\u003c/sub\u003e solution increased, the redox peak current increased while the potential difference decreased due to the redox reaction between PB and PW. With the increasement of K\u003csup\u003e+\u003c/sup\u003e concentration, more Fe\u003csup\u003e3+\u003c/sup\u003e ions participated in the reaction, which then accelerated the chemical reaction rate and improved the redox reversibility. Finally, the current signal increased. According to the Nernst formula,\u003c/p\u003e \u003cp\u003e \u003cem\u003eE\u003c/em\u003e\u0026thinsp;=\u0026thinsp;\u003cem\u003eE\u003c/em\u003e\u003csup\u003eθ\u003c/sup\u003e + (0.0592/\u003cem\u003en\u003c/em\u003e) ln([Fe\u003csup\u003e3+\u003c/sup\u003e]/[Fe\u003csup\u003e2+\u003c/sup\u003e])\u003c/p\u003e \u003cp\u003ewith the increasement of the concentration of K\u003csup\u003e+\u003c/sup\u003e, the concentration of Fe\u003csup\u003e3+\u003c/sup\u003e involved in the reaction increased, the value of [Fe\u003csup\u003e3+\u003c/sup\u003e]/[Fe\u003csup\u003e2+\u003c/sup\u003e] became larger, and the potential moved forward, so that the potential difference of the redox peak decreased. When the concentration of KNO\u003csub\u003e3\u003c/sub\u003e was above 0.8 M, the redox peak signal reached the maximum, indicating that the reaction has reached the saturation state. The potential difference of the redox peak was less than 60 mV, demonstrating the good redox reversibility of PB. Therefore, 0.8 M KNO\u003csub\u003e3\u003c/sub\u003e solution was selected as the detection medium for cTnI. The AuNPs/PB/PS/GCE were immersed in 1 \u0026micro;M Tro4 buffer solution for different durations to optimize the Tro4 incubation time. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB, the DPV response signal of the modified electrode gradually decreased with increasing immersion time. The peak current reached a plateau and remained when the incubation time exceeded 6 hours. Therefore, 6 hours of incubation with Tro4 was selected for the following sensing measurements. Similarly, the incubation time of MCH to block the non-specific active site on the electrode surface was also investigated by immersing Tro4/AuNPs/PB/PS/GCE in 1 mM MCH solution. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC, the DPV signals decreased with increasing immersion time. The optimal blocking time for MCH was selected to be 60 minutes based on timesaving and acceptable sensitivity. The ideal hybridization time between Tro4/AuNPs/PB/PS/GCE and cTnI was investigated as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD. The DPV signals decreased continuously with the incubation time of cTnI and remained unchanged after 60 minutes. Therefore, 60 minutes of incubation with cTnI was chosen for the following sensing measurements.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Detection of cTnI\u003c/h2\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eWith the optimized parameters, electrochemical analyses were performed in triplicate for each concentration of cTnI. The constructed Tro4/AuNPs/PB/PS/GCE that prehybridized with different concentrations of cTnI were placed in 0.8 M KNO\u003csub\u003e3\u003c/sub\u003e solution to detect the electrochemical signal by DPV, as shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA. The peak currents of DPV gradually decreased as the concentration of cTnI increased, and this was explained by the fact that the specific binding of Tro4 to cTnI would further inhibit the K\u003csup\u003e+\u003c/sup\u003e reaction with PB, thereby blocking the reduction of PB (Fe\u003csup\u003e3+\u003c/sup\u003e) to PW (Fe\u003csup\u003e2+\u003c/sup\u003e). The plotted calibration curve presented in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB exhibited that a linear relationship between the peak value of DPV and the negative logarithm of the concentration of the cTnI in the range of 10 fg/mL to 1.0 \u0026micro;g/mL. The linear equation can be described as \u003cem\u003eI\u003c/em\u003e = -2.99\u0026#128936;10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e lg\u003cem\u003eC\u003c/em\u003e-7.21\u0026#128936;10\u003csup\u003e\u0026minus;\u0026thinsp;5\u003c/sup\u003e (R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.996), and the detection of limit (LOD) was determined to be 2.03 fg/mL (S/N\u0026thinsp;=\u0026thinsp;3). The analytical performance of the constructed Tro4/AuNPs/PB/PS/GCE sensor was compared with previously reported literature in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e, \u003cspan additionalcitationids=\"CR30 CR31 CR32 CR33\" citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. It can be concluded that our sensor was easy to prepare and exhibited comparable analytical performance with previously reported electroanalytical methods. To investigate the selectivity of the developed aptamer sensor, a series of proteins such as hemoglobin (HB), bovine serum albumin (BSA), myoglobin (MYO), and cTnT were used for comparison. The concentration of all the interferents was chosen as 1 ng/mL, while cTnI was selected as 0.1 ng/mL. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC, the aptamer sensor for interferers showed negligible change in current response compared to cTnI, indicating good selectivity for cTnI detection. Furthermore, the anti-interference performance of the aptamer sensor was also investigated by analyzing Tro4/AuNPs/PB/GCE in different mixed solutions of cTnI (0.1 ng/mL) with other interferents (1 ng/mL). As presented in the plotted histogram in the latter part of Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC, there was no significant change in the current signal of the sensor after incubation of these mixtures compared to the target cTnI alone, indicating a good anti-interference performance for the determination of cTnI. In addition, the reproducibility of the Tro4/AuNPs/PB/PS/GCE sensor was evaluated for five separately fabricated aptamer sensors on consecutive 15 days. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD, intra-assay reproducibility was confirmed by the fact that the five sensors showed almost identical current response to a 10 ng/mL cTnI under the same experimental conditions with a relative standard deviation (RSD) of 3.6%. The sensors were then stored at 4\u0026deg;C for 15 days, and the DPV responses were collected every two days. The data show that the current response decreased only slightly after 15 days, and the aptamer sensor retained approximately 96% of the initial current response compared to freshly prepared electrodes, confirming the satisfactory stability of the proposed sensor.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eComparison of the sensing performance of various biosensors for the detection of cTnI.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"4\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eElectrode material\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eLinear range\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eLOD\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRef.\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003ePDA-Au-Pb\u003csup\u003e2+\u003c/sup\u003e/Cu\u003csup\u003e2+\u003c/sup\u003e/Tro6\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1 \u0026micro;g/mL-0.01 pg/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e3.8 fg/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTro4-CC/Au/MIL-53(Fe)\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e2 pg/mL-150 ng /mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.5 pg/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eFe\u003csub\u003e3\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003e-Au-TAPT-TDNs\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.05 ng/mL-100 ng/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e27 pg/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eHMCS@PDA@AuNPs PtCu DNs/MUN-CuO-TiO\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.01 pg/mL-500.0 ng/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.3 fg/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAuNPs/Ti\u003csub\u003e3\u003c/sub\u003eC\u003csub\u003e2\u003c/sub\u003e-MXene\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e24.24 fg/mL-3 ng/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e0.14 fg/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eCSA/MCH/Fc-COFNs-MBA/AuE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10 fg/mL-10 ng/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.6 fg/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAu/Zr\u0026ndash;C/PtCuNi\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e100 ng/mL-0.01 pg/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e1.24\u0026times;10\u003csup\u003e\u0026minus;\u0026thinsp;3\u003c/sup\u003epg/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003e[\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTro4/AuNPs/PB/PS/GCE\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10 fg/mL \u0026minus;\u0026thinsp;1ug/mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003e2.03 fg /mL\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c4\"\u003e \u003cp\u003eThis work\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e3.5 Real sample analysis\u003c/h2\u003e \u003cp\u003eTo validate the practical application of the proposed aptamer sensor for the determination of the cTnI in the real samples, the Tro4/AuNPs/PB/PS/GCE-based sensing system was analyzed in spiked human serum samples by using the standard addition method. Different amounts of cTnI were added to the serum samples to simulate the healthy individuals, mild cases, and severe patients. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e, there was a clear demarcation of peak current values between patients and normal subjects. The spike recovery assays of the cTnI were also performed using human serum samples diluted 10-fold with 20 mM Tris-HCl (pH 7.4) solution. The results presented in Table\u0026nbsp;\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e demonstrated that the proposed aptamer sensor exhibited excellent capability in determining cTnI in the real samples. Meanwhile, the recovery rates were in the range of 101.3\u0026ndash;104%, and the RSD ranges were from 2.7\u0026ndash;4.7%.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ecTnI recovery test in diluted human serum samples.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"5\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c4\" colnum=\"4\"\u003e\u003c/div\u003e \u003cdiv align=\"char\" char=\".\" class=\"colspec\" colname=\"c5\" colnum=\"5\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eSamples\u003c/p\u003e \u003cp\u003eNo.\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAdded(ng/mL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eMeasured(ng/mL)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c4\"\u003e \u003cp\u003eRecovery rate(%,n\u0026thinsp;=\u0026thinsp;3)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c5\"\u003e \u003cp\u003eRSD (%,n\u0026thinsp;=\u0026thinsp;3)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e0.1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e0.10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e102.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e2.7%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e1.04\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e104.0%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4.7%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e3\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003e10\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c3\"\u003e \u003cp\u003e10.13\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c4\"\u003e \u003cp\u003e101.3%\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"char\" char=\".\" colname=\"c5\"\u003e \u003cp\u003e4.5%\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4 Conclusion","content":"\u003cp\u003eIn conclusion, an aptamer sensor for the detection of cTnI was constructed by a two-step electrodeposition of PB and AuNPs on the PS microspheres modified electrode. The modification layer of PS microspheres could help to disperse PB and AuNPs homogeneously and increase the active area of the electrode to enhance the sensitivity of the sensor. The proposed Tro4/AuNPs/PB/PS/GCE aptamer sensor exhibited a wide linear range of 10 fg/mL\u0026thinsp;~\u0026thinsp;1 \u0026micro;g/mL, and a LOD of 2.03 fg/mL under optimized experimental conditions. In addition, the aptamer sensor has high selectivity and anti-interference, long stability, and good reproducibility, which could be a promising sensor platform for detection of cTnI in clinical samples. As a result, the sensor holds great promise to aid in the early detection and prognostic assessment of AMI.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003eThe authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.\u003c/p\u003e\n\u003ch2\u003eData availability\u003c/h2\u003e\n\u003cp\u003eAll data that support the fndings of this study are included within the article and any supplementary files.\u003c/p\u003e\n\u003ch2\u003eContributions\u003c/h2\u003e\n\u003cp\u003e\u003cstrong\u003eLiying Jiang\u003c/strong\u003e: Methodology, Writing \u0026ndash; original draft preparation. \u003cstrong\u003eDongyang Li\u003c/strong\u003e: Data curation, Writing \u0026ndash; Review \u0026amp; Editing.\u003cstrong\u003e\u0026nbsp;Mingxing Su:\u003c/strong\u003e Investigation. \u003cstrong\u003eFenghua Chen\u003c/strong\u003e: Investigation. \u003cstrong\u003eXiaomei Qin\u003c/strong\u003e: Investigation. \u003cstrong\u003eLan Wang\u003c/strong\u003e: Investigation. \u003cstrong\u003eY\u003c/strong\u003e\u003cstrong\u003eanghai Gui\u003c/strong\u003e: Investigation. \u003cstrong\u003eJianbo Zhao\u003c/strong\u003e: Investigation. \u003cstrong\u003eHuishi Guo\u003c/strong\u003e:\u0026nbsp;Investigation.\u003cstrong\u003e\u0026nbsp;Xiaoyun Qin\u003c/strong\u003e: Supervision, Fund acquisition, Reviewing \u0026amp; Editing, Proof reading. \u003cstrong\u003eZhen Zhang\u003c/strong\u003e: Supervision, Fund acquisition, Reviewing \u0026amp; Editing, Proof reading.\u003c/p\u003e\n\u003ch2\u003eFunding\u003c/h2\u003e\n\u003cp\u003eThe authors acknowledge the financial support from the National Natural Science Foundation of China (62073299, 21904120), the Key Research and Development Projects of Henan Province under grant (241111222900), and the Ministry of Science and Technology of China (2022YFF1202700).\u003c/p\u003e\n\u003ch2\u003eEthical approval\u003c/h2\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003ch2\u003eClinical Trial Number\u003c/h2\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003ch2\u003eConflict of interest\u003c/h2\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eM\u0026uuml;ller L, Caris-Veyrat C, Lowe G, B\u0026ouml;hm V (2016) Lycopene and its antioxidant role in the prevention of cardiovascular diseases\u0026mdash;a critical review. Crit Rev Food Sci Nutr 56(11):1868\u0026ndash;1879. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/10408398.2013.801827\u003c/span\u003e\u003cspan address=\"10.1080/10408398.2013.801827\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEttehad D, Emdin CA, Kiran A, Anderson SG, Callender T, Emberson J, Chalmers J, Rodgers A, Rahimi K (2016) Blood pressure lowering for prevention of cardiovascular disease and death: a systematic review and meta-analysis. Lancet 387(10022):957\u0026ndash;967. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0140-6736(15)01225-8\u003c/span\u003e\u003cspan address=\"10.1016/S0140-6736(15)01225-8\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLopa NS, Rahman MM, Ahmed F, Ryu T, Sutradhar SC, Lei J, Kim J, Kim DH, Lee YH, Kim W (2019) Simple, low-cost, sensitive and label-free aptasensor for the detection of cardiac troponin I based on a gold nanoparticles modified titanium foil. Biosens Bioelectron 126:381\u0026ndash;388. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.bios.2018.11.012\u003c/span\u003e\u003cspan address=\"10.1016/j.bios.2018.11.012\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAmsterdam EA, Wenger NK, Brindis RG, Casey DE, Ganiats TG, Holmes DR, Jaffe AS, Jneid H, Kelly RF, Kontos MC, Levine GN, Liebson PR, Mukherjee D, Peterson ED, Sabatine MS, Smalling RW, Zieman SJ (2014) 2014 AHA/ACC guideline for the management of patients with non\u0026ndash;ST-elevation acute coronary syndromes. Exec Summary 130(25):2354\u0026ndash;2394. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/doi:10.1161/CIR.0000000000000133\u003c/span\u003e\u003cspan address=\"doi:10.1161/CIR.0000000000000133\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAntman E, Bassand J-P, Klein W, Ohman M, Sendon JLL, Ryd\u0026eacute;n L, Simoons M, Tendera M (2000) Myocardial infarction redefined\u0026mdash;a consensus document of the joint european society of cardiology/american college of cardiology committee for the redefinition of myocardial infarction. 36(3):959\u0026ndash;969. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/doi:10.1016/S0735-1097(00)00804-4\u003c/span\u003e\u003cspan address=\"doi:10.1016/S0735-1097(00)00804-4\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRoffi M, Patrono C, Collet J-P, Mueller C, Valgimigli M, Andreotti F, Bax JJ, Borger MA, Brotons C, Chew DP, Gencer B, Hasenfuss G, Kjeldsen K, Lancellotti P, Landmesser U, Mehilli J, Mukherjee D, Storey RF, Windecker S (2015) 2015 ESC guidelines for the management of acute coronary syndromes in patients presenting without persistent ST-segment elevation. Kardiologia Polska 73(12):1207\u0026ndash;1294. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.5603/kp.2015.0243\u003c/span\u003e\u003cspan address=\"10.5603/kp.2015.0243\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFeng S, Yan M, Xue Y, Huang J, Yang X (2021) Electrochemical immunosensor for cardiac troponin I detection based on covalent organic framework and enzyme-catalyzed signal amplification. Anal Chem 93(40):13572\u0026ndash;13579. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acs.analchem.1c02636\u003c/span\u003e\u003cspan address=\"10.1021/acs.analchem.1c02636\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJo H, Gu H, Jeon W, Youn H, Her J, Kim S-K, Lee J, Shin JH, Ban C (2015) Electrochemical aptasensor of cardiac troponin I for the early diagnosis of acute myocardial infarction. Anal Chem 87(19):9869\u0026ndash;9875. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acs.analchem.5b02312\u003c/span\u003e\u003cspan address=\"10.1021/acs.analchem.5b02312\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYan H, Tang X, Zhu X, Zeng Y, Lu X, Yin Z, Lu Y, Yang Y, Li L (2018) Sandwich-type electrochemical immunosensor for highly sensitive determination of cardiac troponin I using carboxyl-terminated ionic liquid and helical carbon nanotube composite as platform and ferrocenecarboxylic acid as signal label. Sens Actuators B 277:234\u0026ndash;240. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.snb.2018.09.010\u003c/span\u003e\u003cspan address=\"10.1016/j.snb.2018.09.010\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang N, Wang J, Zhao X, Chen H, Xu H, Bai L, Wang W, Yang H, Wei D, Yuan B (2021) Highly sensitive electrochemical immunosensor for the simultaneous detection of multiple tumor markers for signal amplification. Talanta 226:122133. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.talanta.2021.122133\u003c/span\u003e\u003cspan address=\"10.1016/j.talanta.2021.122133\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLiu X, Wen Y, Wang W, Zhao Z, Han Y, Tang K, Wang D (2020) Nanobody-based electrochemical competitive immunosensor for the detection of AFB1 through AFB1-HCR as signal amplifier. Microchim Acta 187(6):352. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00604-020-04343-2\u003c/span\u003e\u003cspan address=\"10.1007/s00604-020-04343-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAnaya P, Moliterno DJ (2013) The evolving role of cardiac troponin in the evaluation of cardiac disorders. Curr Cardiol Rep 15(11):420. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11886-013-0420-0\u003c/span\u003e\u003cspan address=\"10.1007/s11886-013-0420-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi J, Lv Y, Li N, Wu R, Li J, You J, Shen H, Chen X, Li LS (2021) Dual protecting encapsulation synthesis of ultrastable quantum-dot nanobeads for sensitive and accurate detection of cardiac biomarkers. Sens Actuators B 344:130275. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.snb.2021.130275\u003c/span\u003e\u003cspan address=\"10.1016/j.snb.2021.130275\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao H, Zheng J, Liang H, Liu H-F, Liu F, Zhang Y-P, Li C-P (2023) Electrochemical/colorimetric dual-mode sensing strategy for cardiac troponin I detection based on zirconium nitride functionalized covalent organic frameworks. Sens Actuators B 391:134026. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.snb.2023.134026\u003c/span\u003e\u003cspan address=\"10.1016/j.snb.2023.134026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEshlaghi SN, Syedmoradi L, Amini A, Omidfar K (2023) A label-free electrochemical aptasensor based on screen printed carbon electrodes with gold nanoparticles-polypyrrole composite for detection of cardiac troponin I. IEEE Sens J 23(4):3439\u0026ndash;3445. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1109/JSEN.2023.3235740\u003c/span\u003e\u003cspan address=\"10.1109/JSEN.2023.3235740\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJiao L, Zhang L, Du W, Li H, Yang D, Zhu C (2019) Au@Pt nanodendrites enhanced multimodal enzyme-linked immunosorbent assay. Nanoscale 11(18):8798\u0026ndash;8802. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1039/C8NR08741E\u003c/span\u003e\u003cspan address=\"10.1039/C8NR08741E\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDorraj GS, Rassaee MJ, Latifi AM, Pishgoo B, Tavallaei M (2015) Selection of DNA aptamers against Human Cardiac Troponin I for colorimetric sensor based dot blot application. J Biotechnol 208:80\u0026ndash;86. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.jbiotec.2015.05.002\u003c/span\u003e\u003cspan address=\"10.1016/j.jbiotec.2015.05.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen K, Zhao H, Wang Z, Zhou F, Lan M (2023) Sandwich-type electrochemical aptasensor based on polydopamine-Au-metal ions as signal label and coralloid Au-conductive carbon architecture-modified electrode for the simultaneous detection of cardiac troponin I and myoglobin. Sens Actuators B 390:134044. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.snb.2023.134044\u003c/span\u003e\u003cspan address=\"10.1016/j.snb.2023.134044\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMi X, Li H, Tan R, Feng B, Tu Y (2021) The TDs/aptamer cTnI biosensors based on HCR and Au/Ti\u003csub\u003e3\u003c/sub\u003eC\u003csub\u003e2\u003c/sub\u003e-MXene amplification for screening serious patient in COVID-19 pandemic. Biosens Bioelectron 192:113482. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.bios.2021.113482\u003c/span\u003e\u003cspan address=\"10.1016/j.bios.2021.113482\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKaryakin AA (2001) Prussian blue and its analogues: Electrochemistry and Analytical Applications, 13(10) 813\u0026ndash;819. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1002/1521-4109(200106)13:10\u003c/span\u003e\u003cspan address=\"10.1002/1521-4109(200106)13:10\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChu Z, Liu Y, Jin W (2017) Recent progress in Prussian blue films: Methods used to control regular nanostructures for electrochemical biosensing applications. Biosens Bioelectron 96:17\u0026ndash;25. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.bios.2017.04.036\u003c/span\u003e\u003cspan address=\"10.1016/j.bios.2017.04.036\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhai J, Zhai Y, Wen D, Dong S, Behavior (2009) 21(20) 2207\u0026ndash;2212. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1002/elan.200904680\u003c/span\u003e\u003cspan address=\"10.1002/elan.200904680\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eJin E, Lu X, Cui L, Chao D, Wang C (2010) Fabrication of graphene/prussian blue composite nanosheets and their electrocatalytic reduction of H\u003csub\u003e2\u003c/sub\u003eO\u003csub\u003e2\u003c/sub\u003e. Electrochim Acta 55(24):7230\u0026ndash;7234. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.electacta.2010.07.029\u003c/span\u003e\u003cspan address=\"10.1016/j.electacta.2010.07.029\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLai G, Zhang H, Yu A, Ju H (2015) situ deposition of Prussian blue on mesoporous carbon nanosphere for sensitive electrochemical immunoassay. Biosens Bioelectron 74:660\u0026ndash;665. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.bios.2015.07.026\u003c/span\u003e\u003cspan address=\"10.1016/j.bios.2015.07.026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYang M, Wu X, Hu X, Wang K, Zhang C, Gyimah E, Yakubu S, Zhang Z (2019) Electrochemical immunosensor based on Ag\u003csup\u003e+\u003c/sup\u003e-dependent CTAB-AuNPs for ultrasensitive detection of sulfamethazine. Biosens Bioelectron 144:111643. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.bios.2019.111643\u003c/span\u003e\u003cspan address=\"10.1016/j.bios.2019.111643\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFan Y, Shi S, Ma J, Guo Y (2019) A paper-based electrochemical immunosensor with reduced graphene oxide/thionine/gold nanoparticles nanocomposites modification for the detection of cancer antigen 125. Biosens Bioelectron 135:1\u0026ndash;7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.bios.2019.03.063\u003c/span\u003e\u003cspan address=\"10.1016/j.bios.2019.03.063\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAparicio C, Filip J, Machala L (2017) From Prussian blue to iron carbides: high-temperature XRD monitoring of thermal transformation under inert gases. Powder Diffr 32:S207\u0026ndash;S212. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/S0885715617000471\u003c/span\u003e\u003cspan address=\"10.1017/S0885715617000471\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKarastogianni S, Diamantidou D, Girousi S Selective voltammetric detection of ascorbic acid from rosa canina on a modified graphene oxide paste electrode by a manganese(II) complex, Biosensors 2021, 11(9), 294; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/bios11090294\u003c/span\u003e\u003cspan address=\"10.3390/bios11090294\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMomeni F, Khoshfetrat SM, Zarei K (2023) Electrochemical sandwich-type aptasensor based on the multifunctional catechol-loaded Au/MIL-53(Fe) for detection of cardiac troponin I. ACS Appl Nano Mater 6(20):19239\u0026ndash;19248. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1021/acsanm.3c03705\u003c/span\u003e\u003cspan address=\"10.1021/acsanm.3c03705\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng L, Lin C, Liu P, Sun D, Lu J (2023) Anisotropic aptamer-modified DNA tetrahedra/MOF nanoprobes for enhanced colorimetric aptasensing of cardiac troponin I. Chem Eng J 474:145525. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.cej.2023.145525\u003c/span\u003e\u003cspan address=\"10.1016/j.cej.2023.145525\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang Z, Zhao H, Chen K, Cao S, Lan M (2023) Sandwich-type electrochemical aptasensor based on HMCS@PDA@AuNPs and PtCu DNs/MUN-CuO-TiO2 for ultrasensitive detection of cardiac troponin I. Sens Actuators B 393:134275. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.snb.2023.134275\u003c/span\u003e\u003cspan address=\"10.1016/j.snb.2023.134275\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMi X, Li H, Tu Y (2023) An aptamer biosensing strategy for label-free assay of dual acute myocardial infarction biomarkers built upon AuNPs/Ti\u003csub\u003e3\u003c/sub\u003eC\u003csub\u003e2\u003c/sub\u003e-MXenes. Chemosensors 11(3):157. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/chemosensors11030157\u003c/span\u003e\u003cspan address=\"10.3390/chemosensors11030157\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSong Z, Song J, Gao F, Chen X, Wang Q, Zhao Y, Huang X, Yang C, Wang Q (2022) Novel electroactive ferrocene-based covalent organic frameworks towards electrochemical label-free aptasensors for the detection of Cardiac Troponin I. Sens Actuators B 368:132205. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.snb.2022.132205\u003c/span\u003e\u003cspan address=\"10.1016/j.snb.2022.132205\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen K, Zhao H, Wang Z, Zhou F, Shi Z, Cao S, Lan M (2022) Sandwich-type electrochemical aptasensor based on Au-modified conductive octahedral carbon architecture and snowflake-like PtCuNi for the sensitive detection of cardiac troponin I. Biosens Bioelectron 212:114431. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.bios.2022.114431\u003c/span\u003e\u003cspan address=\"10.1016/j.bios.2022.114431\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Schemes","content":"\u003cp\u003eScheme 1 is available in the Supplementary Files section\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Electrochemical sensors, cardiac troponin I, aptamer, Prussian blue, gold nanoparticles","lastPublishedDoi":"10.21203/rs.3.rs-4794692/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4794692/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMonitoring cardiac troponin I (cTnI) is of great value in the clinical diagnosis of acute myocardial infarction (AMI). In this paper, a highly sensitive electrochemical aptamer sensor was demonstrated by using polystyrene (PS) microspheres as the electrode substrate material, combined with Prussian blue (PB) and gold nanoparticles (AuNPs) for the sensitive and label-free determination of cTnI. PS microspheres were synthesized by emulsion polymerization and then dropped onto the glassy carbon electrode, PB and AuNPs were electrodeposited on the electrode in corresponding electrolyte solution step by step. The PS microsphere substrate provided a large surface area for loading mass of the biological affinity aptamers, while the PB layer improved the electrical conductivity of the modified electrode and the electroactive AuNPs exhibited excellent catalytic performance for subsequent electrochemical measurements. In view of the above-mentioned sensing platform, the fabricated label-free electrochemical aptamer sensor showed a wide detection range of 10 fg/mL\u0026thinsp;~\u0026thinsp;1.0 \u0026micro;g/mL and a low limit of detection of 2.03 fg/mL under the optimal conditions. Furthermore, this biosensor provided an effective detection platform for the analysis of cTnI in serum samples. The introduction of this sensitive electrochemical aptamer sensor provides a reference for clinical sensitive detection of cTnI.\u003c/p\u003e","manuscriptTitle":"A label-free electrochemical aptamer sensor for sensitive detection of cardiac troponin I based on AuNPs/PB/PS/GCE","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-22 17:12:24","doi":"10.21203/rs.3.rs-4794692/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"7cae5917-dcc7-4568-b95d-5900d409a0ab","owner":[],"postedDate":"August 22nd, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-24T13:33:39+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-22 17:12:24","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4794692","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4794692","identity":"rs-4794692","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}