The Potential of Human Defensin 5 (HD5) as a Novel Strategy for Malaria Control: Inhibition of Plasmodium Development in Anopheles | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The Potential of Human Defensin 5 (HD5) as a Novel Strategy for Malaria Control: Inhibition of Plasmodium Development in Anopheles Tingting Liu, Jing Wang, Xin Li, Shasha Yu, Dan Zheng, Zhilong Liu, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4129796/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Malaria is a serious threat to human health. The existing vector-based interventions have shortcomings, such as the environmental pollution and strong resistance to chemical insecticides, the relatively slow effects of biological insecticides. It is urgent to look for novel strategies to control malaria such as by reducing mosquito vector competence. Human defensin 5 (HD5) has broad-spectrum and high antimicrobial activity. We are intrigued whether HD5 can block malaria transmission by inhibition of plasmodium development in mosquitoes. So, HD5 was injected intrathoracically into Anopheles stephensi at various time points, and it was found that the infection intensity of Plasmodium yoelii in An. stephensi was significantly reduced by HD5 treatment at 24 h prior to infection or 6 h, 12 h, 24 h post-infection, comparing with the control groups. Then, we found that HD5 treatment significantly up-regulated TEP1 expression at 24 h and 72 h post-infection (hpi), while the expression of MyD88 and Rel1 in the Toll pathway were up-regulated at 24 hpi. Furthermore, RNA interference of MyD88 which is the key upstream molecule of Toll signaling pathway abolished the HD5-induced resistance of mosquitoes against malaria parasites infection. These results indicated HD5 microinjection to mosquito could effectively inhibit the development of malaria parasites in An. stephensi via activating the Toll signaling pathway. This study provides theoretical reference for the application of HD5 in malaria transmission blocking strategies using genetic engineering or transfection methods. Human defensin 5 Anopheles stephensi Plasmodium yoelii Toll signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 1. Introduction Malaria, transmitted by the bite of female Anopheles mosquitoes, is a parasitic disease which caused estimated 249 million malaria cases and 608 000 deaths in 2021(WHO, 2023 ). Vector-based interventions are the principal methods available for reducing malaria. Nevertheless, the long and widespread use of chemical insecticides not only caused environmental pollution but also developed strong resistance in mosquitoes. Biological insecticides show relatively slow effects and short duration of killing efficiency also with the problem of resistance(Benelli, 2015 ). Therefore, it is urgent to look for novel strategies to fight against malaria and reduce mosquito vector competence(Hemingway, 2014 ). In addition to extermination of mosquitoes, malaria transmission can be blocked by interfering the development of plasmodium in mosquitoes, to reduce the vector capacity of anopheles mosquitoes. Defensin, a cys-rich cationic polypeptide, is an important component of the innate immunity in mammals, insects, and plants. It is involved in various biological reactions of host cellular immunity regulation against a variety of pathogenic microorganisms(Hazlett and Wu, 2011 ). The human defensins are divided into two subfamilies based on their sequence homology and disulfide pairing, α and β(Lehrer and Lu, 2012 ). It has been reported that β-defensins promoted the innate and adaptive immune responses of host(Kindrachuk et al., 2010 ). Human Defensin 5 (HD5) is a α subfamily short antimicrobial peptide secreted in Paneth cells located in the base of intestinal crypts(Cunliffe et al., 2001 ; Elphick et al., 2008 ). HD5 contains three pairs of disulfide bonds and has three β reverse folded lamellar structure which exerts anti-microbial effect(de Leeuw et al., 2007 ). HD5 has antimicrobial activity against bacteria, fungi, Treponema pallidum and viruses. As well as inhibiting SARS-CoV-2 invasion and binding to ACE2(Li et al., 2021 ; Niv, 2020 ; Wang et al., 2020 ), HD5 exhibits potent antiviral activity against pseudo typed viruses expressing SARS-CoV-2 spike proteins (Wang et al., 2020 ; Xu et al., 2021 ). Research showed that HD5 displayed a parasiticidal role against Toxoplasma gondii (Tanaka et al., 2010 ). Human primary endocervical epithelial cells (HPECs) participate in the mucosal immune defense by upregulating the secretion of HD5 through the activation of Toll-like receptor 4(TLR4)(Ma and Yang, 2010 ). Defensin can also be synthesized by insect in the fat body and secreted into the haemolymph. Defensins are distinguished by a conserved cysteine motif between insect and mammalian(Zhao et al., 2018 ). The researchers have identified various defensin gene isoforms, which were sequenced and used as a molecular marker for phylogenetic analysis(de Araujo et al., 2015 ). An. stephensi is a vector endemic in Southeast Asia that transmits both malaria parasites Plasmodium falciparum and P. vivax (Ishtiaq et al., 2021 ). The animal model of An. stephensi and Plasmodium yoelii that infect rodents (mice) was often used to study the relationship between the vector and the disease(Simwela and Waters, 2022 ). Based on the above analysis, it is wondering that whether HD5 can regulate the innate immunity of An. stephensi and increase the resistance to P. yoelii . In this study, we present that HD5 could effectively inhibit P. yoelii infection in An. stephensi by activation of the Toll signaling pathway. This is the first report to decipher the effect of HD5 on malaria vector competence of mosquitoes and the innate immunity related mechanisms. Understanding the effect of exogenous HD5 on innate immunity and vector competence of An. stephensi will be helpful to carry out mosquito genetic engineering or transfection methods to induce mosquitoes to produce HD5-like peptides to block malaria transmission. For example, HD5 can be genetically engineered to a symbiotic bacterium to feed mosquitoes, which may enhance the activity of Anopheles to defense plasmodium. It may provide a new strategy to defeat malaria and block the transmission. 2. Materials and Methods 2.1. Mosquito rearing and infection The An. stephensi Hor strain was maintained at 28 ℃ and 70–80% relative humidity with a 12 h light/dark photocycle, according to the standard rearing procedures in the laboratory. Red fluorescence protein transgenic P. yoelii BY265 strain was recovered and passed in mice. Three- to five-day-old female An. stephensi mosquitoes were fed on P. yoelii infected 4–6 -week-old Kunming mice with 5–10% parasitemia at 24 ℃, as described previously(Conteh et al., 2010 ). Mosquitoes were anesthetized with carbon dioxide and dissected 8 days post-infection. The plasmodium oocysts were counted under a fluorescence microscope. Then the infection rate and the intensity were analyzed statistically. 2.2. HD5 treatment The HD5 polypeptide was directly synthesized by chemical methods with 95% purity and kindly donated by Professor Cheng Wang from Institute of Combined Injury of the Army Medical University. The dry powder of HD5 was dissolved into the stock solution (1mg/ml) and then diluted by ddH 2 O to a final working concentration (200 µg/ml) before injection. Three to five-day-old female An. stephensi were injected with 69 nl HD5 intrathoracically. Age-matched mosquitoes injected with 69 nl ddH 2 O were used as controls. Injection was conducted at 24 h prior to infection with P. yoelii or 6 h, 12 h, 24 h, 72 h post-infection. 2.3. RNA isolation, cDNA synthesis, and quantitative PCR Ten female An. stephensi mosquitoes from each group were anesthetized with CO 2 exposure and used for gene transcript analysis at 24 h, and 72 h post-blood feeding. Total RNA was extracted in accordance with the instruction of the HiPure Universal RNA Mini Kit (Magen, Guangzhou, Guangdong, China) and reverse transcribed to cDNA using the Reverse Transcription Kit (Takara, Dalian, Liaoning, China). Then Real-time quantitative PCR was performed using the KAPA SYBR® FAST qPCR Kit (KAPA Biosystems, Wilmington, MA, USA) with a Bio-Rad CFX96 Touch™ real-time PCR instrument (Bio-Rad, Hercules, CA, USA) to determine the transcriptional levels of immune genes, such as TEP1, MyD88, Rel1, Imd, Rel2 and Caspar, using the conserved S7 as the internal reference gene. The primers are listed in the Table 1 . The expression of each gene relative to the ribosomal S7 RNA was determined using the 2 −ΔΔCT method. Table 1 Gene primers for quantitative PCR Target gene Primer sequence (5′ to 3′) As-TEP 1 F: ACCGATTGTCCAAGTTCTCG R: AGCGCATCTGGTTCTGGTAG As-MyD88 F: TCGGCGGACAGTGACATTATTACG R: TCACGATCCTTCAGACACAGTTGC As-Rel 1 F: GAACTGGATTCGGTCACGCTAAGG R: CGGCAGATAATCAGGTCGGACATG As-Cactus F: CGCTTGCAGATGCTAGTGGTCAG R: CCGCTGTTCGCTGGCTGTTC As-Imd F: CGACCGGAATGCAGGTGTATCAG R: CCGCAGAGCCACTCGTTGAAG As-Rel 2 F: AATTACCCGCATTCTGATCG R: CTCCAGCACGTAGTTCACGA As-S7 F: CTAACGACACGAAGACCACAAGA R: CAACCTGCAACGACAGCAAAA 2.4. Western blot Fifteen An. stephensi mosquitoes from each group were homogenized in RIPA lysis buffer (50 mM Tris, pH 7.4; 150 mM NaCl; 1% sodium deoxycholate; 1% Triton X-100; 1 mM EDTA; 0.1% SDS; 1× protease inhibitor; 1× phosphatase inhibitor) at 24 h and 72 h post blood meal. The total protein was extracted and denatured at 95°C for 10 min, then centrifuged at maximum speed for 5 min at room temperature. The supernatants were transferred to sterile microcentrifuge tubes for the following experiments. The protein samples were separated with 10% SDS-PAGE gels, and then transferred to a PVDF membrane for 1 h at 100 V. The membrane was blocked in 5% skimmed milk for 1 h at room temperature, then incubated with 1:2000 TEP1 antibody and the reference protein β-actin antibody at 4 ℃ overnight. The membranes were washed with 1×TBST for 5 min by three times, then incubated with anti-rabbit secondary antibody for 1 h at room temperature. After being washed as above, the membrane signals were acquired with Chemi DOCTMMP Imaging System (BIO-RAD). 2.5. RNA interference RNA interference was conducted to further confirm the role of the Toll signaling pathway in the impact of HD5 treatment on An. stephensi vector competence to P. yoelii . An. stephensi cDNA was subjected to PCR using TEP1 and MyD88 gene-specific primers with a 5′ extension of T7 promoter tags (5′-TAATACGACTCACTATAGGG-3′). A GFP fragment was used to make the control double-stranded RNA (dsRNA) (Table 2 ). The dsRNA was transcribed in vitro using the PCR products as templates with the MEGAscript T7 Kit (Ambion Life Technologies, Austin, TX, USA), following the manufacturer’s instructions. Three to five-day-old female mosquitoes were injected intrathoracically with 69 nl dsTEP1 or dsMyD88 by a Nanoject II microinjector (Drummond Scientifc Co., Bromall, PA, USA). Equal amounts of dsGFP were injected as a control. The gene silencing efficiency was detected three days after dsRNA injection by qRT-PCR as described above. Then mosquitoes were challenged with P. yoelii BY265RFP infection by blood feeding. The plasmodium oocysts in mosquitoes were counted microscopically 8 days post-infection. Meanwhile, the infection rates and intensities were calculated. Table 2 Specific gene primers for RNAi Target gene Primer sequence (5′ to 3′) T7-dsGFP F: TAATACGACTCACTATAGGGAGTCAAGTTCAACGTGTCCGGCG R: TAATACGACTCACTATAGGGAGAGGACCATTTGATCGCGCTT T7-dsTEP1 F: TAATACGACTCACTATAGGGAGTCGGGCTGAAGGCGTTGACC R: TAATACGACTCACTATAGGGAGTGCCACCTTGAATCGTCTGA T7-dsMyD88 F: TAATACGACTCACTATAGGGAGAGGTGAGCGTCAAAGAGACG R: TAATACGACTCACTATAGGGAGTTTTACTGGCTTGTCCGGCT 2.6. Statistical analysis All statistical analyses were performed using GraphPad Prism software (v.8.0) and SigmaStat software (Version 3.5). The Chi-square test was used to analyze the infection rate. The student’s t-test was used to compare normally distributed data, and the Mann-Whitney U-test was used for non-normally distributed data to compare the oocysts counts between the HD5 and control groups. P-values < 0.05 were considered statistically significant. 3. Result 3.1. HD5 injection prior to infection reduced the intensity of P. yoelii infection in An. stephensi To investigate whether HD5 injection pretreatment affects the development of Plasmodium oocysts in An. stephensi , mosquitoes were injected intrathoracically with HD5 24 hours prior to injection. The oocysts from the control group and the HD5 treatment group were counted 8 days post-infection (Fig. 1 a). The infection rates and intensities were compared between the two groups. As a result, HD5 treatment significantly decreased the oocyst counts compared to the control group (P = 0.012 < 0.05) (Fig. 1 b, 1 c). There was no significant difference in the infection rates between the control group and the HD5 treatment group(P = 0.286) (Fig. 1 d). These data suggested that HD5 treatment prior to infection could influence the oocysts development in An. stephensi and reduce the infection intensity but had no impact on the infection rate. 3.2. HD5 treatment post-infection inhibited P. yoelii infection in An. stephensi The above result inspired our interest whether injecting HD5 into mosquitoes after blood feeding also affects parasite infection. Thus, HD5 was injected intrathoracically into An. stephensi post-infection to investigate its influence on parasite development. The mosquitoes were dissected and the oocysts were counted 8 days post-infection (Fig. 2 a). We first investigated the effect of injection of HD5 at 12 hpi on plasmodium development in mosquitoes. The results showed that HD5 injection significantly reduced the oocyst counts comparing with the control group (P = 0.0004 < 0.001) without effect on the infection rates (Fig. 2 b, 2 c, 2 d). Next, we further systematically observed the inhibitory effect of HD5 on plasmodium development in mosquitoes by injection at 6 h, 12 h, 24 h, 72 h post-infection. The results showed that injection with HD5 at 6 h, 12 h and 24 h post-infection significantly decreased the oocyst intensities comparing with the control groups. While there was no significant difference of oocysts counts between the HD5 and control groups when the injection was conducted at 72 hpi (Fig. 2 e). The results implicated that HD5 could intervene the development of early stage of the oocyst. To sum up, our results demonstrated that HD5 effectively inhibited P. yoelii development in An. stephensi if HD5 was injected prior to infection or given early after infection. 3.3. HD5 treatment up-regulated the expression of TEP1 in An. stephensi There have been researches indicating that the thioester-containing protein 1 (TEP1) plays a crucial role in mosquito resistance against malaria parasites (Volohonsky et al., 2017 ). The midgut epithelium is invaded and crossed by Plasmodium ookinetes, triggering a robust TEP1 involved complement-like immune response (Reyes et al., 2019 ; Williams et al., 2019 ). As the main protein responsible for mediating plasmodium lysis, TEP1 binds to the surface of ookinetes and mediates plasmodium lysis (Kwon et al., 2017 ). To investigate whether HD5 treatment reduce the oocysts through affecting the expression of TEP1, Real-time quantitative PCR and Western Blot were performed to detect change of the transcription and protein levels of TEP1 by HD5 injection at 12 h after infectious blood meals. The results showed that HD5 treatment up-regulated both the transcriptional and protein levels of TEP1 in mosquitoes at 24 h and 72 h post-infection comparing with the control groups (Fig. 3 a, 3 b). These results suggested that HD5 treatment could increase the expression of TEP1 and improve the immune response of mosquitoes against malaria parasites. 3.4. Toll signaling pathway was involved in the inhibitory effect of HD5 on P. yoelii development in An. stephensi Parasites are killed by the mosquito's innate immune system(Cirimotich et al., 2010 ). There are four major signaling pathways that have been demonstrated to defense against pathogens, among which the Toll and Imd signaling pathways are widely considered to be mainly involved in anti-plasmodium defense in mosquitoes(Clayton et al., 2014 ; Souvannaseng et al., 2018 ). To explore whether HD5 treatment activates the Toll and Imd signaling pathways further influence the oocysts development, the key effector molecules in the signaling pathways were evaluated by qRT-PCR. We primarily detected the expression of MyD88, Rel1 and Cactus of the Toll signaling pathway. Surprisingly, both the expression of MyD88 and Rel1 were significantly upregulated at 24 hpi but not at 72 hpi by HD5 treatment at 12 hpi (Fig. 4 a, 4 b). The negative regulatory factor Cactus expression was down-regulated at 24 hpi and up-regulated at 72 hpi (Fig. 4 c). It indicated that the Toll signaling pathway was activated, especially at 24 hpi. In addition, we also detected the gene expression of Imd and Rel2, the two key molecules in the Imd signaling pathway. However, there was no significant change in these genes’ expression between the HD5 and control groups (Fig. 4 d, 4 e), which indicated that the Imd signaling pathway was not activated by HD5. These results suggested that the Toll signaling pathway might be activated due to HD5 treatment and result in upregulation of TEP1 expression and a decline in the oocyst counts. 3.5. Inhibition of oocyst development in An. stephensi by HD5 could be reversed with the interference of the Toll signaling pathway To confirm the role of Toll signaling pathway upregulation by HD5 treatment in the inhibition of malaria parasites development in mosquitoes, the gene expression of MyD88 and TEP1 were silenced respectively using RNA interference (RNAi) method, followed by observation of oocyst development. The gene expression of TEP1 and MyD88 were efficiently silenced according to the qRT-PCR results (Fig. 5 a). As shown in the Fig. 5 b, the inhibitory effect of HD5 on oocyst development disappeared when MyD88 expression was silenced by RNAi method which indicated that Toll signaling pathway played a key role in the transmission blocking of malaria by HD5. According to the data of TEP1 interference, there were more oocysts in the dsTEP1 group than that in the dsGFP group, regardless of whether HD5 was injected, which indicated the role of TEP1 in killing of plasmodium and was consistent with the previous report(Blandin et al., 2004 ). And, there were less oocysts in the HD5 group than that in the control group under injection of dsGFP, which further conformed the inhibitory effect of HD5 treatment on development of the oocysts. Nonetheless, HD5 still reduced the oocysts counts when TEP1 expression was silenced by RNAi, which indicated that HD5 treatment might also affect other immune effectors in the Toll signaling pathway to inhibit oocyst development in addition to TEP1. To sum up, these results suggested that activation of the Toll signaling pathway by HD5 significantly enhanced the defense of An. stephensi against malaria parasites. 4. Discussion The chemical and biological insecticides were commonly used in mosquito control with their own shortcomings. New strategies are urgently needed to block the transmission of malaria. For example, malaria transmission can be blocked by interfering with the parasite development in mosquito using transgenic engineering or transfection methods. In this study, we found that HD5 microinjection could effectively inhibit the development of malaria parasites in An. stephensi by enhancing innate immunity of mosquitoes. HD5 has broad-spectrum antibacterial activity and highly effective antimicrobial activity, which has a promising application prospect (Ericksen et al., 2005 ; Porter et al., 1997 ). HD5 can inhibit or kill Gram-positive (G + ) bacteria, Gram-negative (G − ) bacteria, fungi, spirochete, protozoa, and enveloped virus(Awang and Pongprayoon, 2021 ; Ericksen et al., 2005 ; Wanniarachchi et al., 2011 ). Whether HD5 has the parasiticidal effect on Plasmodium has not been studied so far. The influence of HD5 on the innate immunity of mosquitoes has also not been reported. We found that the oocysts were significantly reduced by microinjection of HD5 into Anopheles mosquitoes, indicating that HD5 can decrease the malaria transmission ability of Anopheles. The oocyst counts varied when HD5 was injected intrathoracically into An. stephensi at different time points prior to or post Plasmodium infection, which may be related to the development process of Plasmodium in the mosquitoes. The female mosquito was infected after ingesting a blood meal containing Plasmodium gametocytes. As zygotes form in the midgut, they develop into motile ookinetes that invade the midgut epithelium 18–26 hours after infection(Volohonsky et al., 2020 ). As the ookinetes migrate through the midgut epithelium and the oocysts develop on the basal side, the number of parasites is limited. The oocyst development was significantly inhibited when HD5 was given prior to infection or injected at 6 h, 12 h and 24 h but not 72 h post infection, possibly because the up-regulated immune response by HD5 mainly acted on the early stage of oocysts. In addition, we found that HD5 treatment at 12 hpi demonstrated the most significant inhibitory effect on oocysts development. Therefore, the practical application of HD5 in the future needs to consider the administration time. Besides, the concentration of HD5 also needs to be considered. In this study, we also explored the effects of different concentrations of HD5 on the malaria vector competence of An. stephensi . The mosquitoes were injected with 69 nl HD5 at concentrations of 50 µg/ml, 100 µg/ml and 200 µg/ml. The results showed that administration of HD5 at concentrations of 100 µg/ml and 200 µg/ml led to significantly lower infection intensities of plasmodium than the control group, especially the 200 µg/ml concentration (P = 0.0004 < 0.001). However, no effect was observed when the mosquitoes was injected with HD5 at a concentration of 50 µg/ml (Fig. S1 ). The mosquito's innate immune system plays an important role at multiple stages of Plasmodium infection. Plasmodium ookinetes cross the mosquito midgut epithelium and reach the basal lamina, where they were killed by mosquito complement C3-like protein TEP1 (Blandin et al., 2004 ; Volohonsky et al., 2017 ). Our study found that the expression of TEP1 was up-regulated at 24 h and 72 h post-infection by HD5 treatment, indicating that TEP1 was involved in the effect of HD5 on restriction of plasmodium. Silence of TEP1 expression via RNAi didn’t reverse the impact of HD5 on the development of Plasmodium, indicating the involvement of other effector molecules. As we mentioned before, numerous studies have demonstrated that the anti-Plasmodium and antibacterial defenses of the mosquito are mainly regulated by the Toll and Imd signaling pathways(Blumberg et al., 2013 ; Ramirez et al., 2014 ; Zakovic and Levashina, 2017 ). Detecting and comparing the expression of key molecules of these two signaling pathways showed that the Toll signaling pathway was up-regulated by HD5 injection, while the Imd pathway was not affected. The role of the Toll signaling pathway in the effect on malaria competence of anopheles was further confirmed by silencing MyD88, a key upstream molecule in the Toll signaling pathway. It is consistent with the study that activation of the Toll signaling pathway in Anopheles gambiae by silencing Cactus promotes the activation of the complement-like system in mosquitoes, leading to elimination of the oocyte-cell malaria parasite(Barletta et al., 2022 ). HD5 can ameliorate dextran sodium sulfate-induced mice colitis via inhibiting NF-kB pathway(Zeng et al., 2020 ). The results of present study indicated that HD5 could inhibit malaria parasites development in anopheles via affecting the innate immunity of mosquitoes. HD5 used in the present study is a polypeptide with 95% purity directly synthesized by chemical methods. The dry powder of HD5 was dissolved and diluted with ddH 2 O to a final working concentration. Therefore, there were hardly any impurities and other solvents which might interfere the results. Although the purity of HD5 was very high, the impact of the possible impurities on the results cannot be excluded completely. This issue will be considered in our future study. Defensins play an important role in maintaining the distribution and stability of intestinal flora(Sankaran-Walters et al., 2017 ). The mosquito’s gut microbiota interferes with Plasmodium infection and affects mosquito vectorial capacity. The composition of microbiome might change with shifts in temperature(de Angeli et al., 2023 ). This natural barrier could be a new transmission-blocking strategies(Romoli and Gendrin, 2018 ; Vinayagam S et al., 2023 ). A gut symbiotic bacterium Serratia strain Y1 was isolated from field-caught female Anopheles sinensis and was found capable of enhancing mosquito resistance to Plasmodium infection through activation of mosquito immune responses(Bai et al., 2019 ). The effect of HD5 on malaria parasites in Anopheles can be observed more intuitively and conveniently by direct feeding. However, the challenge is to obtain large quantities of HD5 in vitro. It is difficult to extract native HD5 from intestinal fluid and chemical synthesis is expensive. A large amount of HD5 hopes to be obtained to meet the demand through the increasingly mature genetic engineering technology. A Serratia AS1, isolated from Anopheles ovaries, was genetically engineered to a recombinant strain which could inhibit Plasmodium falciparum infection of An. gambiae (Wang et al., 2017 ). In the future, we hope to construct HD5 into a symbiotic strain to express HD5 in vivo and enhance the activity of Anopheles to defense plasmodium. 5. Conclusion In conclusion, the present study was focused on the inhibitory effect of HD5 on plasmodium development in mosquitoes and the innate immunity related mechanisms. The results indicated that injection of HD5 intrathoracically into An. stephensi at various time points could decrease the P. yoelii infection intensities through up-regulated the Toll signaling pathway. This study can help us to not only understand the effect and mechanism of HD5 on the malaria vector competence of An. stephensi , but also develop new strategies to block malaria transmission. Declarations Supplementary material The effect of HD5 at different concentrations on plasmodium development in mosquitoes can be found in Figure S1. Acknowledgements We would like to thank Prof. Cheng Wang for the supply of HD5 and the staff in our laboratory for their contribution in maintaining the mosquitoes. This work was supported by an award from the Key Laboratory of Extreme Environmental Medicine, Army Medical University. Authors’ contributions T Liu and Y W conceived and designed the study. T L and J W performed the research. T L, X L and Y W analyzed the data. D Z, Z L and H H contributed new methods. T L wrote the original draft, T L, S Y, X Y and Y W improved all the versions. All authors read and approved the final manuscript. Funding support This research was supported by the Scientific and Technological Innovation Capacity Enhancement Special Project of Army Medical University (2021XJS05), the National Natural Science Foundation of China (81971971), the National key research and development plan of China (2022YFC3103001-002). Data availability All data generated or analyzed during this study are included in this published article and its supplementary materials. The original study data is with the authors. Ethics standards All procedures were carried out according to the guidelines for animal care and safe use of Army Medical University and were permitted by the Animal Institute of Army Medical University Consent to participate All authors consented to participate of this research. Consent to publish All authors gave final approval for publication. Conflict of interest The authors declare that they have no competing interests. References Awang, T., Pongprayoon, P., 2021. The penetration of human defensin 5 (HD5) through bacterial outer membrane: simulation studies. J. Mol. Model., 27(10), 291. Bai, L., Wang, L., Vega-Rodríguez, J., Wang, G., Wang, S., 2019. A Gut Symbiotic Bacterium Serratia marcescens Renders Mosquito Resistance to Plasmodium Infection Through Activation of Mosquito Immune Responses. Front. Microbiol., 10( Barletta, A., Saha, B., Trisnadi, N., Talyuli, O., Raddi, G., Barillas-Mury, C., 2022. Hemocyte differentiation to the megacyte lineage enhances mosquito immunity against Plasmodium. eLife, 11( Benelli, G., 2015. Research in mosquito control: current challenges for a brighter future. Parasitol. Res., 114(8), 2801–5. Blandin, S., Shiao, S.H., Moita, L.F., Janse, C.J., Waters, A.P., Kafatos, F.C., Levashina, E.A., 2004. Complement-like protein TEP1 is a determinant of vectorial capacity in the malaria vector Anopheles gambiae . Cell, 116(5), 661–70. Blumberg, B.J., Trop, S., Das, S., Dimopoulos, G., 2013. Bacteria- and IMD pathway-independent immune defenses against Plasmodium falciparum in Anopheles gambiae . PLoS One, 8(9), e72130. Cirimotich, C.M., Dong, Y., Garver, L.S., Sim, S., Dimopoulos, G., 2010. Mosquito immune defenses against Plasmodium infection. Developmental & Comparative Immunology, 34(4), 387–395. Clayton, A.M., Dong, Y., Dimopoulos, G., 2014. The Anopheles innate immune system in the defense against malaria infection. J. Innate Immun., 6(2), 169–81. Conteh, S., Chattopadhyay, R., Anderson, C., Hoffman, S.L., 2010. Plasmodium yoelii -infected A . stephensi inefficiently transmit malaria compared to intravenous route. PLoS One, 5(1), e8947. Cunliffe, R.N., Rose, F.R., Keyte, J., Abberley, L., Chan, W.C., Mahida, Y.R., 2001. Human defensin 5 is stored in precursor form in normal Paneth cells and is expressed by some villous epithelial cells and by metaplastic Paneth cells in the colon in inflammatory bowel disease. Gut, 48(2), 176–85. de Angeli, D.D., Salloum, P.M., Poulin, R., 2023. Vector microbiome: will global climate change affect vector competence and pathogen transmission? Parasitol. Res., 122(1), 11–17. de Araujo, C.A., Lima, A.C., Jansen, A.M., Galvao, C., Jurberg, J., Costa, J., Azambuja, P., Waniek, P.J., 2015. Genes encoding defensins of important Chagas disease vectors used for phylogenetic studies. Parasitol. Res., 114(12), 4503–11. de Leeuw, E., Burks, S.R., Li, X., Kao, J.P., Lu, W., 2007. Structure-dependent functional properties of human defensin 5. FEBS Lett., 581(3), 515–20. Elphick, D., Liddell, S., Mahida, Y.R., 2008. Impaired luminal processing of human defensin-5 in Crohn's disease: persistence in a complex with chymotrypsinogen and trypsin. Am. J. Pathol., 172(3), 702–13. Ericksen, B., Wu, Z., Lu, W., Lehrer, R.I., 2005. Antibacterial activity and specificity of the six human {alpha}-defensins. Antimicrob. Agents Chemother., 49(1), 269–75. Hazlett, L., Wu, M., 2011. Defensins in innate immunity. Cell Tissue Res., 343(1), 175–88. Hemingway, J., 2014. The role of vector control in stopping the transmission of malaria: threats and opportunities. Philos. Trans. R. Soc. B.-Biol. Sci., 369(1645), 20130431. Ishtiaq, F., Swain, S., Kumar, S.S., 2021. Anopheles stephensi (Asian Malaria Mosquito). Trends Parasitol., 37(6), 571–572. Kindrachuk, J., Nijnik, A., Hancock, R.E.W., 2010. Host Defense Peptides: Bridging Antimicrobial and Immunomodulatory Activities. Comprehensive Natural Products II, Elsevier, 5(175–216. Kwon, H., Arends, B.R., Smith, R.C., 2017. Late-phase immune responses limiting oocyst survival are independent of TEP1 function yet display strain specific differences in Anopheles gambiae . Parasites Vectors, 10(1), 369. Lehrer, R., Lu, W., 2012. alpha-Defensins in human innate immunity. Immunol. Rev., 245(1), 84–112. Li, D., Chen, P., Shi, T., Mehmood, A., Qiu, J., 2021. HD5 and LL-37 Inhibit SARS-CoV and SARS-CoV-2 Binding to Human ACE2 by Molecular Simulation. Interdiscip. Sci., 13(4), 766–777. Ma, J.M., Yang, H.X., 2010. Role of Toll-like receptor 4 and human defensin 5 in primary endocervical epithelial cells. Chin. Med. J., 123(13), 1762–7. Niv, Y., 2020. Defensin 5 for prevention of SARS-CoV-2 invasion and Covid-19 disease. Med. Hypotheses, 143(110244. Porter, E.M., van Dam, E., Valore, E.V., Ganz, T., 1997. Broad-spectrum antimicrobial activity of human intestinal defensin 5. Infect. Immun., 65(6), 2396–401. Ramirez, J.L., Garver, L.S., Brayner, F.A., Alves, L.C., Rodrigues, J., Molina-Cruz, A., Barillas-Mury, C., 2014. The role of hemocytes in Anopheles gambiae antiplasmodial immunity. J. Innate Immun., 6(2), 119–28. Reyes, R.V., Sousa, G.L., Sneed, S.D., Farrant, K.V., Christophides, G.K., Povelones, M., 2019. Stimulation of a protease targeting the LRIM1/APL1C complex reveals specificity in complement-like pathway activation in Anopheles gambiae . PLoS One, 14(4), e0214753. Romoli, O., Gendrin, M., 2018. The tripartite interactions between the mosquito, its microbiota and Plasmodium. Parasites Vectors, 11(1). Sankaran-Walters, S., Hart, R., Dills, C., 2017. Guardians of the Gut: Enteric Defensins. Front. Microbiol., 8(647. Simwela, N.V., Waters, A.P., 2022. Current status of experimental models for the study of malaria. Parasitology, 149(6), 729–750. Souvannaseng, L., Hun, L.V., Baker, H., Klyver, J.M., Wang, B., Pakpour, N., Bridgewater, J.M., Napoli, E., Giulivi, C., Riehle, M.A., Luckhart, S., 2018. Inhibition of JNK signaling in the Asian malaria vector Anopheles stephensi extends mosquito longevity and improves resistance to Plasmodium falciparum infection. PLoS Pathog., 14(11), e1007418. Tanaka, T., Rahman, M.M., Battur, B., Boldbaatar, D., Liao, M., Umemiya-Shirafuji, R., Xuan, X., Fujisaki, K., 2010. Parasiticidal activity of human alpha-defensin-5 against Toxoplasma gondii . In Vitro Cell. Dev. Biol.-Anim., 46(6), 560–5. Vinayagam S, Rajendran D, Sekar K, Renu K, Sattu K, 2023. The microbiota, the malarial parasite, and the mosquito [MMM] - A three-sided relationship. Mol. Biochem. Parasitol., Feb;253:111543. Volohonsky, G., Hopp, A.K., Saenger, M., Soichot, J., Scholze, H., Boch, J., Blandin, S.A., Marois, E., 2017. Transgenic Expression of the Anti-parasitic Factor TEP1 in the Malaria Mosquito Anopheles gambiae. PLoS Pathog., 13(1), e1006113. Volohonsky, G., Paul-Gilloteaux, P., Stafkova, J., Soichot, J., Salamero, J., Levashina, E.A., 2020. Kinetics of Plasmodium midgut invasion in Anopheles mosquitoes. PLoS Pathog., 16(9), e1008739. Wang, C., Wang, S., Li, D., Wei, D., Zhao, J., Wang, J., 2020. Human Intestinal Defensin 5 Inhibits SARS-CoV-2 Invasion by Cloaking ACE2. Gastroenterology, 159(3), 1145–1147.e4. Wang, S., Dos-Santos, A., Huang, W., Liu, K.C., Oshaghi, M.A., Wei, G., Agre, P., Jacobs-Lorena, M., 2017. Driving mosquito refractoriness to Plasmodium falciparum with engineered symbiotic bacteria. Science, 357(6358), 1399–1402. Wanniarachchi, Y.A., Kaczmarek, P., Wan, A., Nolan, E.M., 2011. Human defensin 5 disulfide array mutants: disulfide bond deletion attenuates antibacterial activity against Staphylococcus aureus . Biochemistry, 50(37), 8005–17. WHO, 2023. world malaria report2023. Williams, M., Contet, A., Hou, C.D., Levashina, E.A., Baxter, R., 2019. Anopheles gambiae TEP1 forms a complex with the coiled-coil domain of LRIM1/APL1C following a conformational change in the thioester domain. PLoS One, 14(6), e0218203. Xu, C., Wang, A., Marin, M., Honnen, W., Ramasamy, S., Porter, E., Subbian, S., Pinter, A., Melikyan, G.B., Lu, W., Chang, T.L., 2021. Human Defensins Inhibit SARS-CoV-2 Infection by Blocking Viral Entry. Viruses-Basel, 13(7). Zakovic, S., Levashina, E.A., 2017. NF-kappaB-Like Signaling Pathway REL2 in Immune Defenses of the Malaria Vector Anopheles gambiae . Front. Cell. Infect. Microbiol., 7(258. Zeng, L., Tan, J., Xue, M., Liu, L., Wang, M., Liang, L., Deng, J., Chen, W., Chen, Y., 2020. An engineering probiotic producing defensin-5 ameliorating dextran sodium sulfate-induced mice colitis via Inhibiting NF-kB pathway. J. Transl. Med., 18(1). Zhao, L., Alto, B.W., Smartt, C.T., Shin, D., 2018. Transcription Profiling for Defensins of Aedes aegypti (Diptera: Culicidae) During Development and in Response to Infection With Chikungunya and Zika Viruses. J. Med. Entomol., 55(1), 78–89. Additional Declarations No competing interests reported. Supplementary Files FigureS1.tif Figure S1. The effect of HD5 at different concentrations on plasmodium development in mosquitoes. Significance was determined by Mann-Whitney tests; *, P < 0.05; **, P < 0.01; ns, no significant difference. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4129796","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":285183565,"identity":"4c5e3b3f-94cf-480e-9034-fdc0faefbaaf","order_by":0,"name":"Tingting Liu","email":"","orcid":"","institution":"Army Medical University","correspondingAuthor":false,"prefix":"","firstName":"Tingting","middleName":"","lastName":"Liu","suffix":""},{"id":285183567,"identity":"c079fd8a-be6b-4216-add9-e87d89d74d22","order_by":1,"name":"Jing Wang","email":"","orcid":"","institution":"Army Medical University","correspondingAuthor":false,"prefix":"","firstName":"Jing","middleName":"","lastName":"Wang","suffix":""},{"id":285183568,"identity":"1ab69818-fc4a-48d4-94e5-b937c590026a","order_by":2,"name":"Xin Li","email":"","orcid":"","institution":"Army Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xin","middleName":"","lastName":"Li","suffix":""},{"id":285183569,"identity":"8bc4c5f4-a4c1-4ea8-9f03-665788975952","order_by":3,"name":"Shasha Yu","email":"","orcid":"","institution":"Army Medical University","correspondingAuthor":false,"prefix":"","firstName":"Shasha","middleName":"","lastName":"Yu","suffix":""},{"id":285183571,"identity":"802a974d-cb1a-4a30-aeb4-9b858a1cd13c","order_by":4,"name":"Dan Zheng","email":"","orcid":"","institution":"Army Medical University","correspondingAuthor":false,"prefix":"","firstName":"Dan","middleName":"","lastName":"Zheng","suffix":""},{"id":285183572,"identity":"64741137-7438-4e51-ab02-5c8baa160df5","order_by":5,"name":"Zhilong Liu","email":"","orcid":"","institution":"Army Medical University","correspondingAuthor":false,"prefix":"","firstName":"Zhilong","middleName":"","lastName":"Liu","suffix":""},{"id":285183574,"identity":"33d89bd5-e0d5-4332-9d3c-fa7286a314f7","order_by":6,"name":"Hui Hu","email":"","orcid":"","institution":"Army Medical University","correspondingAuthor":false,"prefix":"","firstName":"Hui","middleName":"","lastName":"Hu","suffix":""},{"id":285183576,"identity":"b9a61eac-f8b7-4747-b2ad-013e93b40ea2","order_by":7,"name":"Xuesen Yang","email":"","orcid":"","institution":"Army Medical University","correspondingAuthor":false,"prefix":"","firstName":"Xuesen","middleName":"","lastName":"Yang","suffix":""},{"id":285183578,"identity":"0052e637-c9a6-41a6-868d-cfb78b40377c","order_by":8,"name":"Ying Wang","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABDUlEQVRIiWNgGAWjYNACAyj9wUBCjp+Z+eADorTwACnGGRUWxpLtbMkGBHWAAEgLM8+ZikSD8zxmAnjNP3728Guegjt2+8VOp0nwtkkkGB9mMGNgqLGJxqnlTF6aNY/Bs+Qe6dxtEpJtEnlmhxnSHjAcS8ttwKHF7ECOmTGPweFkHpAWwzaJYqCW4waMDYdxazn/BklLYptE4uZmxjYJvFpu5Bg/BmqxA2s5cEYicQMzMxteLfY33pgxzjE4nMBzO3ezZUOFhLHEYTZmgwQ8fpHszzH+8ObPYXv22bkbb/8xqJPj7z//8cGHGhucWoCATQoYJ4moChJwKwcB5o8/gA7Er2YUjIJRMApGNAAAWLpbdWhHowQAAAAASUVORK5CYII=","orcid":"","institution":"Army Medical University","correspondingAuthor":true,"prefix":"","firstName":"Ying","middleName":"","lastName":"Wang","suffix":""}],"badges":[],"createdAt":"2024-03-19 11:13:48","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4129796/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4129796/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":53872949,"identity":"c0a7dad2-a28f-4561-b96f-b5563c349545","added_by":"auto","created_at":"2024-04-01 15:51:45","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":545733,"visible":true,"origin":"","legend":"\u003cp\u003eHD5 injection prior to infection decreased the intensity of oocysts in \u003cem\u003eAn. stephensi\u003c/em\u003e. aSchematic overview of HD5 treatment in \u003cem\u003eAn. stephensi\u003c/em\u003e. b The infection of \u003cem\u003eP. yoelii\u003c/em\u003e in midguts of \u003cem\u003eAn. stephensi\u003c/em\u003e (yellow dots represent oocysts). c The infection intensity of Plasmodium in mosquito between the HD5 and control groups. d The infection rates of the HD5 and control groups. Significance was determined by Mann-Whitney tests in (c), and by Chi-squaretest in (d); **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ns, no significant difference.\u003c/p\u003e","description":"","filename":"OnlineFigure1.png","url":"https://assets-eu.researchsquare.com/files/rs-4129796/v1/57967e5b20bf16d1ca889a00.png"},{"id":53872954,"identity":"db6c6e81-c8e7-46c4-a48c-140e06a86fb5","added_by":"auto","created_at":"2024-04-01 15:51:46","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":644888,"visible":true,"origin":"","legend":"\u003cp\u003eHD5 injection post-infection inhibits \u003cem\u003eP. yoelii\u003c/em\u003e infection in \u003cem\u003eAn. stephensi\u003c/em\u003e. a Schematic overview of HD5 microinjection into \u003cem\u003eAn. stephensi\u003c/em\u003e. b The infection of \u003cem\u003eP. yoelii\u003c/em\u003e in midguts of \u003cem\u003eAn. stephensi\u003c/em\u003e injected with ddH\u003csub\u003e2\u003c/sub\u003eO or HD5 at 12 hpi (red dots represent oocysts). c The infection intensity of plasmodium in mosquito injected with ddH\u003csub\u003e2\u003c/sub\u003eO or HD5 at 12 hpi. d The plasmodium infection rates of \u003cem\u003eAn. stephensi\u003c/em\u003e injected with ddH\u003csub\u003e2\u003c/sub\u003eO or HD5 at 12 hpi. e The oocyst counts of plasmodium in \u003cem\u003eAn. stephensi\u003c/em\u003e injected with ddH\u003csub\u003e2\u003c/sub\u003eO or HD5 at different time points. Significance was determined by Mann-Whitney tests in (c) and (e), and by Chi-squaretest in (d); *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; ns, no significant difference.\u003c/p\u003e","description":"","filename":"OnlineFigure2.png","url":"https://assets-eu.researchsquare.com/files/rs-4129796/v1/4f1a2b7fd2948368b84ff751.png"},{"id":53872951,"identity":"698f90ed-42c0-4251-95f1-e8c234d971f0","added_by":"auto","created_at":"2024-04-01 15:51:45","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":208540,"visible":true,"origin":"","legend":"\u003cp\u003eHD5 affects the TEP1 expression of \u003cem\u003eAn. stephensi\u003c/em\u003e with \u003cem\u003eP. yoelii\u003c/em\u003einfection. TEP1 transcriptional levels by Real-time quantitative PCR (a) and protein levels by Western blot analysis (b). Significance was determined by t-tests; *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01.\u003c/p\u003e","description":"","filename":"OnlineFigure3.png","url":"https://assets-eu.researchsquare.com/files/rs-4129796/v1/2cc956c8246430d133027f00.png"},{"id":53872950,"identity":"f5214281-856f-42b9-8f71-de9ee80e18f6","added_by":"auto","created_at":"2024-04-01 15:51:45","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":215428,"visible":true,"origin":"","legend":"\u003cp\u003eThe impact of HD5 treatment on activation of the Toll and Imd signaling pathways of \u003cem\u003eAn. stephensi\u003c/em\u003e. Gene expression analysis of MyD88 (a), Rel1 (b), Cactus (c), Imd (d), Rel2(e). Significance was determined by t-tests; *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ns, no significant difference.\u003c/p\u003e","description":"","filename":"OnlineFigure4.png","url":"https://assets-eu.researchsquare.com/files/rs-4129796/v1/7d2a76e2632985133315ae42.png"},{"id":53872952,"identity":"1fd60b89-1070-40a8-93ae-d2a4538f91bc","added_by":"auto","created_at":"2024-04-01 15:51:45","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":225961,"visible":true,"origin":"","legend":"\u003cp\u003eThe RNAi of TEP1 and MyD88 changed \u003cem\u003eP. yoelii\u003c/em\u003e oocyst intensity in HD5-treated and untreated mosquitoes. a The RNAi silencing efficiency of TEP1 and MyD88 in mosquitoes. b Oocyst counts when TEP1 and MyD88 were silenced by RNAi or not in HD5-treated and untreated mosquitoes. Significance was determined by t-test in (a), and by Mann-Whitney tests in (b); *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ***, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001; ns, no significant difference.\u003c/p\u003e","description":"","filename":"OnlineFigure5.png","url":"https://assets-eu.researchsquare.com/files/rs-4129796/v1/ccfcee8fe3d8ca2094beb64b.png"},{"id":56212111,"identity":"f3dbcfd9-16ce-4db9-a502-075521742b23","added_by":"auto","created_at":"2024-05-10 01:59:14","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1197296,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4129796/v1/c0af026d-44e6-41dc-abb5-82cb8fb56d3a.pdf"},{"id":53872953,"identity":"d67f0b4e-9421-4bb2-a77f-275a4d448b8a","added_by":"auto","created_at":"2024-04-01 15:51:45","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":231256,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eFigure S1.\u003c/strong\u003e The effect of HD5 at different concentrations on plasmodium development in mosquitoes. Significance was determined by Mann-Whitney tests; *, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05; **, \u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01; ns, no significant difference.\u003c/p\u003e","description":"","filename":"FigureS1.tif","url":"https://assets-eu.researchsquare.com/files/rs-4129796/v1/2bf3e7f777c4b841837b8f60.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"The Potential of Human Defensin 5 (HD5) as a Novel Strategy for Malaria Control: Inhibition of Plasmodium Development in Anopheles","fulltext":[{"header":"1. Introduction","content":"\u003cp\u003eMalaria, transmitted by the bite of female Anopheles mosquitoes, is a parasitic disease which caused estimated 249\u0026nbsp;million malaria cases and 608 000 deaths in 2021(WHO, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). Vector-based interventions are the principal methods available for reducing malaria. Nevertheless, the long and widespread use of chemical insecticides not only caused environmental pollution but also developed strong resistance in mosquitoes. Biological insecticides show relatively slow effects and short duration of killing efficiency also with the problem of resistance(Benelli, \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Therefore, it is urgent to look for novel strategies to fight against malaria and reduce mosquito vector competence(Hemingway, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In addition to extermination of mosquitoes, malaria transmission can be blocked by interfering the development of plasmodium in mosquitoes, to reduce the vector capacity of anopheles mosquitoes.\u003c/p\u003e \u003cp\u003eDefensin, a cys-rich cationic polypeptide, is an important component of the innate immunity in mammals, insects, and plants. It is involved in various biological reactions of host cellular immunity regulation against a variety of pathogenic microorganisms(Hazlett and Wu, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The human defensins are divided into two subfamilies based on their sequence homology and disulfide pairing, α and β(Lehrer and Lu, \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). It has been reported that β-defensins promoted the innate and adaptive immune responses of host(Kindrachuk et al., \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Human Defensin 5 (HD5) is a α subfamily short antimicrobial peptide secreted in Paneth cells located in the base of intestinal crypts(Cunliffe et al., \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Elphick et al., \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). HD5 contains three pairs of disulfide bonds and has three β reverse folded lamellar structure which exerts anti-microbial effect(de Leeuw et al., \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). HD5 has antimicrobial activity against bacteria, fungi, \u003cem\u003eTreponema pallidum\u003c/em\u003e and viruses. As well as inhibiting SARS-CoV-2 invasion and binding to ACE2(Li et al., \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Niv, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Wang et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), HD5 exhibits potent antiviral activity against pseudo typed viruses expressing SARS-CoV-2 spike proteins (Wang et al., \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Xu et al., \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Research showed that HD5 displayed a parasiticidal role against \u003cem\u003eToxoplasma gondii\u003c/em\u003e(Tanaka et al., \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Human primary endocervical epithelial cells (HPECs) participate in the mucosal immune defense by upregulating the secretion of HD5 through the activation of Toll-like receptor 4(TLR4)(Ma and Yang, \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2010\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eDefensin can also be synthesized by insect in the fat body and secreted into the haemolymph. Defensins are distinguished by a conserved cysteine motif between insect and mammalian(Zhao et al., \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). The researchers have identified various defensin gene isoforms, which were sequenced and used as a molecular marker for phylogenetic analysis(de Araujo et al., \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). \u003cem\u003eAn. stephensi\u003c/em\u003e is a vector endemic in Southeast Asia that transmits both malaria parasites \u003cem\u003ePlasmodium falciparum\u003c/em\u003e and \u003cem\u003eP. vivax\u003c/em\u003e(Ishtiaq et al., \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). The animal model of \u003cem\u003eAn. stephensi\u003c/em\u003e and \u003cem\u003ePlasmodium yoelii\u003c/em\u003e that infect rodents (mice) was often used to study the relationship between the vector and the disease(Simwela and Waters, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Based on the above analysis, it is wondering that whether HD5 can regulate the innate immunity of \u003cem\u003eAn. stephensi\u003c/em\u003e and increase the resistance to \u003cem\u003eP. yoelii\u003c/em\u003e. In this study, we present that HD5 could effectively inhibit \u003cem\u003eP. yoelii\u003c/em\u003e infection in \u003cem\u003eAn. stephensi\u003c/em\u003e by activation of the Toll signaling pathway. This is the first report to decipher the effect of HD5 on malaria vector competence of mosquitoes and the innate immunity related mechanisms. Understanding the effect of exogenous HD5 on innate immunity and vector competence of \u003cem\u003eAn. stephensi\u003c/em\u003e will be helpful to carry out mosquito genetic engineering or transfection methods to induce mosquitoes to produce HD5-like peptides to block malaria transmission. For example, HD5 can be genetically engineered to a symbiotic bacterium to feed mosquitoes, which may enhance the activity of Anopheles to defense plasmodium. It may provide a new strategy to defeat malaria and block the transmission.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. Mosquito rearing and infection\u003c/h2\u003e \u003cp\u003eThe \u003cem\u003eAn. stephensi\u003c/em\u003e Hor strain was maintained at 28 ℃ and 70\u0026ndash;80% relative humidity with a 12 h light/dark photocycle, according to the standard rearing procedures in the laboratory. Red fluorescence protein transgenic \u003cem\u003eP. yoelii\u003c/em\u003e BY265 strain was recovered and passed in mice. Three- to five-day-old female \u003cem\u003eAn. stephensi\u003c/em\u003e mosquitoes were fed on \u003cem\u003eP. yoelii\u003c/em\u003e infected 4\u0026ndash;6 -week-old Kunming mice with 5\u0026ndash;10% parasitemia at 24 ℃, as described previously(Conteh et al., \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Mosquitoes were anesthetized with carbon dioxide and dissected 8 days post-infection. The plasmodium oocysts were counted under a fluorescence microscope. Then the infection rate and the intensity were analyzed statistically.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. HD5 treatment\u003c/h2\u003e \u003cp\u003eThe HD5 polypeptide was directly synthesized by chemical methods with 95% purity and kindly donated by Professor Cheng Wang from Institute of Combined Injury of the Army Medical University. The dry powder of HD5 was dissolved into the stock solution (1mg/ml) and then diluted by ddH\u003csub\u003e2\u003c/sub\u003eO to a final working concentration (200 \u0026micro;g/ml) before injection. Three to five-day-old female \u003cem\u003eAn. stephensi\u003c/em\u003e were injected with 69 nl HD5 intrathoracically. Age-matched mosquitoes injected with 69 nl ddH\u003csub\u003e2\u003c/sub\u003eO were used as controls. Injection was conducted at 24 h prior to infection with \u003cem\u003eP. yoelii\u003c/em\u003e or 6 h, 12 h, 24 h, 72 h post-infection.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. RNA isolation, cDNA synthesis, and quantitative PCR\u003c/h2\u003e \u003cp\u003eTen female \u003cem\u003eAn. stephensi\u003c/em\u003e mosquitoes from each group were anesthetized with CO\u003csub\u003e2\u003c/sub\u003e exposure and used for gene transcript analysis at 24 h, and 72 h post-blood feeding. Total RNA was extracted in accordance with the instruction of the HiPure Universal RNA Mini Kit (Magen, Guangzhou, Guangdong, China) and reverse transcribed to cDNA using the Reverse Transcription Kit (Takara, Dalian, Liaoning, China). Then Real-time quantitative PCR was performed using the KAPA SYBR\u0026reg; FAST qPCR Kit (KAPA Biosystems, Wilmington, MA, USA) with a Bio-Rad CFX96 Touch\u0026trade; real-time PCR instrument (Bio-Rad, Hercules, CA, USA) to determine the transcriptional levels of immune genes, such as TEP1, MyD88, Rel1, Imd, Rel2 and Caspar, using the conserved S7 as the internal reference gene. The primers are listed in the Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e. The expression of each gene relative to the ribosomal S7 RNA was determined using the 2\u003csup\u003e\u0026minus;ΔΔCT\u003c/sup\u003e method.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eGene primers for quantitative PCR\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003ePrimer sequence (5\u0026prime; to 3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAs-TEP 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: ACCGATTGTCCAAGTTCTCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: AGCGCATCTGGTTCTGGTAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAs-MyD88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: TCGGCGGACAGTGACATTATTACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: TCACGATCCTTCAGACACAGTTGC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAs-Rel 1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: GAACTGGATTCGGTCACGCTAAGG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CGGCAGATAATCAGGTCGGACATG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAs-Cactus\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CGCTTGCAGATGCTAGTGGTCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CCGCTGTTCGCTGGCTGTTC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAs-Imd\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CGACCGGAATGCAGGTGTATCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CCGCAGAGCCACTCGTTGAAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAs-Rel 2\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: AATTACCCGCATTCTGATCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CTCCAGCACGTAGTTCACGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eAs-S7\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eF: CTAACGACACGAAGACCACAAGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eR: CAACCTGCAACGACAGCAAAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Western blot\u003c/h2\u003e \u003cp\u003eFifteen \u003cem\u003eAn. stephensi\u003c/em\u003e mosquitoes from each group were homogenized in RIPA lysis buffer (50 mM Tris, pH 7.4; 150 mM NaCl; 1% sodium deoxycholate; 1% Triton X-100; 1 mM EDTA; 0.1% SDS; 1\u0026times; protease inhibitor; 1\u0026times; phosphatase inhibitor) at 24 h and 72 h post blood meal. The total protein was extracted and denatured at 95\u0026deg;C for 10 min, then centrifuged at maximum speed for 5 min at room temperature. The supernatants were transferred to sterile microcentrifuge tubes for the following experiments. The protein samples were separated with 10% SDS-PAGE gels, and then transferred to a PVDF membrane for 1 h at 100 V. The membrane was blocked in 5% skimmed milk for 1 h at room temperature, then incubated with 1:2000 TEP1 antibody and the reference protein β-actin antibody at 4 ℃ overnight. The membranes were washed with 1\u0026times;TBST for 5 min by three times, then incubated with anti-rabbit secondary antibody for 1 h at room temperature. After being washed as above, the membrane signals were acquired with Chemi DOCTMMP Imaging System (BIO-RAD).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. RNA interference\u003c/h2\u003e \u003cp\u003eRNA interference was conducted to further confirm the role of the Toll signaling pathway in the impact of HD5 treatment on \u003cem\u003eAn. stephensi\u003c/em\u003e vector competence to \u003cem\u003eP. yoelii\u003c/em\u003e. \u003cem\u003eAn. stephensi\u003c/em\u003e cDNA was subjected to PCR using TEP1 and MyD88 gene-specific primers with a 5\u0026prime; extension of T7 promoter tags (5\u0026prime;-TAATACGACTCACTATAGGG-3\u0026prime;). A GFP fragment was used to make the control double-stranded RNA (dsRNA) (Table\u003cspan refid=\"Tab2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The dsRNA was transcribed in vitro using the PCR products as templates with the MEGAscript T7 Kit (Ambion Life Technologies, Austin, TX, USA), following the manufacturer\u0026rsquo;s instructions. Three to five-day-old female mosquitoes were injected intrathoracically with 69 nl dsTEP1 or dsMyD88 by a Nanoject II microinjector (Drummond Scientifc Co., Bromall, PA, USA). Equal amounts of dsGFP were injected as a control. The gene silencing efficiency was detected three days after dsRNA injection by qRT-PCR as described above. Then mosquitoes were challenged with \u003cem\u003eP. yoelii\u003c/em\u003e BY265RFP infection by blood feeding. The plasmodium oocysts in mosquitoes were counted microscopically 8 days post-infection. Meanwhile, the infection rates and intensities were calculated.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab2\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eSpecific gene primers for RNAi\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"2\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eTarget gene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003ePrimer sequence (5\u0026prime; to 3\u0026prime;)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT7-dsGFP\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TAATACGACTCACTATAGGGAGTCAAGTTCAACGTGTCCGGCG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TAATACGACTCACTATAGGGAGAGGACCATTTGATCGCGCTT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT7-dsTEP1\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TAATACGACTCACTATAGGGAGTCGGGCTGAAGGCGTTGACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TAATACGACTCACTATAGGGAGTGCCACCTTGAATCGTCTGA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003eT7-dsMyD88\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eF: TAATACGACTCACTATAGGGAGAGGTGAGCGTCAAAGAGACG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e\u0026nbsp;\u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eR: TAATACGACTCACTATAGGGAGTTTTACTGGCTTGTCCGGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Statistical analysis\u003c/h2\u003e \u003cp\u003eAll statistical analyses were performed using GraphPad Prism software (v.8.0) and SigmaStat software (Version 3.5). The Chi-square test was used to analyze the infection rate. The student\u0026rsquo;s t-test was used to compare normally distributed data, and the Mann-Whitney U-test was used for non-normally distributed data to compare the oocysts counts between the HD5 and control groups. P-values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 were considered statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Result","content":"\u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e3.1. HD5 injection prior to infection reduced the intensity of P. yoelii infection in An. stephensi\u003c/h2\u003e \u003cp\u003eTo investigate whether HD5 injection pretreatment affects the development of Plasmodium oocysts in \u003cem\u003eAn. stephensi\u003c/em\u003e, mosquitoes were injected intrathoracically with HD5 24 hours prior to injection. The oocysts from the control group and the HD5 treatment group were counted 8 days post-infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). The infection rates and intensities were compared between the two groups. As a result, HD5 treatment significantly decreased the oocyst counts compared to the control group (P\u0026thinsp;=\u0026thinsp;0.012\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb, \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). There was no significant difference in the infection rates between the control group and the HD5 treatment group(P\u0026thinsp;=\u0026thinsp;0.286) (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ed). These data suggested that HD5 treatment prior to infection could influence the oocysts development in \u003cem\u003eAn. stephensi\u003c/em\u003e and reduce the infection intensity but had no impact on the infection rate.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e3.2. HD5 treatment post-infection inhibited P. yoelii infection in An. stephensi\u003c/h2\u003e \u003cp\u003eThe above result inspired our interest whether injecting HD5 into mosquitoes after blood feeding also affects parasite infection. Thus, HD5 was injected intrathoracically into \u003cem\u003eAn. stephensi\u003c/em\u003e post-infection to investigate its influence on parasite development. The mosquitoes were dissected and the oocysts were counted 8 days post-infection (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea). We first investigated the effect of injection of HD5 at 12 hpi on plasmodium development in mosquitoes. The results showed that HD5 injection significantly reduced the oocyst counts comparing with the control group (P\u0026thinsp;=\u0026thinsp;0.0004\u0026thinsp;\u0026lt;\u0026thinsp;0.001) without effect on the infection rates (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ec, \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ed). Next, we further systematically observed the inhibitory effect of HD5 on plasmodium development in mosquitoes by injection at 6 h, 12 h, 24 h, 72 h post-infection. The results showed that injection with HD5 at 6 h, 12 h and 24 h post-infection significantly decreased the oocyst intensities comparing with the control groups. While there was no significant difference of oocysts counts between the HD5 and control groups when the injection was conducted at 72 hpi (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ee). The results implicated that HD5 could intervene the development of early stage of the oocyst. To sum up, our results demonstrated that HD5 effectively inhibited \u003cem\u003eP. yoelii\u003c/em\u003e development in \u003cem\u003eAn. stephensi\u003c/em\u003e if HD5 was injected prior to infection or given early after infection.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e3.3. HD5 treatment up-regulated the expression of TEP1 in An. stephensi\u003c/h2\u003e \u003cp\u003eThere have been researches indicating that the thioester-containing protein 1 (TEP1) plays a crucial role in mosquito resistance against malaria parasites (Volohonsky et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The midgut epithelium is invaded and crossed by Plasmodium ookinetes, triggering a robust TEP1 involved complement-like immune response (Reyes et al., \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Williams et al., \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). As the main protein responsible for mediating plasmodium lysis, TEP1 binds to the surface of ookinetes and mediates plasmodium lysis (Kwon et al., \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). To investigate whether HD5 treatment reduce the oocysts through affecting the expression of TEP1, Real-time quantitative PCR and Western Blot were performed to detect change of the transcription and protein levels of TEP1 by HD5 injection at 12 h after infectious blood meals. The results showed that HD5 treatment up-regulated both the transcriptional and protein levels of TEP1 in mosquitoes at 24 h and 72 h post-infection comparing with the control groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea, \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eb). These results suggested that HD5 treatment could increase the expression of TEP1 and improve the immune response of mosquitoes against malaria parasites.\u003c/p\u003e \u003ch2\u003e3.4. Toll signaling pathway was involved in the inhibitory effect of HD5 on P. yoelii development in An. stephensi\u003c/em\u003e \u003c/h2\u003e \u003cp\u003eParasites are killed by the mosquito's innate immune system(Cirimotich et al., \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). There are four major signaling pathways that have been demonstrated to defense against pathogens, among which the Toll and Imd signaling pathways are widely considered to be mainly involved in anti-plasmodium defense in mosquitoes(Clayton et al., \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Souvannaseng et al., \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). To explore whether HD5 treatment activates the Toll and Imd signaling pathways further influence the oocysts development, the key effector molecules in the signaling pathways were evaluated by qRT-PCR. We primarily detected the expression of MyD88, Rel1 and Cactus of the Toll signaling pathway. Surprisingly, both the expression of MyD88 and Rel1 were significantly upregulated at 24 hpi but not at 72 hpi by HD5 treatment at 12 hpi (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb). The negative regulatory factor Cactus expression was down-regulated at 24 hpi and up-regulated at 72 hpi (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ec). It indicated that the Toll signaling pathway was activated, especially at 24 hpi. In addition, we also detected the gene expression of Imd and Rel2, the two key molecules in the Imd signaling pathway. However, there was no significant change in these genes\u0026rsquo; expression between the HD5 and control groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ed, \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ee), which indicated that the Imd signaling pathway was not activated by HD5. These results suggested that the Toll signaling pathway might be activated due to HD5 treatment and result in upregulation of TEP1 expression and a decline in the oocyst counts.\u003c/p\u003e \u003ch2\u003e3.5. Inhibition of oocyst development in An. stephensi by HD5 could be reversed with the interference of the Toll signaling pathway\u003c/em\u003e \u003c/h2\u003e \u003cp\u003eTo confirm the role of Toll signaling pathway upregulation by HD5 treatment in the inhibition of malaria parasites development in mosquitoes, the gene expression of MyD88 and TEP1 were silenced respectively using RNA interference (RNAi) method, followed by observation of oocyst development. The gene expression of TEP1 and MyD88 were efficiently silenced according to the qRT-PCR results (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). As shown in the Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb, the inhibitory effect of HD5 on oocyst development disappeared when MyD88 expression was silenced by RNAi method which indicated that Toll signaling pathway played a key role in the transmission blocking of malaria by HD5. According to the data of TEP1 interference, there were more oocysts in the dsTEP1 group than that in the dsGFP group, regardless of whether HD5 was injected, which indicated the role of TEP1 in killing of plasmodium and was consistent with the previous report(Blandin et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). And, there were less oocysts in the HD5 group than that in the control group under injection of dsGFP, which further conformed the inhibitory effect of HD5 treatment on development of the oocysts. Nonetheless, HD5 still reduced the oocysts counts when TEP1 expression was silenced by RNAi, which indicated that HD5 treatment might also affect other immune effectors in the Toll signaling pathway to inhibit oocyst development in addition to TEP1. To sum up, these results suggested that activation of the Toll signaling pathway by HD5 significantly enhanced the defense of \u003cem\u003eAn. stephensi\u003c/em\u003e against malaria parasites.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eThe chemical and biological insecticides were commonly used in mosquito control with their own shortcomings. New strategies are urgently needed to block the transmission of malaria. For example, malaria transmission can be blocked by interfering with the parasite development in mosquito using transgenic engineering or transfection methods. In this study, we found that HD5 microinjection could effectively inhibit the development of malaria parasites in \u003cem\u003eAn. stephensi\u003c/em\u003e by enhancing innate immunity of mosquitoes.\u003c/p\u003e \u003cp\u003eHD5 has broad-spectrum antibacterial activity and highly effective antimicrobial activity, which has a promising application prospect (Ericksen et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Porter et al., \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e1997\u003c/span\u003e). HD5 can inhibit or kill Gram-positive (G\u003csup\u003e+\u003c/sup\u003e) bacteria, Gram-negative (G\u003csup\u003e\u0026minus;\u003c/sup\u003e) bacteria, fungi, spirochete, protozoa, and enveloped virus(Awang and Pongprayoon, \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Ericksen et al., \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Wanniarachchi et al., \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Whether HD5 has the parasiticidal effect on Plasmodium has not been studied so far. The influence of HD5 on the innate immunity of mosquitoes has also not been reported. We found that the oocysts were significantly reduced by microinjection of HD5 into Anopheles mosquitoes, indicating that HD5 can decrease the malaria transmission ability of Anopheles. The oocyst counts varied when HD5 was injected intrathoracically into \u003cem\u003eAn. stephensi\u003c/em\u003e at different time points prior to or post Plasmodium infection, which may be related to the development process of Plasmodium in the mosquitoes. The female mosquito was infected after ingesting a blood meal containing Plasmodium gametocytes. As zygotes form in the midgut, they develop into motile ookinetes that invade the midgut epithelium 18\u0026ndash;26 hours after infection(Volohonsky et al., \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). As the ookinetes migrate through the midgut epithelium and the oocysts develop on the basal side, the number of parasites is limited. The oocyst development was significantly inhibited when HD5 was given prior to infection or injected at 6 h, 12 h and 24 h but not 72 h post infection, possibly because the up-regulated immune response by HD5 mainly acted on the early stage of oocysts. In addition, we found that HD5 treatment at 12 hpi demonstrated the most significant inhibitory effect on oocysts development. Therefore, the practical application of HD5 in the future needs to consider the administration time.\u003c/p\u003e \u003cp\u003eBesides, the concentration of HD5 also needs to be considered. In this study, we also explored the effects of different concentrations of HD5 on the malaria vector competence of \u003cem\u003eAn. stephensi\u003c/em\u003e. The mosquitoes were injected with 69 nl HD5 at concentrations of 50 \u0026micro;g/ml, 100 \u0026micro;g/ml and 200 \u0026micro;g/ml. The results showed that administration of HD5 at concentrations of 100 \u0026micro;g/ml and 200 \u0026micro;g/ml led to significantly lower infection intensities of plasmodium than the control group, especially the 200 \u0026micro;g/ml concentration (P\u0026thinsp;=\u0026thinsp;0.0004\u0026thinsp;\u0026lt;\u0026thinsp;0.001). However, no effect was observed when the mosquitoes was injected with HD5 at a concentration of 50 \u0026micro;g/ml (Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe mosquito's innate immune system plays an important role at multiple stages of Plasmodium infection. Plasmodium ookinetes cross the mosquito midgut epithelium and reach the basal lamina, where they were killed by mosquito complement C3-like protein TEP1 (Blandin et al., \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Volohonsky et al., \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Our study found that the expression of TEP1 was up-regulated at 24 h and 72 h post-infection by HD5 treatment, indicating that TEP1 was involved in the effect of HD5 on restriction of plasmodium. Silence of TEP1 expression via RNAi didn\u0026rsquo;t reverse the impact of HD5 on the development of Plasmodium, indicating the involvement of other effector molecules. As we mentioned before, numerous studies have demonstrated that the anti-Plasmodium and antibacterial defenses of the mosquito are mainly regulated by the Toll and Imd signaling pathways(Blumberg et al., \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Ramirez et al., \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Zakovic and Levashina, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Detecting and comparing the expression of key molecules of these two signaling pathways showed that the Toll signaling pathway was up-regulated by HD5 injection, while the Imd pathway was not affected. The role of the Toll signaling pathway in the effect on malaria competence of anopheles was further confirmed by silencing MyD88, a key upstream molecule in the Toll signaling pathway. It is consistent with the study that activation of the Toll signaling pathway in \u003cem\u003eAnopheles gambiae\u003c/em\u003e by silencing Cactus promotes the activation of the complement-like system in mosquitoes, leading to elimination of the oocyte-cell malaria parasite(Barletta et al., \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). HD5 can ameliorate dextran sodium sulfate-induced mice colitis via inhibiting NF-kB pathway(Zeng et al., \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The results of present study indicated that HD5 could inhibit malaria parasites development in anopheles via affecting the innate immunity of mosquitoes.\u003c/p\u003e \u003cp\u003eHD5 used in the present study is a polypeptide with 95% purity directly synthesized by chemical methods. The dry powder of HD5 was dissolved and diluted with ddH\u003csub\u003e2\u003c/sub\u003eO to a final working concentration. Therefore, there were hardly any impurities and other solvents which might interfere the results. Although the purity of HD5 was very high, the impact of the possible impurities on the results cannot be excluded completely. This issue will be considered in our future study.\u003c/p\u003e \u003cp\u003eDefensins play an important role in maintaining the distribution and stability of intestinal flora(Sankaran-Walters et al., \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The mosquito\u0026rsquo;s gut microbiota interferes with Plasmodium infection and affects mosquito vectorial capacity. The composition of microbiome might change with shifts in temperature(de Angeli et al., \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). This natural barrier could be a new transmission-blocking strategies(Romoli and Gendrin, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Vinayagam S et al., \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). A gut symbiotic bacterium \u003cem\u003eSerratia\u003c/em\u003e strain Y1 was isolated from field-caught female \u003cem\u003eAnopheles sinensis\u003c/em\u003e and was found capable of enhancing mosquito resistance to Plasmodium infection through activation of mosquito immune responses(Bai et al., \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The effect of HD5 on malaria parasites in Anopheles can be observed more intuitively and conveniently by direct feeding. However, the challenge is to obtain large quantities of HD5 in vitro. It is difficult to extract native HD5 from intestinal fluid and chemical synthesis is expensive. A large amount of HD5 hopes to be obtained to meet the demand through the increasingly mature genetic engineering technology. A \u003cem\u003eSerratia\u003c/em\u003e AS1, isolated from Anopheles ovaries, was genetically engineered to a recombinant strain which could inhibit \u003cem\u003ePlasmodium falciparum\u003c/em\u003e infection of \u003cem\u003eAn. gambiae\u003c/em\u003e(Wang et al., \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In the future, we hope to construct HD5 into a symbiotic strain to express HD5 in vivo and enhance the activity of Anopheles to defense plasmodium.\u003c/p\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eIn conclusion, the present study was focused on the inhibitory effect of HD5 on plasmodium development in mosquitoes and the innate immunity related mechanisms. The results indicated that injection of HD5 intrathoracically into \u003cem\u003eAn. stephensi\u003c/em\u003e at various time points could decrease the \u003cem\u003eP. yoelii\u003c/em\u003e infection intensities through up-regulated the Toll signaling pathway. This study can help us to not only understand the effect and mechanism of HD5 on the malaria vector competence of \u003cem\u003eAn. stephensi\u003c/em\u003e, but also develop new strategies to block malaria transmission.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eSupplementary material\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe effect of HD5 at different concentrations on plasmodium development in mosquitoes can be found in Figure S1.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe would like to thank Prof. Cheng Wang for the supply of HD5 and the staff in our laboratory for their contribution in maintaining the mosquitoes. This work was supported by an award from the Key Laboratory of Extreme Environmental Medicine, Army Medical University.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eT Liu and Y W conceived and designed the study. T L and J W performed the research. T L, X L and Y W analyzed the data. D Z, Z L and H H contributed new methods. T L wrote the original draft, T L, S Y, X Y and Y W improved all the versions. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding support\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research was supported by the Scientific and Technological Innovation Capacity Enhancement Special Project of Army Medical University (2021XJS05), the National Natural Science Foundation of China (81971971), the National key research and development plan of China (2022YFC3103001-002).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in this published article and its supplementary materials. The original study data is with the authors.\u003c/p\u003e\n\u003ch2\u003eEthics standards\u003c/h2\u003e\n\u003cp\u003eAll procedures were carried out according to the guidelines for animal care and safe use of Army Medical University and were permitted by the Animal Institute of Army Medical University\u003c/p\u003e\n\u003ch2\u003eConsent to participate\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eAll authors consented to participate of this research.\u003c/p\u003e\n\u003ch2\u003eConsent to publish\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eAll authors gave final approval for publication.\u003c/p\u003e\n\u003ch2\u003eConflict of interest\u0026nbsp;\u003c/h2\u003e\n\u003cp\u003eThe authors declare that they have no competing interests.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAwang, T., Pongprayoon, P., 2021. The penetration of human defensin 5 (HD5) through bacterial outer membrane: simulation studies. J. Mol. Model., 27(10), 291.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBai, L., Wang, L., Vega-Rodr\u0026iacute;guez, J., Wang, G., Wang, S., 2019. A Gut Symbiotic Bacterium Serratia marcescens Renders Mosquito Resistance to Plasmodium Infection Through Activation of Mosquito Immune Responses. Front. Microbiol., 10(\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBarletta, A., Saha, B., Trisnadi, N., Talyuli, O., Raddi, G., Barillas-Mury, C., 2022. Hemocyte differentiation to the megacyte lineage enhances mosquito immunity against Plasmodium. eLife, 11(\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBenelli, G., 2015. Research in mosquito control: current challenges for a brighter future. Parasitol. Res., 114(8), 2801\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlandin, S., Shiao, S.H., Moita, L.F., Janse, C.J., Waters, A.P., Kafatos, F.C., Levashina, E.A., 2004. Complement-like protein TEP1 is a determinant of vectorial capacity in the malaria vector \u003cem\u003eAnopheles gambiae\u003c/em\u003e. Cell, 116(5), 661\u0026ndash;70.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBlumberg, B.J., Trop, S., Das, S., Dimopoulos, G., 2013. Bacteria- and IMD pathway-independent immune defenses against \u003cem\u003ePlasmodium falciparum\u003c/em\u003e in \u003cem\u003eAnopheles gambiae\u003c/em\u003e. PLoS One, 8(9), e72130.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCirimotich, C.M., Dong, Y., Garver, L.S., Sim, S., Dimopoulos, G., 2010. Mosquito immune defenses against Plasmodium infection. Developmental \u0026amp; Comparative Immunology, 34(4), 387\u0026ndash;395.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eClayton, A.M., Dong, Y., Dimopoulos, G., 2014. The Anopheles innate immune system in the defense against malaria infection. J. Innate Immun., 6(2), 169\u0026ndash;81.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eConteh, S., Chattopadhyay, R., Anderson, C., Hoffman, S.L., 2010. \u003cem\u003ePlasmodium yoelii\u003c/em\u003e-infected \u003cem\u003eA\u003c/em\u003e. \u003cem\u003estephensi\u003c/em\u003e inefficiently transmit malaria compared to intravenous route. PLoS One, 5(1), e8947.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCunliffe, R.N., Rose, F.R., Keyte, J., Abberley, L., Chan, W.C., Mahida, Y.R., 2001. Human defensin 5 is stored in precursor form in normal Paneth cells and is expressed by some villous epithelial cells and by metaplastic Paneth cells in the colon in inflammatory bowel disease. Gut, 48(2), 176\u0026ndash;85.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Angeli, D.D., Salloum, P.M., Poulin, R., 2023. Vector microbiome: will global climate change affect vector competence and pathogen transmission? Parasitol. Res., 122(1), 11\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Araujo, C.A., Lima, A.C., Jansen, A.M., Galvao, C., Jurberg, J., Costa, J., Azambuja, P., Waniek, P.J., 2015. Genes encoding defensins of important Chagas disease vectors used for phylogenetic studies. Parasitol. Res., 114(12), 4503\u0026ndash;11.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Leeuw, E., Burks, S.R., Li, X., Kao, J.P., Lu, W., 2007. Structure-dependent functional properties of human defensin 5. FEBS Lett., 581(3), 515\u0026ndash;20.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eElphick, D., Liddell, S., Mahida, Y.R., 2008. Impaired luminal processing of human defensin-5 in Crohn's disease: persistence in a complex with chymotrypsinogen and trypsin. Am. J. Pathol., 172(3), 702\u0026ndash;13.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEricksen, B., Wu, Z., Lu, W., Lehrer, R.I., 2005. Antibacterial activity and specificity of the six human {alpha}-defensins. Antimicrob. Agents Chemother., 49(1), 269\u0026ndash;75.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHazlett, L., Wu, M., 2011. Defensins in innate immunity. Cell Tissue Res., 343(1), 175\u0026ndash;88.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHemingway, J., 2014. The role of vector control in stopping the transmission of malaria: threats and opportunities. Philos. Trans. R. Soc. B.-Biol. Sci., 369(1645), 20130431.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIshtiaq, F., Swain, S., Kumar, S.S., 2021. \u003cem\u003eAnopheles stephensi\u003c/em\u003e (Asian Malaria Mosquito). Trends Parasitol., 37(6), 571\u0026ndash;572.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKindrachuk, J., Nijnik, A., Hancock, R.E.W., 2010. Host Defense Peptides: Bridging Antimicrobial and Immunomodulatory Activities. Comprehensive Natural Products II, Elsevier, 5(175\u0026ndash;216.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKwon, H., Arends, B.R., Smith, R.C., 2017. Late-phase immune responses limiting oocyst survival are independent of TEP1 function yet display strain specific differences in \u003cem\u003eAnopheles gambiae\u003c/em\u003e. Parasites Vectors, 10(1), 369.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLehrer, R., Lu, W., 2012. alpha-Defensins in human innate immunity. Immunol. Rev., 245(1), 84\u0026ndash;112.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi, D., Chen, P., Shi, T., Mehmood, A., Qiu, J., 2021. HD5 and LL-37 Inhibit SARS-CoV and SARS-CoV-2 Binding to Human ACE2 by Molecular Simulation. Interdiscip. Sci., 13(4), 766\u0026ndash;777.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMa, J.M., Yang, H.X., 2010. Role of Toll-like receptor 4 and human defensin 5 in primary endocervical epithelial cells. Chin. Med. J., 123(13), 1762\u0026ndash;7.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNiv, Y., 2020. Defensin 5 for prevention of SARS-CoV-2 invasion and Covid-19 disease. Med. Hypotheses, 143(110244.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePorter, E.M., van Dam, E., Valore, E.V., Ganz, T., 1997. Broad-spectrum antimicrobial activity of human intestinal defensin 5. Infect. Immun., 65(6), 2396\u0026ndash;401.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRamirez, J.L., Garver, L.S., Brayner, F.A., Alves, L.C., Rodrigues, J., Molina-Cruz, A., Barillas-Mury, C., 2014. The role of hemocytes in \u003cem\u003eAnopheles gambiae\u003c/em\u003e antiplasmodial immunity. J. Innate Immun., 6(2), 119\u0026ndash;28.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eReyes, R.V., Sousa, G.L., Sneed, S.D., Farrant, K.V., Christophides, G.K., Povelones, M., 2019. Stimulation of a protease targeting the LRIM1/APL1C complex reveals specificity in complement-like pathway activation in \u003cem\u003eAnopheles gambiae\u003c/em\u003e. PLoS One, 14(4), e0214753.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRomoli, O., Gendrin, M., 2018. The tripartite interactions between the mosquito, its microbiota and Plasmodium. Parasites Vectors, 11(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSankaran-Walters, S., Hart, R., Dills, C., 2017. Guardians of the Gut: Enteric Defensins. Front. Microbiol., 8(647.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSimwela, N.V., Waters, A.P., 2022. Current status of experimental models for the study of malaria. Parasitology, 149(6), 729\u0026ndash;750.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSouvannaseng, L., Hun, L.V., Baker, H., Klyver, J.M., Wang, B., Pakpour, N., Bridgewater, J.M., Napoli, E., Giulivi, C., Riehle, M.A., Luckhart, S., 2018. Inhibition of JNK signaling in the Asian malaria vector \u003cem\u003eAnopheles stephensi\u003c/em\u003e extends mosquito longevity and improves resistance to Plasmodium falciparum infection. PLoS Pathog., 14(11), e1007418.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eTanaka, T., Rahman, M.M., Battur, B., Boldbaatar, D., Liao, M., Umemiya-Shirafuji, R., Xuan, X., Fujisaki, K., 2010. Parasiticidal activity of human alpha-defensin-5 against \u003cem\u003eToxoplasma gondii\u003c/em\u003e. In Vitro Cell. Dev. Biol.-Anim., 46(6), 560\u0026ndash;5.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVinayagam S, Rajendran D, Sekar K, Renu K, Sattu K, 2023. The microbiota, the malarial parasite, and the mosquito [MMM] - A three-sided relationship. Mol. Biochem. Parasitol., Feb;253:111543.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVolohonsky, G., Hopp, A.K., Saenger, M., Soichot, J., Scholze, H., Boch, J., Blandin, S.A., Marois, E., 2017. Transgenic Expression of the Anti-parasitic Factor TEP1 in the Malaria Mosquito Anopheles gambiae. PLoS Pathog., 13(1), e1006113.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVolohonsky, G., Paul-Gilloteaux, P., Stafkova, J., Soichot, J., Salamero, J., Levashina, E.A., 2020. Kinetics of Plasmodium midgut invasion in Anopheles mosquitoes. PLoS Pathog., 16(9), e1008739.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, C., Wang, S., Li, D., Wei, D., Zhao, J., Wang, J., 2020. Human Intestinal Defensin 5 Inhibits SARS-CoV-2 Invasion by Cloaking ACE2. Gastroenterology, 159(3), 1145\u0026ndash;1147.e4.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang, S., Dos-Santos, A., Huang, W., Liu, K.C., Oshaghi, M.A., Wei, G., Agre, P., Jacobs-Lorena, M., 2017. Driving mosquito refractoriness to Plasmodium falciparum with engineered symbiotic bacteria. Science, 357(6358), 1399\u0026ndash;1402.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWanniarachchi, Y.A., Kaczmarek, P., Wan, A., Nolan, E.M., 2011. Human defensin 5 disulfide array mutants: disulfide bond deletion attenuates antibacterial activity against \u003cem\u003eStaphylococcus aureus\u003c/em\u003e. Biochemistry, 50(37), 8005\u0026ndash;17.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWHO, 2023. world malaria report2023.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWilliams, M., Contet, A., Hou, C.D., Levashina, E.A., Baxter, R., 2019. \u003cem\u003eAnopheles gambiae\u003c/em\u003e TEP1 forms a complex with the coiled-coil domain of LRIM1/APL1C following a conformational change in the thioester domain. PLoS One, 14(6), e0218203.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu, C., Wang, A., Marin, M., Honnen, W., Ramasamy, S., Porter, E., Subbian, S., Pinter, A., Melikyan, G.B., Lu, W., Chang, T.L., 2021. Human Defensins Inhibit SARS-CoV-2 Infection by Blocking Viral Entry. Viruses-Basel, 13(7).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZakovic, S., Levashina, E.A., 2017. NF-kappaB-Like Signaling Pathway REL2 in Immune Defenses of the Malaria Vector \u003cem\u003eAnopheles gambiae\u003c/em\u003e. Front. Cell. Infect. Microbiol., 7(258.\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZeng, L., Tan, J., Xue, M., Liu, L., Wang, M., Liang, L., Deng, J., Chen, W., Chen, Y., 2020. An engineering probiotic producing defensin-5 ameliorating dextran sodium sulfate-induced mice colitis via Inhibiting NF-kB pathway. J. Transl. Med., 18(1).\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eZhao, L., Alto, B.W., Smartt, C.T., Shin, D., 2018. Transcription Profiling for Defensins of \u003cem\u003eAedes aegypti\u003c/em\u003e (Diptera: Culicidae) During Development and in Response to Infection With Chikungunya and Zika Viruses. J. Med. Entomol., 55(1), 78\u0026ndash;89.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Human defensin 5, Anopheles stephensi, Plasmodium yoelii, Toll signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-4129796/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4129796/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eMalaria is a serious threat to human health. The existing vector-based interventions have shortcomings, such as the environmental pollution and strong resistance to chemical insecticides, the relatively slow effects of biological insecticides. It is urgent to look for novel strategies to control malaria such as by reducing mosquito vector competence. Human defensin 5 (HD5) has broad-spectrum and high antimicrobial activity. We are intrigued whether HD5 can block malaria transmission by inhibition of plasmodium development in mosquitoes. So, HD5 was injected intrathoracically into \u003cem\u003eAnopheles stephensi\u003c/em\u003e at various time points, and it was found that the infection intensity of \u003cem\u003ePlasmodium yoelii\u003c/em\u003e in \u003cem\u003eAn. stephensi\u003c/em\u003e was significantly reduced by HD5 treatment at 24 h prior to infection or 6 h, 12 h, 24 h post-infection, comparing with the control groups. Then, we found that HD5 treatment significantly up-regulated TEP1 expression at 24 h and 72 h post-infection (hpi), while the expression of MyD88 and Rel1 in the Toll pathway were up-regulated at 24 hpi. Furthermore, RNA interference of MyD88 which is the key upstream molecule of Toll signaling pathway abolished the HD5-induced resistance of mosquitoes against malaria parasites infection. These results indicated HD5 microinjection to mosquito could effectively inhibit the development of malaria parasites in \u003cem\u003eAn. stephensi\u003c/em\u003e via activating the Toll signaling pathway. This study provides theoretical reference for the application of HD5 in malaria transmission blocking strategies using genetic engineering or transfection methods.\u003c/p\u003e","manuscriptTitle":"The Potential of Human Defensin 5 (HD5) as a Novel Strategy for Malaria Control: Inhibition of Plasmodium Development in Anopheles","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-01 15:51:39","doi":"10.21203/rs.3.rs-4129796/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"5a2f22fb-5486-416a-96e0-e7f4bf6d9532","owner":[],"postedDate":"April 1st, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-05-10T01:57:57+00:00","versionOfRecord":[],"versionCreatedAt":"2024-04-01 15:51:39","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4129796","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4129796","identity":"rs-4129796","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.