Purification, structural characterization, and immunoregulatory activity of a polysaccharide from mulberry branch | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Purification, structural characterization, and immunoregulatory activity of a polysaccharide from mulberry branch Wei Xiang, Li Xu, Li Zheng, Qi-ao Zhang, Xiaowen Shi This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-3880414/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 13 Mar, 2024 Read the published version in Chemical and Biological Technologies in Agriculture → Version 1 posted 12 You are reading this latest preprint version Abstract In view of the fact that mulberry branch has not been effectively utilized and polysaccharide is one of the main active components in mulberry branch, this study aims to reveal the structure and immunomodulatory activity of its polysaccharide. A type of neutral polysaccharides, named Mulberry Branch Polysaccharide-2 (MBP-2), was separated from mulberry branch using DEAE-52 and Sephadex G-100. As analyzed, they were mainly composed of glucose with a molecular weight of approximately 21.7 kDa. Methylation analysis demonstrated that MBP-2 primary contained a →4)- α -D-Glc p- (1→, α -D-Glc p -(1→ and →4, 6)- α -D-Glc p -(1→ structure, which was validated by nuclear magnetic resonance (NMR). In addition, cellular experiments indicated that MBP-2 significantly enhanced the production of NO, TNF-α and IL-6 in RAW264.7 cells, unraveling the potential immunoregulatory activity of MBP-2. Further analysis showed that MBP-2 exerted their immunoregulatory activity mainly via binding with TLR4 to activate the downstream TRIF-dependent signaling pathways. Mulberry branch Homopolysaccharide Immunoregulatory activity Toll-like receptor Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Highlights A homopolysaccharide (MBP-2) was purified from mulberry branch; This study first reported the glucan polysaccharides from mulberry branch; MBP-2 had potent immunoregulatory activity; MBP-2 exerted immunoregulatory activity via the TRIF-dependent signaling pathway. 1. Introduction Mulberry ( Morus spp.) is a kind of cash crop widely planted in Asia[ 1 ]. Mulberry branch (Ramulus mori), a by-product of mulberry tree, has not been effectively utilized at present[ 2 ]. Modern studies have reported that mulberry branch is rich in multiple chemical components, including polysaccharides[ 3 ], flavone[ 4 ], and alkaloids[ 1 ]. Jialing 20 is an artificial triploid mulberry variety widely planted in Southwest China. In previous studies, we analyzed the small molecular components of its branch extract[ 5 ] and identified its active components that inhibit α-glucosidase[ 6 ] and butyrylcholinesterase[ 7 ]. However, there are few reports on the structure and activity of its polysaccharide. Polysaccharides are a class of complex carbohydrates with a large molecular weight. They are an assembly of monosaccharides linked together by glycosidic linkages and are widely found in plants, animals and microorganisms[ 8 ]. Mulberry branch polysaccharides (MBPs) as the main active ingredients have preferable anti-tumor[ 9 ], antioxidant[ 10 ], and hypoglycemic [ 11 ] activities. However, its immunoregulatory activity is rarely reported. Immunity is the capability of host to resist harmful microorganisms (viruses, bacteria, etc.).[ 12 ]. Human immunity is classically divided into innate and adaptive components, where macrophages play vital roles[ 13 ]. In response to a certain stimulus or damage, macrophages release a series of pro-inflammatory factors, such as nitric oxide (NO), tumor necrosis factor (TNF) -α, and interleukin (IL) -6, thereby regulating the immunity of the organism[ 14 ]. Native polysaccharides are commonly used as immunoregulators given their activity to activate macrophages and low toxicity[ 15 ]. The present study focused on Jialing 20 mulberry branch polysaccharide (MBP) to perform structural characterization and assessment for its potential immunoregulatory activity, so as to unravel more biological activity of MBP and help better utilize this biological resource. 2. Materials and methods 2.1 Materials and reagents DEAE-52 and Sephadex G-100 were purchased from Yuanye Bio-Technology Co., Ltd. (Shanghai, China). Lipopolysaccharides (LPS), TAK-242 and C29 were purchased from MedChemExpress Co., Ltd. (Monmouth Junction, NJ, USA). Trifluoroacetic acid (TFA) was purchased from ANPEL Laboratory Technologies Lnc. (Shanghai, China). Monosaccharide standards (Arabinose, fructose, fucose, galactose, galacturonic acid, glucose, glucuronic acid, guluronic acid, mannose, mannuronic acid, rhamnose, ribose, and xylose) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Dulbecco’s modified eagle’s medium (DMEM) was purchased from Solarbio (Beijing, China). Fetal bovine serum (FBS) and Trypsin were purchased from Gibco (Grand Island, NY, USA). Cell Counting Kit-8(CCK-8)was purchased from Nuoyang Biotechnology Co., Ltd. (Hangzhou, China). Griess reagent was purchased from Beyotime Biotechnology Co., Ltd. (Shanghai, China). TRIzol was purchased from Invitrogen (Carlsbad, CA, USA). PrimeScript™ RT Master Mix and SYBR Green™ Premix Ex Taq™ II were purchased from Takara (Kyoto, Japan). The Mouse TNF-α ELISA kit and IL-6 ELISA kit were purchased from Multi Sciences Co., Ltd. (Hangzhou, China). The RAW 264.7 cells were obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). 2.2 Preparation of MBPs Mulberry branch (Jialing20) was harvested and preprocessed according to the previous literature[ 16 ]. Dried branch material was crushed, decolorized with methanol, baked to remove residual methanol at 50 ℃, and dissolved in deionized water (m:v = 1:10, 2 h each for 3 times) at 90 ℃. The supernatant was collected and concentrated under reduced pressure using the rotary evaporator (Rotavapor R-100, Büchi, Flawil, Switzerland) at 60 ℃. Anhydrous alcohol was added until 90% concentration, followed by precipitation overnight to obtain crude polysaccharides. Protein impurities in the crude polysaccharides were removed using the Sevag method[ 17 ]. Briefly, the crude sample, chloroform, and n-butanol were fully mixed at a volume ratio of 25:4:1 and centrifuged at 8,000 r/min for 10 min. After repeating several times with the supernatant until there was no noticeable precipitation between two phases, the sample was concentrated under reduced pressure using the rotary evaporator. Experimental MBPs were obtained by freeze drying to constant weight with the freeze dryer (Lab-1C-50E, Biocool, Beijing, China). The MBPs (3 g) were dissolved in deionized water to a final concentration of 30 mg/mL and then loaded onto a cellulose DEAE-52 column. Elution was performed with graded NaCl (0, 0.1, 0.2, 0.5, 1, and 2 mol/L), and the eluate per 10 mL was collected by tubes and detected by the phenol-sulfuric acid method[ 18 ]. Corresponding elution curve was generated. The main DEAE-elution fraction was processed for dialysis, followed by further purification with the Sephadex G-100. Elution was performed using deionized water, and the eluate per 10 mL was collected by tubes and detected by the phenol-sulfuric acid method. The equivalent fractions were pooled and marked as MBP-2. 2.3 Molecular weight determination The average molecular weight of MBP-2 was analyzed by HPGPC on an Waters 1515 instrument (Waters, USA) equipped with an Waters 2414 Refractive Index using a Waters Ultrahydrogel 500 column. The mobile phase was 0.1 mol/L sodium nitrate (NaNO 3 ) -deionized water solution. Isocratic elution was obtained at 1 mL/min flow rate. Calibration curve was drawn by using various standard polyethylene glycol (PEG), and the following equation was finally estimated: Log(Mw)=-0.5603T + 12.973, R 2 = 0.9993. 2.4 Monosaccharide composition analysis Monosaccharide compositions were obtained by the high-performance anion-exchange chromatography (HPAEC). MBP-2 (5 mg) were dissolved in 2 mL 3 mol/L trifluoroacetic acid (TFA), hydrolyzed at 120 ℃ for 2 h, blow-dried with nitrogen flow, washed with methanol, and dried. Methanol washing was performed three times to remove TFA, and then the sample was dissolved in deionized water. The content (%) of each monosaccharide was determined using monosaccharide standard curves (13 monosaccharide standards). The chromatography system was ICS-5000 (Thermofisher Scientific, USA) equipped with Dionex™ CarboPac™ PA20 chromatographic column (3 × 150 mm, 10 µm) (column temperature, 30 ℃; injection volume, 5 µL; flow rate, 0.5 mL/min). Gradient elution was performed using the mobile phase A (0.1 mol/L NaOH) and B (0.1 mol/L NaOH, 0.2 mol/L NaAc) and monitored with an electrochemical detector. The elution procedures were as below: 0–30 min, 5%-20% B;30-30.1 min, 20%-40% B༛30.1–45 min, 40% B༛45-45.1 min, 40%-2.5% B༛45.1–60 min, 5% B. 2.5 Fourier-transform infrared (FT-IR) spectroscopy Samples were analyzed with the Nicolet iZ-10 FT-IR spectrometer (Thermofisher Scientific, USA) in the spectral range (4000 − 500) cm − 1 using pressed KBr tablets. 2.6 Glycosidic linkage analysis 2.6.1 Methylation reaction MBP-2 (1.1 mg) were dissolved in 500 µL anhydrous dimethyl sulfoxide (DMSO) and then successively incubated with 1 mg NaOH (30 min) and 50 µL iodomethane (1 h). Subsequently, 1 mL deionized water and 2 mL CH 2 Cl 2 were added to the solution and vortexed to mix. Centrifugation was performed to discard the upper aqueous phase. The procedure was repeated three times. The lower fraction (CH 2 Cl 2 ) was evaporated to dryness, added with 100 µL 2 mol/L TFA at 120 ℃ for 90 min, and evaporated to dryness again. Then, 50 µL 2 mol/L aqueous ammonia and 50 µL 1 mol/L NaBD 4 were added to mix and placed at room temperature for 2.5 h. The reaction was terminated by addition of 20 µL glacial acetic acid, and the solution was then blow-dried with nitrogen flow. CH 3 OH (250 µL) washing was performed twice, followed by blow-dryness with nitrogen flow again. 250 µL acetic anhydride was added, vortexed to mix, and reacted at 100 ℃ for 2.5 h. Deionized water (1 mL, 10 min) and CH 2 Cl 2 (500 µL) were successively added and vortexed to mix. The lower CH 2 Cl 2 phase was collected and processed for gas chromatography-mass spectrometry (GC-MS). 2.6.2 GC-MS GC was performed using the Agilent 7890A GC system (Agilent Technologies, USA) with the following parameters: injection volume, 1 µL; splitting ratio, 10:1; high purity helium carrier gas; flow rate, 1 mL/min. The injection temperature was 260 ℃. The column temperature started from 140 ℃ (2 min) to 230 ℃ (3 min) at a rate of 3 ℃/min. MS was performed using the Agilent 5977B Quadrupole MS-Detection System (Agilent Technologies, USA) with the following parameters: electron bombardment ion source (EI); injection temperature, 230 ℃; quadrupole temperature, 150 ℃; mass scan range (m/z): 30–600. 2.7 Nuclear magnetic resonance (NMR) analysis Purified MBP-2 (30 mg) were dissolved in 0.5 mL deuterated water (D 2 O) and centrifuged. The supernatant was collected and lyophilized. After repeating this cycle three times, the lyophilized sample was dissolved in 0.5 mL D 2 O and then loaded on the Avance 500 MHz NMR spectrometer (Bruker, Germany) to determine the one- dimensional ( 1 H-NMR, 13 C-NMR) and two-dimensional ( 1 H- 1 H COSY, NOESY, HSQC, HMBC) NMR spectra. 2.8 Cell viability analysis 2.8.1 Cell culture RAW 264.7 cells were cultured in complete Dulbecco's modified Eagle medium (DMEM) (supplemented with 10% FBS and 1% penicillin-streptomycin) in an incubator with a temperature of 37 ℃ and 5% CO 2 . 2.8.2 CCK-8 assay RAW 264.7 cells were inoculated into a 96-well plate at 5 × 10 4 cells/well and cultured overnight in a 37 ℃ incubator with 5% CO 2 . Subsequently, MBP-2 at different concentrations (1, 10, 50, 100, 200, 400, and 800 µg/mL) were added. 1 µg/mL LPS was added as positive control, while MBP-free medium of equal volume was added as blank control. After 24 h of incubation, CCK-8 method was performed with the optical density at a certain wavelength calculated. Cell survival rate was correspondingly obtained. 2.9 NO assay RAW 264.7 cells were cultured in mediums containing MBP-2 at different concentrations (50, 100, 200, and 400 µg/mL). The supernatant was collected after 24 h, and NO level was determined at 540 nm using an assay kit (Beyotime Biotechnology, Shanghai, China). 1 µg/mL LPS was added as positive control, while MBP-free medium of equal volume was added as blank control. 2.10 RT-qPCR RAW 264.7 cells were inoculated into a 12-well plate (1 × 10 6 cells/well) and cultured overnight in an incubator with 5% CO 2 and a temperature of 37 ℃. MBPs at different concentrations (50, 100, 200, and 400 µg/mL) were added to the cells. 1 µg/mL LPS was added as positive control, while MBP-free medium of equal volume was added as blank control. Each group contained 3 replicates. After 24 h, total RNA was extracted using Trizol according to the instructions and reversely transcribed into cDNA with the PrimeScript™ RT Master Mix (Takara, Kyoto, Japan). The cDNA was amplified by the PCR kit (TaKaRa), and RT-qPCR was performed using the Mastercycler (Eppendorf, Hamburg, Germany). GAPDH was used as the internal reference. Primer information was detailed in Table 1 . Table 1 Primer sequences conditions for RT-qPCR primers Gene Forward Reverse iNOS GTTCTCAGCCCAACAATACAAGA GTGGACGGGTCGATGTCAC IL-1β GGTGTGTGACGTTCCCATTA ATTGAGGTGGAGAGCTTTCAG IL-6 TAGTCCTTCCTACCCCAATTTCC CGCACTAGGTTTGCCGAGTA MCP-1 TCGCTCTGCTTGCTGCCATTC ACGTCCTGATCCTCTGCCTGTG GAPDH AACAGGGTGGTGGACCTCAT GGGATAGGGCCTCTCTTGCT 2.11 Examination of cytokine (IL-6, TNF-α) RAW 264.7 cells were inoculated into a 12-well plate at 1 × 10 6 cells/well and cultured overnight in a 37 ℃ incubator with 5% CO 2 . Subsequently, MBP-2 at different concentrations (1, 10, 50, 100, 200, and 400 µg/mL) were added. 1 µg/mL LPS was added as positive control, while MBP-free medium of equal volume was added as blank control. Each group contained 3 replicates. After 24 h, the cell suspension was centrifuged at 1000 ×g for 10 min. The supernatant was collected and processed for determination of IL-6 and TNF-α levels using the ELISA kit (Multi Sciences). The effect of MBP-2 on the production of IL-6 and TNF-α by RAW 264.7 cells was explored using TAK-242 (TLR4 inhibitor) and C29 (TLR2 inhibitor). Cell culture and cytokine examination were performed with the following grouping strategy: Blank control (Ctrl group), TAK-242 inhibitor group (TAK group), C29 inhibitor group (C29 group), MBPs group (MBP-2 group), and inhibitor + MBPs group (TAK + MBP-2, C29 + MBP-2, and TAK + C29 + MBP-2 group). Concentration of each reagent was 10 µg/mL for MBP-2, 1 µM for TAK-242, and 50 µM for C29. MBPs were added 1 h after addition of inhibitors. Each group contained 3 replicates. 3. Results and discussions 3.1 Purification, molecular weight, monosaccharide composition, and FT-IR spectrum of MBP-2 As shown in Fig. 1 A, the main DEAE-elution fraction comprised the majority of crude MBPs, marked as MBP-1. The MBP-1 was dialyzed using a 3 kDa dialysis bag, and the glucan gel-purified sample was labelled as MBP-2. As analyzed by HPGPC (Fig. 1 B), a single symmetric peak occurred at around 21.5 min, suggesting favorable homogeneity of the MBP-2. Further molecular weight fitting analysis demonstrated its number averaged molecular weights (Mn) as 15.3 kDa and weight-averaged molecular weights (Mw) as 21.7 kDa, and the Mw was smaller than the previous report[ 19 , 20 ]. The ion chromatogram of monosaccharide composition of the MBP-2 was shown in Fig. 1 C. Glucose was the main monosaccharide, indicating the potential glucan structure of the MBP-2. There was a distinct difference from the previous report in terms of the monosaccharide composition of MBPs[ 19 , 20 ]. As displayed in FT-IR in Fig. 1 D, a broad and intense absorption peak for stretching vibration of O-H appeared at 3431 cm − 1 , while an absorption peak for stretching vibration of C-H as the characteristic peak of saccharides appeared at 2926 cm − 1 [ 21 ]. The absorption peaks at 1634 cm − 1 was attributed to the stretching vibration of C-O[ 22 ]. The appearance of an absorption peak at 931 cm − 1 demonstrated asymmetric stretching vibration of the pyranose ring of d-glucose[ 23 ]. Besides, the stretch peak was at 849 cm − 1 , demonstrating α-glycosidic linkage[ 24 ]. Thus, the MBP-2 might be composed of d-glucose and α-glycosidic linkages[ 25 ]. No distinct peak was noticed at 1730 cm − 1 , which implied the absence of uronic acid[ 26 ], consistent with the monosaccharide composition analysis. 3.2 Methylation analysis GC-MS was performed following methylation reactions, and the total ion chromatogram was shown in Fig. S1 . Peak analysis demonstrated that, there were three main peaks (peak 1, 2, and 3) with the retention time of 8.87, 14.12, and 18.27 min, and the relative molar amount of 11.4%, 78.5%, and 6.75%, respectively (Table 2 ). The secondary MS data pointed out that the MBP-2 sample was mainly composed of a backbone linked by →4)- α -D-Glc p- (1→ and contains α -D-Glc p- (1→ and →4, 6)- α -D-Glc p -(1→ (Fig. S2). Table 2 Methylation analysis for MBP-2 Time(min) Major mass fragment ( m/z ) Deduced residues Molar ratio 8.87 239.19, 205.11, 162.08, 145.08, 118.05, 102.06, 87.04 T-Glc(p) 1 14.12 233.09, 162.07, 118.06, 87.05 4-Glc(p) 6.88 18.27 261.09, 231.07, 201.06, 142.05, 118.05, 102.06, 59.04 4, 6-Glc(p) 0.59 3.3 NMR analysis NMR was performed to further characterize the structure of saccharide subunits of MBP-2. The major hydrogen signals of MBP-2 varied between δ 3-5.5 ppm in 1 H-NMR (Fig. 2 A) while between δ 60–105 ppm in 13 C-NMR (Fig. 2 B). Usually, most of the α-anomeric protons vary between 5–6 ppm and the β-anomeric protons vary between 4–5 ppm[ 27 ]. Here, an anomeric proton signal appeared at δ 5.3 ppm in 1 H-NMR, demonstrating an α-configuration. In the meantime, an anomeric carbon signal appeared at δ 99.6 ppm in 13 C-NMR. Both signals were attributed to the H1 and C1 signals of →4)- α -D-Glc p -(1→[ 28 ]. According to the relative intensity, the residues were labelled as A, B, and C from high to low. The results of GC-MS showed that residue A had the highest intensity as 78.5%. Correspondingly, residue A had the strongest signals in 1 H-NMR and 13 C-NMR, and the signals at δ 3.9, 3.78, 3.77, 3.58 ppm, except δ5.34 ppm, all could be attributed to the hydrogen signals of residue A. Similarly, the signals at δ 99.6, 76.8, 73.3, 71.6, 71.2, and 60.5 ppm in 13 C-NMR were carbon signals of residue A. Based on the cross-peak signals in 1 H- 1 H COSY, the hydrogen signals of residue A, including H1, H2, H3, H4, and H5, were δ 5.34, 3.55, 3.91, 3.61, and 3.77 ppm, respectively (Fig. 2 C). While based on the cross-peak signals in HSQC, the carbon signals C1, C2, C3, C4, and C5 were respectively δ 99.56, 71.58, 73.29, 76.81, and 71.24 ppm (Fig. 2 F). The chemical shifts of H6a/6b (δ 3.79, and 3.54 ppm) and C6 (δ 60.51 ppm) were also obtained from HSQC. The downfield shift of C4 also indicated that the residue A was →4)- α -D-Glc p -(1→. The above results were also supported by previous reports[ 29 , 30 ]. As for residue B, the signals at δ 4.91, 3.54, and 3.88 ppm were H1-H3 signals. The other hydrogen signals of residue B were directly displayed by HSQC due to a high overlap between signals in COSY. Relative to A-C4, B-C4 did not develop downfield shift given the absence of substituents at the C4 site, consistent with the previous literature[ 31 ]. The chemical shift of residue C signals and corresponding attributes were obtained using the same method and shown in Table 3 . Table 3 1H and 13C NMR chemical shifts of MBP-2 recorded in D 2 O Glycosyl residues H1/C1 H2/C2 H3/C3 H4/C4 H5/C5 H6a,b/C6 A →4)- α -D-Glc p- (1→ 5.34 3.55 3.91 3.61 3.77 3.79 3.54 99.56 71.58 73.29 76.81 71.24 60.51 B α -D-Glc p- (1→ 4.91 3.54 3.88 3.36 3.77 3.89 3.37 98.58 71.7 73.29 69.32 76.71 60.51 C →4,6)- α -D-Glc p- (1→ 5.34 3.59 3.89 3.90 3.78 3.98 99.94 71.66 73.33 76.72 71.27 70.22 HMBC spectrum can display the inter-residue connectivities with glycosidic bonds. As shown in Fig. 2 E, there were cross-peaks between A-H4 (3.36 ppm) and A-C1 (99.56 ppm), and between A-H1 (5.34 ppm) and A-C4 (76.81 ppm), demonstrating a →4)- α -D-Glc p -(1→4)- α -D-Glc p -(1→ (ie. 4A1→4A1) structure. The cross-peaks between A-H1 (5.34 ppm) and C-C4 (76.72 ppm) and between C-H4 (3.90 ppm) and A-C1 (99.56 ppm) indicated a →4)- α -D-Glc p -(1→4, 6)- α -D-Glc p -(1→4)- α -D-Glc p- (1→ (ie. 4A1→4, 6C1) structure. The cross-peaks between A-H4 (3.61 ppm) and C-C1 (99.94 ppm) implied a →4, 6)- α -D –Glc p -(1→4)- α -D-Glc p -(1→ (ie. 4A1→4, 6C1) structure. The cross-signals between B-H1 (4.91 ppm) and C-C6 (70.22 ppm) suggested a α -D-Glc p- (1→6, 4)- α -D-Glc p- (1→ (ie. B1→6, 4C1) structure. In the NOESY spectrum (Fig. 2 D), the cross-peaks between A (H1) and A (H4), except for the existing signals in 1 H- 1 H COSY, further demonstrated the presence of the 4A1→4A1 structure, while the cross-peaks between A (H1) and C (H4) indicated the 4A1→4, 6C1 structure. Additionally, the glucose at positions 1 and 5 formed a ring, resulting in cross-peaks between A (H1) and A (H5) and between B (H1) and B (H5). The results were in line with the results of HMBC. Combining the above findings, the structure of MBP-2 might be characterized as that in Fig. 3 . Currently, glucan polysaccharides have been only reported in the root of white mulberry, while they are starchy polysaccharides with low water solubility[ 32 ]. The present study, for the first time, identified glucan polysaccharides from mulberry branch, which are water-soluble and worthy of further development and utilization. 3.4 Immunoregulatory activity 3.4.1 Cell survival and NO content To assess the safety of MBP-2, CCK-8 was performed to detect the viability of RAW 264.7 cells treated with MBP-2 (1-800 µg/mL) (Fig. 4 A). The result demonstrated that MBP-2 at a low concentration (1–10 µg/mL) significantly promoted the proliferation in RAW 264.7 cells (P < 0.05). Besides, the cell proliferation decreased when the concentration of MBP-2 increased, and the decline was extremely significant upon 800 µg/mL (P < 0.01). MBP-2 at 400 µg/mL contributed to the most promotive effect on cell proliferation and thus selected as the highest concentration in further analysis. NO is an important molecular messenger that can mediate a series of host-defense functions executed by activated macrophages. In addition, it is also a type of cytotoxic agent with immunoregulatory activity[ 33 ]. To explore the potential immunoregulatory activity of MBP-2, the NO produced by RAW 264.7 cells was examined. As shown in Fig. 4 B, MBP-2 at 50–400 µg/mL remarkably activated the production of NO by RAW 264.7 cells, consistent with the positive control (LPS). This suggested that MBP-2 might have immunostimulatory effects. 3.4.2 Expression of relevant cellular genes Inducible nitric oxide synthase (iNOS) can act through NO synthesis[ 34 ]. The immunoregulatory activity of native products is largely attributed to their capability of inducing multiple chemokines (e.g., MCP-1) and cytokines (e.g., TNF-α, IL-6) [ 35 , 36 ]. This study analyzed the effect of MBP-2 on expression of relevant genes in RAW 264.7. It was found that MBP-2 at 50–400 µg/mL significantly stimulated the expression of iNOS in RAW 264.7 cells (Fig. 5 A), consistent with the positive control (LPS) and NO production trend (Fig. 4 B). The result indicated that MBP-2 could activate the cellular defense functions by up-regulating iNOS expression and inducing NO synthesis. Moreover, MBP-2 also led to distinct up-regulation of IL-1β, IL-6, and MCP-1 gene in RAW 264.7 cells (Fig. 5 B-D), thereby exerting its immunoregulatory activity. 3.4.3 Cytokine level Cytokine is a class of bioactive macromolecular proteins that are produced upon an external stimulus to immune cells and play an important role in regulating the body's immunity and inflammatory response[ 37 , 38 ]. Pro-inflammatory cytokines TNF-α and IL-1β can act on macrophages to enhance immune responses and induce the expression of other immunoregulatory factors[ 39 ]. The current study found that MBP-2 significantly elevated the expression of TNF-α and IL-6 (Fig. 6 A-B), thereby exerting its immunoregulatory activity. The above findings demonstrated favorable immunoregulatory activity of MBP-2. It was reported that the immunoregulatory activity of MBPs might be attributed to their (1→4)-α-D- glucan backbone[ 40 ]. The immunoregulatory polysaccharides from traditional Chinese medicines have been applied in development of vaccines as adjuvants to promote the immune response of the body[ 41 , 42 ]. Therefore, the MBP-2 may have the potential to be used as vaccine adjuvants. The secretion of cytokines (IL-1β and TNF-α) can be mediated by multiple signals, among which Toll-like receptor (TLR) is the most significant[ 43 ]. Native polysaccharides can modulate immune cell functions in vitro by interactions with immunoreceptors, such as TLRs[ 44 ]. To investigate the mechanism underlying the immunoregulatory activity of MBP-2, this study selected C29 and TAK-242 for analysis. C29 is a TLR2 inhibitor that can block hTLR2/1 and hTLR2/6 signals[ 45 ]. TAK-242, also known as Resatorvid, is a selective inhibitor of TLR4 signal transduction that can down-regulate the expression of TLR4 downstream signaling molecule Myeloid differentiation factor 88 (MyD88) and TIR-domain-containing adaptor inducing interferon-β (TRIF) [ 46 , 47 ]. As analyzed, TAK-242 dramatically suppressed the production of IL-6 (P < 0.01), and the IL-6 level was not significantly different with that of the Ctrl group (Fig. 6 C). The result suggested that TAK-242 can inhibit the immunoregulatory activity of MBP-2. In addition, IL-6 production was also decreased by C29, but the effect was largely different with that of the Ctrl and TAK groups (P < 0.01). Similar results were obtained for TNF-α (Fig. 6 D). However, there was a large difference between the Ctrl and TAK groups when the MBP-2 concentration was too high or the concentration of inhibitors was too low, which might be due to the large stimulating effect of 10 µg/mL MBP-2 on TNF-α production. In general, the trend for IL-6 and TNF-α production was similar, and the TAK-242 was more potent than C29 in inhibiting their production (P < 0.01). Collectively, MBP-2 may exert its immunoregulatory activity via TLR4, during which TLR2-related pathways are potential participants. Research has revealed that TLR2 regulates downstream mitogen-activated protein kinase (MAPK) and nuclear factor kappa-B (NF-κB) via MYD88-dependent pathways, thereby playing its immune-stimulating effect. Except the MYD88-dependent pathways, TLR4 can also play its role through the TRIF pathway[ 48 ]. The current study found that the TLR4 inhibitor, TAK-242, had more significant suppressive effect on cytokine production in cells treated with MBP-2, as compared to the TLR2 inhibitor C29, indicating that MBP-2 acted mainly via the TRIF-dependent pathways while the MYD88 pathways might also make some contributions. Since the immunoregulatory activity of MBPs has been rarely reported, further studies are required. 4. Conclusion The present study obtained the main neutral sugar, named MBP-2, from mulberry branch through Sephadex G-100 gel purification. Their molecular weight is around 21.7 kDa, and they are mainly composed of a backbone linked by →4)- α -D-Glc p -(1→ and contains α -D-Glc p -(1→ and →4, 6)- α -D-Glc p- (1→. MBP-2 can significantly enhance the NO release from RAW 264.7 cells and exert their immunoregulatory activity via increasing the mRNA expression of relevant inflammatory factors (IL-6 and TNF-α) and promoting their release. With reference to the mechanism, we speculated that MBP-2 exert the immunoregulatory activity mainly via the downstream TRIF-dependent signaling pathways activated by TLR4 receptors. This study, for the first time, reported the glucan polysaccharides from mulberry branch and their immunoregulatory activity, providing new insight into the pharmacological activity of mulberry branch and its development and utilization. Declarations Author contributions Wei Xiang : Conceptualization, Methodology, Formal analysis, Investigation, Data curation, Writing–review & editing. Li Xu : Resources, Supervision. Li Zheng : Validation, Data curation. Qi-ao Zhang : Data curation. Xiaowen Shi : Visualization, Project administration, Funding acquisition. All authors read and approved the manuscript. Acknowledgements Not applicable. Funding This work was supported by the grants from Zhejiang Provincial Health Bureau Science Foundation, Hangzhou, China (No. 2022KY1253 to X.S.). Availability of data and materials Not applicable. Ethics approval and consent to participate Not applicable. Competing interests The authors declare that they have no competing interests Consent for publication Not applicable. References Yang, S.; Wang, B.L.; Xia, X.J.; Li, X.; Wang, R.Y.; Sheng, L.; Li, D.; Liu, Y.L.; Li, Y. Simultaneous quantification of three active alkaloids from a traditional Chinese medicine Ramulus Mori (Sangzhi) in rat plasma using liquid chromatography-tandem mass spectrometry. J Pharmaceut Biomed 2015 , 109 , 177-183, doi:10.1016/j.jpba.2015.02.019. Yu, W.S.; Chen, H.; Xiang, Z.H.; He, N.J. Preparation of polysaccharides from Ramulus mori, and their antioxidant, anti-inflammatory and antibacterial activities. Molecules 2019 , 24 , 24050856, doi:10.3390/molecules24050856. Feng, Z.; Peng, S.; Wu, Z.Y.; Jiao, L.A.; Xu, S.W.; Wu, Y.; Liu, Z.G.; Hu, Y.L.; Liu, J.G.; Wu, Y.; et al. Ramulus mori polysaccharide-loaded PLGA nanoparticles and their anti-inflammatory effects in vivo. Int J Biol Macromol 2021 , 182 , 2024-2036, doi:10.1016/j.ijbiomac.2021.05.200. Lu, H.P.; Jia, Y.N.; Yu, Y.; Xu, L. DNA protection activity of a hydroethanol extract and six polyphenol monomers from Morus alba L. (mulberry) twig. Int J Food Prop 2017 , 20 , 2207-2219, doi:10.1080/10942912.2017.1368554. Xiang, W.; Xia, Z.N.; Xu, L. UPLC-MS/MS profiling, antioxidant, α-glucosidase inhibitory, cholinesterase inhibitory, and cardiovascular protection potentials of Jialing 20 ( Morus multicaulis Perr.) Mulberry Branch Extract. Foods 2021 , 10 , 2659, doi:10.3390/foods10112659. Feng, F.S.; Xiang, W.; Gao, H.; Jia, Y.A.; Zhang, Y.S.; Zeng, L.S.; Chen, J.X.; Huang, X.Z.; Xu, L. Rapid screening of nonalkaloid alpha-glucosidase inhibitors from a Mulberry twig extract using enzyme-functionalized magnetic nanoparticles coupled with UPLC-MS/MS. J Agr Food Chem 2022 , 70 , 11958–11966, doi:10.1021/acs.jafc.2c03435. Zhu, Y.Y.; Xiang, W.; Shen, Y.; Jia, Y.A.; Zhang, Y.S.; Zeng, L.S.; Chen, J.X.; Zhou, Y.; Xue, X.; Huang, X.Z.; et al. New butyrylcholinesterase inhibitor derived from mulberry twigs, a kind of agricultural byproducts. Ind Crop Prod 2022 , 187 , 115535, doi:10.1016/j.indcrop.2022.115535. Kakar, M.U.; Kakar, I.U.; Mehboob, M.Z.; Zada, S.; Soomro, H.; Umair, M.; Iqbal, I.; Umer, M.; Shaheen, S.; Syed, S.F.; et al. A review on polysaccharides from Artemisia sphaerocephala Krasch seeds, their extraction, modification, structure, and applications. Carbohydrate Polymers 2021 , 252 , 117113, doi:10.1016/j.carbpol.2020.117113. Chen, Y.; Jiang, X.; Xie, H.; Li, X.; Shi, L. Structural characterization and antitumor activity of a polysaccharide from Ramulus mori. Carbohydrate Polymers 2018 , 190 , 232-239, doi:10.1016/j.carbpol.2018.02.036. Qiu, F.; He, T.Z.; Zhang, Y.Q. The isolation and the characterization of two polysaccharides from the branch bark of mulberry ( Morus alba L.). Archives of Pharmacal Research 2016 , 39 , 887-896, doi:10.1007/s12272-016-0742-8. Li, X.; Wang, L.; Gao, X.; Li, G.; Cao, H.; Song, D.; Cai, S.; Liang, T.; Zhang, B.; Du, G. Mechanisms of protective effect of Ramulus mori polysaccharides on renal injury in High-Fat Diet/Streptozotocin-Induced Diabetic Rats. Cellular Physiology and Biochemistry 2015 , 37 , 2125-2134, doi:10.1159/000438570. Yang, Q.; Cai, X.X.; Huang, M.C.; Wang, S.Y. A specific peptide with immunomodulatory activity from Pseudostellaria heterophylla and the action mechanism. J Funct Foods 2020 , 68 , 103887, doi:10.1016/j.jff.2020.103887. Cui, L.N.; Chen, L.; Yang, G.; Li, Y.K.; Qiao, Z.H.; Liu, Y.; Meng, Y.; Zhou, Y.F.; Sun, L. Structural characterization and immunomodulatory activity of a heterogalactan from Panax ginseng flowers. Food Research International 2021 , 140 , 109859, doi:10.1016/j.foodres.2020.109859. Yao, Y.; Zhu, Y.Y.; Ren, G.X. Immunoregulatory activities of polysaccharides from mung bean. Carbohydrate Polymers 2016 , 139 , 61-66, doi:10.1016/j.carbpol.2015.12.001. Yin, Z.H.; Liang, Z.H.; Li, C.Q.; Wang, J.M.; Ma, C.Y.; Kang, W.Y. Immunomodulatory effects of polysaccharides from edible fungus: a review. Food Science and Human Wellness 2021 , 10 , 393-400, doi:10.1016/j.fshw.2021.04.001. Xiang, W.; Xia, Z.; Xu, L. UPLC-MS/MS profiling, antioxidant, α-glucosidase inhibitory, cholinesterase inhibitory, and cardiovascular protection potentials of Jialing 20 ( Morus multicaulis Perr.) Mulberry Branch Extract. Foods 2021 , 10 , 2659, doi:10.3390/foods10112659. Zhu, H.J.; Tian, L.; Zhang, L.; Bi, J.X.; Song, Q.Q.; Yang, H.; Qiao, J.J. Preparation, characterization and antioxidant activity of polysaccharide from spent Lentinus edodes substrate. Int J Biol Macromol 2018 , 112 , 976-984, doi:10.1016/j.ijbiomac.2018.01.196. Dubois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.A.; Smith, F. Colorimetric method for determination of sugars and related substances. Analytical Chemistry 1956 , 28 , 350-356, doi:10.1021/ac60111a017. Ai, J.; Bao, B.; Battino, M.; Giampieri, F.; Chen, C.; You, L.J.; Cespedes-Acuna, C.L.; Ognyanov, M.; Tian, L.M.; Bai, W.B. Recent advances on bioactive polysaccharides from mulberry. Food Funct 2021 , 12 , 5219-5235, doi:10.1039/d1fo00682g. He, X.R.; Fang, J.C.; Ruan, Y.L.; Wang, X.X.; Sun, Y.; Wu, N.; Zhao, Z.F.; Chang, Y.; Ning, N.; Guo, H.; et al. Structures, bioactivities and future prospective of polysaccharides from Morus alba (white mulberry): A review. Food Chemistry 2018 , 245 , 899-910, doi:10.1016/j.foodchem.2017.11.084. Zhan, Q.; Wang, Q.; Lin, R.; He, P.; Lai, F.; Zhang, M.; Wu, H. Structural characterization and immunomodulatory activity of a novel acid polysaccharide isolated from the pulp of Rosa laevigata Michx fruit. Int J Biol Macromol 2020 , 145 , 1080-1090, doi:10.1016/j.ijbiomac.2019.09.201. Tang, N.; Wang, X.; Yang, R.; Liu, Z.; Liu, Y.; Tian, J.; Xiao, L.; Li, W. Extraction, isolation, structural characterization and prebiotic activity of cell wall polysaccharide from Kluyveromyces marxianus. Carbohydrate Polymers 2022 , 289 , 119457, doi:10.1016/j.carbpol.2022.119457. Liu, A.J.; Yu, J.; Ji, H.Y.; Zhang, H.C.; Zhang, Y.; Liu, H.P. Extraction of a novel cold-water-soluble polysaccharide from Astragalus membranaceus and its antitumor and immunological activities. Molecules 2017 , 23 , 62, doi:10.3390/molecules23010062. Molaei, H.; Jahanbin, K. Structural features of a new water-soluble polysaccharide from the gum exudates of Amygdalus scoparia Spach (Zedo gum). Carbohydrate Polymers 2018 , 182 , 98-105, doi:10.1016/j.carbpol.2017.10.099. Ji, H.Y.; Yu, J.; Liu, A.J. Structural characterization of a low molecular weight polysaccharide from Grifola frondosa and its antitumor activity in H22 tumor-bearing mice. J Funct Foods 2019 , 61 , 103472, doi:10.1016/j.jff.2019.103472. Zhang, A.Q.; Deng, J.Y.; Yu, S.Y.; Zhang, F.M.; Linhardt, R.J.; Sun, P.L. Purification and structural elucidation of a water-soluble polysaccharide from the fruiting bodies of the Grifola frondosa . Int J Biol Macromol 2018 , 115 , 221-226, doi:10.1016/j.ijbiomac.2018.04.061. Li, J.W.; Ai, L.Z.; Yang, Q.; Liu, Y.F.; Shan, L. Isolation and structural characterization of a polysaccharide from fruits of Zizyphus jujuba cv. Junzao. Int J Biol Macromol 2013 , 55 , 83-87, doi:10.1016/j.ijbiomac.2012.12.017. Chen, H.; Sun, J.; Liu, J.; Gou, Y.R.; Zhang, X.; Wu, X.N.; Sun, R.; Tang, S.X.; Kan, J.; Qian, C.L.; et al. Structural characterization and anti-inflammatory activity of alkali-soluble polysaccharides from purple sweet potato. Int J Biol Macromol 2019 , 131 , 484-494, doi:10.1016/j.ijbiomac.2019.03.126. Wang, J.Q.; Nie, S.P.; Cui, S.W.; Wang, Z.J.; Phillips, A.O.; Phillips, G.O.; Li, Y.J.; Xie, M.Y. Structural characterization and immunostimulatory activity of a glucan from natural Cordyceps sinensis . Food Hydrocolloid 2017 , 67 , 139-147, doi:10.1016/j.foodhyd.2017.01.010. Zhang, Z.; Guo, L.; Yan, A.; Feng, L.; Wan, Y. Fractionation, structure and conformation characterization of polysaccharides from Anoectochilus roxburghii. Carbohydrate Polymers 2020 , 231 , 115688, doi:10.1016/j.carbpol.2019.115688. Yang, X.; Wei, S.; Lu, X.; Qiao, X.; Simal-Gandara, J.; Capanoglu, E.; Wozniak, L.; Zou, L.; Cao, H.; Xiao, J.; et al. A neutral polysaccharide with a triple helix structure from ginger: Characterization and immunomodulatory activity. Food Chemistry 2021 , 350 , 129261, doi:10.1016/j.foodchem.2021.129261. Zhang, X.M.; Liao, W.F.; Cong, Q.F.; Dong, Q.; Ding, K. Isolation and structural characterization of the polysaccharides of Cortex Mori radices. Acta Chimica Sinica 2013 , 71 , 722-728, doi:10.6023/A13010109. Wendehenne, D.; Pugin, A.; Klessig, D.F.; Durner, J. Nitric oxide: Comparative synthesis and signaling in animal and plant cells. Trends in Plant Science 2001 , 6 , 177-183, doi:10.1016/s1360-1385(01)01893-3. Kashfi, K.; Kannikal, J.; Nath, N. Macrophage reprogramming and cancer therapeutics: Role of iNOS-Derived NO. Cells 2021 , 10 , 3194, doi:10.3390/cells10113194. Ryll, R.; Kumazawa, Y.; Yano, I. Immunological properties of trehalose dimycolate (cord factor) and other mycolic acid-containing glycolipids - A review. Microbiology and Immunology 2001 , 45 , 801-811, doi:10.1111/j.1348-0421.2001.tb01319.x. Ren, L.; Zhang, J.; Zhang, T.H. Immunomodulatory activities of polysaccharides from Ganoderma on immune effector cells. Food Chemistry 2021 , 340 , 127933, doi:10.1016/j.foodchem.2020.127933. Hwang, J.; Yadav, D.; Lee, P.C.W.; Jin, J.O. Immunomodulatory effects of polysaccharides from marine algae for treating cancer, infectious disease, and inflammation. Phytotherapy Research 2022 , 36 , 761-777, doi:10.1002/ptr.7348. Zhao, S.; Gao, Q.; Rong, C.B.; Wang, S.X.; Zhao, Z.K.; Liu, Y.; Xu, J.P. Immunomodulatory effects of edible and medicinal mushrooms and their bioactive immunoregulatory products. Journal of Fungi 2020 , 6 , 269, doi:10.3390/jof6040269. Wang, Y.F.; Zhang, Y.F.; Shao, J.J.; Ren, X.J.; Jia, J.X.; Li, B.H. Study on the immunomodulatory activity of a novel polysaccharide from the lichen Umbilicaria esculenta . Int J Biol Macromol 2019 , 121 , 846-851, doi:10.1016/j.ijbiomac.2018.10.080. Zhang, Y.; Zeng, Y.; Men, Y.; Zhang, J.G.; Liu, H.M.; Sun, Y.X. Structural characterization and immunomodulatory activity of exopolysaccharides from submerged culture of Auricularia auricula -judae. Int J Biol Macromol 2018 , 115 , 978-984, doi:10.1016/j.ijbiomac.2018.04.145. Wan, X.H.; Yin, Y.M.; Zhou, C.Z.; Hou, L.; Cui, Q.H.; Zhang, X.P.; Cai, X.Q.; Wang, Y.L.; Wang, L.Z.; Tian, J.Z. Polysaccharides derived from Chinese medicinal herbs: A promising choice of vaccine adjuvants. Carbohydrate Polymers 2022 , 276 , 118739, doi:10.1016/j.carbpol.2021.118739. Wang, D.Y.; Liu, Y.H.; Zhao, W. The adjuvant effects on vaccine and the immunomodulatory mechanisms of polysaccharides from Traditional Chinese Medicine. Frontiers in Molecular Biosciences 2021 , 8 , 655570, doi:10.3389/fmolb.2021.655570. Fan, S.R.; Wang, Y.X.; Zhang, Y.; Wu, Y.M.; Chen, X.M. Achyranthes bidentata polysaccharide activates nuclear factor-kappa B and promotes cytokine production in J774A.1 cells through TLR4/MyD88 signaling pathway. Frontiers in Pharmacology 2021 , 12 , 753599, doi:10.3389/fphar.2021.753599. Young, I.D.; Nepogodiev, S.A.; Black, I.M.; Le Gall, G.; Wittmann, A.; Latousakis, D.; Visnapuu, T.; Azadi, P.; Field, R.A.; Juge, N.; et al. Lipopolysaccharide associated with beta-2,6 fructan mediates TLR4-dependent immunomodulatory activity in vitro. Carbohydrate polymers 2022 , 277 , 118606, doi:10.1016/j.carbpol.2021.118606. Mistry, P.; Laird, M.H.W.; Schwarz, R.S.; Greene, S.; Dyson, T.; Snyder, G.A.; Xiao, T.S.; Chauhan, J.; Fletcher, S.; Toshchakov, V.Y.; et al. Inhibition of TLR2 signaling by small molecule inhibitors targeting a pocket within the TLR2 TIR domain. Proceedings of the National Academy of Sciences of the United States of America 2015 , 112 , 5455-5460, doi:10.1073/pnas.1422576112. Jiang, L.J.; Xu, Z.X.; Li, H.; Wu, M.F.; Wang, F.D.; Liu, S.Y.; Tao, J.L.; Feng, X. TAK-242 exerts a neuroprotective effect via suppression of the TLR4/MyD88/TRIF/NF-kappa B signaling pathway in a neonatal hypoxic-ischemic encephalopathy rat model. Molecular Medicine Reports 2020 , 22 , 1440-1448, doi:10.3892/mmr.2020.11220. Ono, Y.; Maejima, Y.; Saito, M.; Sakamoto, K.; Horita, S.; Shimomura, K.; Inoue, S.; Kotani, J. TAK-242, a specific inhibitor of Toll-like receptor 4 signalling, prevents endotoxemia-induced skeletal muscle wasting in mice. Scientific reports 2020 , 10 , 694, doi:10.1038/s41598-020-57714-3. Zhu, L.J.; Li, W.; Fan, Z.Y.; Ye, X.Y.; Lin, R.Y.; Ban, M.M.; Ren, L.Z.; Chen, X.Q.; Zhang, D.Y. Immunomodulatory activity of polysaccharide from Arca granosa Linnaeus via TLR4/MyD88/NF kappa B and TLR4/TRIF signaling pathways. J Funct Foods 2021 , 84 , 104579, doi:10.1016/j.jff.2021.104579. Additional Declarations No competing interests reported. Supplementary Files Supplementarymaterials.docx Cite Share Download PDF Status: Published Journal Publication published 13 Mar, 2024 Read the published version in Chemical and Biological Technologies in Agriculture → Version 1 posted Editorial decision: Revision requested 25 Feb, 2024 Reviews received at journal 24 Feb, 2024 Reviewers agreed at journal 06 Feb, 2024 Reviews received at journal 01 Feb, 2024 Reviewers agreed at journal 24 Jan, 2024 Reviewers agreed at journal 24 Jan, 2024 Reviews received at journal 23 Jan, 2024 Reviewers agreed at journal 23 Jan, 2024 Reviewers invited by journal 23 Jan, 2024 Editor assigned by journal 22 Jan, 2024 Submission checks completed at journal 22 Jan, 2024 First submitted to journal 19 Jan, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-3880414","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":268855686,"identity":"57a9115c-0c16-4aef-a8c0-5ac10282171b","order_by":0,"name":"Wei Xiang","email":"","orcid":"","institution":"Chongqing Institute of Traditional Chinese Medicine, Chongqing Traditional Chinese Medicine Hospital","correspondingAuthor":false,"prefix":"","firstName":"Wei","middleName":"","lastName":"Xiang","suffix":""},{"id":268855687,"identity":"443dde5b-011d-4f68-8d0d-e761f05c5313","order_by":1,"name":"Li Xu","email":"","orcid":"","institution":"Southwest University","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Xu","suffix":""},{"id":268855688,"identity":"e28a0334-e8a2-4d85-9a5e-a5cf9dc51812","order_by":2,"name":"Li Zheng","email":"","orcid":"","institution":"The Second Affiliated Hospital of Jiaxing University","correspondingAuthor":false,"prefix":"","firstName":"Li","middleName":"","lastName":"Zheng","suffix":""},{"id":268855689,"identity":"6f82366a-ea7c-4545-a60b-01a50e99044a","order_by":3,"name":"Qi-ao Zhang","email":"","orcid":"","institution":"Southwest University","correspondingAuthor":false,"prefix":"","firstName":"Qi-ao","middleName":"","lastName":"Zhang","suffix":""},{"id":268855690,"identity":"721a1bfe-5e8d-4f96-8004-5a047f1db9cd","order_by":4,"name":"Xiaowen Shi","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABIElEQVRIie3RsUrDQBjA8fs4SJYLWRMC+gpfCCiimFdpKehiQRBKB4fUg3PJAxyI72BHt8hBs4RkLbRDg+BW6CQOKl6lToaQUfD+y8fB/bjjjhCT6S9GdxMpTFYbPCGQbJdWJ0J5KMdnHchPSGwRsELtli0Ec1o/s/EyPrRBBI6oYiovkGxGirh3SSPxuRVFrHjpP3LgR/diQSEtEGSpiLfMGolLyUEwFKqHCibztVhYcJsidYQi6PUaiUXt12D4qWJNEs8RJQPOkH60EJcyfUqi4EHBjc+KzPs+BVqIz9lV9D5TfU22jzxASGeXT2l5zrx5M8Eqn9byWl+symv9ladxKAfT1dvoeM+VzeR3YUJIpifruF+3332ryWQy/ZO+AFmRXddzXuFjAAAAAElFTkSuQmCC","orcid":"","institution":"The Second Affiliated Hospital of Jiaxing University","correspondingAuthor":true,"prefix":"","firstName":"Xiaowen","middleName":"","lastName":"Shi","suffix":""}],"badges":[],"createdAt":"2024-01-20 02:44:42","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-3880414/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-3880414/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s40538-024-00563-3","type":"published","date":"2024-03-13T13:03:49+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":50106922,"identity":"b7de0982-b04f-45d8-9703-ad90de8c4861","added_by":"auto","created_at":"2024-01-24 16:08:29","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":135573,"visible":true,"origin":"","legend":"\u003cp\u003eElution profile on DEAE-52 column (A). HPGPC spectrum of MBP-2 (B). Ion chromatography profile of MBP-2 (C). FT-IR spectrum of MBP-2 (D).\u003c/p\u003e","description":"","filename":"image1.png","url":"https://assets-eu.researchsquare.com/files/rs-3880414/v1/952f29b69e3632fad5982afd.png"},{"id":50106923,"identity":"6919ee2f-0b42-4752-a34f-5f1152602f98","added_by":"auto","created_at":"2024-01-24 16:08:29","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":637317,"visible":true,"origin":"","legend":"\u003cp\u003e\u003csup\u003e1\u003c/sup\u003eH-NMR (A), \u003csup\u003e13\u003c/sup\u003eC-NMR (B), \u003csup\u003e1\u003c/sup\u003eH-\u003csup\u003e1\u003c/sup\u003eH COSY (C), NOESY (D), HMBC (E) and HSQC (F) spectrum of MBP-2\u003c/p\u003e","description":"","filename":"image2.png","url":"https://assets-eu.researchsquare.com/files/rs-3880414/v1/30f8caf94c2de3f0ec3a749e.png"},{"id":50106451,"identity":"f378edcb-aa64-49da-b4da-a6caab8e9549","added_by":"auto","created_at":"2024-01-24 16:00:29","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":39795,"visible":true,"origin":"","legend":"\u003cp\u003eChemical structural of MBP-2\u003c/p\u003e","description":"","filename":"image3.png","url":"https://assets-eu.researchsquare.com/files/rs-3880414/v1/e2c9201fc155cdac54f3a19a.png"},{"id":50106449,"identity":"3824a77c-b650-4840-acd9-ed6b62240f59","added_by":"auto","created_at":"2024-01-24 16:00:29","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":45830,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of MBP-2 on cell viability (A) and NO production (B) of RAW 264.7 cells\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e∗\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e∗∗\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, and \u003csup\u003e∗∗∗\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 compared to Ctrl\u003c/p\u003e","description":"","filename":"image4.png","url":"https://assets-eu.researchsquare.com/files/rs-3880414/v1/8c1de05809cc0aabd071594e.png"},{"id":50106924,"identity":"0288088d-aeae-43df-986f-429892f4733b","added_by":"auto","created_at":"2024-01-24 16:08:29","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":83804,"visible":true,"origin":"","legend":"\u003cp\u003emRNA levels of iNOS (A), IL-1β (B), IL-6 (C) and MCP-1 (D) as determined by RT-qPCR\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e∗\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e∗∗\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, and \u003csup\u003e∗∗∗\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 compared to Ctrl\u003c/p\u003e","description":"","filename":"image5.png","url":"https://assets-eu.researchsquare.com/files/rs-3880414/v1/2ab21feed21ea3449b1e3eee.png"},{"id":50106445,"identity":"04315a90-00ce-4133-b45c-a208174e6cf4","added_by":"auto","created_at":"2024-01-24 16:00:29","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":123502,"visible":true,"origin":"","legend":"\u003cp\u003eExpression of cytokines in RAW 264.7 (A-D):\u003c/p\u003e\n\u003cp\u003eA, Effect of MBP-2 on the expression of IL-6; B, Effect of MBP-2 on the expression of TNF-α; C, Effect of TLRs inhibitors on the expression of IL-6; D, Effect of TLRs inhibitors on the expression of TNF-α\u003c/p\u003e\n\u003cp\u003e\u003csup\u003e∗\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e∗∗\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, and \u003csup\u003e∗∗∗\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 compared to Ctrl; \u003csup\u003e##\u003c/sup\u003e\u003cem\u003eP \u0026lt;\u003c/em\u003e 0.01 compared to MBP-2; \u003csup\u003e\u0026amp;\u0026amp;\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.01, and \u003csup\u003e\u0026amp;\u0026amp;\u0026amp;\u003c/sup\u003e\u003cem\u003eP\u003c/em\u003e \u0026lt; 0.001 compared to TAK+MBP-2\u003c/p\u003e","description":"","filename":"image6.png","url":"https://assets-eu.researchsquare.com/files/rs-3880414/v1/77748ec06f423913ea40e2de.png"},{"id":52816294,"identity":"a3e844e4-fcb9-49b2-a857-78d844287ce2","added_by":"auto","created_at":"2024-03-16 13:03:58","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":1459678,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-3880414/v1/e7ee3c5e-6856-44e9-86c2-ea3eeec3c6df.pdf"},{"id":50106446,"identity":"3f29d770-6a1f-4efd-b952-cbed028d5658","added_by":"auto","created_at":"2024-01-24 16:00:29","extension":"docx","order_by":0,"title":"","display":"","copyAsset":false,"role":"supplement","size":247834,"visible":true,"origin":"","legend":"","description":"","filename":"Supplementarymaterials.docx","url":"https://assets-eu.researchsquare.com/files/rs-3880414/v1/107fbb5313cd100b5c3b1271.docx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Purification, structural characterization, and immunoregulatory activity of a polysaccharide from mulberry branch","fulltext":[{"header":"Highlights","content":"\u003col\u003e\n\u003cli\u003e\n\u003cp\u003eA homopolysaccharide (MBP-2) was purified from mulberry branch;\u003c/p\u003e\n\u003c/li\u003e\n\u003cli\u003e\n\u003cp\u003eThis study first reported the glucan polysaccharides from mulberry branch;\u003c/p\u003e\n\u003c/li\u003e\n\u003cli\u003e\n\u003cp\u003eMBP-2 had potent immunoregulatory activity;\u003c/p\u003e\n\u003c/li\u003e\n\u003cli\u003e\n\u003cp\u003eMBP-2 exerted immunoregulatory activity via the TRIF-dependent signaling pathway.\u003c/p\u003e\n\u003c/li\u003e\n\u003c/ol\u003e"},{"header":"1. Introduction","content":"\u003cp\u003eMulberry (\u003cem\u003eMorus\u003c/em\u003e spp.) is a kind of cash crop widely planted in Asia[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Mulberry branch (Ramulus mori), a by-product of mulberry tree, has not been effectively utilized at present[\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Modern studies have reported that mulberry branch is rich in multiple chemical components, including polysaccharides[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], flavone[\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], and alkaloids[\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. Jialing 20 is an artificial triploid mulberry variety widely planted in Southwest China. In previous studies, we analyzed the small molecular components of its branch extract[\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e] and identified its active components that inhibit α-glucosidase[\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e] and butyrylcholinesterase[\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. However, there are few reports on the structure and activity of its polysaccharide.\u003c/p\u003e \u003cp\u003ePolysaccharides are a class of complex carbohydrates with a large molecular weight. They are an assembly of monosaccharides linked together by glycosidic linkages and are widely found in plants, animals and microorganisms[\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Mulberry branch polysaccharides (MBPs) as the main active ingredients have preferable anti-tumor[\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e], antioxidant[\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e], and hypoglycemic [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e] activities. However, its immunoregulatory activity is rarely reported.\u003c/p\u003e \u003cp\u003eImmunity is the capability of host to resist harmful microorganisms (viruses, bacteria, etc.).[\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Human immunity is classically divided into innate and adaptive components, where macrophages play vital roles[\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. In response to a certain stimulus or damage, macrophages release a series of pro-inflammatory factors, such as nitric oxide (NO), tumor necrosis factor (TNF) -α, and interleukin (IL) -6, thereby regulating the immunity of the organism[\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. Native polysaccharides are commonly used as immunoregulators given their activity to activate macrophages and low toxicity[\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eThe present study focused on Jialing 20 mulberry branch polysaccharide (MBP) to perform structural characterization and assessment for its potential immunoregulatory activity, so as to unravel more biological activity of MBP and help better utilize this biological resource.\u003c/p\u003e"},{"header":"2. Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1 Materials and reagents\u003c/h2\u003e \u003cp\u003eDEAE-52 and Sephadex G-100 were purchased from Yuanye Bio-Technology Co., Ltd. (Shanghai, China). Lipopolysaccharides (LPS), TAK-242 and C29 were purchased from MedChemExpress Co., Ltd. (Monmouth Junction, NJ, USA). Trifluoroacetic acid (TFA) was purchased from ANPEL Laboratory Technologies Lnc. (Shanghai, China). Monosaccharide standards (Arabinose, fructose, fucose, galactose, galacturonic acid, glucose, glucuronic acid, guluronic acid, mannose, mannuronic acid, rhamnose, ribose, and xylose) were purchased from Sigma-Aldrich (St. Louis, MO, USA). Dulbecco\u0026rsquo;s modified eagle\u0026rsquo;s medium (DMEM) was purchased from Solarbio (Beijing, China). Fetal bovine serum (FBS) and Trypsin were purchased from Gibco (Grand Island, NY, USA). Cell Counting Kit-8(CCK-8)was purchased from Nuoyang Biotechnology Co., Ltd. (Hangzhou, China). Griess reagent was purchased from Beyotime Biotechnology Co., Ltd. (Shanghai, China). TRIzol was purchased from Invitrogen (Carlsbad, CA, USA). PrimeScript\u0026trade; RT Master Mix and SYBR Green\u0026trade; Premix Ex Taq\u0026trade; II were purchased from Takara (Kyoto, Japan). The Mouse TNF-α ELISA kit and IL-6 ELISA kit were purchased from Multi Sciences Co., Ltd. (Hangzhou, China).\u003c/p\u003e \u003cp\u003eThe RAW 264.7 cells were obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2 Preparation of MBPs\u003c/h2\u003e \u003cp\u003eMulberry branch (Jialing20) was harvested and preprocessed according to the previous literature[\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. Dried branch material was crushed, decolorized with methanol, baked to remove residual methanol at 50 ℃, and dissolved in deionized water (m:v\u0026thinsp;=\u0026thinsp;1:10, 2 h each for 3 times) at 90 ℃. The supernatant was collected and concentrated under reduced pressure using the rotary evaporator (Rotavapor R-100, B\u0026uuml;chi, Flawil, Switzerland) at 60 ℃. Anhydrous alcohol was added until 90% concentration, followed by precipitation overnight to obtain crude polysaccharides. Protein impurities in the crude polysaccharides were removed using the Sevag method[\u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. Briefly, the crude sample, chloroform, and n-butanol were fully mixed at a volume ratio of 25:4:1 and centrifuged at 8,000 r/min for 10 min. After repeating several times with the supernatant until there was no noticeable precipitation between two phases, the sample was concentrated under reduced pressure using the rotary evaporator. Experimental MBPs were obtained by freeze drying to constant weight with the freeze dryer (Lab-1C-50E, Biocool, Beijing, China).\u003c/p\u003e \u003cp\u003eThe MBPs (3 g) were dissolved in deionized water to a final concentration of 30 mg/mL and then loaded onto a cellulose DEAE-52 column. Elution was performed with graded NaCl (0, 0.1, 0.2, 0.5, 1, and 2 mol/L), and the eluate per 10 mL was collected by tubes and detected by the phenol-sulfuric acid method[\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. Corresponding elution curve was generated.\u003c/p\u003e \u003cp\u003eThe main DEAE-elution fraction was processed for dialysis, followed by further purification with the Sephadex G-100. Elution was performed using deionized water, and the eluate per 10 mL was collected by tubes and detected by the phenol-sulfuric acid method. The equivalent fractions were pooled and marked as MBP-2.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3 Molecular weight determination\u003c/h2\u003e \u003cp\u003eThe average molecular weight of MBP-2 was analyzed by HPGPC on an Waters 1515 instrument (Waters, USA) equipped with an Waters 2414 Refractive Index using a Waters Ultrahydrogel 500 column. The mobile phase was 0.1 mol/L sodium nitrate (NaNO\u003csub\u003e3\u003c/sub\u003e) -deionized water solution. Isocratic elution was obtained at 1 mL/min flow rate. Calibration curve was drawn by using various standard polyethylene glycol (PEG), and the following equation was finally estimated: Log(Mw)=-0.5603T\u0026thinsp;+\u0026thinsp;12.973, R\u003csup\u003e2\u003c/sup\u003e\u0026thinsp;=\u0026thinsp;0.9993.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4 Monosaccharide composition analysis\u003c/h2\u003e \u003cp\u003eMonosaccharide compositions were obtained by the high-performance anion-exchange chromatography (HPAEC). MBP-2 (5 mg) were dissolved in 2 mL 3 mol/L trifluoroacetic acid (TFA), hydrolyzed at 120 ℃ for 2 h, blow-dried with nitrogen flow, washed with methanol, and dried. Methanol washing was performed three times to remove TFA, and then the sample was dissolved in deionized water. The content (%) of each monosaccharide was determined using monosaccharide standard curves (13 monosaccharide standards).\u003c/p\u003e \u003cp\u003eThe chromatography system was ICS-5000 (Thermofisher Scientific, USA) equipped with Dionex\u0026trade; CarboPac\u0026trade; PA20 chromatographic column (3 \u0026times; 150 mm, 10 \u0026micro;m) (column temperature, 30 ℃; injection volume, 5 \u0026micro;L; flow rate, 0.5 mL/min). Gradient elution was performed using the mobile phase A (0.1 mol/L NaOH) and B (0.1 mol/L NaOH, 0.2 mol/L NaAc) and monitored with an electrochemical detector. The elution procedures were as below: 0\u0026ndash;30 min, 5%-20% B;30-30.1 min, 20%-40% B༛30.1\u0026ndash;45 min, 40% B༛45-45.1 min, 40%-2.5% B༛45.1\u0026ndash;60 min, 5% B.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5 Fourier-transform infrared (FT-IR) spectroscopy\u003c/h2\u003e \u003cp\u003eSamples were analyzed with the Nicolet iZ-10 FT-IR spectrometer (Thermofisher Scientific, USA) in the spectral range (4000\u0026thinsp;\u0026minus;\u0026thinsp;500) cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e using pressed KBr tablets.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6 Glycosidic linkage analysis\u003c/h2\u003e \u003cdiv id=\"Sec9\" class=\"Section3\"\u003e \u003ch2\u003e2.6.1 Methylation reaction\u003c/h2\u003e \u003cp\u003eMBP-2 (1.1 mg) were dissolved in 500 \u0026micro;L anhydrous dimethyl sulfoxide (DMSO) and then successively incubated with 1 mg NaOH (30 min) and 50 \u0026micro;L iodomethane (1 h). Subsequently, 1 mL deionized water and 2 mL CH\u003csub\u003e2\u003c/sub\u003eCl\u003csub\u003e2\u003c/sub\u003e were added to the solution and vortexed to mix. Centrifugation was performed to discard the upper aqueous phase. The procedure was repeated three times. The lower fraction (CH\u003csub\u003e2\u003c/sub\u003eCl\u003csub\u003e2\u003c/sub\u003e) was evaporated to dryness, added with 100 \u0026micro;L 2 mol/L TFA at 120 ℃ for 90 min, and evaporated to dryness again. Then, 50 \u0026micro;L 2 mol/L aqueous ammonia and 50 \u0026micro;L 1 mol/L NaBD\u003csub\u003e4\u003c/sub\u003e were added to mix and placed at room temperature for 2.5 h. The reaction was terminated by addition of 20 \u0026micro;L glacial acetic acid, and the solution was then blow-dried with nitrogen flow. CH\u003csub\u003e3\u003c/sub\u003eOH (250 \u0026micro;L) washing was performed twice, followed by blow-dryness with nitrogen flow again. 250 \u0026micro;L acetic anhydride was added, vortexed to mix, and reacted at 100 ℃ for 2.5 h. Deionized water (1 mL, 10 min) and CH\u003csub\u003e2\u003c/sub\u003eCl\u003csub\u003e2\u003c/sub\u003e (500 \u0026micro;L) were successively added and vortexed to mix. The lower CH\u003csub\u003e2\u003c/sub\u003eCl\u003csub\u003e2\u003c/sub\u003e phase was collected and processed for gas chromatography-mass spectrometry (GC-MS).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003e2.6.2 GC-MS\u003c/h2\u003e \u003cp\u003eGC was performed using the Agilent 7890A GC system (Agilent Technologies, USA) with the following parameters: injection volume, 1 \u0026micro;L; splitting ratio, 10:1; high purity helium carrier gas; flow rate, 1 mL/min. The injection temperature was 260 ℃. The column temperature started from 140 ℃ (2 min) to 230 ℃ (3 min) at a rate of 3 ℃/min.\u003c/p\u003e \u003cp\u003eMS was performed using the Agilent 5977B Quadrupole MS-Detection System (Agilent Technologies, USA) with the following parameters: electron bombardment ion source (EI); injection temperature, 230 ℃; quadrupole temperature, 150 ℃; mass scan range (m/z): 30\u0026ndash;600.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.7 Nuclear magnetic resonance (NMR) analysis\u003c/h2\u003e \u003cp\u003ePurified MBP-2 (30 mg) were dissolved in 0.5 mL deuterated water (D\u003csub\u003e2\u003c/sub\u003eO) and centrifuged. The supernatant was collected and lyophilized. After repeating this cycle three times, the lyophilized sample was dissolved in 0.5 mL D\u003csub\u003e2\u003c/sub\u003eO and then loaded on the Avance 500 MHz NMR spectrometer (Bruker, Germany) to determine the one- dimensional (\u003csup\u003e1\u003c/sup\u003eH-NMR, \u003csup\u003e13\u003c/sup\u003eC-NMR) and two-dimensional (\u003csup\u003e1\u003c/sup\u003eH-\u003csup\u003e1\u003c/sup\u003eH COSY, NOESY, HSQC, HMBC) NMR spectra.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.8 Cell viability analysis\u003c/h2\u003e \u003cdiv id=\"Sec13\" class=\"Section3\"\u003e \u003ch2\u003e2.8.1 Cell culture\u003c/h2\u003e \u003cp\u003eRAW 264.7 cells were cultured in complete Dulbecco's modified Eagle medium (DMEM) (supplemented with 10% FBS and 1% penicillin-streptomycin) in an incubator with a temperature of 37 ℃ and 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section3\"\u003e \u003ch2\u003e2.8.2 CCK-8 assay\u003c/h2\u003e \u003cp\u003eRAW 264.7 cells were inoculated into a 96-well plate at 5 \u0026times; 10\u003csup\u003e4\u003c/sup\u003e cells/well and cultured overnight in a 37 ℃ incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e. Subsequently, MBP-2 at different concentrations (1, 10, 50, 100, 200, 400, and 800 \u0026micro;g/mL) were added. 1 \u0026micro;g/mL LPS was added as positive control, while MBP-free medium of equal volume was added as blank control. After 24 h of incubation, CCK-8 method was performed with the optical density at a certain wavelength calculated. Cell survival rate was correspondingly obtained.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.9 NO assay\u003c/h2\u003e \u003cp\u003eRAW 264.7 cells were cultured in mediums containing MBP-2 at different concentrations (50, 100, 200, and 400 \u0026micro;g/mL). The supernatant was collected after 24 h, and NO level was determined at 540 nm using an assay kit (Beyotime Biotechnology, Shanghai, China). 1 \u0026micro;g/mL LPS was added as positive control, while MBP-free medium of equal volume was added as blank control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.10 RT-qPCR\u003c/h2\u003e \u003cp\u003eRAW 264.7 cells were inoculated into a 12-well plate (1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/well) and cultured overnight in an incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e and a temperature of 37 ℃. MBPs at different concentrations (50, 100, 200, and 400 \u0026micro;g/mL) were added to the cells. 1 \u0026micro;g/mL LPS was added as positive control, while MBP-free medium of equal volume was added as blank control. Each group contained 3 replicates. After 24 h, total RNA was extracted using Trizol according to the instructions and reversely transcribed into cDNA with the PrimeScript\u0026trade; RT Master Mix (Takara, Kyoto, Japan). The cDNA was amplified by the PCR kit (TaKaRa), and RT-qPCR was performed using the Mastercycler (Eppendorf, Hamburg, Germany). GAPDH was used as the internal reference. Primer information was detailed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003ePrimer sequences conditions for RT-qPCR primers\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGene\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eiNOS\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGTTCTCAGCCCAACAATACAAGA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGTGGACGGGTCGATGTCAC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL-1β\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGGTGTGTGACGTTCCCATTA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATTGAGGTGGAGAGCTTTCAG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eIL-6\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTAGTCCTTCCTACCCCAATTTCC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eCGCACTAGGTTTGCCGAGTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eMCP-1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCGCTCTGCTTGCTGCCATTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eACGTCCTGATCCTCTGCCTGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAACAGGGTGGTGGACCTCAT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGGATAGGGCCTCTCTTGCT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.11 Examination of cytokine (IL-6, TNF-α)\u003c/h2\u003e \u003cp\u003eRAW 264.7 cells were inoculated into a 12-well plate at 1 \u0026times; 10\u003csup\u003e6\u003c/sup\u003e cells/well and cultured overnight in a 37 ℃ incubator with 5% CO\u003csub\u003e2\u003c/sub\u003e. Subsequently, MBP-2 at different concentrations (1, 10, 50, 100, 200, and 400 \u0026micro;g/mL) were added. 1 \u0026micro;g/mL LPS was added as positive control, while MBP-free medium of equal volume was added as blank control. Each group contained 3 replicates. After 24 h, the cell suspension was centrifuged at 1000 \u0026times;g for 10 min. The supernatant was collected and processed for determination of IL-6 and TNF-α levels using the ELISA kit (Multi Sciences).\u003c/p\u003e \u003cp\u003eThe effect of MBP-2 on the production of IL-6 and TNF-α by RAW 264.7 cells was explored using TAK-242 (TLR4 inhibitor) and C29 (TLR2 inhibitor). Cell culture and cytokine examination were performed with the following grouping strategy: Blank control (Ctrl group), TAK-242 inhibitor group (TAK group), C29 inhibitor group (C29 group), MBPs group (MBP-2 group), and inhibitor\u0026thinsp;+\u0026thinsp;MBPs group (TAK\u0026thinsp;+\u0026thinsp;MBP-2, C29\u0026thinsp;+\u0026thinsp;MBP-2, and TAK\u0026thinsp;+\u0026thinsp;C29\u0026thinsp;+\u0026thinsp;MBP-2 group). Concentration of each reagent was 10 \u0026micro;g/mL for MBP-2, 1 \u0026micro;M for TAK-242, and 50 \u0026micro;M for C29. MBPs were added 1 h after addition of inhibitors. Each group contained 3 replicates.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results and discussions","content":"\u003cdiv id=\"Sec19\" class=\"Section2\"\u003e\n\u003ch2\u003e3.1 Purification, molecular weight, monosaccharide composition, and FT-IR spectrum of MBP-2\u003c/h2\u003e\n\u003cp\u003eAs shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eA, the main DEAE-elution fraction comprised the majority of crude MBPs, marked as MBP-1. The MBP-1 was dialyzed using a 3 kDa dialysis bag, and the glucan gel-purified sample was labelled as MBP-2.\u003c/p\u003e\n\u003cp\u003eAs analyzed by HPGPC (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eB), a single symmetric peak occurred at around 21.5 min, suggesting favorable homogeneity of the MBP-2. Further molecular weight fitting analysis demonstrated its number averaged molecular weights (Mn) as 15.3 kDa and weight-averaged molecular weights (Mw) as 21.7 kDa, and the Mw was smaller than the previous report[\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eThe ion chromatogram of monosaccharide composition of the MBP-2 was shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eC. Glucose was the main monosaccharide, indicating the potential glucan structure of the MBP-2. There was a distinct difference from the previous report in terms of the monosaccharide composition of MBPs[\u003cspan class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e20\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eAs displayed in FT-IR in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e1\u003c/span\u003eD, a broad and intense absorption peak for stretching vibration of O-H appeared at 3431 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, while an absorption peak for stretching vibration of C-H as the characteristic peak of saccharides appeared at 2926 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e[\u003cspan class=\"CitationRef\"\u003e21\u003c/span\u003e]. The absorption peaks at 1634 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e was attributed to the stretching vibration of C-O[\u003cspan class=\"CitationRef\"\u003e22\u003c/span\u003e]. The appearance of an absorption peak at 931 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e demonstrated asymmetric stretching vibration of the pyranose ring of d-glucose[\u003cspan class=\"CitationRef\"\u003e23\u003c/span\u003e]. Besides, the stretch peak was at 849 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, demonstrating \u0026alpha;-glycosidic linkage[\u003cspan class=\"CitationRef\"\u003e24\u003c/span\u003e]. Thus, the MBP-2 might be composed of d-glucose and \u0026alpha;-glycosidic linkages[\u003cspan class=\"CitationRef\"\u003e25\u003c/span\u003e]. No distinct peak was noticed at 1730 cm\u003csup\u003e\u0026minus;\u0026thinsp;1\u003c/sup\u003e, which implied the absence of uronic acid[\u003cspan class=\"CitationRef\"\u003e26\u003c/span\u003e], consistent with the monosaccharide composition analysis.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e\n\u003ch2\u003e3.2 Methylation analysis\u003c/h2\u003e\n\u003cp\u003eGC-MS was performed following methylation reactions, and the total ion chromatogram was shown in Fig. \u003cspan class=\"InternalRef\"\u003eS1\u003c/span\u003e. Peak analysis demonstrated that, there were three main peaks (peak 1, 2, and 3) with the retention time of 8.87, 14.12, and 18.27 min, and the relative molar amount of 11.4%, 78.5%, and 6.75%, respectively (Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003e). The secondary MS data pointed out that the MBP-2 sample was mainly composed of a backbone linked by \u0026rarr;4)-\u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep-\u003c/em\u003e(1\u0026rarr; and contains \u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep-\u003c/em\u003e(1\u0026rarr; and \u0026rarr;4, 6)-\u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep\u003c/em\u003e-(1\u0026rarr; (Fig. S2).\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab2\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 2\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003eMethylation analysis for MBP-2\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eTime(min)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eMajor mass fragment\u003c/p\u003e\n\u003cp\u003e(\u003cem\u003em/z\u003c/em\u003e)\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eDeduced residues\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eMolar ratio\u003c/p\u003e\n\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e8.87\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e239.19, 205.11, 162.08, 145.08, 118.05, 102.06, 87.04\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eT-Glc(p)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e1\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e14.12\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e233.09, 162.07, 118.06, 87.05\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4-Glc(p)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e6.88\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e18.27\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e261.09, 231.07, 201.06, 142.05, 118.05, 102.06, 59.04\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e4, 6-Glc(p)\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e0.59\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec21\" class=\"Section2\"\u003e\n\u003ch2\u003e3.3 NMR analysis\u003c/h2\u003e\n\u003cp\u003eNMR was performed to further characterize the structure of saccharide subunits of MBP-2. The major hydrogen signals of MBP-2 varied between \u0026delta; 3-5.5 ppm in \u003csup\u003e1\u003c/sup\u003eH-NMR (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eA) while between \u0026delta; 60\u0026ndash;105 ppm in \u003csup\u003e13\u003c/sup\u003eC-NMR (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eB). Usually, most of the \u0026alpha;-anomeric protons vary between 5\u0026ndash;6 ppm and the \u0026beta;-anomeric protons vary between 4\u0026ndash;5 ppm[\u003cspan class=\"CitationRef\"\u003e27\u003c/span\u003e]. Here, an anomeric proton signal appeared at \u0026delta; 5.3 ppm in \u003csup\u003e1\u003c/sup\u003eH-NMR, demonstrating an \u0026alpha;-configuration. In the meantime, an anomeric carbon signal appeared at \u0026delta; 99.6 ppm in \u003csup\u003e13\u003c/sup\u003eC-NMR. Both signals were attributed to the H1 and C1 signals of \u0026rarr;4)-\u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep\u003c/em\u003e-(1\u0026rarr;[\u003cspan class=\"CitationRef\"\u003e28\u003c/span\u003e]. According to the relative intensity, the residues were labelled as A, B, and C from high to low. The results of GC-MS showed that residue A had the highest intensity as 78.5%. Correspondingly, residue A had the strongest signals in \u003csup\u003e1\u003c/sup\u003eH-NMR and \u003csup\u003e13\u003c/sup\u003eC-NMR, and the signals at \u0026delta; 3.9, 3.78, 3.77, 3.58 ppm, except \u0026delta;5.34 ppm, all could be attributed to the hydrogen signals of residue A. Similarly, the signals at \u0026delta; 99.6, 76.8, 73.3, 71.6, 71.2, and 60.5 ppm in \u003csup\u003e13\u003c/sup\u003eC-NMR were carbon signals of residue A. Based on the cross-peak signals in \u003csup\u003e1\u003c/sup\u003eH-\u003csup\u003e1\u003c/sup\u003eH COSY, the hydrogen signals of residue A, including H1, H2, H3, H4, and H5, were \u0026delta; 5.34, 3.55, 3.91, 3.61, and 3.77 ppm, respectively (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eC). While based on the cross-peak signals in HSQC, the carbon signals C1, C2, C3, C4, and C5 were respectively \u0026delta; 99.56, 71.58, 73.29, 76.81, and 71.24 ppm (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eF). The chemical shifts of H6a/6b (\u0026delta; 3.79, and 3.54 ppm) and C6 (\u0026delta; 60.51 ppm) were also obtained from HSQC. The downfield shift of C4 also indicated that the residue A was \u0026rarr;4)-\u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep\u003c/em\u003e-(1\u0026rarr;. The above results were also supported by previous reports[\u003cspan class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e30\u003c/span\u003e].\u003c/p\u003e\n\u003cp\u003eAs for residue B, the signals at \u0026delta; 4.91, 3.54, and 3.88 ppm were H1-H3 signals. The other hydrogen signals of residue B were directly displayed by HSQC due to a high overlap between signals in COSY. Relative to A-C4, B-C4 did not develop downfield shift given the absence of substituents at the C4 site, consistent with the previous literature[\u003cspan class=\"CitationRef\"\u003e31\u003c/span\u003e]. The chemical shift of residue C signals and corresponding attributes were obtained using the same method and shown in Table\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\n\u003cdiv class=\"gridtable\"\u003e\n\u003ctable id=\"Tab3\" border=\"1\"\u003e\u003ccaption\u003e\n\u003cdiv class=\"CaptionNumber\"\u003eTable 3\u003c/div\u003e\n\u003cdiv class=\"CaptionContent\"\u003e\n\u003cp\u003e1H and 13C NMR chemical shifts of MBP-2 recorded in D\u003csub\u003e2\u003c/sub\u003eO\u003c/p\u003e\n\u003c/div\u003e\n\u003c/caption\u003e\n\u003cthead\u003e\n\u003ctr\u003e\n\u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eGlycosyl residues\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eH1/C1\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eH2/C2\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eH3/C3\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eH4/C4\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eH5/C5\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\n\u003cp\u003eH6a,b/C6\u003c/p\u003e\n\u003c/th\u003e\n\u003cth align=\"left\"\u003e\u0026nbsp;\u003c/th\u003e\n\u003c/tr\u003e\n\u003c/thead\u003e\n\u003ctbody\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eA\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u0026rarr;4)-\u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep-\u003c/em\u003e(1\u0026rarr;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e5.34\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.55\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.91\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.61\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.77\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.79\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.54\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e99.56\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e71.58\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e73.29\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e76.81\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e71.24\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e60.51\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eB\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep-\u003c/em\u003e(1\u0026rarr;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e4.91\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.54\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.88\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.36\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.77\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.89\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.37\u003c/p\u003e\n\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e98.58\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e71.7\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e73.29\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e69.32\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e76.71\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e60.51\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003eC\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\n\u003cp\u003e\u0026rarr;4,6)-\u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep-\u003c/em\u003e(1\u0026rarr;\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e5.34\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.59\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.89\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.90\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.78\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e3.98\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003ctr\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e99.94\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e71.66\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e73.33\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e76.72\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e71.27\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"char\" char=\".\"\u003e\n\u003cp\u003e70.22\u003c/p\u003e\n\u003c/td\u003e\n\u003ctd align=\"left\"\u003e\u0026nbsp;\u003c/td\u003e\n\u003c/tr\u003e\n\u003c/tbody\u003e\n\u003c/table\u003e\n\u003c/div\u003e\n\u003cp\u003eHMBC spectrum can display the inter-residue connectivities with glycosidic bonds. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eE, there were cross-peaks between A-H4 (3.36 ppm) and A-C1 (99.56 ppm), and between A-H1 (5.34 ppm) and A-C4 (76.81 ppm), demonstrating a \u0026rarr;4)-\u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep\u003c/em\u003e-(1\u0026rarr;4)-\u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep\u003c/em\u003e-(1\u0026rarr; (ie. 4A1\u0026rarr;4A1) structure. The cross-peaks between A-H1 (5.34 ppm) and C-C4 (76.72 ppm) and between C-H4 (3.90 ppm) and A-C1 (99.56 ppm) indicated a \u0026rarr;4)-\u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep\u003c/em\u003e-(1\u0026rarr;4, 6)-\u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep\u003c/em\u003e-(1\u0026rarr;4)-\u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep-\u003c/em\u003e(1\u0026rarr; (ie. 4A1\u0026rarr;4, 6C1) structure. The cross-peaks between A-H4 (3.61 ppm) and C-C1 (99.94 ppm) implied a \u0026rarr;4, 6)-\u003cem\u003e\u0026alpha;\u003c/em\u003e-D \u0026ndash;Glc\u003cem\u003ep\u003c/em\u003e-(1\u0026rarr;4)-\u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep\u003c/em\u003e-(1\u0026rarr; (ie. 4A1\u0026rarr;4, 6C1) structure. The cross-signals between B-H1 (4.91 ppm) and C-C6 (70.22 ppm) suggested a \u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep-\u003c/em\u003e(1\u0026rarr;6, 4)-\u003cem\u003e\u0026alpha;\u003c/em\u003e-D-Glc\u003cem\u003ep-\u003c/em\u003e(1\u0026rarr; (ie. B1\u0026rarr;6, 4C1) structure.\u003c/p\u003e\n\u003cp\u003eIn the NOESY spectrum (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e2\u003c/span\u003eD), the cross-peaks between A (H1) and A (H4), except for the existing signals in \u003csup\u003e1\u003c/sup\u003eH-\u003csup\u003e1\u003c/sup\u003eH COSY, further demonstrated the presence of the 4A1\u0026rarr;4A1 structure, while the cross-peaks between A (H1) and C (H4) indicated the 4A1\u0026rarr;4, 6C1 structure. Additionally, the glucose at positions 1 and 5 formed a ring, resulting in cross-peaks between A (H1) and A (H5) and between B (H1) and B (H5). The results were in line with the results of HMBC. Combining the above findings, the structure of MBP-2 might be characterized as that in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e3\u003c/span\u003e.\u003c/p\u003e\n\u003cp\u003eCurrently, glucan polysaccharides have been only reported in the root of white mulberry, while they are starchy polysaccharides with low water solubility[\u003cspan class=\"CitationRef\"\u003e32\u003c/span\u003e]. The present study, for the first time, identified glucan polysaccharides from mulberry branch, which are water-soluble and worthy of further development and utilization.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec22\" class=\"Section2\"\u003e\n\u003ch2\u003e3.4 Immunoregulatory activity\u003c/h2\u003e\n\u003cdiv id=\"Sec23\" class=\"Section3\"\u003e\n\u003ch2\u003e3.4.1 Cell survival and NO content\u003c/h2\u003e\n\u003cp\u003eTo assess the safety of MBP-2, CCK-8 was performed to detect the viability of RAW 264.7 cells treated with MBP-2 (1-800 \u0026micro;g/mL) (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eA). The result demonstrated that MBP-2 at a low concentration (1\u0026ndash;10 \u0026micro;g/mL) significantly promoted the proliferation in RAW 264.7 cells (P\u0026thinsp;\u0026lt;\u0026thinsp;0.05). Besides, the cell proliferation decreased when the concentration of MBP-2 increased, and the decline was extremely significant upon 800 \u0026micro;g/mL (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). MBP-2 at 400 \u0026micro;g/mL contributed to the most promotive effect on cell proliferation and thus selected as the highest concentration in further analysis.\u003c/p\u003e\n\u003cp\u003eNO is an important molecular messenger that can mediate a series of host-defense functions executed by activated macrophages. In addition, it is also a type of cytotoxic agent with immunoregulatory activity[\u003cspan class=\"CitationRef\"\u003e33\u003c/span\u003e]. To explore the potential immunoregulatory activity of MBP-2, the NO produced by RAW 264.7 cells was examined. As shown in Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB, MBP-2 at 50\u0026ndash;400 \u0026micro;g/mL remarkably activated the production of NO by RAW 264.7 cells, consistent with the positive control (LPS). This suggested that MBP-2 might have immunostimulatory effects.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec24\" class=\"Section3\"\u003e\n\u003ch2\u003e3.4.2 Expression of relevant cellular genes\u003c/h2\u003e\n\u003cp\u003eInducible nitric oxide synthase (iNOS) can act through NO synthesis[\u003cspan class=\"CitationRef\"\u003e34\u003c/span\u003e]. The immunoregulatory activity of native products is largely attributed to their capability of inducing multiple chemokines (e.g., MCP-1) and cytokines (e.g., TNF-\u0026alpha;, IL-6) [\u003cspan class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e36\u003c/span\u003e]. This study analyzed the effect of MBP-2 on expression of relevant genes in RAW 264.7. It was found that MBP-2 at 50\u0026ndash;400 \u0026micro;g/mL significantly stimulated the expression of iNOS in RAW 264.7 cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eA), consistent with the positive control (LPS) and NO production trend (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e4\u003c/span\u003eB). The result indicated that MBP-2 could activate the cellular defense functions by up-regulating iNOS expression and inducing NO synthesis. Moreover, MBP-2 also led to distinct up-regulation of IL-1\u0026beta;, IL-6, and MCP-1 gene in RAW 264.7 cells (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e5\u003c/span\u003eB-D), thereby exerting its immunoregulatory activity.\u003c/p\u003e\n\u003c/div\u003e\n\u003cdiv id=\"Sec25\" class=\"Section3\"\u003e\n\u003ch2\u003e3.4.3 Cytokine level\u003c/h2\u003e\n\u003cp\u003eCytokine is a class of bioactive macromolecular proteins that are produced upon an external stimulus to immune cells and play an important role in regulating the body's immunity and inflammatory response[\u003cspan class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e38\u003c/span\u003e]. Pro-inflammatory cytokines TNF-\u0026alpha; and IL-1\u0026beta; can act on macrophages to enhance immune responses and induce the expression of other immunoregulatory factors[\u003cspan class=\"CitationRef\"\u003e39\u003c/span\u003e]. The current study found that MBP-2 significantly elevated the expression of TNF-\u0026alpha; and IL-6 (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eA-B), thereby exerting its immunoregulatory activity.\u003c/p\u003e\n\u003cp\u003eThe above findings demonstrated favorable immunoregulatory activity of MBP-2. It was reported that the immunoregulatory activity of MBPs might be attributed to their (1\u0026rarr;4)-\u0026alpha;-D- glucan backbone[\u003cspan class=\"CitationRef\"\u003e40\u003c/span\u003e]. The immunoregulatory polysaccharides from traditional Chinese medicines have been applied in development of vaccines as adjuvants to promote the immune response of the body[\u003cspan class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e42\u003c/span\u003e]. Therefore, the MBP-2 may have the potential to be used as vaccine adjuvants.\u003c/p\u003e\n\u003cp\u003eThe secretion of cytokines (IL-1\u0026beta; and TNF-\u0026alpha;) can be mediated by multiple signals, among which Toll-like receptor (TLR) is the most significant[\u003cspan class=\"CitationRef\"\u003e43\u003c/span\u003e]. Native polysaccharides can modulate immune cell functions in vitro by interactions with immunoreceptors, such as TLRs[\u003cspan class=\"CitationRef\"\u003e44\u003c/span\u003e]. To investigate the mechanism underlying the immunoregulatory activity of MBP-2, this study selected C29 and TAK-242 for analysis. C29 is a TLR2 inhibitor that can block hTLR2/1 and hTLR2/6 signals[\u003cspan class=\"CitationRef\"\u003e45\u003c/span\u003e]. TAK-242, also known as Resatorvid, is a selective inhibitor of TLR4 signal transduction that can down-regulate the expression of TLR4 downstream signaling molecule Myeloid differentiation factor 88 (MyD88) and TIR-domain-containing adaptor inducing interferon-\u0026beta; (TRIF) [\u003cspan class=\"CitationRef\"\u003e46\u003c/span\u003e, \u003cspan class=\"CitationRef\"\u003e47\u003c/span\u003e]. As analyzed, TAK-242 dramatically suppressed the production of IL-6 (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01), and the IL-6 level was not significantly different with that of the Ctrl group (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eC). The result suggested that TAK-242 can inhibit the immunoregulatory activity of MBP-2. In addition, IL-6 production was also decreased by C29, but the effect was largely different with that of the Ctrl and TAK groups (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Similar results were obtained for TNF-\u0026alpha; (Fig.\u0026nbsp;\u003cspan class=\"InternalRef\"\u003e6\u003c/span\u003eD). However, there was a large difference between the Ctrl and TAK groups when the MBP-2 concentration was too high or the concentration of inhibitors was too low, which might be due to the large stimulating effect of 10 \u0026micro;g/mL MBP-2 on TNF-\u0026alpha; production. In general, the trend for IL-6 and TNF-\u0026alpha; production was similar, and the TAK-242 was more potent than C29 in inhibiting their production (P\u0026thinsp;\u0026lt;\u0026thinsp;0.01). Collectively, MBP-2 may exert its immunoregulatory activity via TLR4, during which TLR2-related pathways are potential participants.\u003c/p\u003e\n\u003cp\u003eResearch has revealed that TLR2 regulates downstream mitogen-activated protein kinase (MAPK) and nuclear factor kappa-B (NF-\u0026kappa;B) via MYD88-dependent pathways, thereby playing its immune-stimulating effect. Except the MYD88-dependent pathways, TLR4 can also play its role through the TRIF pathway[\u003cspan class=\"CitationRef\"\u003e48\u003c/span\u003e]. The current study found that the TLR4 inhibitor, TAK-242, had more significant suppressive effect on cytokine production in cells treated with MBP-2, as compared to the TLR2 inhibitor C29, indicating that MBP-2 acted mainly via the TRIF-dependent pathways while the MYD88 pathways might also make some contributions. Since the immunoregulatory activity of MBPs has been rarely reported, further studies are required.\u003c/p\u003e\n\u003c/div\u003e\n\u003c/div\u003e"},{"header":"4. Conclusion","content":"\u003cp\u003eThe present study obtained the main neutral sugar, named MBP-2, from mulberry branch through Sephadex G-100 gel purification. Their molecular weight is around 21.7 kDa, and they are mainly composed of a backbone linked by \u0026rarr;4)-\u003cem\u003eα\u003c/em\u003e-D-Glc\u003cem\u003ep\u003c/em\u003e-(1\u0026rarr; and contains \u003cem\u003eα\u003c/em\u003e-D-Glc\u003cem\u003ep\u003c/em\u003e-(1\u0026rarr; and \u0026rarr;4, 6)-\u003cem\u003eα\u003c/em\u003e-D-Glc\u003cem\u003ep-\u003c/em\u003e(1\u0026rarr;. MBP-2 can significantly enhance the NO release from RAW 264.7 cells and exert their immunoregulatory activity via increasing the mRNA expression of relevant inflammatory factors (IL-6 and TNF-α) and promoting their release. With reference to the mechanism, we speculated that MBP-2 exert the immunoregulatory activity mainly via the downstream TRIF-dependent signaling pathways activated by TLR4 receptors. This study, for the first time, reported the glucan polysaccharides from mulberry branch and their immunoregulatory activity, providing new insight into the pharmacological activity of mulberry branch and its development and utilization.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthor contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eWei Xiang\u003c/strong\u003e: Conceptualization, Methodology, Formal analysis, Investigation, Data curation, Writing\u0026ndash;review \u0026amp; editing. \u003cstrong\u003eLi Xu\u003c/strong\u003e: Resources, Supervision. \u003cstrong\u003eLi Zheng\u003c/strong\u003e: Validation, Data curation. \u003cstrong\u003eQi-ao Zhang\u003c/strong\u003e: Data curation. \u003cstrong\u003eXiaowen Shi\u003c/strong\u003e: Visualization, Project administration, Funding acquisition. All authors read and approved the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the grants from Zhejiang Provincial Health Bureau Science Foundation, Hangzhou, China (No. 2022KY1253 to X.S.).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have no competing interests\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eYang, S.; Wang, B.L.; Xia, X.J.; Li, X.; Wang, R.Y.; Sheng, L.; Li, D.; Liu, Y.L.; Li, Y. Simultaneous quantification of three active alkaloids from a traditional Chinese medicine Ramulus Mori (Sangzhi) in rat plasma using liquid chromatography-tandem mass spectrometry. \u003cem\u003eJ Pharmaceut Biomed \u003c/em\u003e\u003cstrong\u003e2015\u003c/strong\u003e, \u003cem\u003e109\u003c/em\u003e, 177-183, doi:10.1016/j.jpba.2015.02.019.\u003c/li\u003e\n\u003cli\u003eYu, W.S.; Chen, H.; Xiang, Z.H.; He, N.J. Preparation of polysaccharides from Ramulus mori, and their antioxidant, anti-inflammatory and antibacterial activities. \u003cem\u003eMolecules \u003c/em\u003e\u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e24\u003c/em\u003e, 24050856, doi:10.3390/molecules24050856.\u003c/li\u003e\n\u003cli\u003eFeng, Z.; Peng, S.; Wu, Z.Y.; Jiao, L.A.; Xu, S.W.; Wu, Y.; Liu, Z.G.; Hu, Y.L.; Liu, J.G.; Wu, Y.; et al. Ramulus mori polysaccharide-loaded PLGA nanoparticles and their anti-inflammatory effects in vivo. \u003cem\u003eInt J Biol Macromol \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e182\u003c/em\u003e, 2024-2036, doi:10.1016/j.ijbiomac.2021.05.200.\u003c/li\u003e\n\u003cli\u003eLu, H.P.; Jia, Y.N.; Yu, Y.; Xu, L. DNA protection activity of a hydroethanol extract and six polyphenol monomers from \u003cem\u003eMorus alba\u003c/em\u003e L. (mulberry) twig. \u003cem\u003eInt J Food Prop \u003c/em\u003e\u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e20\u003c/em\u003e, 2207-2219, doi:10.1080/10942912.2017.1368554.\u003c/li\u003e\n\u003cli\u003eXiang, W.; Xia, Z.N.; Xu, L. UPLC-MS/MS profiling, antioxidant, \u0026alpha;-glucosidase inhibitory, cholinesterase inhibitory, and cardiovascular protection potentials of Jialing 20 (\u003cem\u003eMorus multicaulis\u003c/em\u003e Perr.) Mulberry Branch Extract. \u003cem\u003eFoods \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e, 2659, doi:10.3390/foods10112659.\u003c/li\u003e\n\u003cli\u003eFeng, F.S.; Xiang, W.; Gao, H.; Jia, Y.A.; Zhang, Y.S.; Zeng, L.S.; Chen, J.X.; Huang, X.Z.; Xu, L. Rapid screening of nonalkaloid alpha-glucosidase inhibitors from a Mulberry twig extract using enzyme-functionalized magnetic nanoparticles coupled with UPLC-MS/MS. \u003cem\u003eJ Agr Food Chem \u003c/em\u003e\u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e70\u003c/em\u003e, 11958\u0026ndash;11966, doi:10.1021/acs.jafc.2c03435.\u003c/li\u003e\n\u003cli\u003eZhu, Y.Y.; Xiang, W.; Shen, Y.; Jia, Y.A.; Zhang, Y.S.; Zeng, L.S.; Chen, J.X.; Zhou, Y.; Xue, X.; Huang, X.Z.; et al. New butyrylcholinesterase inhibitor derived from mulberry twigs, a kind of agricultural byproducts. \u003cem\u003eInd Crop Prod \u003c/em\u003e\u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e187\u003c/em\u003e, 115535, doi:10.1016/j.indcrop.2022.115535.\u003c/li\u003e\n\u003cli\u003eKakar, M.U.; Kakar, I.U.; Mehboob, M.Z.; Zada, S.; Soomro, H.; Umair, M.; Iqbal, I.; Umer, M.; Shaheen, S.; Syed, S.F.; et al. A review on polysaccharides from \u003cem\u003eArtemisia sphaerocephala\u003c/em\u003e Krasch seeds, their extraction, modification, structure, and applications. \u003cem\u003eCarbohydrate Polymers \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e252\u003c/em\u003e, 117113, doi:10.1016/j.carbpol.2020.117113.\u003c/li\u003e\n\u003cli\u003eChen, Y.; Jiang, X.; Xie, H.; Li, X.; Shi, L. Structural characterization and antitumor activity of a polysaccharide from Ramulus mori. \u003cem\u003eCarbohydrate Polymers \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e190\u003c/em\u003e, 232-239, doi:10.1016/j.carbpol.2018.02.036.\u003c/li\u003e\n\u003cli\u003eQiu, F.; He, T.Z.; Zhang, Y.Q. The isolation and the characterization of two polysaccharides from the branch bark of mulberry (\u003cem\u003eMorus alba\u003c/em\u003e L.). \u003cem\u003eArchives of Pharmacal Research \u003c/em\u003e\u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e39\u003c/em\u003e, 887-896, doi:10.1007/s12272-016-0742-8.\u003c/li\u003e\n\u003cli\u003eLi, X.; Wang, L.; Gao, X.; Li, G.; Cao, H.; Song, D.; Cai, S.; Liang, T.; Zhang, B.; Du, G. Mechanisms of protective effect of Ramulus mori polysaccharides on renal injury in High-Fat Diet/Streptozotocin-Induced Diabetic Rats. \u003cem\u003eCellular Physiology and Biochemistry \u003c/em\u003e\u003cstrong\u003e2015\u003c/strong\u003e, \u003cem\u003e37\u003c/em\u003e, 2125-2134, doi:10.1159/000438570.\u003c/li\u003e\n\u003cli\u003eYang, Q.; Cai, X.X.; Huang, M.C.; Wang, S.Y. A specific peptide with immunomodulatory activity from \u003cem\u003ePseudostellaria heterophylla\u003c/em\u003e and the action mechanism. \u003cem\u003eJ Funct Foods \u003c/em\u003e\u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e68\u003c/em\u003e, 103887, doi:10.1016/j.jff.2020.103887.\u003c/li\u003e\n\u003cli\u003eCui, L.N.; Chen, L.; Yang, G.; Li, Y.K.; Qiao, Z.H.; Liu, Y.; Meng, Y.; Zhou, Y.F.; Sun, L. Structural characterization and immunomodulatory activity of a heterogalactan from \u003cem\u003ePanax ginseng\u003c/em\u003e flowers. \u003cem\u003eFood Research International \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e140\u003c/em\u003e, 109859, doi:10.1016/j.foodres.2020.109859.\u003c/li\u003e\n\u003cli\u003eYao, Y.; Zhu, Y.Y.; Ren, G.X. Immunoregulatory activities of polysaccharides from mung bean. \u003cem\u003eCarbohydrate Polymers \u003c/em\u003e\u003cstrong\u003e2016\u003c/strong\u003e, \u003cem\u003e139\u003c/em\u003e, 61-66, doi:10.1016/j.carbpol.2015.12.001.\u003c/li\u003e\n\u003cli\u003eYin, Z.H.; Liang, Z.H.; Li, C.Q.; Wang, J.M.; Ma, C.Y.; Kang, W.Y. Immunomodulatory effects of polysaccharides from edible fungus: a review. \u003cem\u003eFood Science and Human Wellness \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e, 393-400, doi:10.1016/j.fshw.2021.04.001.\u003c/li\u003e\n\u003cli\u003eXiang, W.; Xia, Z.; Xu, L. UPLC-MS/MS profiling, antioxidant, \u0026alpha;-glucosidase inhibitory, cholinesterase inhibitory, and cardiovascular protection potentials of Jialing 20 (\u003cem\u003eMorus multicaulis\u003c/em\u003e Perr.) Mulberry Branch Extract. \u003cem\u003eFoods \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e, 2659, doi:10.3390/foods10112659.\u003c/li\u003e\n\u003cli\u003eZhu, H.J.; Tian, L.; Zhang, L.; Bi, J.X.; Song, Q.Q.; Yang, H.; Qiao, J.J. Preparation, characterization and antioxidant activity of polysaccharide from spent \u003cem\u003eLentinus edodes\u003c/em\u003e substrate. \u003cem\u003eInt J Biol Macromol \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e112\u003c/em\u003e, 976-984, doi:10.1016/j.ijbiomac.2018.01.196.\u003c/li\u003e\n\u003cli\u003eDubois, M.; Gilles, K.A.; Hamilton, J.K.; Rebers, P.A.; Smith, F. Colorimetric method for determination of sugars and related substances. \u003cem\u003eAnalytical Chemistry \u003c/em\u003e\u003cstrong\u003e1956\u003c/strong\u003e, \u003cem\u003e28\u003c/em\u003e, 350-356, doi:10.1021/ac60111a017.\u003c/li\u003e\n\u003cli\u003eAi, J.; Bao, B.; Battino, M.; Giampieri, F.; Chen, C.; You, L.J.; Cespedes-Acuna, C.L.; Ognyanov, M.; Tian, L.M.; Bai, W.B. Recent advances on bioactive polysaccharides from mulberry. \u003cem\u003eFood Funct \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e12\u003c/em\u003e, 5219-5235, doi:10.1039/d1fo00682g.\u003c/li\u003e\n\u003cli\u003eHe, X.R.; Fang, J.C.; Ruan, Y.L.; Wang, X.X.; Sun, Y.; Wu, N.; Zhao, Z.F.; Chang, Y.; Ning, N.; Guo, H.; et al. Structures, bioactivities and future prospective of polysaccharides from \u003cem\u003eMorus alba\u003c/em\u003e (white mulberry): A review. \u003cem\u003eFood Chemistry \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e245\u003c/em\u003e, 899-910, doi:10.1016/j.foodchem.2017.11.084.\u003c/li\u003e\n\u003cli\u003eZhan, Q.; Wang, Q.; Lin, R.; He, P.; Lai, F.; Zhang, M.; Wu, H. Structural characterization and immunomodulatory activity of a novel acid polysaccharide isolated from the pulp of \u003cem\u003eRosa laevigata\u003c/em\u003e Michx fruit. \u003cem\u003eInt J Biol Macromol \u003c/em\u003e\u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e145\u003c/em\u003e, 1080-1090, doi:10.1016/j.ijbiomac.2019.09.201.\u003c/li\u003e\n\u003cli\u003eTang, N.; Wang, X.; Yang, R.; Liu, Z.; Liu, Y.; Tian, J.; Xiao, L.; Li, W. Extraction, isolation, structural characterization and prebiotic activity of cell wall polysaccharide from Kluyveromyces marxianus. \u003cem\u003eCarbohydrate Polymers \u003c/em\u003e\u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e289\u003c/em\u003e, 119457, doi:10.1016/j.carbpol.2022.119457.\u003c/li\u003e\n\u003cli\u003eLiu, A.J.; Yu, J.; Ji, H.Y.; Zhang, H.C.; Zhang, Y.; Liu, H.P. Extraction of a novel cold-water-soluble polysaccharide from \u003cem\u003eAstragalus membranaceus\u003c/em\u003e and its antitumor and immunological activities. \u003cem\u003eMolecules \u003c/em\u003e\u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e23\u003c/em\u003e, 62, doi:10.3390/molecules23010062.\u003c/li\u003e\n\u003cli\u003eMolaei, H.; Jahanbin, K. Structural features of a new water-soluble polysaccharide from the gum exudates of \u003cem\u003eAmygdalus scoparia\u003c/em\u003e Spach (Zedo gum). \u003cem\u003eCarbohydrate Polymers \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e182\u003c/em\u003e, 98-105, doi:10.1016/j.carbpol.2017.10.099.\u003c/li\u003e\n\u003cli\u003eJi, H.Y.; Yu, J.; Liu, A.J. Structural characterization of a low molecular weight polysaccharide from \u003cem\u003eGrifola frondosa\u003c/em\u003e and its antitumor activity in H22 tumor-bearing mice. \u003cem\u003eJ Funct Foods \u003c/em\u003e\u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e61\u003c/em\u003e, 103472, doi:10.1016/j.jff.2019.103472.\u003c/li\u003e\n\u003cli\u003eZhang, A.Q.; Deng, J.Y.; Yu, S.Y.; Zhang, F.M.; Linhardt, R.J.; Sun, P.L. Purification and structural elucidation of a water-soluble polysaccharide from the fruiting bodies of the \u003cem\u003eGrifola frondosa\u003c/em\u003e. \u003cem\u003eInt J Biol Macromol \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e115\u003c/em\u003e, 221-226, doi:10.1016/j.ijbiomac.2018.04.061.\u003c/li\u003e\n\u003cli\u003eLi, J.W.; Ai, L.Z.; Yang, Q.; Liu, Y.F.; Shan, L. Isolation and structural characterization of a polysaccharide from fruits of \u003cem\u003eZizyphus jujuba\u003c/em\u003e cv. Junzao. \u003cem\u003eInt J Biol Macromol \u003c/em\u003e\u003cstrong\u003e2013\u003c/strong\u003e, \u003cem\u003e55\u003c/em\u003e, 83-87, doi:10.1016/j.ijbiomac.2012.12.017.\u003c/li\u003e\n\u003cli\u003eChen, H.; Sun, J.; Liu, J.; Gou, Y.R.; Zhang, X.; Wu, X.N.; Sun, R.; Tang, S.X.; Kan, J.; Qian, C.L.; et al. Structural characterization and anti-inflammatory activity of alkali-soluble polysaccharides from purple sweet potato. \u003cem\u003eInt J Biol Macromol \u003c/em\u003e\u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e131\u003c/em\u003e, 484-494, doi:10.1016/j.ijbiomac.2019.03.126.\u003c/li\u003e\n\u003cli\u003eWang, J.Q.; Nie, S.P.; Cui, S.W.; Wang, Z.J.; Phillips, A.O.; Phillips, G.O.; Li, Y.J.; Xie, M.Y. Structural characterization and immunostimulatory activity of a glucan from natural \u003cem\u003eCordyceps sinensis\u003c/em\u003e. \u003cem\u003eFood Hydrocolloid \u003c/em\u003e\u003cstrong\u003e2017\u003c/strong\u003e, \u003cem\u003e67\u003c/em\u003e, 139-147, doi:10.1016/j.foodhyd.2017.01.010.\u003c/li\u003e\n\u003cli\u003eZhang, Z.; Guo, L.; Yan, A.; Feng, L.; Wan, Y. Fractionation, structure and conformation characterization of polysaccharides from Anoectochilus roxburghii. \u003cem\u003eCarbohydrate Polymers \u003c/em\u003e\u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e231\u003c/em\u003e, 115688, doi:10.1016/j.carbpol.2019.115688.\u003c/li\u003e\n\u003cli\u003eYang, X.; Wei, S.; Lu, X.; Qiao, X.; Simal-Gandara, J.; Capanoglu, E.; Wozniak, L.; Zou, L.; Cao, H.; Xiao, J.; et al. A neutral polysaccharide with a triple helix structure from ginger: Characterization and immunomodulatory activity. \u003cem\u003eFood Chemistry \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e350\u003c/em\u003e, 129261, doi:10.1016/j.foodchem.2021.129261.\u003c/li\u003e\n\u003cli\u003eZhang, X.M.; Liao, W.F.; Cong, Q.F.; Dong, Q.; Ding, K. Isolation and structural characterization of the polysaccharides of Cortex Mori radices. \u003cem\u003eActa Chimica Sinica \u003c/em\u003e\u003cstrong\u003e2013\u003c/strong\u003e, \u003cem\u003e71\u003c/em\u003e, 722-728, doi:10.6023/A13010109.\u003c/li\u003e\n\u003cli\u003eWendehenne, D.; Pugin, A.; Klessig, D.F.; Durner, J. Nitric oxide: Comparative synthesis and signaling in animal and plant cells. \u003cem\u003eTrends in Plant Science \u003c/em\u003e\u003cstrong\u003e2001\u003c/strong\u003e, \u003cem\u003e6\u003c/em\u003e, 177-183, doi:10.1016/s1360-1385(01)01893-3.\u003c/li\u003e\n\u003cli\u003eKashfi, K.; Kannikal, J.; Nath, N. Macrophage reprogramming and cancer therapeutics: Role of iNOS-Derived NO. \u003cem\u003eCells \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e, 3194, doi:10.3390/cells10113194.\u003c/li\u003e\n\u003cli\u003eRyll, R.; Kumazawa, Y.; Yano, I. Immunological properties of trehalose dimycolate (cord factor) and other mycolic acid-containing glycolipids - A review. \u003cem\u003eMicrobiology and Immunology \u003c/em\u003e\u003cstrong\u003e2001\u003c/strong\u003e, \u003cem\u003e45\u003c/em\u003e, 801-811, doi:10.1111/j.1348-0421.2001.tb01319.x.\u003c/li\u003e\n\u003cli\u003eRen, L.; Zhang, J.; Zhang, T.H. Immunomodulatory activities of polysaccharides from \u003cem\u003eGanoderma\u003c/em\u003e on immune effector cells. \u003cem\u003eFood Chemistry \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e340\u003c/em\u003e, 127933, doi:10.1016/j.foodchem.2020.127933.\u003c/li\u003e\n\u003cli\u003eHwang, J.; Yadav, D.; Lee, P.C.W.; Jin, J.O. Immunomodulatory effects of polysaccharides from marine algae for treating cancer, infectious disease, and inflammation. \u003cem\u003ePhytotherapy Research \u003c/em\u003e\u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e36\u003c/em\u003e, 761-777, doi:10.1002/ptr.7348.\u003c/li\u003e\n\u003cli\u003eZhao, S.; Gao, Q.; Rong, C.B.; Wang, S.X.; Zhao, Z.K.; Liu, Y.; Xu, J.P. Immunomodulatory effects of edible and medicinal mushrooms and their bioactive immunoregulatory products. \u003cem\u003eJournal of Fungi \u003c/em\u003e\u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e6\u003c/em\u003e, 269, doi:10.3390/jof6040269.\u003c/li\u003e\n\u003cli\u003eWang, Y.F.; Zhang, Y.F.; Shao, J.J.; Ren, X.J.; Jia, J.X.; Li, B.H. Study on the immunomodulatory activity of a novel polysaccharide from the lichen \u003cem\u003eUmbilicaria esculenta\u003c/em\u003e. \u003cem\u003eInt J Biol Macromol \u003c/em\u003e\u003cstrong\u003e2019\u003c/strong\u003e, \u003cem\u003e121\u003c/em\u003e, 846-851, doi:10.1016/j.ijbiomac.2018.10.080.\u003c/li\u003e\n\u003cli\u003eZhang, Y.; Zeng, Y.; Men, Y.; Zhang, J.G.; Liu, H.M.; Sun, Y.X. Structural characterization and immunomodulatory activity of exopolysaccharides from submerged culture of \u003cem\u003eAuricularia auricula\u003c/em\u003e-judae. \u003cem\u003eInt J Biol Macromol \u003c/em\u003e\u003cstrong\u003e2018\u003c/strong\u003e, \u003cem\u003e115\u003c/em\u003e, 978-984, doi:10.1016/j.ijbiomac.2018.04.145.\u003c/li\u003e\n\u003cli\u003eWan, X.H.; Yin, Y.M.; Zhou, C.Z.; Hou, L.; Cui, Q.H.; Zhang, X.P.; Cai, X.Q.; Wang, Y.L.; Wang, L.Z.; Tian, J.Z. Polysaccharides derived from Chinese medicinal herbs: A promising choice of vaccine adjuvants. \u003cem\u003eCarbohydrate Polymers \u003c/em\u003e\u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e276\u003c/em\u003e, 118739, doi:10.1016/j.carbpol.2021.118739.\u003c/li\u003e\n\u003cli\u003eWang, D.Y.; Liu, Y.H.; Zhao, W. The adjuvant effects on vaccine and the immunomodulatory mechanisms of polysaccharides from Traditional Chinese Medicine. \u003cem\u003eFrontiers in Molecular Biosciences \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e8\u003c/em\u003e, 655570, doi:10.3389/fmolb.2021.655570.\u003c/li\u003e\n\u003cli\u003eFan, S.R.; Wang, Y.X.; Zhang, Y.; Wu, Y.M.; Chen, X.M. \u003cem\u003eAchyranthes bidentata\u003c/em\u003e polysaccharide activates nuclear factor-kappa B and promotes cytokine production in J774A.1 cells through TLR4/MyD88 signaling pathway. \u003cem\u003eFrontiers in Pharmacology \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e12\u003c/em\u003e, 753599, doi:10.3389/fphar.2021.753599.\u003c/li\u003e\n\u003cli\u003eYoung, I.D.; Nepogodiev, S.A.; Black, I.M.; Le Gall, G.; Wittmann, A.; Latousakis, D.; Visnapuu, T.; Azadi, P.; Field, R.A.; Juge, N.; et al. Lipopolysaccharide associated with beta-2,6 fructan mediates TLR4-dependent immunomodulatory activity in vitro. \u003cem\u003eCarbohydrate polymers \u003c/em\u003e\u003cstrong\u003e2022\u003c/strong\u003e, \u003cem\u003e277\u003c/em\u003e, 118606, doi:10.1016/j.carbpol.2021.118606.\u003c/li\u003e\n\u003cli\u003eMistry, P.; Laird, M.H.W.; Schwarz, R.S.; Greene, S.; Dyson, T.; Snyder, G.A.; Xiao, T.S.; Chauhan, J.; Fletcher, S.; Toshchakov, V.Y.; et al. Inhibition of TLR2 signaling by small molecule inhibitors targeting a pocket within the TLR2 TIR domain. \u003cem\u003eProceedings of the National Academy of Sciences of the United States of America \u003c/em\u003e\u003cstrong\u003e2015\u003c/strong\u003e, \u003cem\u003e112\u003c/em\u003e, 5455-5460, doi:10.1073/pnas.1422576112.\u003c/li\u003e\n\u003cli\u003eJiang, L.J.; Xu, Z.X.; Li, H.; Wu, M.F.; Wang, F.D.; Liu, S.Y.; Tao, J.L.; Feng, X. TAK-242 exerts a neuroprotective effect via suppression of the TLR4/MyD88/TRIF/NF-kappa B signaling pathway in a neonatal hypoxic-ischemic encephalopathy rat model. \u003cem\u003eMolecular Medicine Reports \u003c/em\u003e\u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e22\u003c/em\u003e, 1440-1448, doi:10.3892/mmr.2020.11220.\u003c/li\u003e\n\u003cli\u003eOno, Y.; Maejima, Y.; Saito, M.; Sakamoto, K.; Horita, S.; Shimomura, K.; Inoue, S.; Kotani, J. TAK-242, a specific inhibitor of Toll-like receptor 4 signalling, prevents endotoxemia-induced skeletal muscle wasting in mice. \u003cem\u003eScientific reports \u003c/em\u003e\u003cstrong\u003e2020\u003c/strong\u003e, \u003cem\u003e10\u003c/em\u003e, 694, doi:10.1038/s41598-020-57714-3.\u003c/li\u003e\n\u003cli\u003eZhu, L.J.; Li, W.; Fan, Z.Y.; Ye, X.Y.; Lin, R.Y.; Ban, M.M.; Ren, L.Z.; Chen, X.Q.; Zhang, D.Y. Immunomodulatory activity of polysaccharide from \u003cem\u003eArca granosa\u003c/em\u003e Linnaeus via TLR4/MyD88/NF kappa B and TLR4/TRIF signaling pathways. \u003cem\u003eJ Funct Foods \u003c/em\u003e\u003cstrong\u003e2021\u003c/strong\u003e, \u003cem\u003e84\u003c/em\u003e, 104579, doi:10.1016/j.jff.2021.104579.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"chemical-and-biological-technologies-in-agriculture","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Chemical and Biological Technologies in Agriculture](https://chembioagro.springeropen.com/)","snPcode":"40538","submissionUrl":"https://submission.nature.com/new-submission/40538/3","title":"Chemical and Biological Technologies in Agriculture","twitterHandle":"@SpringerPlants","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Mulberry branch, Homopolysaccharide, Immunoregulatory activity, Toll-like receptor","lastPublishedDoi":"10.21203/rs.3.rs-3880414/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-3880414/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eIn view of the fact that mulberry branch has not been effectively utilized and polysaccharide is one of the main active components in mulberry branch, this study aims to reveal the structure and immunomodulatory activity of its polysaccharide. A type of neutral polysaccharides, named Mulberry Branch Polysaccharide-2 (MBP-2), was separated from mulberry branch using DEAE-52 and Sephadex G-100. As analyzed, they were mainly composed of glucose with a molecular weight of approximately 21.7 kDa. Methylation analysis demonstrated that MBP-2 primary contained a →4)-\u003cem\u003eα\u003c/em\u003e-D-Glc\u003cem\u003ep-\u003c/em\u003e(1→, \u003cem\u003eα\u003c/em\u003e-D-Glc\u003cem\u003ep\u003c/em\u003e-(1→ and →4, 6)-\u003cem\u003eα\u003c/em\u003e-D-Glc\u003cem\u003ep\u003c/em\u003e-(1→ structure, which was validated by nuclear magnetic resonance (NMR). In addition, cellular experiments indicated that MBP-2 significantly enhanced the production of NO, TNF-α and IL-6 in RAW264.7 cells, unraveling the potential immunoregulatory activity of MBP-2. Further analysis showed that MBP-2 exerted their immunoregulatory activity mainly via binding with TLR4 to activate the downstream TRIF-dependent signaling pathways.\u003c/p\u003e","manuscriptTitle":"Purification, structural characterization, and immunoregulatory activity of a polysaccharide from mulberry branch","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-01-24 16:00:24","doi":"10.21203/rs.3.rs-3880414/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-02-25T16:25:10+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-02-24T05:51:14+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"e662e3cd-5f16-453f-8186-5dcefadaca0e","date":"2024-02-07T03:08:03+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-02-02T00:34:29+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"17c08a5d-aa03-4e17-b828-f16264f1db54","date":"2024-01-24T10:26:41+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"76468814-fae6-4fc3-8937-c06e45a4e7f0","date":"2024-01-24T06:34:37+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-01-23T18:01:12+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"682f5d06-3f97-4f6b-be47-329de969b50a","date":"2024-01-23T07:14:53+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-01-23T06:55:35+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-01-22T07:49:48+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-01-22T07:49:48+00:00","index":"","fulltext":""},{"type":"submitted","content":"Chemical and Biological Technologies in Agriculture","date":"2024-01-20T02:40:25+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"chemical-and-biological-technologies-in-agriculture","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [Chemical and Biological Technologies in Agriculture](https://chembioagro.springeropen.com/)","snPcode":"40538","submissionUrl":"https://submission.nature.com/new-submission/40538/3","title":"Chemical and Biological Technologies in Agriculture","twitterHandle":"@SpringerPlants","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"73dec749-7004-436a-95a3-e4a140d89961","owner":[],"postedDate":"January 24th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-03-16T13:03:49+00:00","versionOfRecord":{"articleIdentity":"rs-3880414","link":"https://doi.org/10.1186/s40538-024-00563-3","journal":{"identity":"chemical-and-biological-technologies-in-agriculture","isVorOnly":false,"title":"Chemical and Biological Technologies in Agriculture"},"publishedOn":"2024-03-13 13:03:49","publishedOnDateReadable":"March 13th, 2024"},"versionCreatedAt":"2024-01-24 16:00:24","video":"","vorDoi":"10.1186/s40538-024-00563-3","vorDoiUrl":"https://doi.org/10.1186/s40538-024-00563-3","workflowStages":[]},"version":"v1","identity":"rs-3880414","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-3880414","identity":"rs-3880414","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.