Fruit Weight Regulation by a Paralog of Cell Size Regulator (CSR) in Tomato and Other Crops | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Fruit Weight Regulation by a Paralog of Cell Size Regulator (CSR) in Tomato and Other Crops Qian Feng, Lara Pereira, Manoj Sapkota, Krishna Sai Karnatam, and 4 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-8157882/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 05 Mar, 2026 Read the published version in Theoretical and Applied Genetics → Version 1 posted 5 You are reading this latest preprint version Abstract Fruit weight is a quantitative trait that was under strong selection during the domestication of fruit and vegetable crops such as tomato ( Solanum lycopersicum ). While numerous fruit weight QTLs have been identified, only three tomato fruit weight genes have been cloned. In this study, we utilized a genetically diverse tomato panel, the Varitome collection, to identify additional genetic loci that control fruit weight. We mapped and fine mapped two fruit weight QTLs on chromosome 6, fw6.1 and fw6.2 , by using Genome Wide Association studies (GWAS) and linkage mapping in bi-parental populations. We identified a member of the Cell Size Regulator family, CSR-like1 , as the likely candidate underlying fw6.2 . The near isogenic lines (NILs) carrying the derived allele of fw6.2 produced heavier fruits with larger fruit pericarp cells than lines with wildtype (WT) allele. Transgenic downregulation of CSR-like1 led to a decrease in fruit weight and pericarp cells, supporting the role of this gene at the fw6.2 locus. The haplotype analysis implied that the CSR-like1 -Derived ( CSR-like1 -D) allele was selected in the transition from the fully wild S. pimpinellifolium to the earliest S. lycopersicum cerasiforme accessions . Four single nucleotide polymorphisms (SNPs) were identified in the regulatory region of CSR-like1 that were conserved in the accessions carrying CSR-like1 -WT and were significantly associated with lower fruit weight and pericarp cell size at the locus. Moreover, a pepper GWAS identified a CSR-like1 ortholog that was associated with fruit weight. Together, our findings established CSR-like1 as a novel fruit weight gene likely conserved in other crops. GWAS QTL mapping Fruit weight Fruit development Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 key Message A paralog of Cell Size Regulator (CSR), CSR-like1, underlies the novel fw6.2 QTL in tomato. The gene and locus regulate fruit weight by increasing pericarp cell size and its function on fruit weight appears to be conserved in other crops. Introduction Plant domestication has led to the transformation from wild species into high-yielding and nutritionally valuable crops. Genetic modifications through repeated selection and cultivation have reshaped the plant morphology, physiology, and development to suit human needs (Doebley et al. 2006 ). Increases in fruit or grain size is one of the key traits that differentiate the domesticated crops from their wild progenitors, collectively referred to as “domestication syndrome” (Doebley et al. 2006 ; Gross and Olsen 2010 ). For tomato ( Solanum lycopersicum ), huge variation in fruit size and shape is evident in the cherry-sized type S. lycopersicum var cerasiforme (SLC ) and fully domesticated type S. lycopersicum var. lycopersicum (SLL) compared to its wild relative, S. pimpinellifolium (SP) (Tanksley 2004 ). Several studies have revealed insights regarding the complex domestication history of tomato resulting in different models. One model illustrated a two-step process (Razifard et al. 2020 ): SP first originated in the Andean region of South America and gave rise to the semi-domesticated SLC. The more domesticated South American SLC groups then migrated northwards when some domestication traits, including fruit size, were lost. A second round of selection took place in Mesoamerica before the emergence of the fully domesticated SLL. A recent study suggested a more complex trajectory (Blanca et al. 2021): SP expanded much further northwards into Mesoamerica where it evolved into wild SLC progenitor species. Some SLCs subsequently migrated back to South America and admixed with SP in Ecuador and Peru. Ecuadorian and Peruvian SLC then underwent another northward migration to further evolve into fully domesticated SLL in Mexico. Fruit weight is a character controlled by multiple quantitative trait loci (QTL) (Paran and van der Knaap 2007 ). Though over twenty QTL have been mapped in tomato (Causse et al. 2002 ; Grandillo et al. 1999 ; Illa-Berenguer et al. 2015 ; Pereira et al. 2021b ), only three fruit weight genes have been cloned: fw2.2 , fw3.2 and fw11.3 . Fw2.2 underlies Cell Number Regulator ( CNR ) (Frary et al. 2000 ), a negative cell division regulator with a change in transcription dynamic that is associated with lower cell division rate (Cong et al. 2002 ). The putative casual mutation is thought to lie in the promoter region since the coding region is highly conserved in small-fruit allele and large-fruit allele (Frary et al. 2000 ). Fw3.2 ( SlKLUH ) encodes a P450 enzyme of the CYP78A subfamily that regulates cell number in the fruit (Chakrabarti et al. 2013 ). A tandem duplication of around 50kb containing SlKLUH leads to higher expression of SlKLUH and an increase in fruit weight. (Alonge et al. 2020 ). Fw11.3 encodes Cell Size Regulator ( CSR ) and is the only fruit weight gene known to affect cell size (Mu et al. 2017 ). The derived allele ( CSR-D ) has a 3’ 1.4kb deletion that affects the coding region as well as higher expression throughout fruit development compared to the wildtype allele ( CSR-WT ) (Mu et al. 2017 ). In addition to the fruit weight loci, two locule number loci, lc (Muños et al. 2011 ) and fas (Cong et al. 2008 ; Xu et al. 2015 ), can affect the fruit weight in tomato through regulating the number of locules in the fruit. Here, we report the fine-mapping and identification of two linked fruit weight QTL in tomato, fw6.1 and fw6.2 , and the cloning and characterization of a new fruit weight gene CSR-like1 at the second locus. Similar to its paralog CSR , CSR-like1 also controls the fruit mass through regulating the pericarp cell size. Yet different from CSR , CSR-like1 underwent selection in rather the early stages of domestication and was much higher expressed in fruit tissues. Transgenic plants that downregulated CSR-like1 expression showed decreased fruit weight that developed late during fruit growth, as well as effects on other traits such as ripening. We also present genetic evidence on the function of a pepper ortholog of CSR-like1 on fruit weight. The findings imply a conserved function of CSR-like1 in fruit size regulation in Solanaceae crops. Materials and methods Plant materials The 166 Varitome collection accessions have been described previously (Mata-Nicolás et al. 2020 ; Razifard et al. 2020 ). The plants for the GWAS and mapping populations were grown at University of Georgia’s Horticulture Research Farm (Athens, GA, USA), Vidalia Onion and Vegetable Research Center (Lyons, GA, USA), Georgia Mountain Research and Education Center (Blairsville, GA, USA) and University of Florida’s North Florida Research and Education Center-Suwannee Valley (Live Oak, FL, USA). Population development, and phenotypic characterizations were performed in the University of Georgia (Athens, GA, USA) greenhouses where plants were grown under standard conditions. Variant calling and genome-wide association study (GWAS) Short-read sequencing data for the Varitome tomato accessions were retrieved from NCBI (BioProject PRJNA454805) and aligned to the SL4.0 reference genome. The raw reads were aligned and processed for Variant calling for SNPs and INDELs (insertions and deletions) using t he pipeline as previously described (Pereira et al. 2021a ). Variants were filtered to retain only biallelic sites with missingness < 5%, minor allele frequency (MAF) ≥ 5%, and mapping quality ≥ 30 using bcftools (Danecek et al. 2021 ). After filtering, 659,002 INDELs were retained. For computational efficiency, SNPs were further thinned to one SNP per kilobase using VCFtools (Danecek et al. 2011 ), resulting in a final set of 609,034 SNPs. SNP genotypes were exported from VCF files using the R/vcfR package (Knaus and Grünwald 2017 ). INDELs were encoded as a presence/absence matrix and treated as pseudo-SNPs, with the reference allele representing absence and the alternate allele representing presence of the INDEL. Association mapping was performed using GWASpoly ( https://jendelman.github.io/GWASpoly/GWASpoly.html ) (Rosyara et al. 2016 ) under a diploid setting (ploidy = 2). The diplo-additive model was used as the primary framework, where genotypes are encoded as 0/1/2 copies with heterozygotes intermediate between homozygotes. This model was chosen for its simplicity, statistical power, and biological interpretability. Although other models were tested, results were broadly consistent; therefore, only the diploid additive model is presented. Population structure was controlled using the first three principal components, and kinship was modeled with a leave-one-chromosome-out (LOCO) approach (Cheng et al. 2013 ). Genome-wide significance thresholds were established using the Bonferroni correction at α = 0.05. Analysis of Orthologous CSR-like1 Gene Underlying Fruit Weight Variation in the Capsicum Genus A total of 594 accessions of Capsicum spp., comprising 82 C. annuum , 35 C. annuum var. glabriusculum , 243 C. baccatum , and 234 C. chinense , were obtained from the USDA–ARS Germplasm Resources Information Network (GRIN), Plant Genetic Resources Conservation Unit (Griffin, GA, USA). These accessions represented a wide range of geographical origins and fruit weight variation. Plants were cultivated for the three seasons in a randomized block design with three replications, and phenotypic data were recorded from five plants per accession in each replication. Genomic DNA was extracted from young leaf tissue, and genotyping-by-sequencing (GBS) was performed following the protocol described by Elshire et al. ( 2011 ) using the Illumina HiSeq 2500 platform. The resulting sequence reads were aligned to the Capsicum annuum cv. CM334 v1.55 reference genome (Kim et al. 2014 ) ( http://peppergenome.snu.ac.kr/ ). SNP calling and filtering were performed according to Reddy et al. ( 2025 ), retaining 45,987 high-quality SNPs with a minor allele frequency (MAF) ≥ 0.05 and call rate ≥ 90%. Population structure was assessed through principal component analysis (PCA) using GAPIT 3.0 (Wang and Zhang 2021 ), and admixture proportions were inferred with ADMIXTURE v1.3 (Alexander et al. 2015 ) for K = 1–10. Genome-wide association studies (GWAS) for fruit weight were conducted in GAPIT 3.0 (Wang and Zhang 2021 ) using both the mixed linear model (MLM) and the Bayesian-information and linkage-disequilibrium iteratively nested keyway (BLINK) model to ensure robustness of detection. Biparental mapping population development, finemapping and progeny testing Five F 2 biparental populations were generated to validate fw6.1 and fw6.2 (Supplementary Table S1 ). The populations were fixed for the other known fruit weight and shape genes. To fine map the fw6.1 locus, recombinant plants with one recombination event between marker 18EP962 and 19EP629 (Supplementary Table S2 ) were evaluated for fruit weight in an F 4 population 20S156 (N = 202). Interval mapping results was plotted using R/qtl package (map.funciton = kosambi, model = normal) (Broman et al. 2003 ). Quantile normalization was performed for fruit weight data using qqnorm function in R. The logarithm of odds (LOD) threshold of α = 0.01 was calculated using permutation tests with 1000 permutations. To fine map fw6.1 and fw6.2 separately, we generated F 6 and F 7 recombinant population from a cross between large-fruited BGV06232 and small-fruited BGV008225. Population 22S33 (N = 137) segregated for fw6.1 and population 22S30 (N = 88) segregated for fw6.2 . Family 22S33 was fixed at BGV006232 allele between marker 21EP44 and 18EP327 for fw6.2 . Family 22S30 was fixed at BGV008225 allele between marker 18EP962 and 21EP41 for fw6.1. Nine recombinant plants from different generations were progeny tested. Pedigree information for fine mapping fw6.1 and fw6.2 is shown in Supplementary Fig. S1 . To genotype the plants, Kompetitive Allele Specific PCR (KASP) markers were designed using the Primer Express® Software version 3.0.1 (Applied Biosystems, Carlsbad, CA) as described in Topcu et al. ( 2021 ) and derived cleaved amplified polymorphic sequences (dCAPS) markers were designed using the tool indCAPS (Hodgens et al. 2017 ). Primer information is shown in Supplementary Table S2 . Knockout of CSR-like1 To utilize CRISPR- Cas9 editing to create knockout mutations of CSR-like1 , a single guide RNA was designed using CRISPR-P ( http://crispr.hzau.edu.cn/cgi-bin/CRISPR/CRISPR ) (Supplementary Table S2 ) and cloned into p201N vector (Addgene plasmid #59175). The construct was transformed into BGV007931 (SLC) from the Varitome collection and a breeding line Fla.8059 (SLL) (Scott et al. 2008 ) using standard transformation procedures (Van Eck et al. 2019 ). The transformation yielded two independent T 0 s in BGV007931, and three independent T 0 s in Fla. 8059 background (Supplementary Table S3 ). Primers for genotyping the presence of transgene and the mutation are listed in Supplementary Table S2 . Downregulation of CSR-like1 One artificial microRNA (amiRNA) targeting the coding region of CSR-like1 was designed using WMD3 Web MicroRNA Designer ( http://wmd3.weigelworld.org/ ). Target search with maximum 5 mismatches of the selected amiRNA sequence (TCTTGAGTCGAGTTGCGTCAT) showed CSR-like1 as the only target. The amiRNA sequence and its pair amiRNA* (ATAACGCAACTCGTCTCAAGT) were cloned into the Arabidopsis miR319a precursor backbone. The amiRNA precursor was synthesized by Azenta Life Sciences (South Plainfield, NJ, USA) and cloned into pKYLX71 vector at the XhoI and SacI restriction enzyme sites. The construct was transformed into the large-fruited mapping parent BGV006232. Four T 0 s were obtained and verified for the presence of transgene using primers 20EP672/20EP673 (Supplementary Table S2 ). The BC 1 F 1 families 24S156, 25S158, 25S159 and 25S160 were used for phenotypic evaluations. Pedigree information is shown in Supplementary Fig. S2 . Phenotypic evaluations The mapped interval of fw6.2 spanned 374kb between marker 21EP56 and 24EP416. We generated a fw6.2 NIL family 24S155 in which fw6.2 -D plants carry the large-fruited derived allele from BGV006232 and fw6.2 -WT plants carry the wildtype allele from BGV008225. For fw6.2 NIL family 24S155 and the amiRNA transgenic family 24S156, 6 to 10 ovaries per plant were collected and scanned using a flatbed scanner. Ovary size was measured using Fiji software (Schindelin et al. 2012 ). Flowers were hand-pollinated and tagged for additional fruit phenotyping. Per plant, five to 10 of the largest fruits at turning or red ripe stage were cut at the equatorial plane along the medio-lateral axis and scanned. The images were analyzed using Tomato Analyzer 4.0 (Rodríguez et al. 2010 ) to obtain the total cross-section area, pericarp area, pericarp area ratio, columella area and columella area ratio. Fruit weight at various developmental stages was also measured in grams: 3, 5, 10, 15, 20, 25 DPA with three to four replicates per plant; mature green and red ripe stage consisted of five to 10 replicates per plant. Pericarp thickness, cell layer and mesocarp cell size were measured following the previously established protocols (Mu et al. 2017 ). Mesocarp cell size was calculated as the mean of the five largest cells in a pericarp slice. The number of days between anthesis to red ripe was recorded for the amiRNA transgenic families 24S156, 25S158, 25S159 and 25S160. Plant height at 55 days after sowing was measured for transgenic families 25S158, 25S159 and 25S160. Haplotype analysis of CSR-like1 The genetic diversity of CSR-like1 in the Varitome collection was analyzed following the previously described protocol (Pereira et al. 2021a ). Briefly, SNPs and INDELs were extracted from within CSR-like1 as well as 3 kb upstream of the start site and 1 kb downstream of the termination site with VCFTools (Danecek et al. 2011 ). The locations and functions of the variants were annotated using SnpEff (Cingolani et al. 2012 ) with a reference SL4.0 tomato reference genome ( https://solgenomics.net/ ). The haplotype heatmap was generated using the R package “pheatmap” (Kolde 2019), accompanied with the phylogeny of the accessions (Razifard et al. 2020 ). The fruit weight of each accession was classified into three groups: small (below 3 grams), medium (3–20 g) and big (above 20 g). The p -values of pairwise comparison among haplotype clusters were conducted using the R package “emmeans” (Lenth 2022) and the Tukey test with a significance threshold at 0.05 was used. Single variant association with fruit weight and pericarp cell size was calculated by Kruskal–Wallis test and the p -values were adjusted by the Benjamini–Hochberg method to control the False Discovery Rate (FDR). The haplotype distribution of CSR-like1 was visualized in a geographic map as described in Sapkota et al. ( 2023 ) using R packages “rnaturalearth” ( https://CRAN.R-project.org/package=rnaturalearth ) and “ggspatial” ( https://CRAN.R-project.org/package=ggspatial ). The latitude and longitude of collection sites were retrieved from Razifard et al. ( 2020 ). The haplotypes of CSR-like1 in pepper were identified using five GBS SNPs (S06_227195491, S06_227195529, S06_227195579, S06_227195589, and S06_227195619) and the pairwise comparison of fruit weight among haplotypes were performed using the same method as for tomato haplotype analysis. Results Identification and fine mapping of fw6.1 and fw6.2 in tomato To identify novel genes regulating fruit weight in tomato, a GWAS analysis was performed using the Varitome collection which included 27 wild SP, 121 semi domesticated SLC and 18 ancestral landrace SLL accessions. A total of 15 fruit weight GWAS loci using SNPs and INDELs were identified in this study, which led to six unique fruit weight QTLs on chromosomes 2, 3, 6, 11, and 12, and another six QTLs that were scattered on chromosome 1 (Fig. 1a,b; Supplementary Table S4). The GWAS_fw2.2 locus is likely associated with the known fw2.2 , whereas GWAS_fw11.1 is likely associated with the linked loci fw11.3 and fas . GWAS_fw3.2 is likely associated with fw3.2 , however, the variant was 5 Mb from the known fruit weight gene. Among the novel GWAS loci, GWAS_fw6.1 has two linked INDEL markers associated with fruit weight (ISL4.0ch06_44805731 and ISL4.0ch06_45074906) and was further characterized in this study. To validate the newly identified fw6.1 locus, we evaluated a total of five F 2 biparental populations using flanking markers approximately 1–2 Mb upstream and downstream of the significant GWAS loci. The parental selection of the F 2 populations was based on the predicted variants from the GWAS and the estimated effect of the QTL on fruit weight. For all F 2 populations, the two parents of each population were fixed at the known tomato fruit weight and fruit shape genes (Supplementary Table S1 ). GWAS_fw6.1 was confirmed in the four F 2 populations that segregated at the GWAS_fw6.1 locus, namely 18S33, 18S39,18S40 and 18S133 (Supplementary Table S5). The QTL showed a significant additive effect with a small, nonsignificant dominance deviation, indicating primarily additive gene action with partial dominance (Supplementary Table S5). The marker association was most significant in 18S39, and therefore this population was used to fine map the locus. Family 18S39 was derived from a cross between an Ecuadorian accession (BGV006232) and a Peruvian SLC accession (BGV008225), and the two parental accessions exhibited a 4-fold difference in fruit weight (Supplementary Table S1 ). To narrow the interval of fw6.1 , we screened for recombinant plants using self-pollinated progeny from the 18S39 F 2 population. Linkage mapping indicated the presence of two linked QTLs that were significantly associated with fruit weight on chromosome 6 (Fig. 1c). fw6.1 was flanked by marker 18EP962 (SL4.0ch06:39930114) and 20EP567 (SL4.0ch06:42662777 ) , spanning a 2.73Mb interval, whereas fw6.2 was flanked by marker 20EP1256 (SL4.0ch06:43033158) and 19EP629 (SL4.0ch06:44319744), spanning a 1.29Mb interval. BGV006232 carried the large-fruited derived allele at both fw6.1 and fw6.2 , as shown by the allelic effects of the highest associated markers at each QTL (Supplementary Fig. S3 ). To map each locus further, we selected recombinant plants that were segregating at one locus while fixed at the other. By evaluating two recombinant populations (Fig. 2a,b) and nine progeny testing families (Fig. 2c; Supplementary Table S6), we narrowed fw6.1 to a 1.03 Mb region flanked by marker 22EP373 (SL4.0ch06:40416852) and 22EP37 (SL4.0ch06:41451757), and fw6.2 to a 374 kb region between marker 21EP56 (SL4.0ch06:43262334) and 24EP416 (SL4.0ch06:43636481). To carefully analyze fruit phenotypes that are controlled by fw6.2 and gain insights into its mechanism to regulate fruit weight, we used NILs from an F 7:8 plant 22S310-30 in which fw6.1 was fixed for the derived BGV006232 allele. At fw6.2 , fw.6.2-D NILs carried the derived BGV006232 allele and fw6.2-WT NILs carried the wildtype BGV008225 allele. Fruit weight was significantly different between the two genotypes (Fig. 3a; Table 1), whereas ovary size was not affected (Table 1). The difference in fruit weight started to manifest itself during the development of the fruit 25 days after pollination (Fig. 3a). We conducted additional morphological and cytological measurements (Table 2). Fw6.2 -D NILs showed a larger total fruit and pericarp area than fw6.2 -WT NILs. On the other hand, there was no significant segregation for pericarp area ratio, columella area, and columella area ratio. This suggests that the fruit weight increase in the fw6.2 -D NILs was primarily driven by the enlargement of the pericarp. Moreover, the pericarp cell size was significantly larger in the fw6.2-D NILs, while the two genotypes showed a similar number of pericarp cell layers (Fig. 3b; Table 2). Therefore, fw6.2 is likely to affect fruit weight by regulating the cell size in the pericarp. Candidate gene at fw6.2 : CSR-like1 Since fw6.2 showed the highest PVE and smallest introgression, we evaluated the genes in the 374 kb interval in the tomato reference SL4.0 genome (Supplementary Table S7). Among the 51 genes, Solyc06g073940 stood out as the paralog of the known fruit weight gene CSR controlling pericarp cell size, CSR-like1 (Mu et al. 2017 ). The sequence analysis of CSR-like1 showed that the BGV006232 and BGV008225 alleles carried no nucleotide polymorphisms in the protein coding region, and instead three SNPs in the 5’ untranslated region (UTR), one SNP in the 3’UTR, and 16 SNPs in the putative 3kb regulatory region upstream of CSR-like1 . To validate the function of CSR-like1 in fruit weight, we first sought to create knockout mutants using the CRISPR- Cas9 gene editing approach in two distinct accessions, a small-fruited SLC BGV007931 and a large-fruited SLL Fla. 8095 accession (Scott et al. 2008 ). We recovered two independent T 0 s in BGV007931 and three independent T 0 s in Fla. 8095 backgrounds, respectively, but all five T 0 s carried in frame deletions of 6 bp or 12 bp (Supplementary Table S3 ). Despite the CRISPR-edited alleles were in-frame and not nulls, we evaluated the fruit weight variation in these lines (Supplementary Fig. S4). As expected, the in-frame edited alleles did not show consistent fruit weight differences compared to wildtype. We concluded that CSR-like1 may play an essential role in plant development such that a complete knockout is likely to be lethal. We next sought to downregulate the expression of CSR-like1 using the artificial microRNA (amiRNA) technology, and recovered four T 0 in the large-fruited BGV006232 background. The fruit weight of CSR-like1 -amiRNA plants was between 27% to 43% lower than controls under greenhouse conditions in the transformed lines, including a significant decrease in ovary size (Table 1; Supplementary Table S8). The pericarp area was significantly decreased in CSR-like1 -amiRNA plants resulting from reduced cell size (Fig. 3d; Table 2). We also observed slower fruit development in CSR-like1 -amiRNA plants, starting as early as 5DPA (Fig. 3c), and these plants required approximately 8–12 days more to reach the red ripe stage compared to CSR-like1 -WT plants (Table 3). No vegetative effects were observed as the plants looked normal (Supplementary Table S8; Supplementary Fig. S5). Evolution of CSR-like1 in tomato domestication Fruit weight was an important trait for selection during the domestication of most vegetable crops. To investigate the evolution of CSR-like1 during tomato domestication, we explored the genetic diversity at the locus by generating a heatmap containing six haplotype clusters in the Varitome collection (Fig. 4a). A total of 88 variants were identified at the locus, of which 12 were INDELs ranging in size from 1 to 9 bp in addition to 76 SNPs (Supplementary Table S9). Most of the variants were located in the regulatory region and the UTRs. Similar to the parents in the mapping population, the coding region of CSR-like1 was highly conserved in the Varitome collection with only 2 SNPs in distantly related accessions. SNP_ SL4.0ch06:43344537 resulted in a missense mutation from proline to leucine at amino acid position 355, while SNP_ SL4.0ch06:43344932 led to a synonymous mutation of glutamine at amino acid position 223. The clustering of haplotype groups was also associated with the phylogenetic groups of the accessions. Most of the SLC and all SLL accessions were found in Cluster I, II, and III. All of the wild tomato SP accessions were in Cluster IV, V and VI, carrying more mutations in the regulatory region and the UTRs. The missense mutation was only found in four accessions (1 SP and 3 SLC) in Cluster VI. We also surveyed an additional accession panel (SLL_CUL) including 73 modern cultivars, landraces and heirlooms (Tieman et al. 2017 ), and assigned their haplotypes using conserved SNPs across Cluster III to VI (Supplementary Table S10). These cultivated accessions also have either haplotype I or II, similar to the ancestral SLL in the Varitome collection (Supplementary Table S10). We will now refer haplotype I and II allele together as CSR-like1 - D for derived which was most similar to the Heinz 1706 reference genotype, and haplotype III, IV, V, and VI together as CSR-like1 - WT for wildtype. For the two mapping parents of fw6.2 , the large-fruited parent BGV006232 carries the CSR-like1 - D allele (haplotype II) while the small-fruited parent BGV0008225 carries the CSR-like1 - WT allele (haplotype IV). To further investigate the association between CSR-like1 haplotypes in the entire Varitome collection and fruit traits, we selected only accessions carrying the wildtype fw11.3 / CSR allele since that gene has a large effect on fruit weight and pericarp cell size. The resulting 108 SLC and 27 SP accessions showed that fruit weight and pericarp cell size were larger in the accessions carrying CSR-like1-D alleles (Fig. 4b,c). Similarly, when fixing for CNR ( fw2.2 ), KLUH ( fw3.2 ) and all three known fruit weight genes, the CSR-like1 haplotype I and II were always associated with larger fruits and pericarp cells (Supplemental Figure S6), further supporting the notion that this gene is critical in the regulation of fruit weight via increased cell sizes. We also identified four SNPs in the upstream and downstream of CSR-like1 that are exclusively found in CSR-like1 - WT alleles (red asterisks in Fig. 4a). These SNPs are the four most significant variants associated with fruit weight and pericarp cell size (Supplementary Table S11). CSR-like1 associated with fruit weight in pepper Orthologs of tomato fruit weight genes have been reported as likely candidate genes underlying fruit weight QTLs in other Solanaceae crops including pepper and eggplant (Rinaldi et al. 2016 ; Toppino et al. 2016 ; Zygier et al. 2005 ) as well as some Cucurbitaceae crops including melon, cucumber and watermelon (Monforte et al. 2014 ; Pan et al. 2020 ). To explore the potential conserved function of CSR-like1 in regulating fruit weight in pepper, we conducted GWAS using multi-year phenotypic data collected from four Capsicum species ( C. annuum , C. annuum var. glabriusculum , C. baccatum , and C. chinense ) (Supplementary Table S12). We identified three significant SNPs (S06_227195491, S06_227195529, and S06_227195619) in the mixed linear model (MLM), and one SNP (S06_227195491) in the BLINK model, all located within the coding region of CaCSR-like1 ( CA06g22610 ) (Fig. 5a,b). The Capsicum ortholog CaCSR-like1 exhibited conserved motifs and domain structures characteristic of the CSR/FAF-like proteins (Mu et al. 2017 ), suggesting a conserved molecular mechanism in regulating cell size and fruit mass. To further characterize allelic diversity of CaCSR-like1 , we identified a total of five SNPs (S06_227195491, S06_227195529, S06_227195579, S06_227195589, and S06_227195619) in the coding region of CaCSR-like1 among the Capsicum GWAS panel using the GBS markers (Fig. 6a). Six haplotypes (haplotype I to VI) were assigned using the five segregating sites, and only SNP S06_227195619, S06_227195579 and S06_22719549 led to non-synonymous changes at amino acid position 10, 24 and 53 (Fig. 6a). These non-synonymous mutations were outside of the FAF domain (Pfam accession: PF11250) which is located between amino acid position 230 and 278. The wild pepper C. annuum var. glabriusculum in this study only carried haplotype II or III, while the cultivated pepper C. annuum , C. baccatum , and C. chinense exhibited all six haplotypes across different accessions (Fig. 6b; Supplementary Table S13). There is also clear association of haplotype VI with higher fruit weight within each cultivated pepper species (Fig. 6b). Discussion Fruit weight is a critical component in modern agriculture as it is linked to yield and the price of produce. Hence a key focus in many vegetable breeding programs is to maintain or increase fruit weight. Understanding the genetic basis underlying this highly quantitative trait can provide us valuable insights into fruit development and help accelerate breeding programs. In this study, we successfully identified five unique fruit weight QTL from a GWAS with diverse SP, SLC and SLL accessions. Of these loci, three were likely to correspond to known fruit weight genes while two were novel. We subsequently fine mapped two QTLs on chromosome 6 using association mapping and progeny testing. Of these, fw6.2 harbors the smaller interval of 374 kb. Based on changes in pericarp cell size in fw6.2 NILs, CSR-like1 was identified as the most likely candidate gene at the locus. CSR-like1 is a paralog of the only known fruit weight gene CSR that regulates cell enlargement. The haplotype analyses of CSR-like1 showed that smaller pericarp cell size was associated with accessions carrying CSR-like1 - WT alleles in backgrounds where the other cloned fruit weight genes were fixed (Fig. 4c and Supplementary Figure S6). Moreover, among the F 2 populations that were used to validate GWAS_fw6.1 , four showed significant association with fruit weight at the locus (Supplementary Table S5). Of those that segregated at the GWAS locus, the large-fruited parent of each of the four populations carries CSR-like1-D allele while the other parent carries CSR-like1 - WT allele except for 18S40 where both parents carry the same CSR-like1 - D allele. The small effect on fruit weight at GWAS_fw6.1 may be the result of the other segregating fruit weight QTLs in the population and imply that other genes at the GWAS_fw6.1 locus affect the trait as well (Supplementary Tables S1 and S5). The fifth F 2 population, 18S32, was neither segregating for polymorphisms at GWAS_fw6.1 , nor for the CSR-like1 allele. Therefore, as expected, the locus was not associated with fruit weight in the 18S32 population. Together, genetic mapping and haplotype association analysis demonstrate that CSR-like1 is a likely candidate for fruit weight at the fw6.2 locus. In addition, the haplotype analyses revealed four most significant SNPs associated with fruit weight that could be utilized in future breeding programs for selecting desired fruit weight in tomato (Supplementary Table S11). CSR-like1 was located 19kb away from one of the selective sweep windows in the transition from SP to SLC (Razifard et al. 2020 ), suggesting that the gene may have been selected in the early stage of tomato domestication. This agrees with the distribution of CSR-like1 haplotypes in the genetically distinct groups classified in Razifard et al. ( 2020 ) (Supplementary Fig. S7). All SP accessions in the Varitome collection carried haplotype IV, V or VI, which were associated with smaller fruit weight. Based on the tomato domestication hypothesis proposed by Razifard et al. ( 2020 ), Ecuadorian SLC (SLC_ECU) accessions would be the most ancestral SLC group, and thus would be the first group where larger fruit-associated haplotype I and II allele of CSR-like1 appeared. The frequency of haplotype I and II allele would increase with further domestication. Haplotype III allele is associated with smaller fruit weight compared to haplotype I and II, and is mostly found in a group of SLC accessions from Mexico, Central America, and northern South America (together annotated as SLC_CA). The rise of haplotype III allele would coincide with the transition of fruit weight back to more wild-like tomatoes in SLC_CA, and we would expect to see a reselection of Haplotype I and II of CSR-like1 in the fully cultivated SLL from SLC_Mexico. However, such re-selection was not detected in the study of Razifard et al. ( 2020 ) at the CSR-like1 locus. In fact, the haplotype distribution of CSR-like1 could demonstrate another scenario in the evolution of tomato such as described in Blanca et al. (2021) (Supplementary Fig S8). SLC_CA was likely to be the intermediate group after the northward migration of SP towards Mesoamerica. Later SLC_CA migrated back to South America and admixed with Ecuadorian and Peruvian SP to give rise to Ecuadorian and Peruvian SLC in which haplotype I and II allele of CSR-like1 were further distributed. Some Peruvian SLC then migrated back to Mexico where it evolved fully to SLL. We functionally validated the role of CSR-like1 in controlling fruit weight and pericarp cell size by downregulating its expression in transgenic plants. In the amiRNA lines, the effect of reduced expression of CSR-like1 on fruit development started to manifest itself in ovaries one day prior to anthesis. CSR-like1 is the only member of the CSR/FAF-like family in tomato that has relatively high expression in young flower buds and flowers at anthesis (Mu et al. 2017 ). This suggests that CSR-like1 might regulate cell differentiation and enlargement in floral development as well even though the NILs did not show a difference at that time. Similar differences between lines carrying natural alleles and lines carrying transgenes has been observed in fw3.2/KLUH (Chakrabarti et al. 2013 ). Compared to fw3.2 NILs, the downregulated transgenic lines showed additional phenotypic defects across the entire plant, including plant height, leaves and leaflets, seed number and side shoot number (Chakrabarti et al. 2013 ). Future experiments are needed to determine the developmental time frame for when and how CSR-like1 acts in floral development. Tomato serves as an important model crop for studying fruit development, with many genes displaying conserved functions across plant species. Recently, two association mapping studies in C. annum and C. chinense , respectively, reported SNPs in the orthologs of CSR-like1 to be significantly associated with fruit weight (Nimmakayala et al. 2016 ; Nimmakayala et al. 2021 ). Here we are adding another piece of evidence of a pepper CSR-like1 regulating fruit weight using a more expanded Capsicum collection with multi-model GWAS identifying significant SNPs within the coding region of CaCSR-like1 . The presence of the distinct haplotypes associated with fruit weight further indicates that allelic diversification of CaCSR-like1 contributed to the phenotypic spectrum observed in cultivated Capsicum species. Haplotype VI of CaCSR-like1 was enriched among large-fruited accessions, likely represents a derived allele favored during domestication or selection for increased fruit mass. There is evidence of CSR-like1 being relevant in other crops. In watermelon and cucumber, QTL mapping using recombinant inbred lines (RILs) has identified fruit weight/size QTLs that harbor the respective orthologs of CSR-like1 ( ClCG02G022450 in watermelon; CsGy6G022740 in cucumber) (Guo et al. 2024 ; Weng et al. 2015 ). A recent GWAS utilizing the CucCAP cucumber core collection also identified a SNP which is ~ 250kb upstream of CsGy6G022740 to be significantly associated with fruit size (Lin et al. 2024 ). In eggplant, though there have not been any reported fruit weight QTLs mapped close to CSR-like1 , a fruit weight QTL of around 10 cM on chromosome 12 was mapped in an F 2 population ( S. melongena 305E40 x S. melongena 67/3), with SMEL4.1_12g014140.1 , the ortholog of CSR , residing at the locus (Gaccione et al. 2023 ; Portis et al. 2014 ). Direct genetic modification in other crops could be applied to broaden our understanding on the potential conserved function of CSR-like1 and its related genes in regulating fruit size and other species-specific functions. While the function on fruit size and cell size by CSR-like1 and CSR in tomato is apparent, its molecular function is less clear. CSR-like1 is predicted to encode a protein that contains a FANTASTIC FOUR (FAF) domain, and is an ortholog of FAF-like ( AT5G22090 ) in Arabidopsis thaliana (Mu et al. 2017 ). FAF-like and its related family FAF were first reported in Arabidopsis , which carries four FAF members and one FAF-like (Wahl et al. 2010 ). Phylogenetic analysis in monocotyledonous and dicotyledonous plants suggest that the FAF genes have evolved from a FAF-like gene to become a dicotyledonous-specific gene family after gene duplication (Wahl et al. 2010 ). Many of the plant species in the Rosids and Asterids clades carry only one copy of FAF-like (Mu et al. 2017 ; Wahl et al. 2010 ). Interestingly, an expansion of FAF-like is observed in the Solanaceae family. Tomato, potato ( S. tuberosum ) and chili pepper ( Capsicum annuum ) carry four FAF-like genes whereas eggplant ( S. melongena ) carries three members (Mu et al. 2017 ). In Arabidopsis, FAF-like ( AT5G22090 ) encodes a protein described as EAR1 (ENHANCER of ABA CO-RECEPTOR1), which can enhance the activity of clade A type 2C protein phosphatases (PP2Cs) by binding to their N termini, causing the inhibition of Snf1-related kinases2 (SnRK2s) (Wang et al. 2018 ). Meanwhile, the expression of many downstream targets of ABA signaling rely on phosphorylation by SnRK2s (Hasan et al. 2022 ). Therefore, EAR1 is a negative regulator of ABA signaling and shown to affect seed germination, primary root growth and drought tolerance (Wang et al. 2018 ). Interestingly, in pepper, CaCSR-like1 ( CA06g22610 ; or CaFAF1 ) regulates the ABA signaling pathway but in a different manner than EAR1 (Lim et al. 2022 ; Wang et al. 2018 ). CaCSR-like1 does not interact with the known pepper PP2Ps in yeast two-hybrid assays, and unlike EAR1 , CaCSR-like1 does not affect seed germination and primary root growth when overexpressed in Arabidopsis. Instead, CaCSR-like1 plays a positive role in drought stress and a negative role in salt stress. Therefore, CaCSR-like1’s function differs under certain abiotic stresses (Lim et al. 2022 ). In this study, fruit ripening is delayed in the transgenically downregulated CSR-like1 lines. It is a complex process controlled by many regulators through phytohormone and environmental signals (Kou et al. 2021 ). ABA is known to be a key signaling hormone to regulate the ripening process in tomato through crosstalk with ethylene biosynthesis and metabolism (Kou et al. 2021 ; Mou et al. 2016 ; Zhang et al. 2009 ). As discussed earlier, EAR1 in Arabidopsis is a negative regulator of ABA signaling pathway (Wang et al. 2018 ). Silencing one of the tomato PP2C s, SlPP2C3 ( Solyc06g076400 ), was shown to accelerate the ripening process (Liang et al. 2021 ). Therefore, if CSR-like1 were to have a similar function as EAR1 and interact with PP2Cs like PP2C3, we would expect to see a shortened ripening process in our amiRNA transgenic plants; instead, we observed the opposite result. This suggests that CSR-like1 might have a divergent function from EAR1. As mentioned earlier, a similar case has been made in pepper where CaCSR-like1 was demonstrated to affect ABA signaling through a different mechanism under abiotic stresses (Lim et al. 2022 ). The expansion of CSR/FAF-like family especially in the Solanaceae crops also suggests CSR/FAF-like proteins might have evolved to have novel functions evolution. In summary, our data support a critical role for the tomato FAF-like genes, CSR and CSR-like 1 on fruit weight in this species and potentially other crops. Further understanding its molecular function should lead to insights into fundamental plant processes while at the same time enabling breeders to implement the knowledge presented in their breeding programs. Declarations Competing Interests The corresponding author, Esther van der Knaap, is a member of the Editorial Board of Theoretical and Applied Genetics. As required by journal policy, they will not be involved in the editorial handling or peer-review process of this manuscript. Another Editor with no competing interests will be assigned to oversee the review. All authors declare that no other competing interests exist. Funding This work was supported by NSF IOS 1564366 to EvdK Author contribution EvdK conceived the study and supervised the research. QF, LP, and MS performed all experiments and data analyses on tomato. YW created the CSR-like1 amiRNA construct and genotyped the T 0 tomato lines. KSK, PN and UR performed all experiments and data analyses on pepper. QF and EvdK drafted the original manuscript. All authors reviewed, provided comments and agreed to the published version of the manuscript. Acknowledgements We want to thank Dr. Ana Caicedo for helpful suggestions about the evolution of the locus; Katherine Hardigree for plant care and field experiments; Neda Keyhaninejad for tomato transformations; and all members of the Van der Knaap lab for field harvest and fruit weight evaluations. Data availability The raw DNA sequence data for tomato is available in NCBI ( https://www.ncbi.nlm.nih.gov/ ; SRA: SRP150040, SRP045767, SRP094624, and PRJNA353161). The GBS data for pepper is available in NCBI ( https://www.ncbi.nlm.nih.gov/ ; PRJNA1305095). References Alexander DH, Shringarpure SS, Novembre J, Lange K (2015) Admixture 1.3 software manual. UCLA Human Genetics Software Distribution, Los Angeles Alonge M, Wang X, Benoit M et al (2020) Major Impacts of Widespread Structural Variation on Gene Expression and Crop Improvement in Tomato. Cell 182:145–161e23. https://doi.org/10.1016/j.cell.2020.05.021 Broman KW, Wu H, Sen S, Churchill GA (2003) R/qtl: QTL mapping in experimental crosses. Bioinformatics 19:889–890. https://doi.org/10.1093/bioinformatics/btg112 Causse M, Saliba-Colombani V, Lecomte L, Duffé P, Rousselle P, Buret M (2002) QTL analysis of fruit quality in fresh market tomato: a few chromosome regions control the variation of sensory and instrumental traits. J Exp Bot 53:2089–2098. https://doi.org/10.1093/jxb/erf058 Chakrabarti M, Zhang N, Sauvage C et al (2013) A cytochrome P450 regulates a domestication trait in cultivated tomato. Proceedings of the National Academy of Sciences 110:17125–17130. https://doi.org/10.1073/pnas.1307313110 Cheng R, Parker CC, Abney M, Palmer AA (2013) Practical Considerations Regarding the Use of Genotype and Pedigree Data to Model Relatedness in the Context of Genome-Wide Association Studies. G3 Genes|Genomes|Genetics 3:1861–1867. https://doi.org/10.1534/g3.113.007948 Cingolani P, Adrian P, Lily WL, Melissa C, Tung N, Luan W, Xiangyi JLS L and and, Ruden DM (2012) A program for annotating and predicting the effects of single nucleotide polymorphisms. SnpEff Fly 6:80–92. https://doi.org/10.4161/fly.19695 Cong B, Liu J, Tanksley SD (2002) Natural alleles at a tomato fruit size quantitative trait locus differ by heterochronic regulatory mutations. Proceedings of the National Academy of Sciences 99:13606–13611. https://doi.org/10.1073/pnas.172520999 Cong B, Barrero LS, Tanksley SD (2008) Regulatory change in YABBY-like transcription factor led to evolution of extreme fruit size during tomato domestication. Nat Genet 40:800–804. https://doi.org/10.1038/ng.144 Danecek P, Auton A, Abecasis G et al (2011) The variant call format and VCFtools. Bioinformatics 27:2156–2158. https://doi.org/10.1093/bioinformatics/btr330 Danecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, Whitwham A, Keane T, McCarthy SA, Davies RM, Li H (2021) Twelve years of SAMtools and BCFtools. https://doi.org/10.1093/gigascience/giab008 . Gigascience 10 Doebley JF, Gaut BS, Smith BD (2006) The Molecular Genetics of Crop Domestication. Cell 127:1309–1321. https://doi.org/https://doi.org/ 10.1016/j.cell.2006.12.006 Elshire RJ, Glaubitz JC, Sun Q, Poland JA, Kawamoto K, Buckler ES, Mitchell SE (2011) A Robust, Simple Genotyping-by-Sequencing (GBS) Approach for High Diversity Species. PLoS ONE 6:e19379. https://doi.org/10.1371/journal.pone.0019379 Frary A, Nesbitt TC, Frary A, Grandillo S, Van Der Knaap E, Cong B, Liu J, Meller J, Elber R, Alpert KB (2000) fw2. 2: a quantitative trait locus key to the evolution of tomato fruit size. Science 289:85–88. https://doi.org/10.1126/science.289.5476.85 Gaccione L, Martina M, Barchi L, Portis E (2023) A Compendium for Novel Marker-Based Breeding Strategies in Eggplant. Plants 12:1016. https://doi.org/10.3390/plants12051016 Grandillo S, Ku HM, Tanksley SD (1999) Identifying the loci responsible for natural variation in fruit size and shape in tomato. Theor Appl Genet 99:978–987. https://doi.org/10.1007/s001220051405 Gross BL, Olsen KM (2010) Genetic perspectives on crop domestication. Trends Plant Sci 15:529–537. https://doi.org/10.1016/j.tplants.2010.05.008 Guo S, Tian M, Du H, Liu S, Yu R, Shen H (2024) Quantitative Trait Loci Mapping and Comparative Transcriptome Analysis of Fruit Weight (FW) in Watermelon (Citrullus lanatus L). Genes (Basel) 15. https://doi.org/10.3390/genes15070933 Hasan MM, Liu XD, Waseem M, Guang-Qian Y, Alabdallah NM, Jahan MS, Fang XW (2022) ABA activated SnRK2 kinases: an emerging role in plant growth and physiology. Plant Signal Behav 17:2071024. https://doi.org/10.1080/15592324.2022.2071024 Hodgens C, Nimchuk ZL, Kieber JJ (2017) indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events. PLoS ONE 12:e0188406. https://doi.org/10.1371/journal.pone.0188406 Illa-Berenguer E, Van Houten J, Huang Z, van der Knaap E (2015) Rapid and reliable identification of tomato fruit weight and locule number loci by QTL-seq. Theor Appl Genet 128:1329–1342. https://doi.org/10.1007/s00122-015-2509-x Kim S, Park M, Yeom SI et al (2014) Genome sequence of the hot pepper provides insights into the evolution of pungency in Capsicum species. Nat Genet 46:270–278. https://doi.org/10.1038/ng.2877 Knaus BJ, Grünwald NJ (2017) vcfr: a package to manipulate and visualize variant call format data in R. Mol Ecol Resour 17:44–53. https://doi.org/10.1111/1755-0998.12549 Kou X, Zhou J, Wu CE, Yang S, Liu Y, Chai L, Xue Z (2021) The interplay between ABA/ethylene and NAC TFs in tomato fruit ripening: a review. Plant Mol Biol 106:223–238. https://doi.org/10.1007/s11103-021-01128-w Liang B, Sun Y, Wang J, Zheng Y, Zhang W, Xu Y, Li Q, Leng P (2021) Tomato protein phosphatase 2C influences the onset of fruit ripening and fruit glossiness. J Exp Bot 72:2403–2418. https://doi.org/10.1093/jxb/eraa593 Lim CW, Bae Y, Lee SC (2022) Differential role of Capsicum annuum FANTASTIC FOUR-like gene CaFAF1 on drought and salt stress responses. Environ Exp Bot 199:104887. https://doi.org/https://doi.org/10.1016/j.envexpbot.2022.104887 Lin Y-C, Weng Y, Fei Z, Grumet R (2024) Mining the cucumber core collection: phenotypic and genetic characterization of morphological diversity for fruit quality characteristics. Hortic Res 12. https://doi.org/10.1093/hr/uhae340 Mata-Nicolás E, Montero-Pau J, Gimeno-Paez E, Garcia-Carpintero V, Ziarsolo P, Menda N, Mueller LA, Blanca J, Cañizares J, Van Der Knaap E, Díez MJ (2020) Exploiting the diversity of tomato: the development of a phenotypically and genetically detailed germplasm collection. Hortic Res 7. https://doi.org/10.1038/s41438-020-0291-7 Monforte AJ, Diaz A, Caño-Delgado A, van der Knaap E (2014) The genetic basis of fruit morphology in horticultural crops: lessons from tomato and melon. J Exp Bot 65:4625–4637. https://doi.org/10.1093/jxb/eru017 Mou W, Li D, Bu J, Jiang Y, Khan ZU, Luo Z, Mao L, Ying T (2016) Comprehensive Analysis of ABA Effects on Ethylene Biosynthesis and Signaling during Tomato Fruit Ripening. PLoS ONE 11:e0154072. https://doi.org/10.1371/journal.pone.0154072 Mu Q, Huang Z, Chakrabarti M, Illa-Berenguer E, Liu X, Wang Y, Ramos A, van der Knaap E (2017) Fruit weight is controlled by Cell Size Regulator encoding a novel protein that is expressed in maturing tomato fruits. PLoS Genet 13:e1006930. https://doi.org/10.1371/journal.pgen.1006930 Muños S, Ranc N, Botton E, Bérard A, Rolland S, Duffé P, Carretero Y, Le Paslier M-C, Delalande C, Bouzayen M (2011) Increase in tomato locule number is controlled by two single-nucleotide polymorphisms located near WUSCHEL. Plant Physiol 156:2244–2254. https://doi.org/10.1104/pp.111.173997 Nimmakayala P, Abburi VL, Saminathan T et al (2016) Genome-wide Diversity and Association Mapping for Capsaicinoids and Fruit Weight in Capsicum annuum L. Sci Rep 6:38081. https://doi.org/10.1038/srep38081 Nimmakayala P, Lopez-Ortiz C, Shahi B, Abburi VL, Natarajan P, Kshetry AO, Shinde S, Davenport B, Stommel J, Reddy UK (2021) Exploration into natural variation for genes associated with fruit shape and size among Capsicum chinense collections. Genomics 113:3002–3014. https://doi.org/10.1016/j.ygeno.2021.06.041 Pan Y, Wang Y, McGregor C, Liu S, Luan F, Gao M, Weng Y (2020) Genetic architecture of fruit size and shape variation in cucurbits: a comparative perspective. Theor Appl Genet 133:1–21. https://doi.org/10.1007/s00122-019-03481-3 Paran I, van der Knaap E (2007) Genetic and molecular regulation of fruit and plant domestication traits in tomato and pepper. J Exp Bot 58:3841–3852. https://doi.org/10.1093/jxb/erm257 Pereira L, Sapkota M, Alonge M et al (2021a) Natural Genetic Diversity in Tomato Flavor Genes. Front Plant Sci 12. https://doi.org/10.3389/fpls.2021.642828 Pereira L, Zhang L, Sapkota M, Ramos A, Razifard H, Caicedo AL, Van der Knaap E (2021b) Unraveling the genetics of tomato fruit weight during crop domestication and diversification. Theor Appl Genet 134:3363–3378. https://doi.org/10.1007/s00122-021-03902-2 Portis E, Barchi L, Toppino L, Lanteri S, Acciarri N, Felicioni N, Fusari F, Barbierato V, Cericola F, Valè G, Rotino GL (2014) QTL Mapping in Eggplant Reveals Clusters of Yield-Related Loci and Orthology with the Tomato Genome. PLoS ONE 9:e89499. https://doi.org/10.1371/journal.pone.0089499 Razifard H, Ramos A, Della Valle AL et al (2020) Genomic Evidence for Complex Domestication History of the Cultivated Tomato in Latin America. Mol Biol Evol 37:1118–1132. https://doi.org/10.1093/molbev/msz297 Reddy UK, Karnatam KS, Talavera-Caro A et al (2025) Uncovering the genetic architecture of pungency, carotenoids, and flavor in Capsicum chinense via TWAS-mGWAS integration and spatial Transcriptomics. https://doi.org/10.1093/hr/uhaf243 . Horticulture Research:uhaf243 Rinaldi R, Van Deynze A, Portis E, Rotino GL, Toppino L, Hill T, Ashrafi H, Barchi L, Lanteri S (2016) New Insights on Eggplant/Tomato/Pepper Synteny and Identification of Eggplant and Pepper Orthologous QTL. Front Plant Sci 7:1031. https://doi.org/10.3389/fpls.2016.01031 Rodríguez GR, Moyseenko JB, Robbins MD, Huarachi Morejón N, Francis DM, Van Der Knaap E (2010) Tomato Analyzer: A Useful Software Application to Collect Accurate and Detailed Morphological and Colorimetric Data from Two-dimensional Objects. J Visualized Experiments. https://doi.org/10.3791/1856 Rosyara UR, De Jong WS, Douches DS, Endelman JB (2016) Software for Genome-Wide Association Studies in Autopolyploids and Its Application to Potato. Plant Genome 9. https://doi.org/10.3835/plantgenome2015.08.0073 Sapkota M, Pereira L, Wang Y, Zhang L, Topcu Y, Tieman D, van der Knaap E (2023) Structural variation underlies functional diversity at methyl salicylate loci in tomato. PLoS Genet 19:e1010751. https://doi.org/10.1371/journal.pgen.1010751 Schindelin J, Arganda-Carreras I, Frise E et al (2012) Fiji: an open-source platform for biological-image analysis. Nat Methods 9:676–682. https://doi.org/10.1038/nmeth.2019 Scott JW, Baldwin EA, Klee HJ, Brecht JK, Olson SM, Bartz JA, Sims CA (2008) Fla. 8153 Hybrid Tomato; Fla. 8059 and Fla. 7907 Breeding Lines. HortScience 43:2228–2230. https://doi.org/10.21273/hortsci.43.7.2228 Tanksley SD (2004) The Genetic, Developmental, and Molecular Bases of Fruit Size and Shape Variation in Tomato. Plant Cell 16:S181–S189. https://doi.org/10.1105/tpc.018119 Tieman D, Zhu G, Resende MF, Lin T, Nguyen C, Bies D, Rambla JL, Beltran KSO, Taylor M, Zhang B (2017) A chemical genetic roadmap to improved tomato flavor. Science 355:391–394. https://doi.org/10.1126/science.aal1556 Topcu Y, Sapkota M, Illa-Berenguer E, Nambeesan SU, Van der Knaap E (2021) Identification of blossom-end rot loci using joint QTL-seq and linkage-based QTL mapping in tomato. Theor Appl Genet 134:2931–2945. https://doi.org/10.1007/s00122-021-03869-0 Toppino L, Barchi L, Lo Scalzo R et al (2016) Mapping Quantitative Trait Loci Affecting Biochemical and Morphological Fruit Properties in Eggplant (Solanum melongena L). Front Plant Sci Volume 7–2016. https://doi.org/10.3389/fpls.2016.00256 Van Eck J, Keen P, Tjahjadi M (2019) Agrobacterium tumefaciens-Mediated Transformation of Tomato. In: Kumar S, Barone P, Smith M (eds) Transgenic Plants: Methods and Protocols. edn. Springer New York, New York, NY, pp 225–234 Vu QT, Song K, Park S, Xu L, Nam HG, Hong S (2023) An auxin-mediated ultradian rhythm positively influences root regeneration via EAR1/EUR1 in Arabidopsis. Front Plant Sci 14–2023. https://doi.org/10.3389/fpls.2023.1136445 Wahl V, Brand LH, Guo Y-L, Schmid M (2010) The FANTASTIC FOUR proteins influence shoot meristem size in Arabidopsis thaliana. BMC Plant Biol 10:285. https://doi.org/10.1186/1471-2229-10-285 Wang J, Zhang Z (2021) GAPIT Version 3: Boosting Power and Accuracy for Genomic Association and Prediction. Genomics. Proteom Bioinf 19:629–640. https://doi.org/https://doi.org/10.1016/j.gpb.2021.08.005 Wang K, He J, Zhao Y et al (2018) EAR1 Negatively Regulates ABA Signaling by Enhancing 2C Protein Phosphatase Activity. Plant Cell 30:815–834. https://doi.org/10.1105/tpc.17.00875 Weng Y, Colle M, Wang Y, Yang L, Rubinstein M, Sherman A, Ophir R, Grumet R (2015) QTL mapping in multiple populations and development stages reveals dynamic quantitative trait loci for fruit size in cucumbers of different market classes. Theor Appl Genet 128:1747–1763. https://doi.org/10.1007/s00122-015-2544-7 Xu C, Liberatore KL, MacAlister CA et al (2015) A cascade of arabinosyltransferases controls shoot meristem size in tomato. Nat Genet 47:784–792. https://doi.org/10.1038/ng.3309 Zhang M, Yuan B, Leng P (2009) The role of ABA in triggering ethylene biosynthesis and ripening of tomato fruit. J Exp Bot 60:1579–1588. https://doi.org/10.1093/jxb/erp026 Zygier S, Chaim AB, Efrati A, Kaluzky G, Borovsky Y, Paran I (2005) QTLs mapping for fruit size and shape in chromosomes 2 and 4 in pepper and a comparison of the pepper QTL map with that of tomato. Theor Appl Genet 111:437–445. https://doi.org/10.1007/s00122-005-2015-7 Tables Table 1 to 3 are available in the Supplementary Files section. Supplementary Files CSRlike1tables.pdf SuppFigureS18.pdf SupplementaryTablesS113.xlsx SupplementaryTablesS1416.xlsx Cite Share Download PDF Status: Published Journal Publication published 05 Mar, 2026 Read the published version in Theoretical and Applied Genetics → Version 1 posted Editorial decision: Minor revisions 11 Jan, 2026 Reviewers agreed at journal 10 Dec, 2025 Reviewers invited by journal 10 Dec, 2025 Editor assigned by journal 22 Nov, 2025 First submitted to journal 19 Nov, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-8157882","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":558110116,"identity":"8d828cc9-5688-42d7-be22-d36edf4eea46","order_by":0,"name":"Qian Feng","email":"","orcid":"","institution":"University of Georgia College of Agricultural \u0026 Environmental Sciences","correspondingAuthor":false,"prefix":"","firstName":"Qian","middleName":"","lastName":"Feng","suffix":""},{"id":558110117,"identity":"4ed0ee3e-c594-4b57-a2bd-e23c757390a4","order_by":1,"name":"Lara Pereira","email":"","orcid":"","institution":"University of Georgia Center for Applied Genetic Technologies","correspondingAuthor":false,"prefix":"","firstName":"Lara","middleName":"","lastName":"Pereira","suffix":""},{"id":558110118,"identity":"8393e400-bb07-4d94-b66c-aad9391cb090","order_by":2,"name":"Manoj Sapkota","email":"","orcid":"","institution":"University of Georgia College of Agricultural \u0026 Environmental Sciences","correspondingAuthor":false,"prefix":"","firstName":"Manoj","middleName":"","lastName":"Sapkota","suffix":""},{"id":558110119,"identity":"4d5da97c-772f-4b7d-9b5d-205b4a596aef","order_by":3,"name":"Krishna Sai Karnatam","email":"","orcid":"","institution":"West Virginia State University College of Natural Sciences and Mathematics","correspondingAuthor":false,"prefix":"","firstName":"Krishna","middleName":"Sai","lastName":"Karnatam","suffix":""},{"id":558110120,"identity":"2b87396c-fb45-4a28-8744-902f065914e3","order_by":4,"name":"Yanbing Wang","email":"","orcid":"","institution":"University of Georgia Center for Applied Genetic Technologies","correspondingAuthor":false,"prefix":"","firstName":"Yanbing","middleName":"","lastName":"Wang","suffix":""},{"id":558110121,"identity":"eed460bd-033a-4d8f-8393-0029bbd30031","order_by":5,"name":"Padma Nimmakayala","email":"","orcid":"","institution":"West Virginia State University College of Natural Sciences and Mathematics","correspondingAuthor":false,"prefix":"","firstName":"Padma","middleName":"","lastName":"Nimmakayala","suffix":""},{"id":558110122,"identity":"48ef1bb2-0c31-4ab4-a25b-8a424f5e8286","order_by":6,"name":"Umesh Reddy","email":"","orcid":"","institution":"West Virginia State University College of Natural Sciences and Mathematics","correspondingAuthor":false,"prefix":"","firstName":"Umesh","middleName":"","lastName":"Reddy","suffix":""},{"id":558110123,"identity":"c66b94a2-c485-4bd0-b19c-a2911115194e","order_by":7,"name":"Esther van der Knaap","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAwElEQVRIiWNgGAWjYJACCQaGBAZ+CJuZBC2SDSRrMThArBaD42cP3vi4Jy3P+Eb6xQ8MFdaJDQS1nMlLtpzxLKfY7EZOsQTDmXTCWiQbcsykeQ5UJG67kZMgwdh2mAgt/W/MpP8AtWyekZP8g/EfEVr4JYC2MBzISdwgkX5MgrGBKC1vjC17DqQlzjjzhs0i4Vi6MUEtbPw5hjd+HEhO7G9Pf3zjQ421LEEtSIDHABg9pAH2ByRqGAWjYBSMgpECAAdUQfqAm+XBAAAAAElFTkSuQmCC","orcid":"https://orcid.org/0000-0003-4963-7427","institution":"University of Georgia College of Agricultural and Environmental Sciences","correspondingAuthor":true,"prefix":"","firstName":"Esther","middleName":"van der","lastName":"Knaap","suffix":""}],"badges":[],"createdAt":"2025-11-19 17:59:16","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-8157882/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-8157882/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1007/s00122-026-05177-x","type":"published","date":"2026-03-05T15:58:41+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":98433681,"identity":"fcb862f4-21a9-4d1d-af92-daf49f82c722","added_by":"auto","created_at":"2025-12-17 16:51:01","extension":"xml","order_by":3,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":11697,"visible":true,"origin":"","legend":"","description":"","filename":"taagTAAGD2501072.xml","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/111c04e2973fd77da06825cb.xml"},{"id":98433376,"identity":"c1900abb-7483-4a16-a55f-c2f727a8d924","added_by":"auto","created_at":"2025-12-17 16:50:41","extension":"xml","order_by":4,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":1170,"visible":true,"origin":"","legend":"","description":"","filename":"TAAGD250107219924.go.xml","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/eb546adaab8a4f61c9d33813.xml"},{"id":98433358,"identity":"c71ee52f-07ac-4f24-93b3-3893aff70da3","added_by":"auto","created_at":"2025-12-17 16:50:41","extension":"xml","order_by":5,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":797,"visible":true,"origin":"","legend":"","description":"","filename":"TAAGD2501072Import.xml","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/a180f4aff9c6c2ac02221fc4.xml"},{"id":98433723,"identity":"e2f5fc08-c9cd-4cfe-88d0-a8a310cd3dce","added_by":"auto","created_at":"2025-12-17 16:51:05","extension":"xml","order_by":9,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":162406,"visible":true,"origin":"","legend":"","description":"","filename":"TAAGD25010720enriched.xml","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/0d89b9dc4f1e74cd02dee981.xml"},{"id":98236304,"identity":"9349e840-9e34-4183-9c36-9f6ff7514212","added_by":"auto","created_at":"2025-12-15 14:36:49","extension":"pdf","order_by":10,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":3169063,"visible":true,"origin":"","legend":"","description":"","filename":"CSRlike1figures.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/72626f41fb135a10fcd84efe.pdf"},{"id":98236307,"identity":"c25d7017-2402-4d78-94db-657569ab7823","added_by":"auto","created_at":"2025-12-15 14:36:49","extension":"xml","order_by":11,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":160004,"visible":true,"origin":"","legend":"","description":"","filename":"TAAGD25010720structuring.xml","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/59fbc895ddabd221fe249324.xml"},{"id":98433097,"identity":"4926d656-1311-4f1a-b2b6-ba9bfe88ba27","added_by":"auto","created_at":"2025-12-17 16:50:15","extension":"html","order_by":12,"title":"","display":"","copyAsset":false,"role":"acdc-reference","size":177313,"visible":true,"origin":"","legend":"","description":"","filename":"earlyproof.html","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/31cc7215a21d5f57bf168dd4.html"},{"id":98236290,"identity":"87ce11ba-285f-4daa-919e-5e162df75820","added_by":"auto","created_at":"2025-12-15 14:36:47","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":627327,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"CSRlike1figures1.png","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/ef3db080a2e500fbf8db6f48.png"},{"id":98433259,"identity":"513d850d-e5a3-4184-b541-74d9dd1019f7","added_by":"auto","created_at":"2025-12-17 16:50:31","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":345450,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"CSRlike1figures2.png","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/72d6184a45dde68bd0ad4383.png"},{"id":98434150,"identity":"ad4993c0-b9c9-4d45-a939-77878a00e67e","added_by":"auto","created_at":"2025-12-17 16:51:35","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":656313,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"CSRlike1figures3.png","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/71824d789c44ced04dfbba87.png"},{"id":98433202,"identity":"60fe8b12-a98f-4402-a94a-aed86b408345","added_by":"auto","created_at":"2025-12-17 16:50:26","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":306171,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"CSRlike1figures4.png","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/cba9cf6f94fed69b644e6d6e.png"},{"id":98236302,"identity":"f8cdb44e-df19-4379-b438-bb5bf7ad318e","added_by":"auto","created_at":"2025-12-15 14:36:49","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":688895,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"CSRlike1figures5.png","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/5fc3a8b4b98a3cfc45d3993f.png"},{"id":98432398,"identity":"65a6b118-0cfa-42b2-bf02-99730f608fdc","added_by":"auto","created_at":"2025-12-17 16:49:30","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":456764,"visible":true,"origin":"","legend":"\u003cp\u003eSee image above for figure legend\u003c/p\u003e","description":"","filename":"CSRlike1figures6.png","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/4d2d3d441d2ecbf227c34308.png"},{"id":104251905,"identity":"37e3b183-ea1a-46d5-90b0-ee48a42551ae","added_by":"auto","created_at":"2026-03-09 16:15:59","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3759536,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/2cb50fdb-332f-4bfd-8dd1-5ae4782de609.pdf"},{"id":98236299,"identity":"f7f44453-4b10-4df4-b058-947445b1c710","added_by":"auto","created_at":"2025-12-15 14:36:49","extension":"pdf","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":148558,"visible":true,"origin":"","legend":"","description":"","filename":"CSRlike1tables.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/2bd17b2ab00c5251b0e06534.pdf"},{"id":98434370,"identity":"24cebedc-5b16-4248-8355-9ecb03bf162e","added_by":"auto","created_at":"2025-12-17 16:52:01","extension":"pdf","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":4872086,"visible":true,"origin":"","legend":"","description":"","filename":"SuppFigureS18.pdf","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/c95db343621bda227492dde8.pdf"},{"id":98236297,"identity":"30a92dfc-3345-4f4a-ae26-9d41d3145d6c","added_by":"auto","created_at":"2025-12-15 14:36:49","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":167088,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTablesS113.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/17dcf1ed7407027ef0993ae6.xlsx"},{"id":98433157,"identity":"21ff0155-0696-4639-a2ee-02cb26da7235","added_by":"auto","created_at":"2025-12-17 16:50:21","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":110671,"visible":true,"origin":"","legend":"","description":"","filename":"SupplementaryTablesS1416.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-8157882/v1/ae6f890907f8efe11de75836.xlsx"}],"financialInterests":"","formattedTitle":"Fruit Weight Regulation by a Paralog of Cell Size Regulator (CSR) in Tomato and Other Crops","fulltext":[{"header":"key Message","content":"\u003cp\u003eA paralog of Cell Size Regulator (CSR), CSR-like1, underlies the novel fw6.2 QTL in tomato. The gene and locus regulate fruit weight by increasing pericarp cell size and its function on fruit weight appears to be conserved in other crops.\u003c/p\u003e"},{"header":"Introduction","content":"\u003cp\u003ePlant domestication has led to the transformation from wild species into high-yielding and nutritionally valuable crops. Genetic modifications through repeated selection and cultivation have reshaped the plant morphology, physiology, and development to suit human needs (Doebley et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2006\u003c/span\u003e). Increases in fruit or grain size is one of the key traits that differentiate the domesticated crops from their wild progenitors, collectively referred to as \u0026ldquo;domestication syndrome\u0026rdquo; (Doebley et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Gross and Olsen \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). For tomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e), huge variation in fruit size and shape is evident in the cherry-sized type \u003cem\u003eS. lycopersicum\u003c/em\u003e var \u003cem\u003ecerasiforme\u003c/em\u003e (SLC\u003cem\u003e)\u003c/em\u003e and fully domesticated type \u003cem\u003eS. lycopersicum\u003c/em\u003e var. \u003cem\u003elycopersicum\u003c/em\u003e (SLL) compared to its wild relative, \u003cem\u003eS. pimpinellifolium\u003c/em\u003e (SP) (Tanksley \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2004\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eSeveral studies have revealed insights regarding the complex domestication history of tomato resulting in different models. One model illustrated a two-step process (Razifard et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e): SP first originated in the Andean region of South America and gave rise to the semi-domesticated SLC. The more domesticated South American SLC groups then migrated northwards when some domestication traits, including fruit size, were lost. A second round of selection took place in Mesoamerica before the emergence of the fully domesticated SLL. A recent study suggested a more complex trajectory (Blanca et al. 2021): SP expanded much further northwards into Mesoamerica where it evolved into wild SLC progenitor species. Some SLCs subsequently migrated back to South America and admixed with SP in Ecuador and Peru. Ecuadorian and Peruvian SLC then underwent another northward migration to further evolve into fully domesticated SLL in Mexico.\u003c/p\u003e\u003cp\u003eFruit weight is a character controlled by multiple quantitative trait loci (QTL) (Paran and van der Knaap \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Though over twenty QTL have been mapped in tomato (Causse et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Grandillo et al. \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e1999\u003c/span\u003e; Illa-Berenguer et al. \u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Pereira et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2021b\u003c/span\u003e), only three fruit weight genes have been cloned: \u003cem\u003efw2.2\u003c/em\u003e, \u003cem\u003efw3.2\u003c/em\u003e and \u003cem\u003efw11.3\u003c/em\u003e. \u003cem\u003eFw2.2\u003c/em\u003e underlies \u003cem\u003eCell Number Regulator\u003c/em\u003e (\u003cem\u003eCNR\u003c/em\u003e) (Frary et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2000\u003c/span\u003e), a negative cell division regulator with a change in transcription dynamic that is associated with lower cell division rate (Cong et al. \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). The putative casual mutation is thought to lie in the promoter region since the coding region is highly conserved in small-fruit allele and large-fruit allele (Frary et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2000\u003c/span\u003e). \u003cem\u003eFw3.2\u003c/em\u003e (\u003cem\u003eSlKLUH\u003c/em\u003e) encodes a P450 enzyme of the CYP78A subfamily that regulates cell number in the fruit (Chakrabarti et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). A tandem duplication of around 50kb containing \u003cem\u003eSlKLUH\u003c/em\u003e leads to higher expression of \u003cem\u003eSlKLUH\u003c/em\u003e and an increase in fruit weight. (Alonge et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). \u003cem\u003eFw11.3\u003c/em\u003e encodes \u003cem\u003eCell Size Regulator\u003c/em\u003e (\u003cem\u003eCSR\u003c/em\u003e) and is the only fruit weight gene known to affect cell size (Mu et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The derived allele (\u003cem\u003eCSR-D\u003c/em\u003e) has a 3\u0026rsquo; 1.4kb deletion that affects the coding region as well as higher expression throughout fruit development compared to the wildtype allele (\u003cem\u003eCSR-WT\u003c/em\u003e) (Mu et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In addition to the fruit weight loci, two locule number loci, \u003cem\u003elc\u003c/em\u003e (Mu\u0026ntilde;os et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) and \u003cem\u003efas\u003c/em\u003e (Cong et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Xu et al. \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2015\u003c/span\u003e), can affect the fruit weight in tomato through regulating the number of locules in the fruit.\u003c/p\u003e\u003cp\u003eHere, we report the fine-mapping and identification of two linked fruit weight QTL in tomato, \u003cem\u003efw6.1\u003c/em\u003e and \u003cem\u003efw6.2\u003c/em\u003e, and the cloning and characterization of a new fruit weight gene \u003cem\u003eCSR-like1\u003c/em\u003e at the second locus. Similar to its paralog \u003cem\u003eCSR\u003c/em\u003e, \u003cem\u003eCSR-like1\u003c/em\u003e also controls the fruit mass through regulating the pericarp cell size. Yet different from \u003cem\u003eCSR\u003c/em\u003e, \u003cem\u003eCSR-like1\u003c/em\u003e underwent selection in rather the early stages of domestication and was much higher expressed in fruit tissues. Transgenic plants that downregulated \u003cem\u003eCSR-like1\u003c/em\u003e expression showed decreased fruit weight that developed late during fruit growth, as well as effects on other traits such as ripening. We also present genetic evidence on the function of a pepper ortholog of \u003cem\u003eCSR-like1\u003c/em\u003e on fruit weight. The findings imply a conserved function of \u003cem\u003eCSR-like1\u003c/em\u003e in fruit size regulation in Solanaceae crops.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e\u003ch2\u003ePlant materials\u003c/h2\u003e\u003cp\u003eThe 166 Varitome collection accessions have been described previously (Mata-Nicol\u0026aacute;s et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Razifard et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The plants for the GWAS and mapping populations were grown at University of Georgia\u0026rsquo;s Horticulture Research Farm (Athens, GA, USA), Vidalia Onion and Vegetable Research Center (Lyons, GA, USA), Georgia Mountain Research and Education Center (Blairsville, GA, USA) and University of Florida\u0026rsquo;s North Florida Research and Education Center-Suwannee Valley (Live Oak, FL, USA). Population development, and phenotypic characterizations were performed in the University of Georgia (Athens, GA, USA) greenhouses where plants were grown under standard conditions.\u003c/p\u003e\u003c/div\u003e\n\u003ch3\u003eVariant calling and genome-wide association study (GWAS)\u003c/h3\u003e\n\u003cp\u003eShort-read sequencing data for the Varitome tomato accessions were retrieved from NCBI (BioProject PRJNA454805) and aligned to the SL4.0 reference genome. The raw reads were aligned and processed for Variant calling for SNPs and INDELs (insertions and deletions) using \u003cb\u003et\u003c/b\u003ehe pipeline as previously described (Pereira et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2021a\u003c/span\u003e). Variants were filtered to retain only biallelic sites with missingness\u0026thinsp;\u0026lt;\u0026thinsp;5%, minor allele frequency (MAF)\u0026thinsp;\u0026ge;\u0026thinsp;5%, and mapping quality\u0026thinsp;\u0026ge;\u0026thinsp;30 using bcftools (Danecek et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). After filtering, 659,002 INDELs were retained. For computational efficiency, SNPs were further thinned to one SNP per kilobase using VCFtools (Danecek et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), resulting in a final set of 609,034 SNPs. SNP genotypes were exported from VCF files using the R/vcfR package (Knaus and Gr\u0026uuml;nwald \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). INDELs were encoded as a presence/absence matrix and treated as pseudo-SNPs, with the reference allele representing absence and the alternate allele representing presence of the INDEL. Association mapping was performed using GWASpoly (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://jendelman.github.io/GWASpoly/GWASpoly.html\u003c/span\u003e\u003cspan address=\"https://jendelman.github.io/GWASpoly/GWASpoly.html\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (Rosyara et al. \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2016\u003c/span\u003e) under a diploid setting (ploidy\u0026thinsp;=\u0026thinsp;2). The diplo-additive model was used as the primary framework, where genotypes are encoded as 0/1/2 copies with heterozygotes intermediate between homozygotes. This model was chosen for its simplicity, statistical power, and biological interpretability. Although other models were tested, results were broadly consistent; therefore, only the diploid additive model is presented. Population structure was controlled using the first three principal components, and kinship was modeled with a leave-one-chromosome-out (LOCO) approach (Cheng et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Genome-wide significance thresholds were established using the Bonferroni correction at α\u0026thinsp;=\u0026thinsp;0.05.\u003c/p\u003e\u003cp\u003e\u003cb\u003eAnalysis of Orthologous\u003c/b\u003e \u003cb\u003eCSR-like1\u003c/b\u003e \u003cb\u003eGene Underlying Fruit Weight Variation in the\u003c/b\u003e \u003cb\u003eCapsicum\u003c/b\u003e \u003cb\u003eGenus\u003c/b\u003e\u003c/p\u003e\u003cp\u003eA total of 594 accessions of \u003cem\u003eCapsicum\u003c/em\u003e spp., comprising 82 \u003cem\u003eC. annuum\u003c/em\u003e, 35 \u003cem\u003eC. annuum var. glabriusculum\u003c/em\u003e, 243 \u003cem\u003eC. baccatum\u003c/em\u003e, and 234 \u003cem\u003eC. chinense\u003c/em\u003e, were obtained from the USDA\u0026ndash;ARS Germplasm Resources Information Network (GRIN), Plant Genetic Resources Conservation Unit (Griffin, GA, USA). These accessions represented a wide range of geographical origins and fruit weight variation. Plants were cultivated for the three seasons in a randomized block design with three replications, and phenotypic data were recorded from five plants per accession in each replication. Genomic DNA was extracted from young leaf tissue, and genotyping-by-sequencing (GBS) was performed following the protocol described by Elshire et al. (\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2011\u003c/span\u003e) using the Illumina HiSeq 2500 platform. The resulting sequence reads were aligned to the \u003cem\u003eCapsicum annuum\u003c/em\u003e cv. CM334 v1.55 reference genome (Kim et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://peppergenome.snu.ac.kr/\u003c/span\u003e\u003cspan address=\"http://peppergenome.snu.ac.kr/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). SNP calling and filtering were performed according to Reddy et al. (\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e2025\u003c/span\u003e), retaining 45,987 high-quality SNPs with a minor allele frequency (MAF)\u0026thinsp;\u0026ge;\u0026thinsp;0.05 and call rate\u0026thinsp;\u0026ge;\u0026thinsp;90%. Population structure was assessed through principal component analysis (PCA) using GAPIT 3.0 (Wang and Zhang \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), and admixture proportions were inferred with ADMIXTURE v1.3 (Alexander et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) for K\u0026thinsp;=\u0026thinsp;1\u0026ndash;10. Genome-wide association studies (GWAS) for fruit weight were conducted in GAPIT 3.0 (Wang and Zhang \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) using both the mixed linear model (MLM) and the Bayesian-information and linkage-disequilibrium iteratively nested keyway (BLINK) model to ensure robustness of detection.\u003c/p\u003e\n\u003ch3\u003eBiparental mapping population development, finemapping and progeny testing\u003c/h3\u003e\n\u003cp\u003eFive F\u003csub\u003e2\u003c/sub\u003e biparental populations were generated to validate \u003cem\u003efw6.1\u003c/em\u003e and \u003cem\u003efw6.2\u003c/em\u003e (Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). The populations were fixed for the other known fruit weight and shape genes. To fine map the \u003cem\u003efw6.1\u003c/em\u003e locus, recombinant plants with one recombination event between marker 18EP962 and 19EP629 (Supplementary Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e) were evaluated for fruit weight in an F\u003csub\u003e4\u003c/sub\u003e population 20S156 (N\u0026thinsp;=\u0026thinsp;202). Interval mapping results was plotted using R/qtl package (map.funciton\u0026thinsp;=\u0026thinsp;kosambi, model\u0026thinsp;=\u0026thinsp;normal) (Broman et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2003\u003c/span\u003e). Quantile normalization was performed for fruit weight data using qqnorm function in R. The logarithm of odds (LOD) threshold of α\u0026thinsp;=\u0026thinsp;0.01 was calculated using permutation tests with 1000 permutations. To fine map \u003cem\u003efw6.1\u003c/em\u003e and \u003cem\u003efw6.2\u003c/em\u003e separately, we generated F\u003csub\u003e6\u003c/sub\u003e and F\u003csub\u003e7\u003c/sub\u003e recombinant population from a cross between large-fruited BGV06232 and small-fruited BGV008225. Population 22S33 (N\u0026thinsp;=\u0026thinsp;137) segregated for \u003cem\u003efw6.1\u003c/em\u003e and population 22S30 (N\u0026thinsp;=\u0026thinsp;88) segregated for \u003cem\u003efw6.2\u003c/em\u003e. Family 22S33 was fixed at BGV006232 allele between marker 21EP44 and 18EP327 for \u003cem\u003efw6.2\u003c/em\u003e. Family 22S30 was fixed at BGV008225 allele between marker 18EP962 and 21EP41 for \u003cem\u003efw6.1.\u003c/em\u003e Nine recombinant plants from different generations were progeny tested. Pedigree information for fine mapping \u003cem\u003efw6.1\u003c/em\u003e and \u003cem\u003efw6.2\u003c/em\u003e is shown in Supplementary Fig. \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e.\u003c/p\u003e\u003cp\u003eTo genotype the plants, Kompetitive Allele Specific PCR (KASP) markers were designed using the Primer Express\u0026reg; Software version 3.0.1 (Applied Biosystems, Carlsbad, CA) as described in Topcu et al. (\u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2021\u003c/span\u003e) and derived cleaved amplified polymorphic sequences (dCAPS) markers were designed using the tool indCAPS (Hodgens et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Primer information is shown in Supplementary Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cb\u003eKnockout of\u003c/b\u003e \u003cb\u003eCSR-like1\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo utilize CRISPR-\u003cem\u003eCas9\u003c/em\u003e editing to create knockout mutations of \u003cem\u003eCSR-like1\u003c/em\u003e, a single guide RNA was designed using CRISPR-P (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://crispr.hzau.edu.cn/cgi-bin/CRISPR/CRISPR\u003c/span\u003e\u003cspan address=\"http://crispr.hzau.edu.cn/cgi-bin/CRISPR/CRISPR\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) (Supplementary Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e) and cloned into p201N vector (Addgene plasmid #59175). The construct was transformed into BGV007931 (SLC) from the Varitome collection and a breeding line Fla.8059 (SLL) (Scott et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2008\u003c/span\u003e) using standard transformation procedures (Van Eck et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). The transformation yielded two independent T\u003csub\u003e0\u003c/sub\u003es in BGV007931, and three independent T\u003csub\u003e0\u003c/sub\u003es in Fla. 8059 background (Supplementary Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e). Primers for genotyping the presence of transgene and the mutation are listed in Supplementary Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e.\u003c/p\u003e\u003cp\u003e\u003cb\u003eDownregulation of\u003c/b\u003e \u003cb\u003eCSR-like1\u003c/b\u003e\u003c/p\u003e\u003cp\u003eOne artificial microRNA (amiRNA) targeting the coding region of \u003cem\u003eCSR-like1\u003c/em\u003e was designed using WMD3 Web MicroRNA Designer (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://wmd3.weigelworld.org/\u003c/span\u003e\u003cspan address=\"http://wmd3.weigelworld.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). Target search with maximum 5 mismatches of the selected amiRNA sequence (TCTTGAGTCGAGTTGCGTCAT) showed \u003cem\u003eCSR-like1\u003c/em\u003e as the only target. The amiRNA sequence and its pair amiRNA* (ATAACGCAACTCGTCTCAAGT) were cloned into the Arabidopsis miR319a precursor backbone. The amiRNA precursor was synthesized by Azenta Life Sciences (South Plainfield, NJ, USA) and cloned into pKYLX71 vector at the \u003cem\u003eXhoI\u003c/em\u003e and \u003cem\u003eSacI\u003c/em\u003e restriction enzyme sites. The construct was transformed into the large-fruited mapping parent BGV006232. Four T\u003csub\u003e0\u003c/sub\u003es were obtained and verified for the presence of transgene using primers 20EP672/20EP673 (Supplementary Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). The BC\u003csub\u003e1\u003c/sub\u003eF\u003csub\u003e1\u003c/sub\u003e families 24S156, 25S158, 25S159 and 25S160 were used for phenotypic evaluations. Pedigree information is shown in Supplementary Fig. \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e.\u003c/p\u003e\n\u003ch3\u003ePhenotypic evaluations\u003c/h3\u003e\n\u003cp\u003eThe mapped interval of \u003cem\u003efw6.2\u003c/em\u003e spanned 374kb between marker 21EP56 and 24EP416. We generated a \u003cem\u003efw6.2\u003c/em\u003e NIL family 24S155 in which \u003cem\u003efw6.2\u003c/em\u003e-D plants carry the large-fruited derived allele from BGV006232 and \u003cem\u003efw6.2\u003c/em\u003e-WT plants carry the wildtype allele from BGV008225. For \u003cem\u003efw6.2\u003c/em\u003e NIL family 24S155 and the amiRNA transgenic family 24S156, 6 to 10 ovaries per plant were collected and scanned using a flatbed scanner. Ovary size was measured using Fiji software (Schindelin et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Flowers were hand-pollinated and tagged for additional fruit phenotyping. Per plant, five to 10 of the largest fruits at turning or red ripe stage were cut at the equatorial plane along the medio-lateral axis and scanned. The images were analyzed using Tomato Analyzer 4.0 (Rodr\u0026iacute;guez et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) to obtain the total cross-section area, pericarp area, pericarp area ratio, columella area and columella area ratio. Fruit weight at various developmental stages was also measured in grams: 3, 5, 10, 15, 20, 25 DPA with three to four replicates per plant; mature green and red ripe stage consisted of five to 10 replicates per plant. Pericarp thickness, cell layer and mesocarp cell size were measured following the previously established protocols (Mu et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Mesocarp cell size was calculated as the mean of the five largest cells in a pericarp slice. The number of days between anthesis to red ripe was recorded for the amiRNA transgenic families 24S156, 25S158, 25S159 and 25S160. Plant height at 55 days after sowing was measured for transgenic families 25S158, 25S159 and 25S160.\u003c/p\u003e\u003cp\u003e\u003cb\u003eHaplotype analysis of\u003c/b\u003e \u003cb\u003eCSR-like1\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe genetic diversity of \u003cem\u003eCSR-like1\u003c/em\u003e in the Varitome collection was analyzed following the previously described protocol (Pereira et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e2021a\u003c/span\u003e). Briefly, SNPs and INDELs were extracted from within \u003cem\u003eCSR-like1\u003c/em\u003e as well as 3 kb upstream of the start site and 1 kb downstream of the termination site with VCFTools (Danecek et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). The locations and functions of the variants were annotated using SnpEff (Cingolani et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2012\u003c/span\u003e) with a reference SL4.0 tomato reference genome (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://solgenomics.net/\u003c/span\u003e\u003cspan address=\"https://solgenomics.net/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The haplotype heatmap was generated using the R package \u0026ldquo;pheatmap\u0026rdquo; (Kolde 2019), accompanied with the phylogeny of the accessions (Razifard et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). The fruit weight of each accession was classified into three groups: small (below 3 grams), medium (3\u0026ndash;20 g) and big (above 20 g). The \u003cem\u003ep\u003c/em\u003e-values of pairwise comparison among haplotype clusters were conducted using the R package \u0026ldquo;emmeans\u0026rdquo; (Lenth 2022) and the Tukey test with a significance threshold at 0.05 was used. Single variant association with fruit weight and pericarp cell size was calculated by Kruskal\u0026ndash;Wallis test and the \u003cem\u003ep\u003c/em\u003e-values were adjusted by the Benjamini\u0026ndash;Hochberg method to control the False Discovery Rate (FDR). The haplotype distribution of \u003cem\u003eCSR-like1\u003c/em\u003e was visualized in a geographic map as described in Sapkota et al. (\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2023\u003c/span\u003e) using R packages \u0026ldquo;rnaturalearth\u0026rdquo; (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://CRAN.R-project.org/package=rnaturalearth\u003c/span\u003e\u003cspan address=\"https://CRAN.R-project.org/package=rnaturalearth\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and \u0026ldquo;ggspatial\u0026rdquo; (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://CRAN.R-project.org/package=ggspatial\u003c/span\u003e\u003cspan address=\"https://CRAN.R-project.org/package=ggspatial\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The latitude and longitude of collection sites were retrieved from Razifard et al. (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe haplotypes of \u003cem\u003eCSR-like1\u003c/em\u003e in pepper were identified using five GBS SNPs (S06_227195491, S06_227195529, S06_227195579, S06_227195589, and S06_227195619) and the pairwise comparison of fruit weight among haplotypes were performed using the same method as for tomato haplotype analysis.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eIdentification and fine mapping of\u003c/b\u003e \u003cb\u003efw6.1\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003efw6.2\u003c/b\u003e \u003cb\u003ein tomato\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTo identify novel genes regulating fruit weight in tomato, a GWAS analysis was performed using the Varitome collection which included 27 wild SP, 121 semi domesticated SLC and 18 ancestral landrace SLL accessions. A total of 15 fruit weight GWAS loci using SNPs and INDELs were identified in this study, which led to six unique fruit weight QTLs on chromosomes 2, 3, 6, 11, and 12, and another six QTLs that were scattered on chromosome 1 (Fig.\u0026nbsp;1a,b; Supplementary Table S4). The \u003cem\u003eGWAS_fw2.2\u003c/em\u003e locus is likely associated with the known \u003cem\u003efw2.2\u003c/em\u003e, whereas \u003cem\u003eGWAS_fw11.1\u003c/em\u003e is likely associated with the linked loci \u003cem\u003efw11.3\u003c/em\u003e and \u003cem\u003efas\u003c/em\u003e. \u003cem\u003eGWAS_fw3.2\u003c/em\u003e is likely associated with \u003cem\u003efw3.2\u003c/em\u003e, however, the variant was 5 Mb from the known fruit weight gene. Among the novel GWAS loci, \u003cem\u003eGWAS_fw6.1\u003c/em\u003e has two linked INDEL markers associated with fruit weight (ISL4.0ch06_44805731 and ISL4.0ch06_45074906) and was further characterized in this study.\u003c/p\u003e\u003cp\u003eTo validate the newly identified \u003cem\u003efw6.1\u003c/em\u003e locus, we evaluated a total of five F\u003csub\u003e2\u003c/sub\u003e biparental populations using flanking markers approximately 1\u0026ndash;2 Mb upstream and downstream of the significant GWAS loci. The parental selection of the F\u003csub\u003e2\u003c/sub\u003e populations was based on the predicted variants from the GWAS and the estimated effect of the QTL on fruit weight. For all F\u003csub\u003e2\u003c/sub\u003e populations, the two parents of each population were fixed at the known tomato fruit weight and fruit shape genes (Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). \u003cem\u003eGWAS_fw6.1\u003c/em\u003e was confirmed in the four F\u003csub\u003e2\u003c/sub\u003e populations that segregated at the \u003cem\u003eGWAS_fw6.1\u003c/em\u003e locus, namely 18S33, 18S39,18S40 and 18S133 (Supplementary Table S5). The QTL showed a significant additive effect with a small, nonsignificant dominance deviation, indicating primarily additive gene action with partial dominance (Supplementary Table S5). The marker association was most significant in 18S39, and therefore this population was used to fine map the locus. Family 18S39 was derived from a cross between an Ecuadorian accession (BGV006232) and a Peruvian SLC accession (BGV008225), and the two parental accessions exhibited a 4-fold difference in fruit weight (Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eTo narrow the interval of \u003cem\u003efw6.1\u003c/em\u003e, we screened for recombinant plants using self-pollinated progeny from the 18S39 F\u003csub\u003e2\u003c/sub\u003e population. Linkage mapping indicated the presence of two linked QTLs that were significantly associated with fruit weight on chromosome 6 (Fig.\u0026nbsp;1c). \u003cem\u003efw6.1\u003c/em\u003e was flanked by marker 18EP962 (SL4.0ch06:39930114) and 20EP567 (SL4.0ch06:42662777\u003cem\u003e)\u003c/em\u003e, spanning a 2.73Mb interval, whereas \u003cem\u003efw6.2\u003c/em\u003e was flanked by marker 20EP1256 (SL4.0ch06:43033158) and 19EP629 (SL4.0ch06:44319744), spanning a 1.29Mb interval. BGV006232 carried the large-fruited derived allele at both \u003cem\u003efw6.1\u003c/em\u003e and \u003cem\u003efw6.2\u003c/em\u003e, as shown by the allelic effects of the highest associated markers at each QTL (Supplementary Fig. \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eTo map each locus further, we selected recombinant plants that were segregating at one locus while fixed at the other. By evaluating two recombinant populations (Fig.\u0026nbsp;2a,b) and nine progeny testing families (Fig.\u0026nbsp;2c; Supplementary Table S6), we narrowed \u003cem\u003efw6.1\u003c/em\u003e to a 1.03 Mb region flanked by marker 22EP373 (SL4.0ch06:40416852) and 22EP37 (SL4.0ch06:41451757), and \u003cem\u003efw6.2\u003c/em\u003e to a 374 kb region between marker 21EP56 (SL4.0ch06:43262334) and 24EP416 (SL4.0ch06:43636481).\u003c/p\u003e\u003cp\u003eTo carefully analyze fruit phenotypes that are controlled by \u003cem\u003efw6.2\u003c/em\u003e and gain insights into its mechanism to regulate fruit weight, we used NILs from an F\u003csub\u003e7:8\u003c/sub\u003e plant 22S310-30 in which \u003cem\u003efw6.1\u003c/em\u003e was fixed for the derived BGV006232 allele. At \u003cem\u003efw6.2\u003c/em\u003e, \u003cem\u003efw.6.2-D\u003c/em\u003e NILs carried the derived BGV006232 allele and \u003cem\u003efw6.2-WT\u003c/em\u003e NILs carried the wildtype BGV008225 allele. Fruit weight was significantly different between the two genotypes (Fig.\u0026nbsp;3a; Table\u0026nbsp;1), whereas ovary size was not affected (Table\u0026nbsp;1). The difference in fruit weight started to manifest itself during the development of the fruit 25 days after pollination (Fig.\u0026nbsp;3a). We conducted additional morphological and cytological measurements (Table\u0026nbsp;2). \u003cem\u003eFw6.2\u003c/em\u003e-D NILs showed a larger total fruit and pericarp area than \u003cem\u003efw6.2\u003c/em\u003e-WT NILs. On the other hand, there was no significant segregation for pericarp area ratio, columella area, and columella area ratio. This suggests that the fruit weight increase in the \u003cem\u003efw6.2\u003c/em\u003e-D NILs was primarily driven by the enlargement of the pericarp. Moreover, the pericarp cell size was significantly larger in the \u003cem\u003efw6.2-D\u003c/em\u003e NILs, while the two genotypes showed a similar number of pericarp cell layers (Fig.\u0026nbsp;3b; Table\u0026nbsp;2). Therefore, \u003cem\u003efw6.2\u003c/em\u003e is likely to affect fruit weight by regulating the cell size in the pericarp.\u003c/p\u003e\u003cp\u003e\u003cb\u003eCandidate gene at\u003c/b\u003e \u003cb\u003efw6.2\u003c/b\u003e: \u003cb\u003eCSR-like1\u003c/b\u003e\u003c/p\u003e\u003cp\u003eSince \u003cem\u003efw6.2\u003c/em\u003e showed the highest PVE and smallest introgression, we evaluated the genes in the 374 kb interval in the tomato reference SL4.0 genome (Supplementary Table S7). Among the 51 genes, \u003cem\u003eSolyc06g073940\u003c/em\u003e stood out as the paralog of the known fruit weight gene \u003cem\u003eCSR\u003c/em\u003e controlling pericarp cell size, \u003cem\u003eCSR-like1\u003c/em\u003e (Mu et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The sequence analysis of \u003cem\u003eCSR-like1\u003c/em\u003e showed that the BGV006232 and BGV008225 alleles carried no nucleotide polymorphisms in the protein coding region, and instead three SNPs in the 5\u0026rsquo; untranslated region (UTR), one SNP in the 3\u0026rsquo;UTR, and 16 SNPs in the putative 3kb regulatory region upstream of \u003cem\u003eCSR-like1\u003c/em\u003e.\u003c/p\u003e\u003cp\u003eTo validate the function of \u003cem\u003eCSR-like1\u003c/em\u003e in fruit weight, we first sought to create knockout mutants using the CRISPR-\u003cem\u003eCas9\u003c/em\u003e gene editing approach in two distinct accessions, a small-fruited SLC BGV007931 and a large-fruited SLL Fla. 8095 accession (Scott et al. \u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). We recovered two independent T\u003csub\u003e0\u003c/sub\u003es in BGV007931 and three independent T\u003csub\u003e0\u003c/sub\u003es in Fla. 8095 backgrounds, respectively, but all five T\u003csub\u003e0\u003c/sub\u003es carried in frame deletions of 6 bp or 12 bp (Supplementary Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e). Despite the CRISPR-edited alleles were in-frame and not nulls, we evaluated the fruit weight variation in these lines (Supplementary Fig. S4). As expected, the in-frame edited alleles did not show consistent fruit weight differences compared to wildtype. We concluded that \u003cem\u003eCSR-like1\u003c/em\u003e may play an essential role in plant development such that a complete knockout is likely to be lethal.\u003c/p\u003e\u003cp\u003eWe next sought to downregulate the expression of \u003cem\u003eCSR-like1\u003c/em\u003e using the artificial microRNA (amiRNA) technology, and recovered four T\u003csub\u003e0\u003c/sub\u003e in the large-fruited BGV006232 background. The fruit weight of \u003cem\u003eCSR-like1\u003c/em\u003e-amiRNA plants was between 27% to 43% lower than controls under greenhouse conditions in the transformed lines, including a significant decrease in ovary size (Table\u0026nbsp;1; Supplementary Table S8). The pericarp area was significantly decreased in \u003cem\u003eCSR-like1\u003c/em\u003e-amiRNA plants resulting from reduced cell size (Fig.\u0026nbsp;3d; Table\u0026nbsp;2). We also observed slower fruit development in \u003cem\u003eCSR-like1\u003c/em\u003e-amiRNA plants, starting as early as 5DPA (Fig.\u0026nbsp;3c), and these plants required approximately 8\u0026ndash;12 days more to reach the red ripe stage compared to \u003cem\u003eCSR-like1\u003c/em\u003e-WT plants (Table\u0026nbsp;3). No vegetative effects were observed as the plants looked normal (Supplementary Table S8; Supplementary Fig. S5).\u003c/p\u003e\u003cp\u003e\u003cb\u003eEvolution of\u003c/b\u003e \u003cb\u003eCSR-like1\u003c/b\u003e \u003cb\u003ein tomato domestication\u003c/b\u003e\u003c/p\u003e\u003cp\u003eFruit weight was an important trait for selection during the domestication of most vegetable crops. To investigate the evolution of \u003cem\u003eCSR-like1\u003c/em\u003e during tomato domestication, we explored the genetic diversity at the locus by generating a heatmap containing six haplotype clusters in the Varitome collection (Fig.\u0026nbsp;4a). A total of 88 variants were identified at the locus, of which 12 were INDELs ranging in size from 1 to 9 bp in addition to 76 SNPs (Supplementary Table S9). Most of the variants were located in the regulatory region and the UTRs. Similar to the parents in the mapping population, the coding region of \u003cem\u003eCSR-like1\u003c/em\u003e was highly conserved in the Varitome collection with only 2 SNPs in distantly related accessions. SNP_ SL4.0ch06:43344537 resulted in a missense mutation from proline to leucine at amino acid position 355, while SNP_ SL4.0ch06:43344932 led to a synonymous mutation of glutamine at amino acid position 223. The clustering of haplotype groups was also associated with the phylogenetic groups of the accessions. Most of the SLC and all SLL accessions were found in Cluster I, II, and III. All of the wild tomato SP accessions were in Cluster IV, V and VI, carrying more mutations in the regulatory region and the UTRs. The missense mutation was only found in four accessions (1 SP and 3 SLC) in Cluster VI. We also surveyed an additional accession panel (SLL_CUL) including 73 modern cultivars, landraces and heirlooms (Tieman et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), and assigned their haplotypes using conserved SNPs across Cluster III to VI (Supplementary Table S10). These cultivated accessions also have either haplotype I or II, similar to the ancestral SLL in the Varitome collection (Supplementary Table S10). We will now refer haplotype I and II allele together as \u003cem\u003eCSR-like1\u003c/em\u003e-\u003cem\u003eD\u003c/em\u003e for derived which was most similar to the Heinz 1706 reference genotype, and haplotype III, IV, V, and VI together as \u003cem\u003eCSR-like1\u003c/em\u003e-\u003cem\u003eWT\u003c/em\u003e for wildtype.\u003c/p\u003e\u003cp\u003eFor the two mapping parents of \u003cem\u003efw6.2\u003c/em\u003e, the large-fruited parent BGV006232 carries the \u003cem\u003eCSR-like1\u003c/em\u003e-\u003cem\u003eD\u003c/em\u003e allele (haplotype II) while the small-fruited parent BGV0008225 carries the \u003cem\u003eCSR-like1\u003c/em\u003e-\u003cem\u003eWT\u003c/em\u003e allele (haplotype IV). To further investigate the association between \u003cem\u003eCSR-like1\u003c/em\u003e haplotypes in the entire Varitome collection and fruit traits, we selected only accessions carrying the wildtype \u003cem\u003efw11.3\u003c/em\u003e/\u003cem\u003eCSR\u003c/em\u003e allele since that gene has a large effect on fruit weight and pericarp cell size. The resulting 108 SLC and 27 SP accessions showed that fruit weight and pericarp cell size were larger in the accessions carrying \u003cem\u003eCSR-like1-D\u003c/em\u003e alleles (Fig.\u0026nbsp;4b,c). Similarly, when fixing for \u003cem\u003eCNR\u003c/em\u003e (\u003cem\u003efw2.2\u003c/em\u003e), \u003cem\u003eKLUH\u003c/em\u003e (\u003cem\u003efw3.2\u003c/em\u003e) and all three known fruit weight genes, the \u003cem\u003eCSR-like1\u003c/em\u003e haplotype I and II were always associated with larger fruits and pericarp cells (Supplemental Figure S6), further supporting the notion that this gene is critical in the regulation of fruit weight via increased cell sizes. We also identified four SNPs in the upstream and downstream of \u003cem\u003eCSR-like1\u003c/em\u003e that are exclusively found in \u003cem\u003eCSR-like1\u003c/em\u003e-\u003cem\u003eWT\u003c/em\u003e alleles (red asterisks in Fig.\u0026nbsp;4a). These SNPs are the four most significant variants associated with fruit weight and pericarp cell size (Supplementary Table S11).\u003c/p\u003e\u003cp\u003e\u003cb\u003eCSR-like1\u003c/b\u003e \u003cb\u003eassociated with fruit weight in pepper\u003c/b\u003e\u003c/p\u003e\u003cp\u003eOrthologs of tomato fruit weight genes have been reported as likely candidate genes underlying fruit weight QTLs in other Solanaceae crops including pepper and eggplant (Rinaldi et al. \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Toppino et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Zygier et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2005\u003c/span\u003e) as well as some Cucurbitaceae crops including melon, cucumber and watermelon (Monforte et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Pan et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). To explore the potential conserved function of \u003cem\u003eCSR-like1\u003c/em\u003e in regulating fruit weight in pepper, we conducted GWAS using multi-year phenotypic data collected from four \u003cem\u003eCapsicum\u003c/em\u003e species (\u003cem\u003eC. annuum\u003c/em\u003e, \u003cem\u003eC. annuum\u003c/em\u003e var. \u003cem\u003eglabriusculum\u003c/em\u003e, \u003cem\u003eC. baccatum\u003c/em\u003e, and \u003cem\u003eC. chinense\u003c/em\u003e) (Supplementary Table S12). We identified three significant SNPs (S06_227195491, S06_227195529, and S06_227195619) in the mixed linear model (MLM), and one SNP (S06_227195491) in the BLINK model, all located within the coding region of \u003cem\u003eCaCSR-like1\u003c/em\u003e (\u003cem\u003eCA06g22610\u003c/em\u003e) (Fig.\u0026nbsp;5a,b). The \u003cem\u003eCapsicum\u003c/em\u003e ortholog CaCSR-like1 exhibited conserved motifs and domain structures characteristic of the CSR/FAF-like proteins (Mu et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), suggesting a conserved molecular mechanism in regulating cell size and fruit mass.\u003c/p\u003e\u003cp\u003eTo further characterize allelic diversity of \u003cem\u003eCaCSR-like1\u003c/em\u003e, we identified a total of five SNPs (S06_227195491, S06_227195529, S06_227195579, S06_227195589, and S06_227195619) in the coding region of \u003cem\u003eCaCSR-like1\u003c/em\u003e among the \u003cem\u003eCapsicum\u003c/em\u003e GWAS panel using the GBS markers (Fig.\u0026nbsp;6a). Six haplotypes (haplotype I to VI) were assigned using the five segregating sites, and only SNP S06_227195619, S06_227195579 and S06_22719549 led to non-synonymous changes at amino acid position 10, 24 and 53 (Fig.\u0026nbsp;6a). These non-synonymous mutations were outside of the FAF domain (Pfam accession: PF11250) which is located between amino acid position 230 and 278. The wild pepper \u003cem\u003eC. annuum\u003c/em\u003e var. \u003cem\u003eglabriusculum\u003c/em\u003e in this study only carried haplotype II or III, while the cultivated pepper \u003cem\u003eC. annuum\u003c/em\u003e, \u003cem\u003eC. baccatum\u003c/em\u003e, and \u003cem\u003eC. chinense\u003c/em\u003e exhibited all six haplotypes across different accessions (Fig.\u0026nbsp;6b; Supplementary Table S13). There is also clear association of haplotype VI with higher fruit weight within each cultivated pepper species (Fig.\u0026nbsp;6b).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eFruit weight is a critical component in modern agriculture as it is linked to yield and the price of produce. Hence a key focus in many vegetable breeding programs is to maintain or increase fruit weight. Understanding the genetic basis underlying this highly quantitative trait can provide us valuable insights into fruit development and help accelerate breeding programs. In this study, we successfully identified five unique fruit weight QTL from a GWAS with diverse SP, SLC and SLL accessions. Of these loci, three were likely to correspond to known fruit weight genes while two were novel. We subsequently fine mapped two QTLs on chromosome 6 using association mapping and progeny testing. Of these, \u003cem\u003efw6.2\u003c/em\u003e harbors the smaller interval of 374 kb. Based on changes in pericarp cell size in \u003cem\u003efw6.2\u003c/em\u003e NILs, \u003cem\u003eCSR-like1\u003c/em\u003e was identified as the most likely candidate gene at the locus. \u003cem\u003eCSR-like1\u003c/em\u003e is a paralog of the only known fruit weight gene \u003cem\u003eCSR\u003c/em\u003e that regulates cell enlargement.\u003c/p\u003e\u003cp\u003eThe haplotype analyses of \u003cem\u003eCSR-like1\u003c/em\u003e showed that smaller pericarp cell size was associated with accessions carrying \u003cem\u003eCSR-like1\u003c/em\u003e-\u003cem\u003eWT\u003c/em\u003e alleles in backgrounds where the other cloned fruit weight genes were fixed (Fig.\u0026nbsp;4c and Supplementary Figure S6). Moreover, among the F\u003csub\u003e2\u003c/sub\u003e populations that were used to validate \u003cem\u003eGWAS_fw6.1\u003c/em\u003e, four showed significant association with fruit weight at the locus (Supplementary Table S5). Of those that segregated at the GWAS locus, the large-fruited parent of each of the four populations carries \u003cem\u003eCSR-like1-D\u003c/em\u003e allele while the other parent carries \u003cem\u003eCSR-like1\u003c/em\u003e-\u003cem\u003eWT\u003c/em\u003e allele except for 18S40 where both parents carry the same \u003cem\u003eCSR-like1\u003c/em\u003e-\u003cem\u003eD\u003c/em\u003e allele. The small effect on fruit weight at \u003cem\u003eGWAS_fw6.1\u003c/em\u003e may be the result of the other segregating fruit weight QTLs in the population and imply that other genes at the \u003cem\u003eGWAS_fw6.1\u003c/em\u003e locus affect the trait as well (Supplementary Tables S1 and S5). The fifth F\u003csub\u003e2\u003c/sub\u003e population, 18S32, was neither segregating for polymorphisms at \u003cem\u003eGWAS_fw6.1\u003c/em\u003e, nor for the \u003cem\u003eCSR-like1\u003c/em\u003e allele. Therefore, as expected, the locus was not associated with fruit weight in the 18S32 population. Together, genetic mapping and haplotype association analysis demonstrate that \u003cem\u003eCSR-like1\u003c/em\u003e is a likely candidate for fruit weight at the \u003cem\u003efw6.2\u003c/em\u003e locus. In addition, the haplotype analyses revealed four most significant SNPs associated with fruit weight that could be utilized in future breeding programs for selecting desired fruit weight in tomato (Supplementary Table S11).\u003c/p\u003e\u003cp\u003e\u003cem\u003eCSR-like1\u003c/em\u003e was located 19kb away from one of the selective sweep windows in the transition from SP to SLC (Razifard et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), suggesting that the gene may have been selected in the early stage of tomato domestication. This agrees with the distribution of \u003cem\u003eCSR-like1\u003c/em\u003e haplotypes in the genetically distinct groups classified in Razifard et al. (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) (Supplementary Fig. S7). All SP accessions in the Varitome collection carried haplotype IV, V or VI, which were associated with smaller fruit weight. Based on the tomato domestication hypothesis proposed by Razifard et al. (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), Ecuadorian SLC (SLC_ECU) accessions would be the most ancestral SLC group, and thus would be the first group where larger fruit-associated haplotype I and II allele of \u003cem\u003eCSR-like1\u003c/em\u003e appeared. The frequency of haplotype I and II allele would increase with further domestication. Haplotype III allele is associated with smaller fruit weight compared to haplotype I and II, and is mostly found in a group of SLC accessions from Mexico, Central America, and northern South America (together annotated as SLC_CA). The rise of haplotype III allele would coincide with the transition of fruit weight back to more wild-like tomatoes in SLC_CA, and we would expect to see a reselection of Haplotype I and II of \u003cem\u003eCSR-like1\u003c/em\u003e in the fully cultivated SLL from SLC_Mexico. However, such re-selection was not detected in the study of Razifard et al. (\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) at the \u003cem\u003eCSR-like1\u003c/em\u003e locus. In fact, the haplotype distribution of \u003cem\u003eCSR-like1\u003c/em\u003e could demonstrate another scenario in the evolution of tomato such as described in Blanca et al. (2021) (Supplementary Fig S8). SLC_CA was likely to be the intermediate group after the northward migration of SP towards Mesoamerica. Later SLC_CA migrated back to South America and admixed with Ecuadorian and Peruvian SP to give rise to Ecuadorian and Peruvian SLC in which haplotype I and II allele of \u003cem\u003eCSR-like1\u003c/em\u003e were further distributed. Some Peruvian SLC then migrated back to Mexico where it evolved fully to SLL.\u003c/p\u003e\u003cp\u003eWe functionally validated the role of \u003cem\u003eCSR-like1\u003c/em\u003e in controlling fruit weight and pericarp cell size by downregulating its expression in transgenic plants. In the amiRNA lines, the effect of reduced expression of \u003cem\u003eCSR-like1\u003c/em\u003e on fruit development started to manifest itself in ovaries one day prior to anthesis. \u003cem\u003eCSR-like1\u003c/em\u003e is the only member of the \u003cem\u003eCSR/FAF-like\u003c/em\u003e family in tomato that has relatively high expression in young flower buds and flowers at anthesis (Mu et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). This suggests that \u003cem\u003eCSR-like1\u003c/em\u003e might regulate cell differentiation and enlargement in floral development as well even though the NILs did not show a difference at that time. Similar differences between lines carrying natural alleles and lines carrying transgenes has been observed in \u003cem\u003efw3.2/KLUH\u003c/em\u003e (Chakrabarti et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Compared to \u003cem\u003efw3.2\u003c/em\u003e NILs, the downregulated transgenic lines showed additional phenotypic defects across the entire plant, including plant height, leaves and leaflets, seed number and side shoot number (Chakrabarti et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Future experiments are needed to determine the developmental time frame for when and how \u003cem\u003eCSR-like1\u003c/em\u003e acts in floral development.\u003c/p\u003e\u003cp\u003eTomato serves as an important model crop for studying fruit development, with many genes displaying conserved functions across plant species. Recently, two association mapping studies in \u003cem\u003eC. annum\u003c/em\u003e and \u003cem\u003eC. chinense\u003c/em\u003e, respectively, reported SNPs in the orthologs of \u003cem\u003eCSR-like1\u003c/em\u003e to be significantly associated with fruit weight (Nimmakayala et al. \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Nimmakayala et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Here we are adding another piece of evidence of a pepper \u003cem\u003eCSR-like1\u003c/em\u003e regulating fruit weight using a more expanded \u003cem\u003eCapsicum\u003c/em\u003e collection with multi-model GWAS identifying significant SNPs within the coding region of \u003cem\u003eCaCSR-like1\u003c/em\u003e. The presence of the distinct haplotypes associated with fruit weight further indicates that allelic diversification of \u003cem\u003eCaCSR-like1\u003c/em\u003e contributed to the phenotypic spectrum observed in cultivated \u003cem\u003eCapsicum\u003c/em\u003e species. Haplotype VI of \u003cem\u003eCaCSR-like1\u003c/em\u003e was enriched among large-fruited accessions, likely represents a derived allele favored during domestication or selection for increased fruit mass.\u003c/p\u003e\u003cp\u003eThere is evidence of \u003cem\u003eCSR-like1\u003c/em\u003e being relevant in other crops. In watermelon and cucumber, QTL mapping using recombinant inbred lines (RILs) has identified fruit weight/size QTLs that harbor the respective orthologs of \u003cem\u003eCSR-like1\u003c/em\u003e (\u003cem\u003eClCG02G022450\u003c/em\u003e in watermelon; \u003cem\u003eCsGy6G022740\u003c/em\u003e in cucumber) (Guo et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e2024\u003c/span\u003e; Weng et al. \u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). A recent GWAS utilizing the CucCAP cucumber core collection also identified a SNP which is ~\u0026thinsp;250kb upstream of \u003cem\u003eCsGy6G022740\u003c/em\u003e to be significantly associated with fruit size (Lin et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2024\u003c/span\u003e). In eggplant, though there have not been any reported fruit weight QTLs mapped close to \u003cem\u003eCSR-like1\u003c/em\u003e, a fruit weight QTL of around 10 cM on chromosome 12 was mapped in an F\u003csub\u003e2\u003c/sub\u003e population (\u003cem\u003eS. melongena\u003c/em\u003e 305E40 x \u003cem\u003eS. melongena\u003c/em\u003e 67/3), with \u003cem\u003eSMEL4.1_12g014140.1\u003c/em\u003e, the ortholog of \u003cem\u003eCSR\u003c/em\u003e, residing at the locus (Gaccione et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2023\u003c/span\u003e; Portis et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Direct genetic modification in other crops could be applied to broaden our understanding on the potential conserved function of \u003cem\u003eCSR-like1\u003c/em\u003e and its related genes in regulating fruit size and other species-specific functions.\u003c/p\u003e\u003cp\u003eWhile the function on fruit size and cell size by \u003cem\u003eCSR-like1\u003c/em\u003e and \u003cem\u003eCSR\u003c/em\u003e in tomato is apparent, its molecular function is less clear. \u003cem\u003eCSR-like1\u003c/em\u003e is predicted to encode a protein that contains a FANTASTIC FOUR (FAF) domain, and is an ortholog of \u003cem\u003eFAF-like\u003c/em\u003e (\u003cem\u003eAT5G22090\u003c/em\u003e) in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e (Mu et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). \u003cem\u003eFAF-like\u003c/em\u003e and its related family \u003cem\u003eFAF\u003c/em\u003e were first reported in \u003cem\u003eArabidopsis\u003c/em\u003e, which carries four \u003cem\u003eFAF\u003c/em\u003e members and one \u003cem\u003eFAF-like\u003c/em\u003e (Wahl et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Phylogenetic analysis in monocotyledonous and dicotyledonous plants suggest that the \u003cem\u003eFAF\u003c/em\u003e genes have evolved from a \u003cem\u003eFAF-like\u003c/em\u003e gene to become a dicotyledonous-specific gene family after gene duplication (Wahl et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Many of the plant species in the Rosids and Asterids clades carry only one copy of \u003cem\u003eFAF-like\u003c/em\u003e (Mu et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Wahl et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Interestingly, an expansion of \u003cem\u003eFAF-like\u003c/em\u003e is observed in the Solanaceae family. Tomato, potato (\u003cem\u003eS. tuberosum\u003c/em\u003e) and chili pepper (\u003cem\u003eCapsicum annuum\u003c/em\u003e) carry four \u003cem\u003eFAF-like\u003c/em\u003e genes whereas eggplant (\u003cem\u003eS. melongena\u003c/em\u003e) carries three members (Mu et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In Arabidopsis, \u003cem\u003eFAF-like\u003c/em\u003e (\u003cem\u003eAT5G22090\u003c/em\u003e) encodes a protein described as EAR1 (ENHANCER of ABA CO-RECEPTOR1), which can enhance the activity of clade A type 2C protein phosphatases (PP2Cs) by binding to their N termini, causing the inhibition of Snf1-related kinases2 (SnRK2s) (Wang et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Meanwhile, the expression of many downstream targets of ABA signaling rely on phosphorylation by SnRK2s (Hasan et al. \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Therefore, EAR1 is a negative regulator of ABA signaling and shown to affect seed germination, primary root growth and drought tolerance (Wang et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Interestingly, in pepper, \u003cem\u003eCaCSR-like1\u003c/em\u003e (\u003cem\u003eCA06g22610\u003c/em\u003e; or \u003cem\u003eCaFAF1\u003c/em\u003e) regulates the ABA signaling pathway but in a different manner than \u003cem\u003eEAR1\u003c/em\u003e (Lim et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2022\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). CaCSR-like1 does not interact with the known pepper PP2Ps in yeast two-hybrid assays, and unlike \u003cem\u003eEAR1\u003c/em\u003e, \u003cem\u003eCaCSR-like1\u003c/em\u003e does not affect seed germination and primary root growth when overexpressed in Arabidopsis. Instead, \u003cem\u003eCaCSR-like1\u003c/em\u003e plays a positive role in drought stress and a negative role in salt stress. Therefore, \u003cem\u003eCaCSR-like1\u0026rsquo;s\u003c/em\u003e function differs under certain abiotic stresses (Lim et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eIn this study, fruit ripening is delayed in the transgenically downregulated \u003cem\u003eCSR-like1\u003c/em\u003e lines. It is a complex process controlled by many regulators through phytohormone and environmental signals (Kou et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). ABA is known to be a key signaling hormone to regulate the ripening process in tomato through crosstalk with ethylene biosynthesis and metabolism (Kou et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Mou et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). As discussed earlier, EAR1 in Arabidopsis is a negative regulator of ABA signaling pathway (Wang et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Silencing one of the tomato \u003cem\u003ePP2C\u003c/em\u003es, \u003cem\u003eSlPP2C3\u003c/em\u003e (\u003cem\u003eSolyc06g076400\u003c/em\u003e), was shown to accelerate the ripening process (Liang et al. \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Therefore, if CSR-like1 were to have a similar function as EAR1 and interact with PP2Cs like PP2C3, we would expect to see a shortened ripening process in our amiRNA transgenic plants; instead, we observed the opposite result. This suggests that CSR-like1 might have a divergent function from EAR1. As mentioned earlier, a similar case has been made in pepper where CaCSR-like1 was demonstrated to affect ABA signaling through a different mechanism under abiotic stresses (Lim et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). The expansion of CSR/FAF-like family especially in the Solanaceae crops also suggests CSR/FAF-like proteins might have evolved to have novel functions evolution.\u003c/p\u003e\u003cp\u003eIn summary, our data support a critical role for the tomato \u003cem\u003eFAF-like\u003c/em\u003e genes, \u003cem\u003eCSR\u003c/em\u003e and \u003cem\u003eCSR-like 1\u003c/em\u003e on fruit weight in this species and potentially other crops. Further understanding its molecular function should lead to insights into fundamental plant processes while at the same time enabling breeders to implement the knowledge presented in their breeding programs.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003ch2\u003eCompeting Interests\u003c/h2\u003e\u003cp\u003eThe corresponding author, Esther van der Knaap, is a member of the Editorial Board of Theoretical and Applied Genetics. As required by journal policy, they will not be involved in the editorial handling or peer-review process of this manuscript. Another Editor with no competing interests will be assigned to oversee the review. All authors declare that no other competing interests exist.\u003c/p\u003e\u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e\u003cp\u003eThis work was supported by NSF IOS 1564366 to EvdK\u003c/p\u003e\u003ch2\u003eAuthor contribution\u003c/h2\u003e\u003cp\u003eEvdK conceived the study and supervised the research. QF, LP, and MS performed all experiments and data analyses on tomato. YW created the \u003cem\u003eCSR-like1\u003c/em\u003e amiRNA construct and genotyped the T\u003csub\u003e0\u003c/sub\u003e tomato lines. KSK, PN and UR performed all experiments and data analyses on pepper. QF and EvdK drafted the original manuscript. All authors reviewed, provided comments and agreed to the published version of the manuscript.\u003c/p\u003e\u003ch2\u003eAcknowledgements\u003c/h2\u003e\u003cp\u003eWe want to thank Dr. Ana Caicedo for helpful suggestions about the evolution of the locus; Katherine Hardigree for plant care and field experiments; Neda Keyhaninejad for tomato transformations; and all members of the Van der Knaap lab for field harvest and fruit weight evaluations.\u003c/p\u003e\u003ch2\u003eData availability\u003c/h2\u003e\u003cp\u003eThe raw DNA sequence data for tomato is available in NCBI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; SRA: SRP150040, SRP045767, SRP094624, and PRJNA353161). The GBS data for pepper is available in NCBI (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.ncbi.nlm.nih.gov/\u003c/span\u003e\u003cspan address=\"https://www.ncbi.nlm.nih.gov/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e; PRJNA1305095).\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eAlexander DH, Shringarpure SS, Novembre J, Lange K (2015) Admixture 1.3 software manual. UCLA Human Genetics Software Distribution, Los Angeles\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eAlonge M, Wang X, Benoit M et al (2020) Major Impacts of Widespread Structural Variation on Gene Expression and Crop Improvement in Tomato. Cell 182:145\u0026ndash;161e23. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cell.2020.05.021\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2020.05.021\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBroman KW, Wu H, Sen S, Churchill GA (2003) R/qtl: QTL mapping in experimental crosses. Bioinformatics 19:889\u0026ndash;890. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/btg112\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btg112\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCausse M, Saliba-Colombani V, Lecomte L, Duff\u0026eacute; P, Rousselle P, Buret M (2002) QTL analysis of fruit quality in fresh market tomato: a few chromosome regions control the variation of sensory and instrumental traits. J Exp Bot 53:2089\u0026ndash;2098. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jxb/erf058\u003c/span\u003e\u003cspan address=\"10.1093/jxb/erf058\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eChakrabarti M, Zhang N, Sauvage C et al (2013) A cytochrome P450 regulates a domestication trait in cultivated tomato. Proceedings of the National Academy of Sciences 110:17125\u0026ndash;17130. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.1307313110\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1307313110\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCheng R, Parker CC, Abney M, Palmer AA (2013) Practical Considerations Regarding the Use of Genotype and Pedigree Data to Model Relatedness in the Context of Genome-Wide Association Studies. G3 Genes|Genomes|Genetics 3:1861\u0026ndash;1867. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1534/g3.113.007948\u003c/span\u003e\u003cspan address=\"10.1534/g3.113.007948\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCingolani P, Adrian P, Lily WL, Melissa C, Tung N, Luan W, Xiangyi JLS L and and, Ruden DM (2012) A program for annotating and predicting the effects of single nucleotide polymorphisms. SnpEff Fly 6:80\u0026ndash;92. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4161/fly.19695\u003c/span\u003e\u003cspan address=\"10.4161/fly.19695\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCong B, Liu J, Tanksley SD (2002) Natural alleles at a tomato fruit size quantitative trait locus differ by heterochronic regulatory mutations. Proceedings of the National Academy of Sciences 99:13606\u0026ndash;13611. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.172520999\u003c/span\u003e\u003cspan address=\"10.1073/pnas.172520999\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCong B, Barrero LS, Tanksley SD (2008) Regulatory change in YABBY-like transcription factor led to evolution of extreme fruit size during tomato domestication. Nat Genet 40:800\u0026ndash;804. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ng.144\u003c/span\u003e\u003cspan address=\"10.1038/ng.144\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDanecek P, Auton A, Abecasis G et al (2011) The variant call format and VCFtools. Bioinformatics 27:2156\u0026ndash;2158. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/bioinformatics/btr330\u003c/span\u003e\u003cspan address=\"10.1093/bioinformatics/btr330\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDanecek P, Bonfield JK, Liddle J, Marshall J, Ohan V, Pollard MO, Whitwham A, Keane T, McCarthy SA, Davies RM, Li H (2021) Twelve years of SAMtools and BCFtools. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/gigascience/giab008\u003c/span\u003e\u003cspan address=\"10.1093/gigascience/giab008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Gigascience 10\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eDoebley JF, Gaut BS, Smith BD (2006) The Molecular Genetics of Crop Domestication. Cell 127:1309\u0026ndash;1321. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/\u003c/span\u003e\u003cspan address=\"https://doi.org/https://doi.org/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003e10.1016/j.cell.2006.12.006\u003c/span\u003e\u003cspan address=\"10.1016/j.cell.2006.12.006\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eElshire RJ, Glaubitz JC, Sun Q, Poland JA, Kawamoto K, Buckler ES, Mitchell SE (2011) A Robust, Simple Genotyping-by-Sequencing (GBS) Approach for High Diversity Species. PLoS ONE 6:e19379. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0019379\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0019379\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eFrary A, Nesbitt TC, Frary A, Grandillo S, Van Der Knaap E, Cong B, Liu J, Meller J, Elber R, Alpert KB (2000) fw2. 2: a quantitative trait locus key to the evolution of tomato fruit size. Science 289:85\u0026ndash;88. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.289.5476.85\u003c/span\u003e\u003cspan address=\"10.1126/science.289.5476.85\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGaccione L, Martina M, Barchi L, Portis E (2023) A Compendium for Novel Marker-Based Breeding Strategies in Eggplant. Plants 12:1016. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/plants12051016\u003c/span\u003e\u003cspan address=\"10.3390/plants12051016\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGrandillo S, Ku HM, Tanksley SD (1999) Identifying the loci responsible for natural variation in fruit size and shape in tomato. Theor Appl Genet 99:978\u0026ndash;987. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s001220051405\u003c/span\u003e\u003cspan address=\"10.1007/s001220051405\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGross BL, Olsen KM (2010) Genetic perspectives on crop domestication. Trends Plant Sci 15:529\u0026ndash;537. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.tplants.2010.05.008\u003c/span\u003e\u003cspan address=\"10.1016/j.tplants.2010.05.008\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eGuo S, Tian M, Du H, Liu S, Yu R, Shen H (2024) Quantitative Trait Loci Mapping and Comparative Transcriptome Analysis of Fruit Weight (FW) in Watermelon (Citrullus lanatus L). Genes (Basel) 15. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3390/genes15070933\u003c/span\u003e\u003cspan address=\"10.3390/genes15070933\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHasan MM, Liu XD, Waseem M, Guang-Qian Y, Alabdallah NM, Jahan MS, Fang XW (2022) ABA activated SnRK2 kinases: an emerging role in plant growth and physiology. Plant Signal Behav 17:2071024. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1080/15592324.2022.2071024\u003c/span\u003e\u003cspan address=\"10.1080/15592324.2022.2071024\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eHodgens C, Nimchuk ZL, Kieber JJ (2017) indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events. PLoS ONE 12:e0188406. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0188406\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0188406\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIlla-Berenguer E, Van Houten J, Huang Z, van der Knaap E (2015) Rapid and reliable identification of tomato fruit weight and locule number loci by QTL-seq. Theor Appl Genet 128:1329\u0026ndash;1342. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00122-015-2509-x\u003c/span\u003e\u003cspan address=\"10.1007/s00122-015-2509-x\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKim S, Park M, Yeom SI et al (2014) Genome sequence of the hot pepper provides insights into the evolution of pungency in Capsicum species. Nat Genet 46:270\u0026ndash;278. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ng.2877\u003c/span\u003e\u003cspan address=\"10.1038/ng.2877\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKnaus BJ, Gr\u0026uuml;nwald NJ (2017) vcfr: a package to manipulate and visualize variant call format data in R. Mol Ecol Resour 17:44\u0026ndash;53. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/1755-0998.12549\u003c/span\u003e\u003cspan address=\"10.1111/1755-0998.12549\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKou X, Zhou J, Wu CE, Yang S, Liu Y, Chai L, Xue Z (2021) The interplay between ABA/ethylene and NAC TFs in tomato fruit ripening: a review. Plant Mol Biol 106:223\u0026ndash;238. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11103-021-01128-w\u003c/span\u003e\u003cspan address=\"10.1007/s11103-021-01128-w\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLiang B, Sun Y, Wang J, Zheng Y, Zhang W, Xu Y, Li Q, Leng P (2021) Tomato protein phosphatase 2C influences the onset of fruit ripening and fruit glossiness. J Exp Bot 72:2403\u0026ndash;2418. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jxb/eraa593\u003c/span\u003e\u003cspan address=\"10.1093/jxb/eraa593\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLim CW, Bae Y, Lee SC (2022) Differential role of Capsicum annuum FANTASTIC FOUR-like gene CaFAF1 on drought and salt stress responses. Environ Exp Bot 199:104887. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.envexpbot.2022.104887\u003c/span\u003e\u003cspan address=\"10.1016/j.envexpbot.2022.104887\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLin Y-C, Weng Y, Fei Z, Grumet R (2024) Mining the cucumber core collection: phenotypic and genetic characterization of morphological diversity for fruit quality characteristics. Hortic Res 12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/hr/uhae340\u003c/span\u003e\u003cspan address=\"10.1093/hr/uhae340\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMata-Nicol\u0026aacute;s E, Montero-Pau J, Gimeno-Paez E, Garcia-Carpintero V, Ziarsolo P, Menda N, Mueller LA, Blanca J, Ca\u0026ntilde;izares J, Van Der Knaap E, D\u0026iacute;ez MJ (2020) Exploiting the diversity of tomato: the development of a phenotypically and genetically detailed germplasm collection. Hortic Res 7. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41438-020-0291-7\u003c/span\u003e\u003cspan address=\"10.1038/s41438-020-0291-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMonforte AJ, Diaz A, Ca\u0026ntilde;o-Delgado A, van der Knaap E (2014) The genetic basis of fruit morphology in horticultural crops: lessons from tomato and melon. J Exp Bot 65:4625\u0026ndash;4637. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jxb/eru017\u003c/span\u003e\u003cspan address=\"10.1093/jxb/eru017\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMou W, Li D, Bu J, Jiang Y, Khan ZU, Luo Z, Mao L, Ying T (2016) Comprehensive Analysis of ABA Effects on Ethylene Biosynthesis and Signaling during Tomato Fruit Ripening. PLoS ONE 11:e0154072. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0154072\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0154072\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMu Q, Huang Z, Chakrabarti M, Illa-Berenguer E, Liu X, Wang Y, Ramos A, van der Knaap E (2017) Fruit weight is controlled by Cell Size Regulator encoding a novel protein that is expressed in maturing tomato fruits. PLoS Genet 13:e1006930. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pgen.1006930\u003c/span\u003e\u003cspan address=\"10.1371/journal.pgen.1006930\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eMu\u0026ntilde;os S, Ranc N, Botton E, B\u0026eacute;rard A, Rolland S, Duff\u0026eacute; P, Carretero Y, Le Paslier M-C, Delalande C, Bouzayen M (2011) Increase in tomato locule number is controlled by two single-nucleotide polymorphisms located near WUSCHEL. Plant Physiol 156:2244\u0026ndash;2254. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1104/pp.111.173997\u003c/span\u003e\u003cspan address=\"10.1104/pp.111.173997\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNimmakayala P, Abburi VL, Saminathan T et al (2016) Genome-wide Diversity and Association Mapping for Capsaicinoids and Fruit Weight in Capsicum annuum L. Sci Rep 6:38081. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/srep38081\u003c/span\u003e\u003cspan address=\"10.1038/srep38081\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eNimmakayala P, Lopez-Ortiz C, Shahi B, Abburi VL, Natarajan P, Kshetry AO, Shinde S, Davenport B, Stommel J, Reddy UK (2021) Exploration into natural variation for genes associated with fruit shape and size among Capsicum chinense collections. Genomics 113:3002\u0026ndash;3014. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.ygeno.2021.06.041\u003c/span\u003e\u003cspan address=\"10.1016/j.ygeno.2021.06.041\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePan Y, Wang Y, McGregor C, Liu S, Luan F, Gao M, Weng Y (2020) Genetic architecture of fruit size and shape variation in cucurbits: a comparative perspective. Theor Appl Genet 133:1\u0026ndash;21. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00122-019-03481-3\u003c/span\u003e\u003cspan address=\"10.1007/s00122-019-03481-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eParan I, van der Knaap E (2007) Genetic and molecular regulation of fruit and plant domestication traits in tomato and pepper. J Exp Bot 58:3841\u0026ndash;3852. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jxb/erm257\u003c/span\u003e\u003cspan address=\"10.1093/jxb/erm257\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePereira L, Sapkota M, Alonge M et al (2021a) Natural Genetic Diversity in Tomato Flavor Genes. Front Plant Sci 12. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2021.642828\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2021.642828\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePereira L, Zhang L, Sapkota M, Ramos A, Razifard H, Caicedo AL, Van der Knaap E (2021b) Unraveling the genetics of tomato fruit weight during crop domestication and diversification. Theor Appl Genet 134:3363\u0026ndash;3378. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00122-021-03902-2\u003c/span\u003e\u003cspan address=\"10.1007/s00122-021-03902-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003ePortis E, Barchi L, Toppino L, Lanteri S, Acciarri N, Felicioni N, Fusari F, Barbierato V, Cericola F, Val\u0026egrave; G, Rotino GL (2014) QTL Mapping in Eggplant Reveals Clusters of Yield-Related Loci and Orthology with the Tomato Genome. PLoS ONE 9:e89499. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0089499\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0089499\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRazifard H, Ramos A, Della Valle AL et al (2020) Genomic Evidence for Complex Domestication History of the Cultivated Tomato in Latin America. Mol Biol Evol 37:1118\u0026ndash;1132. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/molbev/msz297\u003c/span\u003e\u003cspan address=\"10.1093/molbev/msz297\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eReddy UK, Karnatam KS, Talavera-Caro A et al (2025) Uncovering the genetic architecture of pungency, carotenoids, and flavor in Capsicum chinense via TWAS-mGWAS integration and spatial Transcriptomics. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/hr/uhaf243\u003c/span\u003e\u003cspan address=\"10.1093/hr/uhaf243\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Horticulture Research:uhaf243\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRinaldi R, Van Deynze A, Portis E, Rotino GL, Toppino L, Hill T, Ashrafi H, Barchi L, Lanteri S (2016) New Insights on Eggplant/Tomato/Pepper Synteny and Identification of Eggplant and Pepper Orthologous QTL. Front Plant Sci 7:1031. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2016.01031\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2016.01031\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRodr\u0026iacute;guez GR, Moyseenko JB, Robbins MD, Huarachi Morej\u0026oacute;n N, Francis DM, Van Der Knaap E (2010) Tomato Analyzer: A Useful Software Application to Collect Accurate and Detailed Morphological and Colorimetric Data from Two-dimensional Objects. J Visualized Experiments. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3791/1856\u003c/span\u003e\u003cspan address=\"10.3791/1856\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eRosyara UR, De Jong WS, Douches DS, Endelman JB (2016) Software for Genome-Wide Association Studies in Autopolyploids and Its Application to Potato. Plant Genome 9. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3835/plantgenome2015.08.0073\u003c/span\u003e\u003cspan address=\"10.3835/plantgenome2015.08.0073\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSapkota M, Pereira L, Wang Y, Zhang L, Topcu Y, Tieman D, van der Knaap E (2023) Structural variation underlies functional diversity at methyl salicylate loci in tomato. PLoS Genet 19:e1010751. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pgen.1010751\u003c/span\u003e\u003cspan address=\"10.1371/journal.pgen.1010751\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSchindelin J, Arganda-Carreras I, Frise E et al (2012) Fiji: an open-source platform for biological-image analysis. Nat Methods 9:676\u0026ndash;682. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nmeth.2019\u003c/span\u003e\u003cspan address=\"10.1038/nmeth.2019\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eScott JW, Baldwin EA, Klee HJ, Brecht JK, Olson SM, Bartz JA, Sims CA (2008) Fla. 8153 Hybrid Tomato; Fla. 8059 and Fla. 7907 Breeding Lines. HortScience 43:2228\u0026ndash;2230. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.21273/hortsci.43.7.2228\u003c/span\u003e\u003cspan address=\"10.21273/hortsci.43.7.2228\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTanksley SD (2004) The Genetic, Developmental, and Molecular Bases of Fruit Size and Shape Variation in Tomato. Plant Cell 16:S181\u0026ndash;S189. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.018119\u003c/span\u003e\u003cspan address=\"10.1105/tpc.018119\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTieman D, Zhu G, Resende MF, Lin T, Nguyen C, Bies D, Rambla JL, Beltran KSO, Taylor M, Zhang B (2017) A chemical genetic roadmap to improved tomato flavor. Science 355:391\u0026ndash;394. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1126/science.aal1556\u003c/span\u003e\u003cspan address=\"10.1126/science.aal1556\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eTopcu Y, Sapkota M, Illa-Berenguer E, Nambeesan SU, Van der Knaap E (2021) Identification of blossom-end rot loci using joint QTL-seq and linkage-based QTL mapping in tomato. Theor Appl Genet 134:2931\u0026ndash;2945. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00122-021-03869-0\u003c/span\u003e\u003cspan address=\"10.1007/s00122-021-03869-0\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eToppino L, Barchi L, Lo Scalzo R et al (2016) Mapping Quantitative Trait Loci Affecting Biochemical and Morphological Fruit Properties in Eggplant (Solanum melongena L). Front Plant Sci Volume 7\u0026ndash;2016. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2016.00256\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2016.00256\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVan Eck J, Keen P, Tjahjadi M (2019) Agrobacterium tumefaciens-Mediated Transformation of Tomato. In: Kumar S, Barone P, Smith M (eds) Transgenic Plants: Methods and Protocols. edn. Springer New York, New York, NY, pp 225\u0026ndash;234\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eVu QT, Song K, Park S, Xu L, Nam HG, Hong S (2023) An auxin-mediated ultradian rhythm positively influences root regeneration via EAR1/EUR1 in Arabidopsis. Front Plant Sci 14\u0026ndash;2023. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpls.2023.1136445\u003c/span\u003e\u003cspan address=\"10.3389/fpls.2023.1136445\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWahl V, Brand LH, Guo Y-L, Schmid M (2010) The FANTASTIC FOUR proteins influence shoot meristem size in Arabidopsis thaliana. BMC Plant Biol 10:285. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1471-2229-10-285\u003c/span\u003e\u003cspan address=\"10.1186/1471-2229-10-285\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang J, Zhang Z (2021) GAPIT Version 3: Boosting Power and Accuracy for Genomic Association and Prediction. Genomics. Proteom Bioinf 19:629\u0026ndash;640. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/https://doi.org/10.1016/j.gpb.2021.08.005\u003c/span\u003e\u003cspan address=\"10.1016/j.gpb.2021.08.005\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWang K, He J, Zhao Y et al (2018) EAR1 Negatively Regulates ABA Signaling by Enhancing 2C Protein Phosphatase Activity. Plant Cell 30:815\u0026ndash;834. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1105/tpc.17.00875\u003c/span\u003e\u003cspan address=\"10.1105/tpc.17.00875\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eWeng Y, Colle M, Wang Y, Yang L, Rubinstein M, Sherman A, Ophir R, Grumet R (2015) QTL mapping in multiple populations and development stages reveals dynamic quantitative trait loci for fruit size in cucumbers of different market classes. Theor Appl Genet 128:1747\u0026ndash;1763. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00122-015-2544-7\u003c/span\u003e\u003cspan address=\"10.1007/s00122-015-2544-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eXu C, Liberatore KL, MacAlister CA et al (2015) A cascade of arabinosyltransferases controls shoot meristem size in tomato. Nat Genet 47:784\u0026ndash;792. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/ng.3309\u003c/span\u003e\u003cspan address=\"10.1038/ng.3309\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZhang M, Yuan B, Leng P (2009) The role of ABA in triggering ethylene biosynthesis and ripening of tomato fruit. J Exp Bot 60:1579\u0026ndash;1588. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1093/jxb/erp026\u003c/span\u003e\u003cspan address=\"10.1093/jxb/erp026\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eZygier S, Chaim AB, Efrati A, Kaluzky G, Borovsky Y, Paran I (2005) QTLs mapping for fruit size and shape in chromosomes 2 and 4 in pepper and a comparison of the pepper QTL map with that of tomato. Theor Appl Genet 111:437\u0026ndash;445. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s00122-005-2015-7\u003c/span\u003e\u003cspan address=\"10.1007/s00122-005-2015-7\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1 to 3 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"theoretical-and-applied-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"taag","sideBox":"Learn more about [Theoretical and Applied Genetics](https://www.springer.com/journal/122)","snPcode":"122","submissionUrl":"https://submission.nature.com/new-submission/122/3","title":"Theoretical and Applied Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false},"keywords":"GWAS, QTL mapping, Fruit weight, Fruit development","lastPublishedDoi":"10.21203/rs.3.rs-8157882/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-8157882/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eFruit weight is a quantitative trait that was under strong selection during the domestication of fruit and vegetable crops such as tomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e). While numerous fruit weight QTLs have been identified, only three tomato fruit weight genes have been cloned. In this study, we utilized a genetically diverse tomato panel, the Varitome collection, to identify additional genetic loci that control fruit weight. We mapped and fine mapped two fruit weight QTLs on chromosome 6, \u003cem\u003efw6.1\u003c/em\u003e and \u003cem\u003efw6.2\u003c/em\u003e, by using Genome Wide Association studies (GWAS) and linkage mapping in bi-parental populations. We identified a member of the \u003cem\u003eCell Size Regulator\u003c/em\u003e family, \u003cem\u003eCSR-like1\u003c/em\u003e, as the likely candidate underlying \u003cem\u003efw6.2\u003c/em\u003e. The near isogenic lines (NILs) carrying the derived allele of \u003cem\u003efw6.2\u003c/em\u003e produced heavier fruits with larger fruit pericarp cells than lines with wildtype (WT) allele. Transgenic downregulation of \u003cem\u003eCSR-like1\u003c/em\u003e led to a decrease in fruit weight and pericarp cells, supporting the role of this gene at the \u003cem\u003efw6.2\u003c/em\u003e locus. The haplotype analysis implied that the \u003cem\u003eCSR-like1\u003c/em\u003e-Derived (\u003cem\u003eCSR-like1\u003c/em\u003e-D) allele was selected in the transition from the fully wild \u003cem\u003eS. pimpinellifolium\u003c/em\u003e to the earliest \u003cem\u003eS. lycopersicum cerasiforme \u003c/em\u003eaccessions\u003cem\u003e.\u003c/em\u003e Four single nucleotide polymorphisms (SNPs) were identified in the regulatory region of \u003cem\u003eCSR-like1\u003c/em\u003ethat were conserved in the accessions carrying \u003cem\u003eCSR-like1\u003c/em\u003e-WT and were significantly associated with lower fruit weight and pericarp cell size at the locus. Moreover, a pepper GWAS identified a \u003cem\u003eCSR-like1\u003c/em\u003e ortholog that was associated with fruit weight. Together, our findings established \u003cem\u003eCSR-like1\u003c/em\u003e as a novel fruit weight gene likely conserved in other crops.\u003c/p\u003e","manuscriptTitle":"Fruit Weight Regulation by a Paralog of Cell Size Regulator (CSR) in Tomato and Other Crops","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-12-15 14:36:43","doi":"10.21203/rs.3.rs-8157882/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Minor revisions","date":"2026-01-11T21:56:20+00:00","index":"","fulltext":""},{"type":"reviewerAgreed","content":"","date":"2025-12-11T01:38:45+00:00","index":0,"fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-12-10T09:03:29+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-11-22T11:56:59+00:00","index":"","fulltext":""},{"type":"submitted","content":"Theoretical and Applied Genetics","date":"2025-11-19T12:59:03+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"theoretical-and-applied-genetics","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"taag","sideBox":"Learn more about [Theoretical and Applied Genetics](https://www.springer.com/journal/122)","snPcode":"122","submissionUrl":"https://submission.nature.com/new-submission/122/3","title":"Theoretical and Applied Genetics","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"Springer Hybrid","inReviewEnabled":true,"inReviewRevisionsEnabled":false}}],"origin":"","ownerIdentity":"28c1a3f5-e67d-4f58-96c0-e5f23ce55765","owner":[],"postedDate":"December 15th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-03-09T16:13:06+00:00","versionOfRecord":{"articleIdentity":"rs-8157882","link":"https://doi.org/10.1007/s00122-026-05177-x","journal":{"identity":"theoretical-and-applied-genetics","isVorOnly":false,"title":"Theoretical and Applied Genetics"},"publishedOn":"2026-03-05 15:58:41","publishedOnDateReadable":"March 5th, 2026"},"versionCreatedAt":"2025-12-15 14:36:43","video":"","vorDoi":"10.1007/s00122-026-05177-x","vorDoiUrl":"https://doi.org/10.1007/s00122-026-05177-x","workflowStages":[]},"version":"v1","identity":"rs-8157882","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-8157882","identity":"rs-8157882","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.