Sildenafil Promotes Osteogenic Differentiation of Human Mesenchymal Stem Cells and Inhibits Bone Loss by Affecting the TGF-β Signaling Pathway

Sildenafil Promotes Osteogenic Differentiation of Human Mesenchymal Stem Cells and Inhibits Bone Loss by Affecting the TGF-β Signaling Pathway | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Sildenafil Promotes Osteogenic Differentiation of Human Mesenchymal Stem Cells and Inhibits Bone Loss by Affecting the TGF-β Signaling Pathway Menglong Hu, Likun Wu, Erfan Wei, Xingtong Pan, Qiyue Zhu, Xv Xiuyun, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-5662251/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 23 Apr, 2025 Read the published version in Stem Cell Research & Therapy → Version 1 posted 5 You are reading this latest preprint version Abstract Background Osteoporosis, a common bone disorder, is primarily managed pharmacologically. However, existing medications are associated with non-trivial side-effects. Sildenafil, which already finds many clinical applications, promotes angiogenesis and cellular differentiation. Osteoporotic patients often exhibit a reduced intraosseous vasculature and impaired cellular differentiation; sildenafil may thus usefully treat osteoporosis. Methods Here, the effects of sildenafil on the osteogenic differentiation of human mesenchymal stem cells (hMSCs) were explored, as were the molecular mechanisms in play. We treated hMSCs with varying concentrations of sildenafil and measured cell proliferation and osteogenic differentiation in vitro . We used a mouse model of subcutaneous ectopic osteogenesis to assess sildenafil's effect on hMSC osteogenic differentiation in vivo . We also explored the effects of sildenafil on bone loss in tail-suspended (TS) and ovariectomized (OVX) mice. Mechanistically, we employed RNA-sequencing to define potentially relevant molecular pathways. Results Low sildenafil concentrations significantly enhanced osteogenic hMSC differentiation; the optimal sildenafil concentration may be 10 mg/L. Sildenafil mitigated osteoporosis in OVX and TS mice. Low sildenafil concentrations probably promoted hMSC osteogenic differentiation by acting on the transforming growth factor-β (TGF-β) signaling pathway. Conclusions In conclusion, low sildenafil concentrations enhanced hMSC osteogenic differentiation and inhibited bone loss. Sildenafil may usefully treat osteoporosis. Our findings offer new insights into the physiological effects of the material. Sildenafil Mesenchymal stem cells Osteogenesis Osteoporosis TGF-β signaling pathway Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 1. Background Osteoporosis is a common bone disorder associated with reduced bone density and quality, and microstructural damage; bones become more fragile and the fracture risk rises. Osteoporosis affects not only patients but also their families and society [1]. The global prevalence of osteoporosis in older adults is 21.7% [2, 3]. The numbers of intraosseous blood vessels decrease in patients with senile and postmenopausal osteoporosis [4]. Such changes in bone structure may be related to impaired osteogenic differentiation capacities of mesenchymal stem cells (MSCs) [5, 6]. Many osteoporosis management and prevention strategies have been developed [7, 8]. Currently, pharmacotherapy is the simplest, most convenient, and most effective approach; the fracture risk is decreased either by reducing bone resorption or stimulating bone formation. Bisphosphonates find many clinical applications, but the adverse effects include upper gastrointestinal tract symptoms, renal toxicity, and (rarer) complications such as medication-related jaw osteonecrosis [7, 9]. New pharmacological interventions are required. Any new drug must be evaluated both preclinically and clinically; this is expensive (over 2 billion dollars), risky, and time-consuming (10 to 15 years) [10, 11]. New indications for existing drugs are thus very attractive. Sildenafil, the small-molecule C 22 H 30 N 6 O 4 S, is currently primarily used to treat erectile dysfunction but may also aid patients with fatty liver and heart failure [4, 12]. Sildenafil improves vascular function, promotes angiogenesis, and enhances wound-healing [13–17]. As an inhibitor of phosphodiesterase type 5 (PDE5), sildenafil enhances the activity of the nitric oxide/soluble guanylate cyclase/cyclic guanosine monophosphate (NO/sGC/cGMP) pathway that controls cell growth and differentiation and smooth muscle relaxation [12]. NO stimulates both bone regeneration and new blood vessel formation via the NO/sGC/cGMP pathway [18–20]. Given the close relationship between angiogenesis, NO activity, and osteogenesis, and that of the reduced bone vasculature and impaired cell differentiation of osteoporosis patients, we hypothesized that sildenafil might effectively treat osteoporosis. We thus explored whether sildenafil enhanced hMSC osteogenic differentiation. To the best of our knowledge, no study has yet addressed this topic. Importantly, sildenafil is an approved drug; sildenafil is safe. We here examine how sildenafil affects hMSC osteogenic differentiation both in vivo and in vitro , and the potential molecular mechanisms in play. Sildenafil at 10 mg/L promoted hMSC osteogenic differentiation both in vitro and in vivo , the latter in a model of ectopic bone formation; and inhibited bone loss in ovariectomized mice and those suspended by their hindlimbs. Sildenafil may modulate the TGF-β signaling pathway. We expand the therapeutic applications of sildenafil; the material may usefully treat osteoporosis. 2. Materials and Methods 2.1. hMSC culture Human bone marrow-derived MSCs (hBMSCs) and human adipose-derived mesenchymal stem cells (hASCs) (ScienCell Company, USA) were grown at 37°C. The proliferation medium (PM) and the osteogenic medium (OM) were prepared according to the previous literature [21]. 2.2. The sildenafil concentrate Sildenafil (Y0001578, Sigma-Aldrich, China) was dissolved in PM with 1‰ dimethyl sulfoxide (DMSO) to 100 mg/L and then diluted to 1, 5, 10, 20, and 40 mg/L in PM or OM. 2.3. Cell proliferation assay hBMSCs and hASCs were seeded into 96-well plates. Cell proliferation was assessed on days 0, 1, 3, 5, 7, and 14 (three replicate wells). Cells were counted using a Cell Counting Kit-8 (Dojindo Laboratories, Japan) and the absorbance at 450 nm was measured to quantify cell proliferation by a microplate reader (ELx800, Biotek, America). The details have been previously described [22]. 2.4. Scratch assay hBMSCs and hASCs were cultured in six-well plates to approximately 70% confluence; scratches were created using the tip of a 200-µL pipette, and serum-free media with varying concentrations of sildenafil added. The cells were photographed under an inverted optical microscope (TE2000-U, Nikon, Japan) at 0, 12, and 24 h. Image J software (Open access, USA) was used to measure cell migration, as follows: Cell migration ratio (%) \(\:=\frac{\text{A}0-\:\text{A}\text{t}}{\text{A}0}\times\:100\%\) where A 0 and A t are the respective scratch areas before and after addition of serum-free culture media [23]. 2.5. Transwell assay PM (600 µL) was added to the lower chamber and 1×10 5 hBMSCs or hASCs in 200 µL of serum-free medium supplemented or not with various concentrations of sildenafil to the upper chamber. The chambers were separated by a membrane filter with pores 8 µm in diameter (Corning, USA). After 24 h of incubation, the upper chamber (with non-migratory cells) was removed. The membrane was fixed, and stained for 10 min in 0.1% (w/v) crystal violet; then washed, dried, images captured, and migrated cells counted. The details have been previously published [21]. 2.6. Alkaline phosphatase (ALP) staining and quantification Cells (20,000) were added to each well of a 12-well plate, grown to 70–80% confluence, and osteogenically induced. Experiments commenced after 7 days of culture in OM with various concentrations of sildenafil. ALP staining/assessment employed a dedicated kit (Beyotime, China) and a microplate reader (ELx800, Biotek, USA). The details have been published previously [22]. 2.7. Alizarin red S (ARS) staining and quantification Cells (20,000) were added to each well of a 12-well plate, grown to 70–80% confluence, and osteogenically induced. After incubation in PM, OM, or OM with various concentrations of sildenafil for 14 days, hBMSCs or hASCs were stained with an ARS solution (Sigma-Aldrich, USA) for 10–20 min and imaged (HP Scanjet G4050; Hewlett-Packard, USA). To quantify staining, mineralized nodules were dissolved in 100 mM cetylpyridinium chloride and absorbances at 490 nm recorded using a spectrophotometer (ELx800; Biotek, USA). 2.8. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) Cells (50,000) were added to each well of a 6-well plate, grown to 70–80% confluence, and osteogenically induced. Total RNAs were prepared from hBMSCs and hASCs cultured for 7 and 14 days. The equipment and methods used to determine total RNA concentrations, reverse transcription to cDNA, and qRT-PCR, have been published previously [22]. The primers are listed in Table 1 . Table 1 The primer sequences. Genes Forward (5ʹ to 3ʹ) Reverse (5ʹ to 3ʹ) GAPDH CGGACCAATACGACCAAATCCG AGCCACATCGCTCAGACACC ALP GACCTCCTCGGAAGACACTC TGAAGGGCTTCTTGTCTGTG RUNX2 TCTTAGAACAAATTCTGCCCTTT TGCTTTGGTCTTGAAATCACA BGLAP AGCAAAGGTGCAGCCTTTGT GCGCCTGGGTCTCTTCACT TGF-β1 CAATTCCTGGCGATACCTCAG GCACAACTCCGGTGACATCAA TGF-βR1 TCAGCTCTGGTTGGTGTCAG ATGTGAAGATGGGCAAGACC TGF-β2 TCAAGAGGGATCTAGGGTGGAA GGCARGCTCCAGCACAGAA TGF-βR2 AATATCCTCTGAAGAACGACCTAA TCCCACCTGCCCACTGTTA GAPDH, glyceraldehyde-3-phosphate dehydrogenase; ALP, alkaline phosphatase; RUNX2, runt-related transcription factor 2; BGLAP, bone gamma-carboxyglutamate protein; TGF-β1, transforming growth factor-β1; TGF-βR1, transforming growth factor-β type Ⅰ receptor; TGF-β2, transforming growth factor-β2; TGF-βR2, transforming growth factor-β type ⅠⅠ receptor. 2.9. Subcutaneous cell transplantation into nude mice Guided by the in vitro results, sildenafil at 10 mg/L was used in vivo . Twelve BALB/C nude mice (female, 6 weeks of age) were randomly divided into two groups of five and given hBMSCs grown in either PM or PM + 10 mg/L sildenafil. hBMSCs that had been cultured for 7 days were mixed with β-tricalcium phosphate (Rebone, China) and then subcutaneously implanted into the dorsa of nude mice. Samples collected after 8 weeks were subjected to Masson staining, hematoxylin and eosin (H&E) staining, and immunohistochemical staining for OCN (osteocalcin) to evaluate osteogenesis [24]. We thus explored whether sildenafil aided the heterotopic osteogenic differentiation of hBMSCs in vivo . The mice were purchased from the Vital River Corporation (China). All animal experiments were complied with the ARRIVE guidelines and were carried out in accordance with the U.K. Animals (Scientific Procedures) Act, 1986 and associated guidelines. In the animal experiments of this study, the animals were housed under SPF condition with a controlled temperature of 20–26°C, relative humidity of 40–70%, and a 12/12-hour light/dark cycle. The sample size for each group of mice was determined based on previous studies [22]. The mice were first acclimated for one week, after which those without apparent abnormalities in appearance or behavior were selected. They were then randomly assigned to different groups using a random number generator. Experimental and control groups were randomly assigned. If a mouse died due to surgery, it was excluded from the group, and a new mouse from the same batch was randomly selected for subsequent experiments. All mice were anesthetized with avertin (a 1:1 mixture of tribromoethanol and tert-amyl alcohol), which was diluted to 0.25% with saline before use and administered via intramuscular injection at a dose of 150 mg/kg (‌MA0478‌‌1, meilunbio, China) [25, 26]. Euthanasia of mice was performed by cervical dislocation following deep anesthesia. Data analysts were blinded to the group assignments during analysis. 2.10. Intraperitoneal injection of ovariectomized (OVX) mice Mice were anesthetized with avertin (150 mg/kg), and bilateral ovariectomy was performed through a dorsal approach to remove the ovaries. Sham-operated mice underwent the same procedure without ovary removal. The OVX model induces estrogen deficiency, which mimics the pathophysiological changes observed in postmenopausal osteoporosis [27]. Twenty female SPF C57BL/6N mice (8 weeks of age) were categorized into four groups (n = 5): Sham + PBS, sham + sildenafil, OVX + PBS, and OVX + sildenafil. Sildenafil was intraperitoneally injected daily for 1 month commencing 3 months after surgery; the control group receiving an equivalent volume of PBS. After 1 further month, femoral osteogenesis was evaluated via H&E staining, Masson staining and micro-CT. Heart, liver, spleen, lung, kidney, and blood samples were subjected to H&E staining and serological analysis. 2.11. Intraperitoneal injection of tail-suspended mice Mice were tail-suspended with the heads tilted downward at 30° and the hind limbs elevated for 14 days. Sham-treated mice were not suspended, mouse movement was not restricted [28]. Twenty female SPF C57BL/6N mice (8 weeks of age) were divided into four groups (n = 5): Sham + PBS, sham + sildenafil, suspension + PBS, and suspension + sildenafil. Commencing on day 14 after tail suspension (TS), mice received daily intraperitoneal injections of sildenafil or PBS for 14 days, after which samples were collected. Femora were subjected to H&E staining, Masson staining and micro-CT analysis that evaluated osteogenesis status. Heart, liver, spleen, lung, kidney, and blood samples were taken for H&E staining and serological analysis. 2.12. ELISA of serum biomarkers Blood samples were obtained from the mice of Sections 2.11 and 2.12 above. Bone alkaline phosphatase (BALP) and procollagen type 1 N-terminal propeptide (P1NP), both of which are indicators of bone formation, were quantitated using ELISA kits (Telenbiotech, China). 2.13. Micro-computed tomography (CT) Mouse femora were fixed in 10% (v/v) formalin for 24 h and then scanned from the proximal end. The scan time was 1,500 ms and the scan resolution 8.82 µm. Data analysis employed an Inveon Research Workplace (Siemens, Germany). This derived the bone mineral density (BMD), bone surface area/bone volume (BS/BV), bone volume fraction (BV/TV), trabecular thickness (Tb.Th), trabecular separation (Tb.Sp), and trabecular number (Tb.N). 2.14. RNA-sequencing (RNA-Seq) and statistical analyses hBMSCs (50,000) were seeded into each well of a six-well plate, grown to 70–80% confluence, osteogenically induced in OM (control) and OM with 10 mg/L sildenafil for 7 days, and RNAs collected. RNA-Seq was performed by Novogene Bioinformatics Technology Co. Ltd. All RNA samples underwent rigorous quality control, primarily using an Agilent 2100 bioanalyzer. High-quality libraries underwent Illumina sequencing. RNA-Seq identifies differences in gene expression via reference genome alignment; quality control; and quantitative, functional enrichment, differential expression, alternative splicing, and variant site analyses. 2.15. Western blotting hBMSCs were induced in OM (control) and OM supplemented with 10 mg/L sildenafil for 7 days and proteins collected. A digital Western blot system (Simple Western Blot; Wes Separation Module, ProteinSimple, USA) was used to measure the expression levels of TGF-β1, TGF-βR2, p-TGF-βR2, Smad2/3 and p-Smad2/3 proteins and the data were analyzed with the aid of Compass software (ProteinSimple) [29]. The following antibodies were employed: anti-GAPDH rabbit polyclonal antibody (HX1832, Huaxingbio, China), anti-TGF-β1 antibody (ab215715, abcam, UK), anti-TGF-βR2 antibody (T56879, abmart, China), anti-TGF-βR2 (phosphor-S225) antibody (ab183037, abcam, UK), anti-Smad2 + Smad3 antibody [EPR19557-4] (ab202445, abcam, UK), and anti-Smad2 + Smad3 (phospho T8) antibody (ab254407, abcam, UK). 2.16. Statistical analyses Data were subjected to one-way analysis of variance (ANOVA) using SPSS ver. 24.0 software (IBM, USA). A P -value < 0.05 was considered statistically significant. All results are presented as means ± standard deviations (SDs). The work has been reported in line with the ARRIVE guidelines 2.0. 3. Results 3.1. Low concentrations of sildenafil enhanced the proliferation and migration of hBMSCs and hASCs in vitro Compared to the PM-alone group, 10 mg/L sildenafil most potently enhanced the proliferation of hBMSCs and hASCs in vitro (Figs. 1 B, S1A), as revealed by the CCK-8 data. The scratch and transwell assays similarly showed that 10 mg/L sildenafil most effectively promoted migration of hBMSCs and hASCs in vitro (Figs. 1 C-F, S1B-E). When the sidenafil concentration was below or above 10 mg/L, efficacy decreased. In summary, 10 mg/L sildenafil enhanced the proliferation and migration of hBMSCs and hASCs in vitro . 3.2. Low concentrations of sildenafil enhanced the osteogenic differentiation of hBMSCs and hASCs in vitro Quantification of the ALP activity and ALP staining of hBMSCs indicated that sildenafil at 5, 10, and 20 mg/L promoted osteogenic differentiation in vitro ; sildenafil at 10 mg/L exerted the greatest effects. ARS staining and quantification were performed after 14 days of culture. The results were consistent with those for ALP activity and ALP staining (Fig. 2 A-D). After 7 days of osteogenic induction, qRT-PCR showed that 10 mg/L sildenafil most significantly (compared to other levels) enhanced the expression of osteogenic genes ( RUNX2, ALP ) (Fig. 2 E). Similarly, after 14 days, sildenafil at 10 mg/L optimally promoted RUNX2 and BGLAP expression in hBMSCs (Fig. 2 F). The sildenafil-induced enhancement of hBMSC osteogenic differentiation in vitro fell at sildenafil concentrations below or over 10 mg/L. The hASC data were similar to those of hBMSCs. ALP staining and quantification, and ARS staining and quantification, indicated that 10 mg/L sildenafil most effectively enhanced osteogenic differentiation (Fig. S2 A-D). qRT-PCR similarly showed that sildenafil at 10 mg/L exhibited the strongest effect (Fig. S2 E, F). In summary, 10 mg/L sildenafil optimally promoted the osteogenic differentiation of hBMSCs and hASCs in vitro . 3.3. Sildenafil at 10 mg/L promoted osteogenic differentiation of hBMSCs in vivo. The above in vitro experiments revealed that 10 mg/L sildenafil optimally promoted the proliferation and migration of hMSCs. More importantly, sildenafil at 10 mg/L optimally enhanced osteogenic differentiation in vitro . Therefore, sildenafil at 10 mg/L was used in the subsequent in vivo experiments. H&E staining showed that the PM + sildenafil group exhibited more new bone formation than did the PM group (Fig. 3 A). Masson staining indicated that the PM + sildenafil group exhibited increased collagen formation (Fig. 3 B). Furthermore, the results of OCN immunohistochemical staining demonstrated that the PM + sildenafil group exhibited more brown-stained tissue, indicating a higher expression of OCN compared to the PM group (Fig. 3 C). Thus, 10 mg/L sildenafil enhanced the osteogenic differentiation of hBMSCs and promoted ectopic bone formation. 3.4. Sildenafil at 10 mg/L inhibited bone loss in OVX mice. Micro-CT revealed that the surgical group injected with PBS exhibited more significant bone loss than did the sham surgical group; the OVX mouse model was successfully established. Gross micro-CT images of femora showed that OVX mice injected with sildenafil exhibited denser bone and more trabeculae than did the OVX + PBS group (Fig. 4 A). Sildenafil injection significantly increased the Tb.Th, BV/TV, BMD, and Tb.N values compared to those of the OVX + PBS group, and decreased BS/BV and Tb.Sp (Fig. 4 B-G). Thus, sildenafil (compared to PBS) reduced bone loss. ELISAs showed that sildenafil (compared to PBS) increased the serum BALP and P1NP levels; sildenafil promoted bone formation and prevented bone loss in OVX mice (Fig. 4 H, I). Femoral H&E staining and Masson staining indicated that the OVX + sildenafil group exhibited more new bone formation than the OVX + PBS group (Fig. 4 A). H&E staining of liver, heart, kidney, lung, and spleen samples from all four groups revealed no significant toxicity; sildenafil at 10 mg/L exhibited good biocompatibility in vivo (Figure S3 ) and effectively mitigated bone loss in OVX mice. 3.5. Sildenafil at 10 mg/L suppressed bone loss in TS mice. To investigate whether sildenafil mitigated bone loss under weightless conditions, we tail-suspended mice to simulate weightlessness. Micro-CT revealed that bone loss was greater in the suspension + PBS group than the sham + PBS group; the TS model was successfully established. The micro-CT data were similar to those of Section 3.4 , thus confirming significantly less bone loss in the suspension + sildenafil group compared to the suspension + PBS group. The former group exhibited a denser bone structure and more trabeculae than the latter group (Fig. 5 A). Abdominal injection of sildenafil into TS mice significantly increased the femoral Tb.Th, BV/TV, Tb.N, and BMD values, and decreased the Tb.Sp and BS/BV (Fig. 5 B-G). The serum levels of BALP and P1NP were higher in the suspension + sildenafil group than in the suspension + PBS group (Fig. 5 H, I). H&E staining similarly demonstrated reduced bone loss in the group injected with sildenafil, compared to PBS (Fig. 5 A). H&E staining of spleen, liver, heart, kidney, and lung sections from all groups revealed no significant toxicity (Fig. S2 ). In summary, 10 mg/L sildenafil effectively inhibited bone loss in TS mice. 3.6. Low concentrations of sildenafil promoted osteogenic differentiation of hBMSCs by modulating the TGF-β signaling pathway. hBMSCs (a control OM group and a test OM + sildenafil group) were used to explore how sildenafil enhanced osteogenic differentiation of hBMSCs. The Venn diagram of co-expressed genes revealed 10,154 such genes between the two groups (Fig. 6 A). The volcano plot of differentially expressed genes showed that, compared to the OM group, the OM + sildenafil group exhibited 2,048 upregulated and 1,734 downregulated genes (Fig. 6 B). Gene Ontology (GO) enrichment maps revealed the differential enrichment of genes involved in relevant activities (Fig. 6 C). The Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment scatter-plot illustrated the most significantly enriched pathways (Fig. 6 D). Of these, the TGF-β signaling pathway exhibited notable between-group difference and thus a close association with osteogenesis. The levels of mRNAs encoding TGF-βR1, TGF-βR2, TGF-β1, and TGF-β2 (key components of TGF-β signaling) were significantly higher in the OM + sildenafil group than in the OM group (Fig. 6 E-H). At the protein level, the levels of TGF-β1, p-Smad2/3/Smad2/3, and p-TGF-βR2/TGF-βR2 were significantly higher in the OM + sildenafil group than in the OM group (Fig. 6 I-L). We thus (preliminarily) suggest that low concentrations of sildenafil may enhance the osteogenic differentiation of hBMSCs by influencing the TGF-β signaling pathway. However, further investigation is required. 4. Discussion We found that low concentrations of sildenafil (optimally 10 mg/L) enhanced the migration and proliferation of hMSCs in vitro and promoted osteogenic differentiation of hMSCs both in vivo and in vitro . In vivo , sildenafil mitigated bone loss in both TS and OVX mice. Sildenafil may facilitate osteogenic differentiation of hBMSCs by influencing the TGF-β signaling pathway (Fig. 7 ). Sildenafil has been FDA-approved to treat various conditions, and is affordable and safe [30]. The fact that sildenafil inhibits bone loss suggests that sildenafil may usefully treat osteoporosis. 4.1. Low concentrations of sildenafil enhanced the proliferation and migration of hBMSCs and hASCs in vitro . We found that low concentrations of sildenafil promoted the proliferation and migration of hBMSCs; this has seldom been reported. Previous research indicated that sildenafil enhanced migration of human umbilical vein endothelial cells by acting on a cGMP-dependent pathway that influences cell growth and differentiation [31], suggesting that sildenafil might similarly enhance the proliferation and migration of hBMSCs. We confirmed that 10 mg/L sildenafil optimally enhanced the proliferation and migration of hBMSCs in vitro . It was earlier shown that sildenafil decreased reactive oxygen species levels and reversed DNA damage in mouse bone marrow cells [32]. Sildenafil also reduced endothelial cell apoptosis [33, 34]. We simultaneously investigated hASCs and hBMSCs, extending the generalizability of the drug. Both hASCs and hBMSCs possess osteogenic differentiation potential. hASCs are also important in terms of bone regeneration. Moreover, compared to hBMSCs, hASCs are more readily accessible and cause less damage to the body [35, 36]. We found that the effects of low concentrations of sildenafil on hASC proliferation and migration were similar to those on hBMSCs. In summary, 10 mg/L sildenafil enhanced the proliferation and migration of hBMSCs and hASCs in vitro . 4.2. Low concentrations of sildenafil promoted osteogenic differentiation of hMSCs in vitro . We found that low concentrations of sildenafil enhanced the osteogenic differentiation of hBMSCs and hASCs; this is novel. Previous studies indicated that various PDE5 inhibitors, such as sildenafil, enhanced the osteogenic differentiation of neonatal mouse calvarial cells (MCO). However, the sildenafil concentrations employed were not specified, and MSCs were not tested [37]. We found that sildenafil at 10 mg/L optimally promoted osteogenic differentiation of hMSCs in vitro ; this laid the groundwork for subsequent in vivo experiments. 4.3. Low concentrations of sildenafil promoted osteogenesis in vivo We used a nude mouse model of subcutaneous ectopic osteogenesis, and OVX and TS mouse models, to show that 10 mg/L sildenafil promoted osteogenesis in vivo . This suggested that sildenafil might usefully treat both primary and secondary osteoporosis [38]. The animal models used simulate both forms of osteoporosis. The OVX model mimics osteoporosis caused by post-menopausal estrogen deficiency; this form of primary osteoporosis is very common. In recent years, as space exploration has advanced, bone loss caused by weightlessness has garnered increasing attention. The TS mouse model simulates such bone loss (secondary osteoporosis) [39]. Sildenafil alleviated bone loss in both the OVX and TS animal models; this is clinically relevant. Previous studies have loaded sildenafil and phenytoin onto poly (lactic acid) bilayer nanofibrous scaffolds for orthopedic regeneration, primarily utilizing sildenafil to enhance vascularization within regenerating tissues and improve blood supply. These scaffolds demonstrated the ability to promote vascular repair and eventual healing in fracture models, but the focus was not on sildenafil's role in promoting bone regeneration. In contrast, our study emphasized the effects of sildenafil on the osteogenic differentiation of hMSCs and its potential to improve osteoporosis [40]. Another study combined sildenafil with keratin-based nanofibers and merwinite nanoparticles for bone tissue regeneration, but similarly highlighted sildenafil's role in promoting vascularization. Besides, this study lacked osteogenesis-related in vivo experiments, which distinguishes it from the focus of our research [41]. Recent studies have suggested that sildenafil mitigates bisphosphonate-induced osteonecrosis of the rat jaw and promotes healing in rat mandibular fracture models [42–44]. The aforementioned studies were limited to in vivo experiments and lacked in vitro investigations. Additionally, they did not directly apply to osteoporosis animal models or ectopic bone formation models but rather focused on the pro-osteogenic effects in a specific disease context. In contrast, our study focuses on the effects of sildenafil on the osteogenic differentiation of hMSCs, its therapeutic potential for osteoporosis, and the exploration of its possible mechanisms. In summary, sildenafil promotes the osteogenic differentiation of hBMSCs in vivo and may usefully treat osteoporosis. Sildenafil, as a clinically widely used drug, has demonstrated a relatively well-established safety profile despite side effects such as headache and dyspepsia. Our animal experiments further confirmed its biosafety. 4.4. Sildenafil promoted osteogenic differentiation of hBMSCs by affecting the TGF-β pathway. It remains unclear how sildenafil enhances the osteogenic differentiation of hBMSCs. It is essential to understand the mechanism(s) in play. We performed RNA-Seq transcriptomic analysis to this end; sildenafil modulated the TGF-β pathway signaling. Sildenafil activated that pathway in hBMSCs; the pathway critically regulates various biological processes including bone metabolism [45]. Salidroside alleviated inhibition of osteogenic differentiation by acting on the TGF-β signaling pathway [46]. Regulation of TGF-β signaling enhanced the osteogenic differentiation of BMSCs [47]. We suggest that sildenafil may enhance the osteogenic differentiation of hBMSCs by influencing TGF-β signaling; this is novel. However, more work is required. 4.5. Limitations and prospects We found that low concentrations of sildenafil promoted the osteogenic differentiation of hMSCs and inhibited bone loss. However, our work has certain limitations. First, the optimal sildenafil concentration was 5–20 mg/L; we used 10 mg/L, but the precise optimal concentration remains to be determined. Second, we did not explore why higher concentrations inhibited osteogenesis; future studies should evaluate toxicity and other explanations. Besides, due to limitations in time and funding, we have not yet conducted rescue experiments, such as adding pathway inhibitors, to further verify the necessity of the TGF-β signaling pathway in the therapeutic effects of sildenafil. More in vivo and in vitro experiments are required to clarify how TGF-β signaling affects sildenafil-induced osteogenic differentiation of hBMSCs. Finally, large-animal experiments are required if sildenafil is to be used to treat osteoporosis. 5. Conclusion Low concentrations (optimally 10 mg/L) of sildenafil enhanced hMSC proliferation, migration, and osteogenic differentiation in vitro . In vivo , 10 mg/L sildenafil promoted hBMSC osteogenic differentiation in the nude mouse model of subcutaneous heterotopic osteogenesis and prevented bone loss in TS and OVX mice. Mechanistically, sildenafil may enhance the osteogenic differentiation of hBMSCs by modulating the TGF-β signaling pathway. Low concentrations of sildenafil promoted the osteogenic differentiation of hMSCs, enhancing our understanding of the physiological effects of sildenafil and broadening the possible applications to management of osteoporosis. Abbreviations α-MEM α-minimum essential medium ALP Alkaline phosphatase ARS Alizarin red S BALP Bone alkaline phosphatase BGLAP Bone gamma-carboxyglutamate protein BMD Bone mineral density BS/BV Bone surface area/bone volume BV/TV Trabecular bone volume/tissue volume DMEM Dulbecco’s modified Eagle’s medium DMSO Dimethyl sulfoxide GAPDH Glyceraldehyde-3-phosphate dehydrogenase FBS Fetal bovine serum GO Gene Ontology H&E Hematoxylin and eosin hASCs Human adipose-derived mesenchymal stem cells hBMSCs Human bone marrow-derived mesenchymal stem cells hMSCs Human mesenchymal stem cells KEGG Kyoto Encyclopedia of Genes and Genomes Micro-CT Micro-computed tomography MCO Mouse calvarial cells OCN Osteocalcin OM Osteogenic medium OVX Ovariectomized P1NP Procollagen type 1 N-terminal propeptide PBS Phosphate balanced solution PDE5 Phosphodiesterase type 5 PM Proliferation medium p-Smad2/3 Phospho-Smad2/3 p-TGF-βR2 Phospho- transforming growth factor-β type ⅠⅠ receptor qRT-PCR Quantitative real-time reverse transcription polymerase chain reaction RNA-Seq RNA-Sequencing RUNX2 Runt-related transcription factor 2 Tb.N Trabecular number Tb.Sp Trabecular separation Tb.Th Trabecular thickness TGF-β Transforming growth factor-β TGF-β1 Transforming growth factor-β1 TGF-β2 Transforming growth factor-β2 TGF-βR1 Transforming growth factor-β type Ⅰ receptor TGF-βR2 Transforming growth factor-β type ⅠⅠ receptor TS Tail-suspended Declarations Ethics approval and consent to participate The study titled "The Effects and Mechanisms of Sildenafil in the Treatment of Osteoporosis" was approved by the Laboratory Animal Welfare and Ethics Committee of the Biomedical Ethics Committee at Peking University (Date: 16. 02. 2023, No. LA2023198). The specific animal experimental protocol for this study was pre-designed prior to the research. All surgeries were performed under anesthesia, and all efforts were made to minimize animal suffering. hBMSCs and hASCs were obtained from ScienCell Company (USA). ScienCell Company has confirmed that there was initial ethical approval for collection of human cells, and that the donors had signed informed consent. Consent for publication Not applicable. Availability of data and materials The RNA-seq data are available at the Sequence Read Archive of National Center for Biotechnology Information (PRJNA1200213). Competing interests The authors declare no conflicts of interest. Funding This work was supported by the National Science Foundation of China [grant numbers 82170929, 82370924]; the Youth Research Fund of Peking University School and Hospital of Stomatology [grant number PKUSS20230101]; and the Beijing Natural Science Foundation-Haidian Original Innovation Joint Fund Project [grant number L222030, L222090, L222145]. Authors' contributions Menglong Hu and Likun Wu primarily conducted the experiments and data analysis. Erfan Wei, Xingtong Pan, and Qiyue Zhu assisted in some experimental procedures. Likun Wu drafted the initial manuscript, with Menglong Hu providing revisions. Xv Xiuyun, Letian Lv, and Xinyi Dong reviewed the manuscript. Hao Liu and Yunsong Liu took primary responsibility for conceptual design and funding support. All authors have approved the final submitted version. Acknowledgements The authors declare that they have not use AI-generated work in this manuscript. References Li Z, Li D, Chen R, Gao S, Xu Z, Li N. Cell death regulation: A new way for natural products to treat osteoporosis. Pharmacological research. 2023; 187: 106635. Salari N, Ghasemi H, Mohammadi L, Behzadi MH, Rabieenia E, Shohaimi S, et al. The global prevalence of osteoporosis in the world: a comprehensive systematic review and meta-analysis. Journal of orthopaedic surgery and research. 2021; 16: 609. Foessl I, Dimai HP, Obermayer-Pietsch B. Long-term and sequential treatment for osteoporosis. Nature reviews Endocrinology. 2023; 19: 520-33. Peng J, Lai ZG, Fang ZL, Xing S, Hui K, Hao C, et al. Dimethyloxalylglycine prevents bone loss in ovariectomized C57BL/6J mice through enhanced angiogenesis and osteogenesis. PloS one. 2014; 9: e112744. Chen Y, Huang Y, Li J, Jiao T, Yang L. Enhancing osteoporosis treatment with engineered mesenchymal stem cell-derived extracellular vesicles: mechanisms and advances. Cell death & disease. 2024; 15: 119. Feehan J, Jacques M, Kondrikov D, Eynon N, Wijeratne T, Apostolopoulos V, et al. Circulating Osteoprogenitor Cells Have a Mixed Immune and Mesenchymal Progenitor Function in Humans. Stem cells (Dayton, Ohio). 2023; 41: 1060-75. Song S, Guo Y, Yang Y, Fu D. Advances in pathogenesis and therapeutic strategies for osteoporosis. Pharmacology & therapeutics. 2022; 237: 108168. Dai H, Hosseinpour S, Hua S, Xu C. Advances in porous inorganic nanomaterials for bone regeneration. Nano TransMed. 2022; 1: 9130005. Reid IR, Billington EO. Drug therapy for osteoporosis in older adults. Lancet (London, England). 2022; 399: 1080-92. Berdigaliyev N, Aljofan M. An overview of drug discovery and development. Future medicinal chemistry. 2020; 12: 939-47. Schlander M, Hernandez-Villafuerte K, Cheng CY, Mestre-Ferrandiz J, Baumann M. How Much Does It Cost to Research and Develop a New Drug? A Systematic Review and Assessment. PharmacoEconomics. 2021; 39: 1243-69. Andersson KE. PDE5 inhibitors - pharmacology and clinical applications 20 years after sildenafil discovery. British journal of pharmacology. 2018; 175: 2554-65. Gürsoy K, Oruç M, Kankaya Y, Ulusoy MG, Koçer U, Kankaya D, et al. Effect of topically applied sildenafil citrate on wound healing: experimental study. Bosnian journal of basic medical sciences. 2014; 14: 125-31. Caetano ESP, Mattioli SV, da Silva MLS, Martins LZ, Almeida AA, da Rocha ALV, et al. Sildenafil attenuates oxidative stress and endothelial dysfunction in lead-induced hypertension. Basic & clinical pharmacology & toxicology. 2023. Senthilkumar A, Smith RD, Khitha J, Arora N, Veerareddy S, Langston W, et al. Sildenafil promotes ischemia-induced angiogenesis through a PKG-dependent pathway. Arteriosclerosis, thrombosis, and vascular biology. 2007; 27: 1947-54. Baron-Menguy C, Bocquet A, Richard A, Guihot AL, Toutain B, Pacaud P, et al. Sildenafil-Induced Revascularization of Rat Hindlimb Involves Arteriogenesis through PI3K/AKT and eNOS Activation. International journal of molecular sciences. 2022; 23. Leal MAS, Aires R, Pandolfi T, Marques VB, Campagnaro BP, Pereira TMC, et al. Sildenafil reduces aortic endothelial dysfunction and structural damage in spontaneously hypertensive rats: Role of NO, NADPH and COX-1 pathways. Vascular pharmacology. 2020; 124: 106601. Bandara N, Gurusinghe S, Lim SY, Chen H, Chen S, Wang D, et al. Molecular control of nitric oxide synthesis through eNOS and caveolin-1 interaction regulates osteogenic differentiation of adipose-derived stem cells by modulation of Wnt/β-catenin signaling. Stem cell research & therapy. 2016; 7: 182. Su CH, Li WP, Tsao LC, Wang LC, Hsu YP, Wang WJ, et al. Enhancing Microcirculation on Multitriggering Manner Facilitates Angiogenesis and Collagen Deposition on Wound Healing by Photoreleased NO from Hemin-Derivatized Colloids. ACS nano. 2019; 13: 4290-301. Xu T, Yang Y, Suo D, Bei HP, Xu X, Zhao X. Electrosprayed Regeneration-Enhancer-Element Microspheres Power Osteogenesis and Angiogenesis Coupling. Small (Weinheim an der Bergstrasse, Germany). 2022; 18: e2200314. Li W, Liu Y, Zhang P, Tang Y, Zhou M, Jiang W, et al. Tissue-Engineered Bone Immobilized with Human Adipose Stem Cells-Derived Exosomes Promotes Bone Regeneration. ACS applied materials & interfaces. 2018; 10: 5240-54. Liu X, Li Z, Liu H, Zhu Y, Xia D, Wang S, et al. Low concentration flufenamic acid enhances osteogenic differentiation of mesenchymal stem cells and suppresses bone loss by inhibition of the NF-κB signaling pathway. Stem cell research & therapy. 2019; 10: 213. Yang F, Xue Y, Wang F, Guo D, He Y, Zhao X, et al. Sustained release of magnesium and zinc ions synergistically accelerates wound healing. Bioactive materials. 2023; 26: 88-101. Hu L, Zhao B, Gao Z, Xu J, Fan Z, Zhang C, et al. Regeneration characteristics of different dental derived stem cell sheets. Journal of oral rehabilitation. 2020; 47 Suppl 1: 66-72. Pachon RE, Scharf BA, Vatner DE, Vatner SF. Best anesthetics for assessing left ventricular systolic function by echocardiography in mice. American journal of physiology Heart and circulatory physiology. 2015; 308: H1525-9. Hablitz LM, Vinitsky HS, Sun Q, Stæger FF, Sigurdsson B, Mortensen KN, et al. Increased glymphatic influx is correlated with high EEG delta power and low heart rate in mice under anesthesia. Science advances. 2019; 5: eaav5447. Jin C, Zhang P, Zhang M, Zhang X, Lv L, Liu H, et al. Inhibition of SLC7A11 by Sulfasalazine Enhances Osteogenic Differentiation of Mesenchymal Stem Cells by Modulating BMP2/4 Expression and Suppresses Bone Loss in Ovariectomized Mice. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research. 2017; 32: 508-21. Peng H, Hu B, Xie LQ, Su T, Li CJ, Liu Y, et al. A mechanosensitive lipolytic factor in the bone marrow promotes osteogenesis and lymphopoiesis. Cell metabolism. 2022; 34: 1168-82.e6. Zhou L, Wu D, Zhou Y, Wang D, Fu H, Huang Q, et al. Tumor cell-released kynurenine biases MEP differentiation into megakaryocytes in individuals with cancer by activating AhR-RUNX1. Nature immunology. 2023; 24: 2042-52. Sable CA, Ivy DD, Beekman RH, 3rd, Clayton-Jeter HD, Jenkins KJ, Mahle WT, et al. 2017 ACC/AAP/AHA Health Policy Statement on Opportunities and Challenges in Pediatric Drug Development: Learning From Sildenafil. Journal of the American College of Cardiology. 2017; 70: 495-503. Dussault S, Maingrette F, Ménard C, Michaud SE, Haddad P, Groleau J, et al. Sildenafil increases endothelial progenitor cell function and improves ischemia-induced neovascularization in hypercholesterolemic apolipoprotein E-deficient mice. Hypertension (Dallas, Tex : 1979). 2009; 54: 1043-9. Bernardes FP, Batista AT, Porto ML, Vasquez EC, Campagnaro BP, Meyrelles SS. Protective effect of sildenafil on the genotoxicity and cytotoxicity in apolipoprotein E-deficient mice bone marrow cells. Lipids in health and disease. 2016; 15: 100. Ala M, Mohammad Jafari R, Ala M, Hejazi SM, Tavangar SM, Mahdavi SR, et al. Sildenafil improves radiation-induced oral mucositis by attenuating oxidative stress, NF-κB, ERK and JNK signalling pathways. Journal of cellular and molecular medicine. 2022; 26: 4556-65. Wortel RC, Mizrachi A, Li H, Markovsky E, Enyedi B, Jacobi J, et al. Sildenafil Protects Endothelial Cells From Radiation-Induced Oxidative Stress. The journal of sexual medicine. 2019; 16: 1721-33. Ge W, Liu Y, Chen T, Zhang X, Lv L, Jin C, et al. The epigenetic promotion of osteogenic differentiation of human adipose-derived stem cells by the genetic and chemical blockade of histone demethylase LSD1. Biomaterials. 2014; 35: 6015-25. Hurle K, Maia FR, Ribeiro VP, Pina S, Oliveira JM, Goetz-Neunhoeffer F, et al. Osteogenic lithium-doped brushite cements for bone regeneration. Bioactive materials. 2022; 16: 403-17. Pal S, Rashid M, Singh SK, Porwal K, Singh P, Mohamed R, et al. Skeletal restoration by phosphodiesterase 5 inhibitors in osteopenic mice: Evidence of osteoanabolic and osteoangiogenic effects of the drugs. Bone. 2020; 135: 115305. Soriano R, Herrera S, Nogués X, Diez-Perez A. Current and future treatments of secondary osteoporosis. Best practice & research Clinical endocrinology & metabolism. 2014; 28: 885-94. Gu R, Liu H, Hu M, Zhu Y, Liu X, Wang F, et al. D-Mannose prevents bone loss under weightlessness. Journal of translational medicine. 2023; 21: 8. Ali IH, Khalil IA, El-Sherbiny IM. Phenytoin/sildenafil loaded poly(lactic acid) bilayer nanofibrous scaffolds for efficient orthopedics regeneration. International journal of biological macromolecules. 2019; 136: 154-64. Talib Al-Sudani B, Al-Musawi MH, Kamil MM, Turki SH, Nasiri-Harchegani S, Najafinezhad A, et al. Vasculo-osteogenic keratin-based nanofibers containing merwinite nanoparticles and sildenafil for bone tissue regeneration. International journal of pharmaceutics. 2024; 667: 124875. Mroczek T, Delfrate G, Mecca LEA, Andreis JD, Lipinski LC, Fernandes D, et al. Sildenafil reduces bisphosphonate-induced jaw osteonecrosis in rats. Clinical oral investigations. 2023; 27: 2437-48. Çakir-Özkan N, Bereket C, Sener I, Alici Ö, Kabak YB, Önger ME. Therapeutic Effects of Sildenafil on Experimental Mandibular Fractures. The Journal of craniofacial surgery. 2016; 27: 615-20. MalekiGorji M, Golestaneh A, Razavi SM. The effect of two phosphodiesterase inhibitors on bone healing in mandibular fractures (animal study in rats). Journal of the Korean Association of Oral and Maxillofacial Surgeons. 2020; 46: 258-65. Davis BN, Hilyard AC, Lagna G, Hata A. SMAD proteins control DROSHA-mediated microRNA maturation. Nature. 2008; 454: 56-61. Xie B, Zhou H, Liu H, Liao S, Zhou C, Xu D. Salidroside alleviates dexamethasone-induced inhibition of bone formation via transforming growth factor-beta/Smad2/3 signaling pathway. Phytotherapy research : PTR. 2023; 37: 1938-50. Wang T, Li W, Zhang Y, Xu X, Qiang L, Miao W, et al. Bioprinted constructs that simulate nerve-bone crosstalk to improve microenvironment for bone repair. Bioactive materials. 2023; 27: 377-93. Supplementary Files AuthorChecklistFull.pdf SupplementaryMaterial.docx GraphicAbstract.jpeg Cite Share Download PDF Status: Published Journal Publication published 23 Apr, 2025 Read the published version in Stem Cell Research & Therapy → Version 1 posted Reviewers agreed at journal 21 Jan, 2025 Reviewers invited by journal 21 Jan, 2025 Editor assigned by journal 16 Jan, 2025 First submitted to journal 14 Jan, 2025 Editorial decision: Major Revision 12 Jan, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-5662251","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":405267776,"identity":"2ad9aef8-5572-4849-aadb-9aeeb5714f68","order_by":0,"name":"Menglong Hu","email":"","orcid":"","institution":"Peking University Hospital of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Menglong","middleName":"","lastName":"Hu","suffix":""},{"id":405267777,"identity":"4e7cacab-3f84-4632-869d-7355dc36312c","order_by":1,"name":"Likun Wu","email":"","orcid":"","institution":"Peking University Hospital of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Likun","middleName":"","lastName":"Wu","suffix":""},{"id":405267778,"identity":"a7b68b1d-c7c5-441b-a026-3b64bb605b89","order_by":2,"name":"Erfan Wei","email":"","orcid":"","institution":"Peking University Hospital of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Erfan","middleName":"","lastName":"Wei","suffix":""},{"id":405267779,"identity":"9be3544c-269d-4de0-b786-541ab9848cc1","order_by":3,"name":"Xingtong Pan","email":"","orcid":"","institution":"Peking University Hospital of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Xingtong","middleName":"","lastName":"Pan","suffix":""},{"id":405267780,"identity":"0ecf9d87-b445-4cc8-aa0b-f902cab56e02","order_by":4,"name":"Qiyue Zhu","email":"","orcid":"","institution":"Peking University Hospital of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Qiyue","middleName":"","lastName":"Zhu","suffix":""},{"id":405267781,"identity":"0c39fb0c-6115-43db-ac1f-187a4f66b10f","order_by":5,"name":"Xv Xiuyun","email":"","orcid":"","institution":"Peking University Hospital of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Xv","middleName":"","lastName":"Xiuyun","suffix":""},{"id":405267782,"identity":"f49ed635-1514-44d9-a5fa-1bef2b140b15","order_by":6,"name":"Letian Lv","email":"","orcid":"","institution":"Peking University Hospital of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Letian","middleName":"","lastName":"Lv","suffix":""},{"id":405267783,"identity":"630b9812-1217-417b-b4d9-7d8069948029","order_by":7,"name":"Xinyi Dong","email":"","orcid":"","institution":"Peking University Hospital of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Xinyi","middleName":"","lastName":"Dong","suffix":""},{"id":405267784,"identity":"8e5a8e64-2d44-4feb-9c89-c5d9bef1bdda","order_by":8,"name":"Hao Liu","email":"","orcid":"","institution":"Peking University Hospital of Stomatology","correspondingAuthor":false,"prefix":"","firstName":"Hao","middleName":"","lastName":"Liu","suffix":""},{"id":405267785,"identity":"8eac50ce-c524-4668-8eac-b3e314ad7e1a","order_by":9,"name":"Yunsong Liu","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA+0lEQVRIiWNgGAWjYBACPmY4k/kYmJIAETx4tLAhtLClEakFweQxI1ILO4+ZNO+OOjlz/jXfHv6oYciTnJHA+OBtG4O8OU6HgbScOWxsOePtdmOeYwzF0hIJzIZz2xgMdzbg09J2IHHDjbPbpBkbGBLnSSSwAUUYEgwO4NVSB9Ry5pnkT4gW9t9EaGFO3HC+h02CF6hlNtAWZvxa2Iot57YdNja4wWYmzXNMoliy52Gz5JxzEoYbcGjh5z+88cbbtjo5g/OHn0n+qLHJkziefPDDmzIbeVy2AAELOCYYJBJgJDAQoNGDCzB/gNgHMTQBn9JRMApGwSgYmQAAC/ZO7ml1ajMAAAAASUVORK5CYII=","orcid":"https://orcid.org/0000-0001-8364-1898","institution":"Peking University School of Stomatology","correspondingAuthor":true,"prefix":"","firstName":"Yunsong","middleName":"","lastName":"Liu","suffix":""}],"badges":[],"createdAt":"2024-12-17 13:39:26","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-5662251/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-5662251/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s13287-025-04320-7","type":"published","date":"2025-04-23T15:57:36+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":74587326,"identity":"c7c40c29-c0bd-4928-9fd7-79d83cbfdfcb","added_by":"auto","created_at":"2025-01-23 16:55:33","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":753529,"visible":true,"origin":"","legend":"\u003cp\u003eLow concentrations of sildenafil enhanced the proliferation and migration of hBMSCs \u003cem\u003ein vitro\u003c/em\u003e. A. Chemical structure of sildenafil; B. hBMSC growth curve derived using the CCK-8 assay; C, D. The transwell assay was employed to investigate how sildenafil at different concentrations affected hBMSC migration; E, F. The morphologies and quantitative analyses of the scratch assay migration areas used to explore the effects of sildenafil at different concentrations on hBMSC migration. The data are means ± standard deviations. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, and ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 compared to the PM group. N ≥ 3. Transwell assay image [scale bar]: 100 μm. Scratch assay image [scale bar]: 500 μm. hBMSCs, human bone marrow-derived mesenchymal stem cells.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-5662251/v1/a89b8b1c3b111ecf01a0b922.png"},{"id":74586219,"identity":"4b9a81bb-aad1-460c-b3db-a531bfcf2acd","added_by":"auto","created_at":"2025-01-23 16:47:33","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":448472,"visible":true,"origin":"","legend":"\u003cp\u003eLow concentrations of sildenafil enhanced osteogenic differentiation of hBMSCs \u003cem\u003ein vitro\u003c/em\u003e. A. ALP staining revealing the effects of sildenafil at different concentrations on the osteogenic differentiation of hBMSCs; B. ARS staining revealing the effects of sildenafil at different concentrations on the osteogenic differentiation of hBMSCs; C. Quantification of ALP staining; D. Quantification of ARS staining; E. The relative levels of mRNAs encoding \u003cem\u003eRUNX2\u003c/em\u003e and\u003cem\u003eALP\u003c/em\u003e in hBMSCs as revealed by qRT-PCR after 7 days of osteogenic induction; F. The relative levels of mRNAs encoding \u003cem\u003eRUNX2 \u003c/em\u003eand\u003cem\u003e BGLAP\u003c/em\u003e in hBMSCs after 14 days of osteogenic induction. The data are means ± standard deviations. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, and ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 compared to the OM group. hBMSCs, human bone marrow-derived mesenchymal stem cells; ALP, alkaline phosphatase; ARS, alizarin red S; RUNX2, runt-related transcription factor 2; BGLAP, bone gamma-carboxyglutamate protein; qRT-PCR, quantitative real-time reverse transcription polymerase chain reaction; OM, osteogenic medium.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-5662251/v1/c2452408c11670fe86fc0f3b.png"},{"id":74587616,"identity":"1b356a9a-473f-44b2-a56c-aa57b6de53bc","added_by":"auto","created_at":"2025-01-23 17:03:36","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":903601,"visible":true,"origin":"","legend":"\u003cp\u003eSildenafil at 10 mg/L promoted osteogenic differentiation of hBMSCs in the subcutaneous ectopic osteogenesis model. A. H\u0026amp;E staining of the PM and the PM + sildenafil groups; B. Masson trichrome staining of the PM and the PM + sildenafil groups; C. Immunohistochemical staining for OCN of the PM and the PM + sildenafil groups. [scale bars]: 500 μm (10x) and 100 μm (40x). hBMSCs, human bone marrow-derived mesenchymal stem cells; H\u0026amp;E, hematoxylin and eosin; PM, proliferation medium; OCN, osteocalcin.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-5662251/v1/3770c45aad81afade5e5f35e.png"},{"id":74587324,"identity":"d884359e-0f6a-4892-8098-ad6550fe39a2","added_by":"auto","created_at":"2025-01-23 16:55:33","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1234488,"visible":true,"origin":"","legend":"\u003cp\u003eSildenafil at 10 mg/L alleviated osteoporosis in OVX mice. A. Micro-CT images, H\u0026amp;E staining and Masson staining of the sham + PBS, sham + sildenafil, OVX + PBS, and OVX + sildenafil groups; B-G. The BMD, BV/TV, Tb.N, Tb.Th, BS/BV, and Tb.Sp values of the of sham + PBS, sham + sildenafil, OVX + PBS, and OVX + sildenafil groups; H, I. The expression levels of the bone formation-related serum markers BALP and P1NP in the sham + PBS, sham + sildenafil, OVX + PBS, and OVX + sildenafil groups. The data are means ± standard deviations. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, and ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001. n ≥ 3. H\u0026amp;E staining image [scale bar]: 500 μm. OVX, ovariectomized; micro-CT, micro-computed tomography; PBS, phosphate balanced solution; H\u0026amp;E, hematoxylin and eosin; BMD, bone mineral density; BV/TV, bone volume fraction; Tb.N, trabecular number; Tb.Th, trabecular thickness; BS/BV, bone surface area/bone volume; Tb.Sp, trabecular separation; BALP, bone alkaline phosphatase; P1NP, procollagen type 1 N-terminal propeptide. ​\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-5662251/v1/ce534c92932d09a1398e794d.png"},{"id":74587617,"identity":"5a05d8d7-68bb-4eb5-9b67-8358de41a801","added_by":"auto","created_at":"2025-01-23 17:03:36","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":1215003,"visible":true,"origin":"","legend":"\u003cp\u003eSildenafil at 10 mg/L alleviated osteoporosis in TS mice. A. Micro-CT images, H\u0026amp;E staining and Masson staining of the sham + PBS, sham + sildenafil, suspension + PBS, and suspension + sildenafil groups; B-G. The BMD, BV/TV, Tb.N, Tb.Th, BS/BV, and Tb.Sp values of the sham + PBS, sham + sildenafil, suspension + PBS, and suspension + sildenafil groups; H, I. The expression levels of the bone formation-related serum markers BALP and P1NP in the sham + PBS, sham + sildenafil, suspension + PBS, and suspension + sildenafil groups. The data are means ± standard deviations. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, and ***\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.001. n ≥ 3. H\u0026amp;E staining image [scale bar]: 500 μm. TS, tail-suspended; micro-CT, micro-computed tomography; PBS, phosphate balanced solution; H\u0026amp;E, hematoxylin and eosin; BMD, bone mineral density; BV/TV, bone volume fraction; Tb.N, trabecular number; Tb.Th, trabecular thickness; BS/BV, bone surface area/bone volume; Tb.Sp, trabecular separation; BALP, anti-bone alkaline phosphatase; P1NP, type Ⅰ N terminal propeptide.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-5662251/v1/a8888fda38fd544faf2c62c9.png"},{"id":74586250,"identity":"d69a2e34-4792-413d-9675-c7b10c0a3652","added_by":"auto","created_at":"2025-01-23 16:47:34","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":764890,"visible":true,"origin":"","legend":"\u003cp\u003eSildenafil may promote osteogenic differentiation of hBMSCs by modulating the TGF-β signaling pathway. A. The Venn diagram of co-expressed genes in the OM and OM + sildenafil groups; B. The volcano plot of differentially expressed genes in the OM and OM + sildenafil groups; C. GO gene enrichment maps; D. The KEGG enrichment scatter plot; E-H. qRT-PCR analysis of the relative levels of mRNAs encoding TGF-β1, TGF-β2, TGF-βR1, and TGF-βR2 in hBMSCs; I. Western blots revealing the expression levels of TGF-β1, TGF-βR2, p-TGF-βR2, Smad2/3, p-Smad2/3, and GAPDH. Full-length blots are presented in Supplementary Figures (Fig. S5-9), the samples derived from the same experiment and that blots were processed in parallel; J-L. Quantification of TGF-β1, p-TGF-βR2/ TGF-βR2, and p-Smad2/3/ Smad2/3 expression. The data are means ± standard deviations. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, and ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 compared to OM. N ≥ 3. hBMSCs, human bone marrow-derived mesenchymal stem cells; OM, osteogenic medium; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes; qRT-PCR, quantitative real-time reverse transcription polymerase chain reaction; TGF-β1, transforming growth factor-β1; TGF-β2, transforming growth factor-β2; TGF-βR1, transforming growth factor-β type Ⅰ receptor; TGF-βR2, transforming growth factor-β type ⅠⅠ receptor; p-TGF-βR2, phospho- transforming growth factor-β type ⅠⅠ receptor; p-Smad2/3, phospho-Smad2/3; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; OM, osteogenic media.\u003c/p\u003e","description":"","filename":"Figure6.png","url":"https://assets-eu.researchsquare.com/files/rs-5662251/v1/262931feae9a37045816634a.png"},{"id":74586221,"identity":"143bd3af-52fe-40f8-94a9-4b1f674e3072","added_by":"auto","created_at":"2025-01-23 16:47:33","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":578789,"visible":true,"origin":"","legend":"\u003cp\u003eSildenafil promotes osteogenic differentiation of hMSCs and suppresses bone loss by affecting TGF-β signaling. Low concentrations of sildenafil enhanced the proliferation and migration of hMSCs \u003cem\u003ein vitro\u003c/em\u003e, and promoted osteogenic differentiation of hMSCs both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e. \u003cem\u003eIn vivo\u003c/em\u003e, 10 mg/L sildenafil reduced bone loss in both OVX and TS mice. Sildenafil may promote osteogenic differentiation of hBMSCs by influencing the TGF-β signaling pathway. hMSCs, human mesenchymal stem cells; TGF-β, transforming growth factor-β; OVX, ovariectomized; TS, tail-suspended; hBMSCs, human bone marrow-derived mesenchymal stem cells.\u003c/p\u003e","description":"","filename":"Figure7.png","url":"https://assets-eu.researchsquare.com/files/rs-5662251/v1/6733301a7302d2df78e1e408.png"},{"id":81569654,"identity":"3b1421a1-29c9-48ec-a249-ab7d6229d461","added_by":"auto","created_at":"2025-04-28 16:09:38","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":7284619,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5662251/v1/fb97adf3-86b8-4b0b-a92c-4a7042f8e98a.pdf"},{"id":74587323,"identity":"093c4048-da33-43e5-a3c5-ece38ac7800f","added_by":"auto","created_at":"2025-01-23 16:55:33","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":306977,"visible":true,"origin":"","legend":"","description":"","filename":"AuthorChecklistFull.pdf","url":"https://assets-eu.researchsquare.com/files/rs-5662251/v1/9ed25e8604cf6f3ca286e5fd.pdf"},{"id":74586232,"identity":"9fa6361e-aea7-4ca3-8dde-4199c804c8b6","added_by":"auto","created_at":"2025-01-23 16:47:33","extension":"docx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":2236028,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryMaterial.docx","url":"https://assets-eu.researchsquare.com/files/rs-5662251/v1/9a5ca377b6d7f96feab3ec44.docx"},{"id":74586229,"identity":"ab59a7ed-3dfd-4230-a260-197d9eaf842f","added_by":"auto","created_at":"2025-01-23 16:47:33","extension":"jpeg","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":1349596,"visible":true,"origin":"","legend":"","description":"","filename":"GraphicAbstract.jpeg","url":"https://assets-eu.researchsquare.com/files/rs-5662251/v1/b04fed4a379857c24d7f4ca4.jpeg"}],"financialInterests":"","formattedTitle":"Sildenafil Promotes Osteogenic Differentiation of Human Mesenchymal Stem Cells and Inhibits Bone Loss by Affecting the TGF-β Signaling Pathway","fulltext":[{"header":"1. Background","content":"\u003cp\u003eOsteoporosis is a common bone disorder associated with reduced bone density and quality, and microstructural damage; bones become more fragile and the fracture risk rises. Osteoporosis affects not only patients but also their families and society [1]. The global prevalence of osteoporosis in older adults is 21.7% [2, 3]. The numbers of intraosseous blood vessels decrease in patients with senile and postmenopausal osteoporosis [4]. Such changes in bone structure may be related to impaired osteogenic differentiation capacities of mesenchymal stem cells (MSCs) [5, 6].\u003c/p\u003e \u003cp\u003eMany osteoporosis management and prevention strategies have been developed [7, 8]. Currently, pharmacotherapy is the simplest, most convenient, and most effective approach; the fracture risk is decreased either by reducing bone resorption or stimulating bone formation. Bisphosphonates find many clinical applications, but the adverse effects include upper gastrointestinal tract symptoms, renal toxicity, and (rarer) complications such as medication-related jaw osteonecrosis [7, 9]. New pharmacological interventions are required.\u003c/p\u003e \u003cp\u003eAny new drug must be evaluated both preclinically and clinically; this is expensive (over 2\u0026nbsp;billion dollars), risky, and time-consuming (10 to 15 years) [10, 11]. New indications for existing drugs are thus very attractive.\u003c/p\u003e \u003cp\u003eSildenafil, the small-molecule C\u003csub\u003e22\u003c/sub\u003eH\u003csub\u003e30\u003c/sub\u003eN\u003csub\u003e6\u003c/sub\u003eO\u003csub\u003e4\u003c/sub\u003eS, is currently primarily used to treat erectile dysfunction but may also aid patients with fatty liver and heart failure [4, 12]. Sildenafil improves vascular function, promotes angiogenesis, and enhances wound-healing [13\u0026ndash;17]. As an inhibitor of phosphodiesterase type 5 (PDE5), sildenafil enhances the activity of the nitric oxide/soluble guanylate cyclase/cyclic guanosine monophosphate (NO/sGC/cGMP) pathway that controls cell growth and differentiation and smooth muscle relaxation [12]. NO stimulates both bone regeneration and new blood vessel formation via the NO/sGC/cGMP pathway [18\u0026ndash;20]. Given the close relationship between angiogenesis, NO activity, and osteogenesis, and that of the reduced bone vasculature and impaired cell differentiation of osteoporosis patients, we hypothesized that sildenafil might effectively treat osteoporosis. We thus explored whether sildenafil enhanced hMSC osteogenic differentiation. To the best of our knowledge, no study has yet addressed this topic. Importantly, sildenafil is an approved drug; sildenafil is safe.\u003c/p\u003e \u003cp\u003eWe here examine how sildenafil affects hMSC osteogenic differentiation both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e, and the potential molecular mechanisms in play. Sildenafil at 10 mg/L promoted hMSC osteogenic differentiation both \u003cem\u003ein vitro\u003c/em\u003e and \u003cem\u003ein vivo\u003c/em\u003e, the latter in a model of ectopic bone formation; and inhibited bone loss in ovariectomized mice and those suspended by their hindlimbs. Sildenafil may modulate the TGF-β signaling pathway. We expand the therapeutic applications of sildenafil; the material may usefully treat osteoporosis.\u003c/p\u003e"},{"header":"2. Materials and Methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003e2.1. hMSC culture\u003c/h2\u003e \u003cp\u003eHuman bone marrow-derived MSCs (hBMSCs) and human adipose-derived mesenchymal stem cells (hASCs) (ScienCell Company, USA) were grown at 37\u0026deg;C. The proliferation medium (PM) and the osteogenic medium (OM) were prepared according to the previous literature [21].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003e2.2. The sildenafil concentrate\u003c/h2\u003e \u003cp\u003eSildenafil (Y0001578, Sigma-Aldrich, China) was dissolved in PM with 1\u0026permil; dimethyl sulfoxide (DMSO) to 100 mg/L and then diluted to 1, 5, 10, 20, and 40 mg/L in PM or OM.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003e2.3. Cell proliferation assay\u003c/h2\u003e \u003cp\u003ehBMSCs and hASCs were seeded into 96-well plates. Cell proliferation was assessed on days 0, 1, 3, 5, 7, and 14 (three replicate wells). Cells were counted using a Cell Counting Kit-8 (Dojindo Laboratories, Japan) and the absorbance at 450 nm was measured to quantify cell proliferation by a microplate reader (ELx800, Biotek, America). The details have been previously described [22].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003e2.4. Scratch assay\u003c/h2\u003e \u003cp\u003ehBMSCs and hASCs were cultured in six-well plates to approximately 70% confluence; scratches were created using the tip of a 200-\u0026micro;L pipette, and serum-free media with varying concentrations of sildenafil added. The cells were photographed under an inverted optical microscope (TE2000-U, Nikon, Japan) at 0, 12, and 24 h. Image J software (Open access, USA) was used to measure cell migration, as follows:\u003c/p\u003e \u003cp\u003eCell migration ratio (%)\u003cspan class=\"InlineEquation\"\u003e\u003cspan class=\"mathinline\"\u003e\\(\\:=\\frac{\\text{A}0-\\:\\text{A}\\text{t}}{\\text{A}0}\\times\\:100\\%\\)\u003c/span\u003e\u003c/span\u003e\u003c/p\u003e \u003cp\u003ewhere A\u003csub\u003e0\u003c/sub\u003e and A\u003csub\u003et\u003c/sub\u003e are the respective scratch areas before and after addition of serum-free culture media [23].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003e2.5. Transwell assay\u003c/h2\u003e \u003cp\u003ePM (600 \u0026micro;L) was added to the lower chamber and 1\u0026times;10\u003csup\u003e5\u003c/sup\u003e hBMSCs or hASCs in 200 \u0026micro;L of serum-free medium supplemented or not with various concentrations of sildenafil to the upper chamber. The chambers were separated by a membrane filter with pores 8 \u0026micro;m in diameter (Corning, USA). After 24 h of incubation, the upper chamber (with non-migratory cells) was removed. The membrane was fixed, and stained for 10 min in 0.1% (w/v) crystal violet; then washed, dried, images captured, and migrated cells counted. The details have been previously published [21].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003e2.6. Alkaline phosphatase (ALP) staining and quantification\u003c/h2\u003e \u003cp\u003eCells (20,000) were added to each well of a 12-well plate, grown to 70\u0026ndash;80% confluence, and osteogenically induced. Experiments commenced after 7 days of culture in OM with various concentrations of sildenafil. ALP staining/assessment employed a dedicated kit (Beyotime, China) and a microplate reader (ELx800, Biotek, USA). The details have been published previously [22].\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003e2.7. Alizarin red S (ARS) staining and quantification\u003c/h2\u003e \u003cp\u003eCells (20,000) were added to each well of a 12-well plate, grown to 70\u0026ndash;80% confluence, and osteogenically induced. After incubation in PM, OM, or OM with various concentrations of sildenafil for 14 days, hBMSCs or hASCs were stained with an ARS solution (Sigma-Aldrich, USA) for 10\u0026ndash;20 min and imaged (HP Scanjet G4050; Hewlett-Packard, USA). To quantify staining, mineralized nodules were dissolved in 100 mM cetylpyridinium chloride and absorbances at 490 nm recorded using a spectrophotometer (ELx800; Biotek, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003e2.8. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR)\u003c/h2\u003e \u003cp\u003eCells (50,000) were added to each well of a 6-well plate, grown to 70\u0026ndash;80% confluence, and osteogenically induced. Total RNAs were prepared from hBMSCs and hASCs cultured for 7 and 14 days. The equipment and methods used to determine total RNA concentrations, reverse transcription to cDNA, and qRT-PCR, have been published previously [22]. The primers are listed in Table\u0026nbsp;\u003cspan refid=\"Tab1\" class=\"InternalRef\"\u003e1\u003c/span\u003e.\u003c/p\u003e \u003cp\u003e \u003cdiv class=\"gridtable\"\u003e\u003ctable float=\"Yes\" id=\"Tab1\" border=\"1\"\u003e \u003ccaption language=\"En\"\u003e \u003cdiv class=\"CaptionNumber\"\u003eTable 1\u003c/div\u003e \u003cdiv class=\"CaptionContent\"\u003e \u003cp\u003eThe primer sequences.\u003c/p\u003e \u003c/div\u003e \u003c/caption\u003e \u003ccolgroup cols=\"3\"\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c1\" colnum=\"1\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c2\" colnum=\"2\"\u003e\u003c/div\u003e \u003cdiv align=\"left\" class=\"colspec\" colname=\"c3\" colnum=\"3\"\u003e\u003c/div\u003e \u003cthead\u003e \u003ctr\u003e \u003cth align=\"left\" colname=\"c1\"\u003e \u003cp\u003eGenes\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c2\"\u003e \u003cp\u003eForward (5ʹ to 3ʹ)\u003c/p\u003e \u003c/th\u003e \u003cth align=\"left\" colname=\"c3\"\u003e \u003cp\u003eReverse (5ʹ to 3ʹ)\u003c/p\u003e \u003c/th\u003e \u003c/tr\u003e \u003c/thead\u003e \u003ctbody\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eGAPDH\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCGGACCAATACGACCAAATCCG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eAGCCACATCGCTCAGACACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eALP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eGACCTCCTCGGAAGACACTC\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGAAGGGCTTCTTGTCTGTG\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eRUNX2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCTTAGAACAAATTCTGCCCTTT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTGCTTTGGTCTTGAAATCACA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eBGLAP\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAGCAAAGGTGCAGCCTTTGT\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCGCCTGGGTCTCTTCACT\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTGF-β1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eCAATTCCTGGCGATACCTCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGCACAACTCCGGTGACATCAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTGF-βR1\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCAGCTCTGGTTGGTGTCAG\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eATGTGAAGATGGGCAAGACC\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTGF-β2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eTCAAGAGGGATCTAGGGTGGAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eGGCARGCTCCAGCACAGAA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003ctr\u003e \u003ctd align=\"left\" colname=\"c1\"\u003e \u003cp\u003e\u003cem\u003eTGF-βR2\u003c/em\u003e\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c2\"\u003e \u003cp\u003eAATATCCTCTGAAGAACGACCTAA\u003c/p\u003e \u003c/td\u003e \u003ctd align=\"left\" colname=\"c3\"\u003e \u003cp\u003eTCCCACCTGCCCACTGTTA\u003c/p\u003e \u003c/td\u003e \u003c/tr\u003e \u003c/tbody\u003e \u003c/colgroup\u003e \u003ctfoot\u003e \u003ctr\u003e\u003ctd colspan=\"3\"\u003eGAPDH, glyceraldehyde-3-phosphate dehydrogenase; ALP, alkaline phosphatase; RUNX2, runt-related transcription factor 2; BGLAP, bone gamma-carboxyglutamate protein; TGF-β1, transforming growth factor-β1; TGF-βR1, transforming growth factor-β type Ⅰ receptor; TGF-β2, transforming growth factor-β2; TGF-βR2, transforming growth factor-β type ⅠⅠ receptor.\u003c/td\u003e\u003c/tr\u003e \u003c/tfoot\u003e \u003c/table\u003e\u003c/div\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003e2.9. Subcutaneous cell transplantation into nude mice\u003c/h2\u003e \u003cp\u003eGuided by the \u003cem\u003ein vitro\u003c/em\u003e results, sildenafil at 10 mg/L was used \u003cem\u003ein vivo\u003c/em\u003e. Twelve BALB/C nude mice (female, 6 weeks of age) were randomly divided into two groups of five and given hBMSCs grown in either PM or PM\u0026thinsp;+\u0026thinsp;10 mg/L sildenafil. hBMSCs that had been cultured for 7 days were mixed with β-tricalcium phosphate (Rebone, China) and then subcutaneously implanted into the dorsa of nude mice. Samples collected after 8 weeks were subjected to Masson staining, hematoxylin and eosin (H\u0026amp;E) staining, and immunohistochemical staining for OCN (osteocalcin) to evaluate osteogenesis [24]. We thus explored whether sildenafil aided the heterotopic osteogenic differentiation of hBMSCs \u003cem\u003ein vivo\u003c/em\u003e.\u003c/p\u003e \u003cp\u003eThe mice were purchased from the Vital River Corporation (China). All animal experiments were complied with the ARRIVE guidelines and were carried out in accordance with the U.K. Animals (Scientific Procedures) Act, 1986 and associated guidelines. In the animal experiments of this study, the animals were housed under SPF condition with a controlled temperature of 20\u0026ndash;26\u0026deg;C, relative humidity of 40\u0026ndash;70%, and a 12/12-hour light/dark cycle. The sample size for each group of mice was determined based on previous studies [22]. The mice were first acclimated for one week, after which those without apparent abnormalities in appearance or behavior were selected. They were then randomly assigned to different groups using a random number generator. Experimental and control groups were randomly assigned. If a mouse died due to surgery, it was excluded from the group, and a new mouse from the same batch was randomly selected for subsequent experiments. All mice were anesthetized with avertin (a 1:1 mixture of tribromoethanol and tert-amyl alcohol), which was diluted to 0.25% with saline before use and administered via intramuscular injection at a dose of 150 mg/kg (\u0026zwnj;MA0478\u0026zwnj;\u0026zwnj;1, meilunbio, China) [25, 26]. Euthanasia of mice was performed by cervical dislocation following deep anesthesia. Data analysts were blinded to the group assignments during analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003e2.10. Intraperitoneal injection of ovariectomized (OVX) mice\u003c/h2\u003e \u003cp\u003eMice were anesthetized with avertin (150 mg/kg), and bilateral ovariectomy was performed through a dorsal approach to remove the ovaries. Sham-operated mice underwent the same procedure without ovary removal. The OVX model induces estrogen deficiency, which mimics the pathophysiological changes observed in postmenopausal osteoporosis [27].\u003c/p\u003e \u003cp\u003eTwenty female SPF C57BL/6N mice (8 weeks of age) were categorized into four groups (n\u0026thinsp;=\u0026thinsp;5): Sham\u0026thinsp;+\u0026thinsp;PBS, sham\u0026thinsp;+\u0026thinsp;sildenafil, OVX\u0026thinsp;+\u0026thinsp;PBS, and OVX\u0026thinsp;+\u0026thinsp;sildenafil. Sildenafil was intraperitoneally injected daily for 1 month commencing 3 months after surgery; the control group receiving an equivalent volume of PBS. After 1 further month, femoral osteogenesis was evaluated via H\u0026amp;E staining, Masson staining and micro-CT. Heart, liver, spleen, lung, kidney, and blood samples were subjected to H\u0026amp;E staining and serological analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003e2.11. Intraperitoneal injection of tail-suspended mice\u003c/h2\u003e \u003cp\u003eMice were tail-suspended with the heads tilted downward at 30\u0026deg; and the hind limbs elevated for 14 days. Sham-treated mice were not suspended, mouse movement was not restricted [28]. Twenty female SPF C57BL/6N mice (8 weeks of age) were divided into four groups (n\u0026thinsp;=\u0026thinsp;5): Sham\u0026thinsp;+\u0026thinsp;PBS, sham\u0026thinsp;+\u0026thinsp;sildenafil, suspension\u0026thinsp;+\u0026thinsp;PBS, and suspension\u0026thinsp;+\u0026thinsp;sildenafil. Commencing on day 14 after tail suspension (TS), mice received daily intraperitoneal injections of sildenafil or PBS for 14 days, after which samples were collected. Femora were subjected to H\u0026amp;E staining, Masson staining and micro-CT analysis that evaluated osteogenesis status. Heart, liver, spleen, lung, kidney, and blood samples were taken for H\u0026amp;E staining and serological analysis.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003e2.12. ELISA of serum biomarkers\u003c/h2\u003e \u003cp\u003eBlood samples were obtained from the mice of Sections \u003cspan refid=\"Sec13\" class=\"InternalRef\"\u003e2.11\u003c/span\u003e and \u003cspan refid=\"Sec14\" class=\"InternalRef\"\u003e2.12\u003c/span\u003e above. Bone alkaline phosphatase (BALP) and procollagen type 1 N-terminal propeptide (P1NP), both of which are indicators of bone formation, were quantitated using ELISA kits (Telenbiotech, China).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003e2.13. Micro-computed tomography (CT)\u003c/h2\u003e \u003cp\u003eMouse femora were fixed in 10% (v/v) formalin for 24 h and then scanned from the proximal end. The scan time was 1,500 ms and the scan resolution 8.82 \u0026micro;m. Data analysis employed an Inveon Research Workplace (Siemens, Germany). This derived the bone mineral density (BMD), bone surface area/bone volume (BS/BV), bone volume fraction (BV/TV), trabecular thickness (Tb.Th), trabecular separation (Tb.Sp), and trabecular number (Tb.N).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003e2.14. RNA-sequencing (RNA-Seq) and statistical analyses\u003c/h2\u003e \u003cp\u003ehBMSCs (50,000) were seeded into each well of a six-well plate, grown to 70\u0026ndash;80% confluence, osteogenically induced in OM (control) and OM with 10 mg/L sildenafil for 7 days, and RNAs collected. RNA-Seq was performed by Novogene Bioinformatics Technology Co. Ltd. All RNA samples underwent rigorous quality control, primarily using an Agilent 2100 bioanalyzer. High-quality libraries underwent Illumina sequencing. RNA-Seq identifies differences in gene expression via reference genome alignment; quality control; and quantitative, functional enrichment, differential expression, alternative splicing, and variant site analyses.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003e2.15. Western blotting\u003c/h2\u003e \u003cp\u003ehBMSCs were induced in OM (control) and OM supplemented with 10 mg/L sildenafil for 7 days and proteins collected. A digital Western blot system (Simple Western Blot; Wes Separation Module, ProteinSimple, USA) was used to measure the expression levels of TGF-β1, TGF-βR2, p-TGF-βR2, Smad2/3 and p-Smad2/3 proteins and the data were analyzed with the aid of Compass software (ProteinSimple) [29]. The following antibodies were employed: anti-GAPDH rabbit polyclonal antibody (HX1832, Huaxingbio, China), anti-TGF-β1 antibody (ab215715, abcam, UK), anti-TGF-βR2 antibody (T56879, abmart, China), anti-TGF-βR2 (phosphor-S225) antibody (ab183037, abcam, UK), anti-Smad2\u0026thinsp;+\u0026thinsp;Smad3 antibody [EPR19557-4] (ab202445, abcam, UK), and anti-Smad2\u0026thinsp;+\u0026thinsp;Smad3 (phospho T8) antibody (ab254407, abcam, UK).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003e2.16. Statistical analyses\u003c/h2\u003e \u003cp\u003eData were subjected to one-way analysis of variance (ANOVA) using SPSS ver. 24.0 software (IBM, USA). A \u003cem\u003eP\u003c/em\u003e-value\u0026thinsp;\u0026lt;\u0026thinsp;0.05 was considered statistically significant. All results are presented as means\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviations (SDs). The work has been reported in line with the ARRIVE guidelines 2.0.\u003c/p\u003e \u003c/div\u003e"},{"header":"3. Results","content":"\u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003e3.1. Low concentrations of sildenafil enhanced the proliferation and migration of hBMSCs and hASCs \u003cem\u003ein vitro\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eCompared to the PM-alone group, 10 mg/L sildenafil most potently enhanced the proliferation of hBMSCs and hASCs \u003cem\u003ein vitro\u003c/em\u003e (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB, S1A), as revealed by the CCK-8 data. The scratch and transwell assays similarly showed that 10 mg/L sildenafil most effectively promoted migration of hBMSCs and hASCs \u003cem\u003ein vitro\u003c/em\u003e (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC-F, S1B-E). When the sidenafil concentration was below or above 10 mg/L, efficacy decreased. In summary, 10 mg/L sildenafil enhanced the proliferation and migration of hBMSCs and hASCs \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003e3.2. Low concentrations of sildenafil enhanced the osteogenic differentiation of hBMSCs and hASCs \u003cem\u003ein vitro\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eQuantification of the ALP activity and ALP staining of hBMSCs indicated that sildenafil at 5, 10, and 20 mg/L promoted osteogenic differentiation \u003cem\u003ein vitro\u003c/em\u003e; sildenafil at 10 mg/L exerted the greatest effects. ARS staining and quantification were performed after 14 days of culture. The results were consistent with those for ALP activity and ALP staining (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA-D). After 7 days of osteogenic induction, qRT-PCR showed that 10 mg/L sildenafil most significantly (compared to other levels) enhanced the expression of osteogenic genes (\u003cem\u003eRUNX2, ALP\u003c/em\u003e) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). Similarly, after 14 days, sildenafil at 10 mg/L optimally promoted \u003cem\u003eRUNX2\u003c/em\u003e and \u003cem\u003eBGLAP\u003c/em\u003e expression in hBMSCs (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eF). The sildenafil-induced enhancement of hBMSC osteogenic differentiation \u003cem\u003ein vitro\u003c/em\u003e fell at sildenafil concentrations below or over 10 mg/L. The hASC data were similar to those of hBMSCs. ALP staining and quantification, and ARS staining and quantification, indicated that 10 mg/L sildenafil most effectively enhanced osteogenic differentiation (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eA-D). qRT-PCR similarly showed that sildenafil at 10 mg/L exhibited the strongest effect (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eE, F). In summary, 10 mg/L sildenafil optimally promoted the osteogenic differentiation of hBMSCs and hASCs \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec22\" class=\"Section2\"\u003e \u003ch2\u003e3.3. Sildenafil at 10 mg/L promoted osteogenic differentiation of hBMSCs \u003cem\u003ein vivo.\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eThe above \u003cem\u003ein vitro\u003c/em\u003e experiments revealed that 10 mg/L sildenafil optimally promoted the proliferation and migration of hMSCs. More importantly, sildenafil at 10 mg/L optimally enhanced osteogenic differentiation \u003cem\u003ein vitro\u003c/em\u003e. Therefore, sildenafil at 10 mg/L was used in the subsequent \u003cem\u003ein vivo\u003c/em\u003e experiments.\u003c/p\u003e \u003cp\u003eH\u0026amp;E staining showed that the PM\u0026thinsp;+\u0026thinsp;sildenafil group exhibited more new bone formation than did the PM group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA). Masson staining indicated that the PM\u0026thinsp;+\u0026thinsp;sildenafil group exhibited increased collagen formation (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Furthermore, the results of OCN immunohistochemical staining demonstrated that the PM\u0026thinsp;+\u0026thinsp;sildenafil group exhibited more brown-stained tissue, indicating a higher expression of OCN compared to the PM group (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Thus, 10 mg/L sildenafil enhanced the osteogenic differentiation of hBMSCs and promoted ectopic bone formation.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section2\"\u003e \u003ch2\u003e3.4. Sildenafil at 10 mg/L inhibited bone loss in OVX mice.\u003c/h2\u003e \u003cp\u003eMicro-CT revealed that the surgical group injected with PBS exhibited more significant bone loss than did the sham surgical group; the OVX mouse model was successfully established. Gross micro-CT images of femora showed that OVX mice injected with sildenafil exhibited denser bone and more trabeculae than did the OVX\u0026thinsp;+\u0026thinsp;PBS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). Sildenafil injection significantly increased the Tb.Th, BV/TV, BMD, and Tb.N values compared to those of the OVX\u0026thinsp;+\u0026thinsp;PBS group, and decreased BS/BV and Tb.Sp (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB-G). Thus, sildenafil (compared to PBS) reduced bone loss. ELISAs showed that sildenafil (compared to PBS) increased the serum BALP and P1NP levels; sildenafil promoted bone formation and prevented bone loss in OVX mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eH, I).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eFemoral H\u0026amp;E staining and Masson staining indicated that the OVX\u0026thinsp;+\u0026thinsp;sildenafil group exhibited more new bone formation than the OVX\u0026thinsp;+\u0026thinsp;PBS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA). H\u0026amp;E staining of liver, heart, kidney, lung, and spleen samples from all four groups revealed no significant toxicity; sildenafil at 10 mg/L exhibited good biocompatibility \u003cem\u003ein vivo\u003c/em\u003e (Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e) and effectively mitigated bone loss in OVX mice.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003e3.5. Sildenafil at 10 mg/L suppressed bone loss in TS mice.\u003c/h2\u003e \u003cp\u003eTo investigate whether sildenafil mitigated bone loss under weightless conditions, we tail-suspended mice to simulate weightlessness. Micro-CT revealed that bone loss was greater in the suspension\u0026thinsp;+\u0026thinsp;PBS group than the sham\u0026thinsp;+\u0026thinsp;PBS group; the TS model was successfully established. The micro-CT data were similar to those of Section \u003cspan refid=\"Sec23\" class=\"InternalRef\"\u003e3.4\u003c/span\u003e, thus confirming significantly less bone loss in the suspension\u0026thinsp;+\u0026thinsp;sildenafil group compared to the suspension\u0026thinsp;+\u0026thinsp;PBS group. The former group exhibited a denser bone structure and more trabeculae than the latter group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Abdominal injection of sildenafil into TS mice significantly increased the femoral Tb.Th, BV/TV, Tb.N, and BMD values, and decreased the Tb.Sp and BS/BV (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB-G). The serum levels of BALP and P1NP were higher in the suspension\u0026thinsp;+\u0026thinsp;sildenafil group than in the suspension\u0026thinsp;+\u0026thinsp;PBS group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eH, I). H\u0026amp;E staining similarly demonstrated reduced bone loss in the group injected with sildenafil, compared to PBS (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). H\u0026amp;E staining of spleen, liver, heart, kidney, and lung sections from all groups revealed no significant toxicity (Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). In summary, 10 mg/L sildenafil effectively inhibited bone loss in TS mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003e3.6. Low concentrations of sildenafil promoted osteogenic differentiation of hBMSCs by modulating the TGF-β signaling pathway.\u003c/h2\u003e \u003cp\u003ehBMSCs (a control OM group and a test OM\u0026thinsp;+\u0026thinsp;sildenafil group) were used to explore how sildenafil enhanced osteogenic differentiation of hBMSCs. The Venn diagram of co-expressed genes revealed 10,154 such genes between the two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). The volcano plot of differentially expressed genes showed that, compared to the OM group, the OM\u0026thinsp;+\u0026thinsp;sildenafil group exhibited 2,048 upregulated and 1,734 downregulated genes (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Gene Ontology (GO) enrichment maps revealed the differential enrichment of genes involved in relevant activities (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC). The Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment scatter-plot illustrated the most significantly enriched pathways (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). Of these, the TGF-β signaling pathway exhibited notable between-group difference and thus a close association with osteogenesis. The levels of mRNAs encoding TGF-βR1, TGF-βR2, TGF-β1, and TGF-β2 (key components of TGF-β signaling) were significantly higher in the OM\u0026thinsp;+\u0026thinsp;sildenafil group than in the OM group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE-H). At the protein level, the levels of TGF-β1, p-Smad2/3/Smad2/3, and p-TGF-βR2/TGF-βR2 were significantly higher in the OM\u0026thinsp;+\u0026thinsp;sildenafil group than in the OM group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eI-L). We thus (preliminarily) suggest that low concentrations of sildenafil may enhance the osteogenic differentiation of hBMSCs by influencing the TGF-β signaling pathway. However, further investigation is required.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"4. Discussion","content":"\u003cp\u003eWe found that low concentrations of sildenafil (optimally 10 mg/L) enhanced the migration and proliferation of hMSCs \u003cem\u003ein vitro\u003c/em\u003e and promoted osteogenic differentiation of hMSCs both \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e. \u003cem\u003eIn vivo\u003c/em\u003e, sildenafil mitigated bone loss in both TS and OVX mice. Sildenafil may facilitate osteogenic differentiation of hBMSCs by influencing the TGF-β signaling pathway (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). Sildenafil has been FDA-approved to treat various conditions, and is affordable and safe [30]. The fact that sildenafil inhibits bone loss suggests that sildenafil may usefully treat osteoporosis.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec27\" class=\"Section2\"\u003e \u003ch2\u003e4.1. Low concentrations of sildenafil enhanced the proliferation and migration of hBMSCs and hASCs \u003cem\u003ein vitro\u003c/em\u003e.\u003c/h2\u003e \u003cp\u003eWe found that low concentrations of sildenafil promoted the proliferation and migration of hBMSCs; this has seldom been reported. Previous research indicated that sildenafil enhanced migration of human umbilical vein endothelial cells by acting on a cGMP-dependent pathway that influences cell growth and differentiation [31], suggesting that sildenafil might similarly enhance the proliferation and migration of hBMSCs. We confirmed that 10 mg/L sildenafil optimally enhanced the proliferation and migration of hBMSCs \u003cem\u003ein vitro\u003c/em\u003e. It was earlier shown that sildenafil decreased reactive oxygen species levels and reversed DNA damage in mouse bone marrow cells [32]. Sildenafil also reduced endothelial cell apoptosis [33, 34].\u003c/p\u003e \u003cp\u003eWe simultaneously investigated hASCs and hBMSCs, extending the generalizability of the drug. Both hASCs and hBMSCs possess osteogenic differentiation potential. hASCs are also important in terms of bone regeneration. Moreover, compared to hBMSCs, hASCs are more readily accessible and cause less damage to the body [35, 36]. We found that the effects of low concentrations of sildenafil on hASC proliferation and migration were similar to those on hBMSCs. In summary, 10 mg/L sildenafil enhanced the proliferation and migration of hBMSCs and hASCs \u003cem\u003ein vitro\u003c/em\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003e4.2. Low concentrations of sildenafil promoted osteogenic differentiation of hMSCs \u003cem\u003ein vitro\u003c/em\u003e.\u003c/h2\u003e \u003cp\u003eWe found that low concentrations of sildenafil enhanced the osteogenic differentiation of hBMSCs and hASCs; this is novel. Previous studies indicated that various PDE5 inhibitors, such as sildenafil, enhanced the osteogenic differentiation of neonatal mouse calvarial cells (MCO). However, the sildenafil concentrations employed were not specified, and MSCs were not tested [37]. We found that sildenafil at 10 mg/L optimally promoted osteogenic differentiation of hMSCs \u003cem\u003ein vitro\u003c/em\u003e; this laid the groundwork for subsequent \u003cem\u003ein vivo\u003c/em\u003e experiments.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003e4.3. Low concentrations of sildenafil promoted osteogenesis \u003cem\u003ein vivo\u003c/em\u003e\u003c/h2\u003e \u003cp\u003eWe used a nude mouse model of subcutaneous ectopic osteogenesis, and OVX and TS mouse models, to show that 10 mg/L sildenafil promoted osteogenesis \u003cem\u003ein vivo\u003c/em\u003e. This suggested that sildenafil might usefully treat both primary and secondary osteoporosis [38]. The animal models used simulate both forms of osteoporosis. The OVX model mimics osteoporosis caused by post-menopausal estrogen deficiency; this form of primary osteoporosis is very common. In recent years, as space exploration has advanced, bone loss caused by weightlessness has garnered increasing attention. The TS mouse model simulates such bone loss (secondary osteoporosis) [39]. Sildenafil alleviated bone loss in both the OVX and TS animal models; this is clinically relevant.\u003c/p\u003e \u003cp\u003ePrevious studies have loaded sildenafil and phenytoin onto poly (lactic acid) bilayer nanofibrous scaffolds for orthopedic regeneration, primarily utilizing sildenafil to enhance vascularization within regenerating tissues and improve blood supply. These scaffolds demonstrated the ability to promote vascular repair and eventual healing in fracture models, but the focus was not on sildenafil's role in promoting bone regeneration. In contrast, our study emphasized the effects of sildenafil on the osteogenic differentiation of hMSCs and its potential to improve osteoporosis [40]. Another study combined sildenafil with keratin-based nanofibers and merwinite nanoparticles for bone tissue regeneration, but similarly highlighted sildenafil's role in promoting vascularization. Besides, this study lacked osteogenesis-related \u003cem\u003ein vivo\u003c/em\u003e experiments, which distinguishes it from the focus of our research [41]. Recent studies have suggested that sildenafil mitigates bisphosphonate-induced osteonecrosis of the rat jaw and promotes healing in rat mandibular fracture models [42\u0026ndash;44]. The aforementioned studies were limited to \u003cem\u003ein vivo\u003c/em\u003e experiments and lacked \u003cem\u003ein vitro\u003c/em\u003e investigations. Additionally, they did not directly apply to osteoporosis animal models or ectopic bone formation models but rather focused on the pro-osteogenic effects in a specific disease context. In contrast, our study focuses on the effects of sildenafil on the osteogenic differentiation of hMSCs, its therapeutic potential for osteoporosis, and the exploration of its possible mechanisms. In summary, sildenafil promotes the osteogenic differentiation of hBMSCs \u003cem\u003ein vivo\u003c/em\u003e and may usefully treat osteoporosis. Sildenafil, as a clinically widely used drug, has demonstrated a relatively well-established safety profile despite side effects such as headache and dyspepsia. Our animal experiments further confirmed its biosafety.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec30\" class=\"Section2\"\u003e \u003ch2\u003e4.4. Sildenafil promoted osteogenic differentiation of hBMSCs by affecting the TGF-β pathway.\u003c/h2\u003e \u003cp\u003eIt remains unclear how sildenafil enhances the osteogenic differentiation of hBMSCs. It is essential to understand the mechanism(s) in play. We performed RNA-Seq transcriptomic analysis to this end; sildenafil modulated the TGF-β pathway signaling. Sildenafil activated that pathway in hBMSCs; the pathway critically regulates various biological processes including bone metabolism [45]. Salidroside alleviated inhibition of osteogenic differentiation by acting on the TGF-β signaling pathway [46]. Regulation of TGF-β signaling enhanced the osteogenic differentiation of BMSCs [47]. We suggest that sildenafil may enhance the osteogenic differentiation of hBMSCs by influencing TGF-β signaling; this is novel. However, more work is required.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec31\" class=\"Section2\"\u003e \u003ch2\u003e4.5. Limitations and prospects\u003c/h2\u003e \u003cp\u003eWe found that low concentrations of sildenafil promoted the osteogenic differentiation of hMSCs and inhibited bone loss. However, our work has certain limitations. First, the optimal sildenafil concentration was 5\u0026ndash;20 mg/L; we used 10 mg/L, but the precise optimal concentration remains to be determined. Second, we did not explore why higher concentrations inhibited osteogenesis; future studies should evaluate toxicity and other explanations. Besides, due to limitations in time and funding, we have not yet conducted rescue experiments, such as adding pathway inhibitors, to further verify the necessity of the TGF-β signaling pathway in the therapeutic effects of sildenafil. More \u003cem\u003ein vivo\u003c/em\u003e and \u003cem\u003ein vitro\u003c/em\u003e experiments are required to clarify how TGF-β signaling affects sildenafil-induced osteogenic differentiation of hBMSCs. Finally, large-animal experiments are required if sildenafil is to be used to treat osteoporosis.\u003c/p\u003e \u003c/div\u003e"},{"header":"5. Conclusion","content":"\u003cp\u003eLow concentrations (optimally 10 mg/L) of sildenafil enhanced hMSC proliferation, migration, and osteogenic differentiation \u003cem\u003ein vitro\u003c/em\u003e. \u003cem\u003eIn vivo\u003c/em\u003e, 10 mg/L sildenafil promoted hBMSC osteogenic differentiation in the nude mouse model of subcutaneous heterotopic osteogenesis and prevented bone loss in TS and OVX mice. Mechanistically, sildenafil may enhance the osteogenic differentiation of hBMSCs by modulating the TGF-β signaling pathway. Low concentrations of sildenafil promoted the osteogenic differentiation of hMSCs, enhancing our understanding of the physiological effects of sildenafil and broadening the possible applications to management of osteoporosis.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003e\u0026alpha;-MEM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003e\u0026alpha;-minimum essential medium\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eALP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eAlkaline phosphatase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eARS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eAlizarin red S\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eBALP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eBone alkaline phosphatase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eBGLAP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eBone gamma-carboxyglutamate protein\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eBMD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eBone mineral density\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eBS/BV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eBone surface area/bone volume\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eBV/TV\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eTrabecular bone volume/tissue volume\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eDMEM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eDulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eDMSO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eDimethyl sulfoxide\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eGAPDH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eGlyceraldehyde-3-phosphate dehydrogenase\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eFBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eFetal bovine serum\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eGO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eGene Ontology\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eH\u0026amp;E\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eHematoxylin and eosin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003ehASCs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eHuman adipose-derived mesenchymal stem cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003ehBMSCs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eHuman bone marrow-derived mesenchymal stem cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003ehMSCs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eHuman mesenchymal stem cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eKEGG\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eKyoto Encyclopedia of Genes and Genomes\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eMicro-CT\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eMicro-computed tomography\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eMCO\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eMouse calvarial cells\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eOCN\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eOsteocalcin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eOM\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eOsteogenic medium\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eOVX\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eOvariectomized\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eP1NP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eProcollagen type 1 N-terminal propeptide\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003ePBS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003ePhosphate balanced solution\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003ePDE5\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003ePhosphodiesterase type 5\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003ePM\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eProliferation medium\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003ep-Smad2/3\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003ePhospho-Smad2/3\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003ep-TGF-\u0026beta;R2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003ePhospho- transforming growth factor-\u0026beta; type ⅠⅠ receptor\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eqRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eQuantitative real-time reverse transcription polymerase chain reaction\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eRNA-Seq\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eRNA-Sequencing\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eRUNX2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eRunt-related transcription factor 2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eTb.N\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eTrabecular number\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eTb.Sp\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eTrabecular separation\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eTb.Th\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eTrabecular thickness\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eTGF-\u0026beta;\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eTransforming growth factor-\u0026beta;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eTGF-\u0026beta;1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eTransforming growth factor-\u0026beta;1\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eTGF-\u0026beta;2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eTransforming growth factor-\u0026beta;2\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eTGF-\u0026beta;R1\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eTransforming growth factor-\u0026beta; type Ⅰ receptor\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eTGF-\u0026beta;R2\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eTransforming growth factor-\u0026beta; type ⅠⅠ receptor\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd valign=\"top\" style=\"width: 17.5407%;\"\u003e\n \u003cp\u003eTS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd valign=\"top\" style=\"width: 82.4593%;\"\u003e\n \u003cp\u003eTail-suspended\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003e\u003cem\u003eEthics approval and consent to participate\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe study titled \"The Effects and Mechanisms of Sildenafil in the Treatment of Osteoporosis\" was approved by the Laboratory Animal Welfare and Ethics Committee of the Biomedical Ethics Committee at Peking University (Date: 16. 02. 2023, No. LA2023198). The specific animal experimental protocol for this study was pre-designed prior to the research. All surgeries were performed under anesthesia, and all efforts were made to minimize animal suffering. hBMSCs and hASCs were obtained from ScienCell Company (USA). ScienCell Company has confirmed that there was initial ethical approval for collection of human cells, and that the donors had signed informed consent.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eConsent for publication\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAvailability of data and materials\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe RNA-seq data are available at the Sequence Read Archive of National Center for Biotechnology Information (PRJNA1200213).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eCompeting interests\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eFunding\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by the National Science Foundation of China [grant numbers 82170929, 82370924]; the Youth Research Fund of Peking University School and Hospital of Stomatology [grant number PKUSS20230101]; and the Beijing Natural Science Foundation-Haidian Original Innovation Joint Fund Project [grant number L222030, L222090, L222145].\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAuthors' contributions\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eMenglong Hu and Likun Wu primarily conducted the experiments and data analysis. Erfan Wei, Xingtong Pan, and Qiyue Zhu assisted in some experimental procedures. Likun Wu drafted the initial manuscript, with Menglong Hu providing revisions. Xv Xiuyun, Letian Lv, and Xinyi Dong reviewed the manuscript. Hao Liu and Yunsong Liu took primary responsibility for conceptual design and funding support. All authors have approved the final submitted version.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003e\u003cem\u003eAcknowledgements\u003c/em\u003e\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that they have not use AI-generated work in this manuscript.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eLi Z, Li D, Chen R, Gao S, Xu Z, Li N. Cell death regulation: A new way for natural products to treat osteoporosis. Pharmacological research. 2023; 187: 106635.\u003c/li\u003e\n\u003cli\u003eSalari N, Ghasemi H, Mohammadi L, Behzadi MH, Rabieenia E, Shohaimi S, et al. The global prevalence of osteoporosis in the world: a comprehensive systematic review and meta-analysis. Journal of orthopaedic surgery and research. 2021; 16: 609.\u003c/li\u003e\n\u003cli\u003eFoessl I, Dimai HP, Obermayer-Pietsch B. Long-term and sequential treatment for osteoporosis. Nature reviews Endocrinology. 2023; 19: 520-33.\u003c/li\u003e\n\u003cli\u003ePeng J, Lai ZG, Fang ZL, Xing S, Hui K, Hao C, et al. Dimethyloxalylglycine prevents bone loss in ovariectomized C57BL/6J mice through enhanced angiogenesis and osteogenesis. PloS one. 2014; 9: e112744.\u003c/li\u003e\n\u003cli\u003eChen Y, Huang Y, Li J, Jiao T, Yang L. Enhancing osteoporosis treatment with engineered mesenchymal stem cell-derived extracellular vesicles: mechanisms and advances. Cell death \u0026amp; disease. 2024; 15: 119.\u003c/li\u003e\n\u003cli\u003eFeehan J, Jacques M, Kondrikov D, Eynon N, Wijeratne T, Apostolopoulos V, et al. Circulating Osteoprogenitor Cells Have a Mixed Immune and Mesenchymal Progenitor Function in Humans. Stem cells (Dayton, Ohio). 2023; 41: 1060-75.\u003c/li\u003e\n\u003cli\u003eSong S, Guo Y, Yang Y, Fu D. Advances in pathogenesis and therapeutic strategies for osteoporosis. Pharmacology \u0026amp; therapeutics. 2022; 237: 108168.\u003c/li\u003e\n\u003cli\u003eDai H, Hosseinpour S, Hua S, Xu C. Advances in porous inorganic nanomaterials for bone regeneration. Nano TransMed. 2022; 1: 9130005.\u003c/li\u003e\n\u003cli\u003eReid IR, Billington EO. Drug therapy for osteoporosis in older adults. Lancet (London, England). 2022; 399: 1080-92.\u003c/li\u003e\n\u003cli\u003eBerdigaliyev N, Aljofan M. An overview of drug discovery and development. Future medicinal chemistry. 2020; 12: 939-47.\u003c/li\u003e\n\u003cli\u003eSchlander M, Hernandez-Villafuerte K, Cheng CY, Mestre-Ferrandiz J, Baumann M. How Much Does It Cost to Research and Develop a New Drug? A Systematic Review and Assessment. PharmacoEconomics. 2021; 39: 1243-69.\u003c/li\u003e\n\u003cli\u003eAndersson KE. PDE5 inhibitors - pharmacology and clinical applications 20 years after sildenafil discovery. British journal of pharmacology. 2018; 175: 2554-65.\u003c/li\u003e\n\u003cli\u003eG\u0026uuml;rsoy K, Oru\u0026ccedil; M, Kankaya Y, Ulusoy MG, Ko\u0026ccedil;er U, Kankaya D, et al. Effect of topically applied sildenafil citrate on wound healing: experimental study. Bosnian journal of basic medical sciences. 2014; 14: 125-31.\u003c/li\u003e\n\u003cli\u003eCaetano ESP, Mattioli SV, da Silva MLS, Martins LZ, Almeida AA, da Rocha ALV, et al. Sildenafil attenuates oxidative stress and endothelial dysfunction in lead-induced hypertension. Basic \u0026amp; clinical pharmacology \u0026amp; toxicology. 2023.\u003c/li\u003e\n\u003cli\u003eSenthilkumar A, Smith RD, Khitha J, Arora N, Veerareddy S, Langston W, et al. Sildenafil promotes ischemia-induced angiogenesis through a PKG-dependent pathway. Arteriosclerosis, thrombosis, and vascular biology. 2007; 27: 1947-54.\u003c/li\u003e\n\u003cli\u003eBaron-Menguy C, Bocquet A, Richard A, Guihot AL, Toutain B, Pacaud P, et al. Sildenafil-Induced Revascularization of Rat Hindlimb Involves Arteriogenesis through PI3K/AKT and eNOS Activation. International journal of molecular sciences. 2022; 23.\u003c/li\u003e\n\u003cli\u003eLeal MAS, Aires R, Pandolfi T, Marques VB, Campagnaro BP, Pereira TMC, et al. Sildenafil reduces aortic endothelial dysfunction and structural damage in spontaneously hypertensive rats: Role of NO, NADPH and COX-1 pathways. Vascular pharmacology. 2020; 124: 106601.\u003c/li\u003e\n\u003cli\u003eBandara N, Gurusinghe S, Lim SY, Chen H, Chen S, Wang D, et al. Molecular control of nitric oxide synthesis through eNOS and caveolin-1 interaction regulates osteogenic differentiation of adipose-derived stem cells by modulation of Wnt/\u0026beta;-catenin signaling. Stem cell research \u0026amp; therapy. 2016; 7: 182.\u003c/li\u003e\n\u003cli\u003eSu CH, Li WP, Tsao LC, Wang LC, Hsu YP, Wang WJ, et al. Enhancing Microcirculation on Multitriggering Manner Facilitates Angiogenesis and Collagen Deposition on Wound Healing by Photoreleased NO from Hemin-Derivatized Colloids. ACS nano. 2019; 13: 4290-301.\u003c/li\u003e\n\u003cli\u003eXu T, Yang Y, Suo D, Bei HP, Xu X, Zhao X. Electrosprayed Regeneration-Enhancer-Element Microspheres Power Osteogenesis and Angiogenesis Coupling. Small (Weinheim an der Bergstrasse, Germany). 2022; 18: e2200314.\u003c/li\u003e\n\u003cli\u003eLi W, Liu Y, Zhang P, Tang Y, Zhou M, Jiang W, et al. Tissue-Engineered Bone Immobilized with Human Adipose Stem Cells-Derived Exosomes Promotes Bone Regeneration. ACS applied materials \u0026amp; interfaces. 2018; 10: 5240-54.\u003c/li\u003e\n\u003cli\u003eLiu X, Li Z, Liu H, Zhu Y, Xia D, Wang S, et al. Low concentration flufenamic acid enhances osteogenic differentiation of mesenchymal stem cells and suppresses bone loss by inhibition of the NF-\u0026kappa;B signaling pathway. Stem cell research \u0026amp; therapy. 2019; 10: 213.\u003c/li\u003e\n\u003cli\u003eYang F, Xue Y, Wang F, Guo D, He Y, Zhao X, et al. Sustained release of magnesium and zinc ions synergistically accelerates wound healing. Bioactive materials. 2023; 26: 88-101.\u003c/li\u003e\n\u003cli\u003eHu L, Zhao B, Gao Z, Xu J, Fan Z, Zhang C, et al. Regeneration characteristics of different dental derived stem cell sheets. Journal of oral rehabilitation. 2020; 47 Suppl 1: 66-72.\u003c/li\u003e\n\u003cli\u003ePachon RE, Scharf BA, Vatner DE, Vatner SF. Best anesthetics for assessing left ventricular systolic function by echocardiography in mice. American journal of physiology Heart and circulatory physiology. 2015; 308: H1525-9.\u003c/li\u003e\n\u003cli\u003eHablitz LM, Vinitsky HS, Sun Q, St\u0026aelig;ger FF, Sigurdsson B, Mortensen KN, et al. Increased glymphatic influx is correlated with high EEG delta power and low heart rate in mice under anesthesia. Science advances. 2019; 5: eaav5447.\u003c/li\u003e\n\u003cli\u003eJin C, Zhang P, Zhang M, Zhang X, Lv L, Liu H, et al. Inhibition of SLC7A11 by Sulfasalazine Enhances Osteogenic Differentiation of Mesenchymal Stem Cells by Modulating BMP2/4 Expression and Suppresses Bone Loss in Ovariectomized Mice. Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research. 2017; 32: 508-21.\u003c/li\u003e\n\u003cli\u003ePeng H, Hu B, Xie LQ, Su T, Li CJ, Liu Y, et al. A mechanosensitive lipolytic factor in the bone marrow promotes osteogenesis and lymphopoiesis. Cell metabolism. 2022; 34: 1168-82.e6.\u003c/li\u003e\n\u003cli\u003eZhou L, Wu D, Zhou Y, Wang D, Fu H, Huang Q, et al. Tumor cell-released kynurenine biases MEP differentiation into megakaryocytes in individuals with cancer by activating AhR-RUNX1. Nature immunology. 2023; 24: 2042-52.\u003c/li\u003e\n\u003cli\u003eSable CA, Ivy DD, Beekman RH, 3rd, Clayton-Jeter HD, Jenkins KJ, Mahle WT, et al. 2017 ACC/AAP/AHA Health Policy Statement on Opportunities and Challenges in Pediatric Drug Development: Learning From Sildenafil. Journal of the American College of Cardiology. 2017; 70: 495-503.\u003c/li\u003e\n\u003cli\u003eDussault S, Maingrette F, M\u0026eacute;nard C, Michaud SE, Haddad P, Groleau J, et al. Sildenafil increases endothelial progenitor cell function and improves ischemia-induced neovascularization in hypercholesterolemic apolipoprotein E-deficient mice. Hypertension (Dallas, Tex : 1979). 2009; 54: 1043-9.\u003c/li\u003e\n\u003cli\u003eBernardes FP, Batista AT, Porto ML, Vasquez EC, Campagnaro BP, Meyrelles SS. Protective effect of sildenafil on the genotoxicity and cytotoxicity in apolipoprotein E-deficient mice bone marrow cells. Lipids in health and disease. 2016; 15: 100.\u003c/li\u003e\n\u003cli\u003eAla M, Mohammad Jafari R, Ala M, Hejazi SM, Tavangar SM, Mahdavi SR, et al. Sildenafil improves radiation-induced oral mucositis by attenuating oxidative stress, NF-\u0026kappa;B, ERK and JNK signalling pathways. Journal of cellular and molecular medicine. 2022; 26: 4556-65.\u003c/li\u003e\n\u003cli\u003eWortel RC, Mizrachi A, Li H, Markovsky E, Enyedi B, Jacobi J, et al. Sildenafil Protects Endothelial Cells From Radiation-Induced Oxidative Stress. The journal of sexual medicine. 2019; 16: 1721-33.\u003c/li\u003e\n\u003cli\u003eGe W, Liu Y, Chen T, Zhang X, Lv L, Jin C, et al. The epigenetic promotion of osteogenic differentiation of human adipose-derived stem cells by the genetic and chemical blockade of histone demethylase LSD1. Biomaterials. 2014; 35: 6015-25.\u003c/li\u003e\n\u003cli\u003eHurle K, Maia FR, Ribeiro VP, Pina S, Oliveira JM, Goetz-Neunhoeffer F, et al. Osteogenic lithium-doped brushite cements for bone regeneration. Bioactive materials. 2022; 16: 403-17.\u003c/li\u003e\n\u003cli\u003ePal S, Rashid M, Singh SK, Porwal K, Singh P, Mohamed R, et al. Skeletal restoration by phosphodiesterase 5 inhibitors in osteopenic mice: Evidence of osteoanabolic and osteoangiogenic effects of the drugs. Bone. 2020; 135: 115305.\u003c/li\u003e\n\u003cli\u003eSoriano R, Herrera S, Nogu\u0026eacute;s X, Diez-Perez A. Current and future treatments of secondary osteoporosis. Best practice \u0026amp; research Clinical endocrinology \u0026amp; metabolism. 2014; 28: 885-94.\u003c/li\u003e\n\u003cli\u003eGu R, Liu H, Hu M, Zhu Y, Liu X, Wang F, et al. D-Mannose prevents bone loss under weightlessness. Journal of translational medicine. 2023; 21: 8.\u003c/li\u003e\n\u003cli\u003eAli IH, Khalil IA, El-Sherbiny IM. Phenytoin/sildenafil loaded poly(lactic acid) bilayer nanofibrous scaffolds for efficient orthopedics regeneration. International journal of biological macromolecules. 2019; 136: 154-64.\u003c/li\u003e\n\u003cli\u003eTalib Al-Sudani B, Al-Musawi MH, Kamil MM, Turki SH, Nasiri-Harchegani S, Najafinezhad A, et al. Vasculo-osteogenic keratin-based nanofibers containing merwinite nanoparticles and sildenafil for bone tissue regeneration. International journal of pharmaceutics. 2024; 667: 124875.\u003c/li\u003e\n\u003cli\u003eMroczek T, Delfrate G, Mecca LEA, Andreis JD, Lipinski LC, Fernandes D, et al. Sildenafil reduces bisphosphonate-induced jaw osteonecrosis in rats. Clinical oral investigations. 2023; 27: 2437-48.\u003c/li\u003e\n\u003cli\u003e\u0026Ccedil;akir-\u0026Ouml;zkan N, Bereket C, Sener I, Alici \u0026Ouml;, Kabak YB, \u0026Ouml;nger ME. Therapeutic Effects of Sildenafil on Experimental Mandibular Fractures. The Journal of craniofacial surgery. 2016; 27: 615-20.\u003c/li\u003e\n\u003cli\u003eMalekiGorji M, Golestaneh A, Razavi SM. The effect of two phosphodiesterase inhibitors on bone healing in mandibular fractures (animal study in rats). Journal of the Korean Association of Oral and Maxillofacial Surgeons. 2020; 46: 258-65.\u003c/li\u003e\n\u003cli\u003eDavis BN, Hilyard AC, Lagna G, Hata A. SMAD proteins control DROSHA-mediated microRNA maturation. Nature. 2008; 454: 56-61.\u003c/li\u003e\n\u003cli\u003eXie B, Zhou H, Liu H, Liao S, Zhou C, Xu D. Salidroside alleviates dexamethasone-induced inhibition of bone formation via transforming growth factor-beta/Smad2/3 signaling pathway. Phytotherapy research : PTR. 2023; 37: 1938-50.\u003c/li\u003e\n\u003cli\u003eWang T, Li W, Zhang Y, Xu X, Qiang L, Miao W, et al. Bioprinted constructs that simulate nerve-bone crosstalk to improve microenvironment for bone repair. Bioactive materials. 2023; 27: 377-93.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":true,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Sildenafil, Mesenchymal stem cells, Osteogenesis, Osteoporosis, TGF-β signaling pathway","lastPublishedDoi":"10.21203/rs.3.rs-5662251/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-5662251/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground\u003c/h2\u003e \u003cp\u003eOsteoporosis, a common bone disorder, is primarily managed pharmacologically. However, existing medications are associated with non-trivial side-effects. Sildenafil, which already finds many clinical applications, promotes angiogenesis and cellular differentiation. Osteoporotic patients often exhibit a reduced intraosseous vasculature and impaired cellular differentiation; sildenafil may thus usefully treat osteoporosis.\u003c/p\u003e\u003ch2\u003eMethods\u003c/h2\u003e \u003cp\u003eHere, the effects of sildenafil on the osteogenic differentiation of human mesenchymal stem cells (hMSCs) were explored, as were the molecular mechanisms in play. We treated hMSCs with varying concentrations of sildenafil and measured cell proliferation and osteogenic differentiation \u003cem\u003ein vitro\u003c/em\u003e. We used a mouse model of subcutaneous ectopic osteogenesis to assess sildenafil's effect on hMSC osteogenic differentiation \u003cem\u003ein vivo\u003c/em\u003e. We also explored the effects of sildenafil on bone loss in tail-suspended (TS) and ovariectomized (OVX) mice. Mechanistically, we employed RNA-sequencing to define potentially relevant molecular pathways.\u003c/p\u003e\u003ch2\u003eResults\u003c/h2\u003e \u003cp\u003eLow sildenafil concentrations significantly enhanced osteogenic hMSC differentiation; the optimal sildenafil concentration may be 10 mg/L. Sildenafil mitigated osteoporosis in OVX and TS mice. Low sildenafil concentrations probably promoted hMSC osteogenic differentiation by acting on the transforming growth factor-β (TGF-β) signaling pathway.\u003c/p\u003e\u003ch2\u003eConclusions\u003c/h2\u003e \u003cp\u003eIn conclusion, low sildenafil concentrations enhanced hMSC osteogenic differentiation and inhibited bone loss. Sildenafil may usefully treat osteoporosis. Our findings offer new insights into the physiological effects of the material.\u003c/p\u003e","manuscriptTitle":"Sildenafil Promotes Osteogenic Differentiation of Human Mesenchymal Stem Cells and Inhibits Bone Loss by Affecting the TGF-β Signaling Pathway","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-01-23 16:47:27","doi":"10.21203/rs.3.rs-5662251/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"reviewerAgreed","content":"","date":"2025-01-22T02:55:42+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-01-21T20:07:33+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-01-16T08:22:31+00:00","index":"","fulltext":""},{"type":"submitted","content":"Stem Cell Research \u0026 Therapy","date":"2025-01-15T04:20:29+00:00","index":"","fulltext":""},{"type":"decision","content":"Major Revision","date":"2025-01-13T04:02:03+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"stem-cell-research-and-therapy","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scrt","sideBox":"Learn more about [Stem Cell Research \u0026 Therapy](http://stemcellres.biomedcentral.com)","snPcode":"","submissionUrl":"https://www.editorialmanager.com/scrt/default.aspx","title":"Stem Cell Research \u0026 Therapy","twitterHandle":"@BioMedCentral","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"46498415-7d66-406a-a1a8-022e428652ef","owner":[],"postedDate":"January 23rd, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2025-04-28T16:01:52+00:00","versionOfRecord":{"articleIdentity":"rs-5662251","link":"https://doi.org/10.1186/s13287-025-04320-7","journal":{"identity":"stem-cell-research-and-therapy","isVorOnly":false,"title":"Stem Cell Research \u0026 Therapy"},"publishedOn":"2025-04-23 15:57:36","publishedOnDateReadable":"April 23rd, 2025"},"versionCreatedAt":"2025-01-23 16:47:27","video":"","vorDoi":"10.1186/s13287-025-04320-7","vorDoiUrl":"https://doi.org/10.1186/s13287-025-04320-7","workflowStages":[]},"version":"v1","identity":"rs-5662251","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-5662251","identity":"rs-5662251","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}