Disulfiram inhibits Gasdermin D pores formation and improves insulin-dependent glucose uptake and glucose homeostasis in skeletal muscle of obesity-induced insulin-resistant mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Article Disulfiram inhibits Gasdermin D pores formation and improves insulin-dependent glucose uptake and glucose homeostasis in skeletal muscle of obesity-induced insulin-resistant mice Cynthia Cadagan, Javier Russell-Guzmán, Luan Américo-Da-Silva, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7117118/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 26 Nov, 2025 Read the published version in Scientific Reports → Version 1 posted 10 You are reading this latest preprint version Abstract Insulin resistance (IR), which involves impaired insulin signaling diminished insulin sensitivity in skeletal muscle, is closely associated with chronic low-grade inflammation. A key mediator of this process is the NLRP3 inflammasome, which activates Gasdermin D (GSDMD). Upon cleavage, the N-terminal fragment of GSDMD (GSDMD-NT) forms membrane pores that facilitate interleukin-1β (IL-1β) release. Disulfiram (DSF), an FDA-approved drug that also inhibits GSDMD-NT pore formation, has emerged as a potential therapeutic for inflammasome-mediated inflammation. However, the role of GSDMD in skeletal muscle during IR remains poorly understood. This study evaluated whether GSDMD-NT-mediated IL-1β release contributes to skeletal muscle inflammation and IR, and whether DSF can restore insulin sensitivity. Male C57BL/6 mice were fed a normal chow diet (NCD) or a high-fat diet (HFD) for 8 weeks; a subgroup of HFD-fed mice received intraperitoneal DSF (50 mg/kg) for 3 weeks. The flexor digitorum brevis (FDB) and gastrocnemius muscles were collected for single-fiber isolation, quantitative PCR, immunoblotting, and immunofluorescence. IL-1β levels were measured by ELISA. Insulin sensitivity was assessed via 2-NBDG uptake, Akt phosphorylation, and glucose tolerance tests (IPGTT). HFD-fed mice exhibited increased GSDMD-NT and oligomer levels, localized to the sarcolemma and T-tubules, along with elevated IL-1β in skeletal muscle. DSF administration reduced weight gain, fasting glycemia, IPGTT, and systemic IL-1β, while enhancing insulin-stimulated 2-NBDG uptake and Akt phosphorylation in FDB. Moreover, DSF reduced GSDMD-NT oligomerization and IL-1β release in the gastrocnemius muscle. These findings suggest a novel pathogenic role for GSDMD in skeletal muscle IR and support DSF as a potential candidate for metabolic disease intervention. Health sciences/Diseases Health sciences/Endocrinology Biological sciences/Immunology Biological sciences/Physiology GSDMD-NT glucose uptake IL-1β release insulin signaling NALP3 inflammasome Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Obesity is a multifactorial condition arising from the interplay of genetic, environmental, and lifestyle factors, and is associated with chronic metabolic dysfunction [1], a key driver of insulin resistance (IR) [2]. This metabolic impairment is closely linked to the development of type 2 diabetes mellitus, dyslipidemia, and cardiovascular disease, all of which are major contributors to global morbidity and mortality [3]. Skeletal muscle plays a central role in glucose homeostasis and serves as the primary site for insulin-stimulated glucose uptake [4]. Additionally, it functions as a source of proinflammatory cytokines, thereby linking obesity to systemic low-grade inflammation [5]. A critical mechanism connecting innate immunity to metabolic dysfunction is the activation of inflammasomes, a multiprotein complex that drives the release of proinflammatory cytokines. Among these, the NLRP3 (NOD-, LRR-, pyrin domain-containing protein 3) inflammasome is the most extensively studied in chronic disease contexts, playing a central role through activation of caspase-1, which promotes the maturation and secretion of interleukin-1β (IL-1β) [6, 7]. We recently demonstrated that NLRP3 components are expressed in skeletal muscle, where they contribute to impaired glucose metabolism and promote IR [8]. Skeletal muscle from IR-obese mice exhibited NLRP3 hyperactivation, increased IL-1β expression, and reduced GLUT4 translocation in insulin response, which were reversed by pharmacological inhibition of NLRP3 [8]. Gasdermin D (GSDMD), a principal substrate of caspase-1, is a key effector of pyroptosis, a lytic proinflammatory form of programmed cell death downstream of NLRP3 activation [9]. Upon cleavage by caspase-1, the C-terminal inhibitory domain is removed, liberating the N-terminal fragment (GSDMD-NT), which oligomerizes and integrates into the plasma membrane to form pores. These pores facilitate the release of proinflammatory cytokines, notably IL-1β, also independently of complete cell lysis [10–12]. This sublytic activity provides a mechanism for sustained inflammatory signaling in metabolically active tissues. Previously, we observed increased full-length GSDMD protein abundance and localization in skeletal muscle fibers from high-fat diet (HFD)-fed mice [8], implicating a possible role for GSDMD in the pathogenesis of obesity-induced IR. By enabling cytokine release without overt pyroptosis, GSDMD may sustain a local proinflammatory milieu that impairs insulin signaling. Thus, the NLRP3–GSDMD axis emerges as a critical molecular link between obesity-induced inflammation and metabolic dysfunction in skeletal muscle. Disulfiram (DSF), a pharmacological inhibitor of GSDMD-NT pore formation, has gained attention for suppressing inflammation downstream of NLRP3 activation, without interfering with upstream signaling pathways [13]. Originally approved by the FDA for the treatment of chronic alcoholism as an aldehyde dehydrogenase inhibitor [14]. DSF has recently demonstrated metabolic benefits in rodent models, including reductions in body weight, adiposity, hyperglycemia, and IR as well as reversal of HFD–induced hepatic steatosis [15]. Despite these promising systemic effects, the role of this compound in skeletal muscle insulin sensitivity has not been explored. Omics analyzes showed that DSF modulates lipid metabolism, redox balance, and influences autophagic pathways in hepatic cells [16]. At the molecular level, DSF inhibits GSDMD-NT-dependent pore formation through covalent modification of a critical cysteine residue (Cys191 in humans, Cys192 in mice), which prevents oligomerization and IL-1β release without altering inflammasome assembly [16]. This selective blockade of downstream proinflammatory signaling and preservation of the innate immune sensing position DSF as a compelling candidate for drug repurposing in metabolic diseases. Nevertheless, its direct effects on skeletal muscle metabolism and insulin responsiveness remain to be elucidated. In this study, we tested the hypothesis that GSDMD-NT contributes to IL-1β-mediated skeletal muscle inflammation and IR, and that pharmacological inhibition with DSF can restore insulin responsiveness by preventing GSDMD-NT oligomerization and pore formation. To address this, we employed HFD-fed mice, a well-established model of obesity-induced IR. This study aims to elucidate a novel mechanistic link between inflammasome activation and muscle insulin sensitivity, and to explore further the therapeutic potential of targeting GSDMD as a strategy to mitigate metabolic inflammation and improve glucose homeostasis. Methods Ethics statement All animal procedures were approved by the Animal Bioethics Committee of the Faculty of Dentistry, University of Chile (Protocol CBA 240423 FOUCH). All methods were carried out in accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the U.S. Department of Health and Human Services and American Veterinary Medical Association (AVMA) guidelines. The selected procedures were designed to minimize discomfort and distress while allowing for the collection of relevant metabolic and molecular data. Additionally, the study is reported in accordance with the ARRIVE guidelines (https://arriveguidelines.org). Animals A total of 96 male C57BL/6 mice, provided by the Animal Facility of the Faculty of Dentistry at the University of Chile, were used in this study. Animals were specific-pathogen-free (SPF), with no prior procedures before enrollment in the study. Prior to procedures, animals were maintained at 21°C with a 12:12-h light-dark cycle. Environmental enrichment was provided and included nesting materials, cardboard cones for shelter and exploration, and social housing with compatible animals. After 21 days, the animals were assigned to two groups: normal chow diet (NCD, n = 35), which received a standard diet (10% fat, 20% protein, and 70% carbohydrates). In contrast, the experimental group (n = 35) received, by 8 weeks, a high-fat diet (HFD) (60% fat, 20% protein, and 20% carbohydrates; D12492, Research Diets, New Brunswick, NJ, USA). A subgroup of HFD-fed mice (n = 20) received intraperitoneal injections of either vehicle (sunflower oil; HFD control) or disulfiram (HFD + DSF; Sigma) at 50 mg/kg body weight, 3 times per week from week 7 to 10. A separate group of HFD-fed mice was allocated for ex vivo muscle incubation experiments (n = 6). Each experimental group was assigned a numerical code, and tissue collection was performed in a randomized order based on this coding. Handling procedures were consistent across groups to minimize potential bias. For euthanasia, animals were placed in a plexiglass chamber, anesthetized with 5% isoflurane for 5 minutes, and then subjected to cervical dislocation. Intraperitoneal glucose tolerance test (IPGTT) Following a 4-hour fast, mice received an intraperitoneal glucose bolus (2 g/kg). Blood glucose levels were measured from tail vein samples at 0, 15, 30, 60, and 120 minutes using a One Touch II glucometer (Lifescan, Johnson & Johnson, Switzerland). Culture of isolated skeletal muscle fibers As previously described by [17], isolated fibers from the flexor digitorum brevis (FDB) muscle were obtained through enzymatic digestion with IV collagenase (Worthington, USA) for 90 minutes at 37 °C. Next, muscle tissue was mechanically dissociated by passing it through fire-polished Pasteur pipettes. The resulting fibers were plated on coverslips coated with Matrigel (Sigma-Aldrich, Burlington, MA, USA) and cultured in DMEM (25 mmol/L glucose), supplemented with 10% horse serum (Invitrogen, Waltham, MA, USA). Cultures were maintained in an incubator at 37 °C, 95% humidity, and 5% CO 2 . 2-NBDG uptake The assay was performed as reported previously [17]. Isolated FDB muscle fibers were cultured for 24 hours in serum-free DMEM, incubated for 5 minutes in glucose-free Krebs−Ringer buffer, and then stimulated with insulin (100 nmol/L, Actrapid, Novo Nordisk, Denmark) for 20 minutes. Fibers were exposed to fluorescent glucose analog 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose (2-NBDG, 300 µmol/L; Invitrogen, Waltham, MA, USA) for 15 minutes, washed, and transferred to Krebs−Ringer buffer with 5.6 mmol/L glucose. Intracellular fluorescence images were acquired using a Cell Observer Z1 epifluorescence microscope (Carl Zeiss AG, Germany). The probe was excited at 488 nm, and the resulting emission was recorded at 525 nm using a bandpass filter, with a 40X objective (numerical aperture 0.55) and a 0.63X adapter. Fluorescence intensity was calculated by averaging intracellular signal measurements from 3 distinct regions of each fiber and subtracting the background fluorescence signal recorded in the extracellular medium. Approximately 128 individual fibers were analyzed for each condition. Image analysis and region of interest (ROI) quantification were performed using Fiji software (NIH, Bethesda, MD, USA). mRNA expression Total RNA was extracted from FDB muscles using TRIzol® reagent (Invitrogen, USA), following the manufacturer’s protocol. Complementary DNA (cDNA) was synthesized via reverse transcription using 1 μg of total RNA and random primers. Quantitative PCR (qPCR) was carried out as previously described [8], employing the following primers (Integrated DNA Technologies, Ann Arbor, MI, USA): GSDMD (forward: TGAAGCACGTCTTGGAACAG; reverse: TCTTTTCATCCCAGCAGTCC). Expression levels were normalized against the housekeeping gene Rplp0 (forward: CTCCAAGCAGATGCAGCAGA; reverse: ATAGCCTTGCGCATCATGGT) and quantified using the 2 −ΔΔCt method. Western blotting Tissue samples were lysed using a manual homogenizer and sonication at 4°C in RIPA buffer. Next, lysates were centrifuged at 3,000 × g for 15 minutes. Protein (30 or 60 μg) from FDB and gastrocnemius samples, respectively, was resolved on 10% to 15% SDS-PAGE gels. The proteins were transferred to PVDF membranes and blocked with 5% bovine serum albumin (BSA). The membranes were incubated overnight at 4ºC with the following primary antibodies: NLRP3 (1:500, anti-rat, R&D Systems, Minneapolis, MN, USA), β-tubulin (1:2,000), GAPDH (1:10,000), phospho-Akt Ser473 (1:2,000), and total Akt (1:2,000), all from Cell Signaling Technology (anti-rabbit, Danvers, MA, USA); and GSDMD-NT (1:500, anti-rabbit, Abcam, Cambridge, MA). After incubation with species-specific secondary antibodies for 2 hours, protein bands were visualized using the LI-COR Odyssey® XF imaging system and Image Studio software (Lincoln, NE, USA). Densitometric analyses were performed using Fiji software (NIH, Bethesda, MD, USA), and figures were prepared using the Sciugo platform. Evaluation of GSDMD Oligomers To assess GSDMD oligomerization in FDB or gastrocnemius muscle, homogenate samples were initially incubated for 5 minutes with 10 μg/mLcatalase (Sigma-Aldrich, Burlington, MA, USA), followed by 10 minutes incubation in cold phosphate-buffered saline (PBS) containing 100 mmol/LN-ethylmaleimide (NEM; Sigma) at 4 °C to alkylate free cysteine residues. Tissue homogenization was then carried out at 4 °C using a handheld homogenizer (D1000, Biolab, Madrid, Spain), followed by sonication in cold RIPA lysis buffer (Sigma-Aldrich, Burlington, MA, USA) supplemented with protease inhibitors (Basilea, Switzerland) and 100 mmol/L NEM. Lysis and supernatant collection were carried out as previously described for Western blot analysis. To evaluate the effect of disulfiram (DSF), gastrocnemius muscles from HFD-fed mice were enzymatically dissociated with type IV collagenase for 30 minutes and cultured ex vivo for 24 hours in the presence or absence of 10 nmol/LDSF. Microsomal fractionation Skeletal muscles from the trunk and lower limbs of NCD- or HFD-fed mice were homogenized using an Ultra-Turrax® homogenizer (IKA, Germany) in buffer A (150 mmol/L KCl, 5 mmol/LMgSO 4 , 20 mmol/LMOPS/Tris, pH 6.8) containing protease inhibitors [leupeptin (1 µg/mL), pepstatin (1 µg/mL), benzamidine (0.4 mmol/L), and phenylmethylsulfonyl fluoride (1 mmol/L)]. Homogenates were centrifuged at 1,380 × g for 30 minutes at 4 °C. Pellets were re-extracted, and the combined supernatant was centrifuged at 17,000 × g for 30 minutes at 4°C to isolate membrane fractions. Pellets were resuspended in buffer A and centrifuged again at 1,380 x g to remove contractile proteins. The resulting supernatant was subjected to a second 17,000 x g centrifugation for 30 minutes at 4°C. The final pellet, enriched in triad structures (T-tubule), was washed in buffer B (300 mmol/L sucrose, 20 mmol/L MOPS/Tris, pH 6.8) with protease inhibitors, centrifuged again, resuspended in a minimal volume of buffer B, snap-frozen in liquid nitrogen, and stored at −80°C [18]. Immunofluorescence imaging Isolated FDB fibers plated on 12 mm Matrigel-coated coverslips were fixed in 4% paraformaldehyde, permeabilized with 0.01% Triton X-100, and blocked in 1% BSA/PBS for 1 hour. Fibers were incubated overnight at 4 °C with primary antibodies against anti-GSDMD-NT (1:300, anti-rabbit, Abcam, Cambridge, MA), anti-NLRP3 (1:500, R&D Systems, Minneapolis, MN, USA), and anti-DPHR (1:500, Invitrogen, Waltham, MA, USA), followed by Alexa Fluor-conjugated secondary antibodies (1:250, Invitrogen, Waltham, MA, USA) for 1 hour. Fluorescence images were acquired using a Nikon C2+ confocal microscope (40X, NA 1.3) and analyzed using Fiji software (NIH, Bethesda, MD, USA). IL-1β levels in plasma and cultured muscle fibers Plasma levels of IL-1β in NCD, HFD, and HFD + DSF mice were determined using a commercial ELISA kit (R&D Systems, USA) according to the manufacturer's instructions. To assess IL-1β in culture media of muscle fibers, FDB and gastrocnemius muscle from NCD and HFD mice were digested with type IV collagenase for 30 minutes and cultured for 24 hours with or without 10 nmol/L DSF. IL-1β levels were normalized to muscle weight (pg/mg). Statistical analysis Data are presented as mean ± SEM. Comparisons between and within multiple groups were assessed using two-way ANOVA followed by Tukey post-hoc test. The Mann–Whitney U test was used to compare two independent groups, and the Wilcoxon signed-rank test was applied for paired comparisons of cultures derived from the same animal under two distinct conditions. A p < 0.05 was considered statistically significant. All analyses and graphical representations were performed using GraphPad Prism 9 (GraphPad Software Inc., San Diego, CA, USA). Results Elevated GSDMD-NT protein levels in skeletal muscle from HDF-fed mice. We analyzed whether GSDMD-NT was differentially expressed in the skeletal muscle of obesity-induced IR mice. As shown in Fig. 1 , no significant differences were observed in the mRNA expression levels of GSDMD in muscle fibers isolated from HFD-fed mice compared to NCD-fed mice (Fig. 1 a). Nevertheless, we detected an immunoreactive band at 30 kDa for the GSDMD-NT protein, which was significantly increased ( p = 0.032) in HFD-fed mice (2.76 ± 0.43-fold) compared to NCD-fed mice (1.00 ± 0.34-fold), as determined by Western blot analysis in FDB muscle homogenates (Fig. 1 b). In addition, we analyzed the localization of GSDMD-NT in isolated skeletal muscle fibers (Fig. 1 c). Immunofluorescence detection of the GSDMD-NT and NLRP3 proteins showed an increased fluorescence intensity for both proteins in isolated fibers from HFD-fed mice compared to NCD-fed mice. Of note, immunostaining experiments revealed a peripheral signal in the medial portion of the skeletal fibers (Fig. Supp. 1). To determine whether GSDMD-NT co-localizes with DHPR, a well-established marker of the T-tubule membrane, we performed immunostaining and Western blot analysis on both the isolated microsomal fraction (enriched in sarcolemma membranes) and the triad membrane (enriched in T-tubules flanked by sarcoplasmic reticulum). As shown in Figure Supp. 2, GSDMD-NT co-localizes with DHPR in HFD-fed mice, reaching an M1 Manders coefficient of 0.98 ± 0.01, compared to NCD-fed mice (0.90 ± 0.05, Fig. Suppl. 2b). In addition, we detected an immunoreactive band in the Western Blotting analysis of GSDMD-NT in both the microsomal fraction and T-tubule membrane, with increased signal in membranes isolated from HFD-fed mice compared to NCD-fed mice (Fig. Suppl. 2c). An HFD induces oligomerization of GSDMD-NT and enhances IL-1β release in skeletal muscle. It has been suggested that GSDMD-NT monomers can be inserted into the plasma membrane and subsequently assembled into pore-forming oligomers, facilitating the release of inflammatory mediators such as IL-1β. We performed Western blot analysis using a non-denaturing gel to assess whether this process also occurs in skeletal muscle. A significant increase ( p = 0.029) in the oligomer-to-monomer ratio was observed in HFD-fed mice compared to NCD-fed mice (4.08 ± 0.89-fold and 1.00 ± 0.22-fold, respectively) (Fig. 2 a), indicating increased pore assembly in skeletal muscle. Subsequently, we measured IL-1β release in ex vivo FDB and gastrocnemius muscle (Fig. 2 b & Fig. Suppl. 3). IL-1β levels were significantly elevated in HFD-fed mice, reaching values of 2.29 ± 0.44 pg/mg protein in the FDB (p = 0.018) and 0.66 ± 0.05 pg/mg protein in the gastrocnemius (p = 0.032), compared to 1.10 ± 0.16 pg/mg and 0.48 ± 0.05 pg/mg, respectively, in NCD-fed controls. These results suggest that GSDMD-NT oligomerization contributes to IL-1β release in skeletal muscle from obesity-induced IR mice. Disulfiram reduced the IL-1β plasma levels in HFD-fed mice. To investigate the effects of DSF on glucose handling and plasma IL-1β levels, we intraperitoneally injected HFD-fed mice three times per week with DSF (50 mg/kg) or vehicle for 3 weeks. Before treatment, the HFD-fed group exhibited similar body mass, fasting blood glucose, and IPGTT (Fig. Suppl. 4). Post-treatment, mice injected with either DSF or vehicle showed no significant changes in food intake or insulinemia (Fig. 3 ). In contrast, DSF treatment reduced both total body mass ( p = 0.027) and epididymal adipose tissue ( p = 0.026), restored fasting blood glucose levels ( p < 0.0001), which remained significantly elevated in vehicle-treated mice, and led to an improvement in the IPGTT ( p < 0.0001) with an AUG of 27,197 ± 1,076 (mg·min/dL) and 36,240 ± 838 (mg·min/dL), respectively (Fig. 3 a-d). These results suggest that DSF reduces glucose levels in obesity-induced IR mice after three weeks of treatment. IL-1β plasma levels were also diminished ( p = 0.041) in DSF-treated mice (3.08 ± 0.17 pg/mL) compared to vehicle-treated mice (4.65 ± 0.53 pg/mL). Disulfiram increases insulin-dependent Akt phosphorylation and glucose uptake in skeletal muscle. To determine whether DSF modulates insulin signaling activation, we assessed Akt phosphorylation at serine 473 (S473) in whole-muscle homogenates from FDB using Western blot analysis (Fig. 4 a). As expected, in HFD-fed mice, insulin pre-incubation did not alter Akt phosphorylation at S473 ( p = 0.583) in vehicle-treated mice compared to basal conditions (2.02 ± 0.13-fold vs. 1.00 ± 0.07-fold, respectively). In contrast, DSF-treated HFD-fed mice show an increase in insulin-stimulated Akt phosphorylation at S473 ( p = 0.031), reaching 4.14 ± 0.89-fold compared to their basal levels (1.60 ± 0.65-fold). To further assess this point, glucose uptake was determined by measuring 2-NBDG incorporation, a fluorescent glucose analogue. As shown in Fig. 4 b, insulin increased 2-NBDG uptake in fibers isolated from DSF-treated HFD-fed mice, from 1.25 ± 0.01-fold under basal conditions to 1.45 ± 0.01-fold with insulin stimulation ( p = 0.047). Conversely, fibers from vehicle-injected mice showed a 2-NBDG uptake of 1.00 ± 0.08-fold in basal conditions and 1.17 ± 0.05-fold after insulin stimulation ( p = 0.091). Moreover, insulin-stimulated 2-NBDG uptake was higher in muscle fibers from DSF-treated HFD-fed mice than in those from vehicle-treated mice (p = 0.006). Disulfiram reduces GSDMD-NT oligomerization and IL-1β release in skeletal muscle from HFD-fed mice. To assess whether DSF modulates the inflammatory processes, we performed Western blot and ELISA in the whole skeletal muscle. In both experiments, skeletal muscle was incubated with 10 nmol/L DSF for 24 hours. This treatment significantly reduced ( p = 0.029) the GSDMD-NT oligomer-to-monomer ratio in the gastrocnemius muscle of HFD-fed mice, reaching values of 0.49 ± 0.06-fold compared to 1.00 ± 0.21-fold in DMSO-treated muscle (Fig. 5 a). Accordingly, IL-1β release from ex vivo skeletal muscle was also diminished ( p = 0.028) following DSF incubation (0.46 ± 0.03 pg/mg) compared to DMSO-treated muscle (0.72 ± 0.16 pg/mg) (Fig. 5 b). These findings suggest that DSF inhibits IL-1β release through GSDMD-NT oligomerization in skeletal muscle under metabolic stress conditions. Discussion Chronic low-grade inflammation contributes to the pathogenesis of IR during obesity [ 19 – 21 ]. NLRP3 activation plays a main role in this response, primarily mediated by immune cells [ 7 ]. Nevertheless, its expression and activation have also been demonstrated in non-immune tissues, including human adipocytes [ 22 ], hepatocytes [ 23 ], and skeletal muscle [ 8 ]. We previously showed that NLRP3 inflammasome activation inhibits GLUT4 translocation and disrupts insulin signaling in skeletal muscle [ 8 , 24 ]. These findings align with NLRP3-mediated inflammatory activity linked to metabolic dysfunction in skeletal muscle [ 25 ]. In this study, we determined that GSDMD contributes to IL-1β release and disrupts glucose homeostasis in skeletal muscle under NLRP3-mediated metabolic inflammation. Moreover, DSF treatment mitigates these alterations by reducing GSDMD-NT oligomerization and pore formation, supporting GSDMD as a potential target to attenuate metabolic inflammation and improve glucose handling in obesity-induced IR. In HFD-fed mice, GSDMD-NT protein levels were increased and localized primarily to the sarcolemma and T-tubules in skeletal muscle. This spatial distribution may be particularly relevant for facilitating IL-1β release, promoting a local positive feedback loop that sustains NLRP3 inflammasome activation and drives chronic inflammation, contributing to metabolic dysfunction and IR (Figs. 1 & 2 ). The detection of oligomers within the 170–235 kDa range supports the active pore formation in sarcolemma and T-tubule. Approximately 6–8 GSDMD-NT molecules oligomerize to form a pore in FDB skeletal muscle fibers (Fig. 2 a), a stoichiometry lower than that reported in previous studies using atomic force microscopy, which have shown GSDMD-NT pores composed of 18 to 36 subunits [ 26 ]. Although GSDMD-NT oligomerization is associated with pyroptosis, it has been suggested that IL-1β can be released through sublytic pores without causing complete membrane rupture in macrophages, dendritic cells, and partially in neutrophils [ 12 ]. Recent studies have demonstrated that small oligomers, such as pentamers, can form stable pores exhibiting sublytic activity with limited membrane disruption [ 27 ]. Although the precise mechanism of pore formation remains unclear, cysteine residues are emerging as key modulators of the oligomerization process. Notably, Cys39, Cys57, and particularly Cys191/192 (Cys191 in humans; Cys192 in mice) have been identified as key mediators of this process [ 28 ]. In the context of IR, oxidative stress is known to activate the NLRP3 inflammasome via interaction with thioredoxin-interacting protein (TXNIP) in skeletal muscle [ 24 ]. Reactive oxygen species (ROS) have also been shown to promote GSDMD-NT oligomerization, with Cys192 being essential for ROS sensitivity [ 29 ]. Moreover, the S-palmitoylation of Cys192 has been implicated in regulating GSDMD membrane targeting [ 28 ]. Nevertheless, whether these or other cysteine residues contribute specifically to GSDMD-NT oligomerization in skeletal muscle remains to be determined. It is well-established that skeletal muscle is active in secreting inflammatory factors and bioactive peptides, known as myokines, under IR conditions [ 30 , 31 ]. We observed increased IL-1β levels in the culture media of FDB and gastrocnemius muscles from IR mice, suggesting the contribution of skeletal muscle tissue to the inflammation associated with this metabolic dysfunction. IL-1β is secreted through several non-classical mechanisms, including lysosomal exocytosis, microvesicle shedding, fusion of multivesicular bodies and exosomes, GSDMD-NT pore formation, and passive release following cell lysis [ 32 ]. Our results show elevated GSDMD oligomerization in skeletal muscle fibers (Fig. 2 b), suggesting that IL-1β may be exported through GSDMD-formed pores, contributing to local signaling events that impair insulin sensitivity [ 33 ]. Due to its half-life in plasma (19.0 minutes in rats), IL-1β-associated vesicles and/or exosomes may mediate effects in distant sites rather than only at the local inflammatory tissue [ 34 ]. DSF, originally approved for the treatment of chronic alcohol dependence, exhibits a well-established safety profile in adherent patients, and long-term administration has not been associated with the development of pharmacological tolerance [ 14 ]. DSF covalently modifies a conserved cysteine residue Cys191/192 in GSDMD, inhibiting pore formation and pyroptosis [ 13 ]. Recently, prolonged disulfiram treatment for 40 to 60 weeks in obese mice has been reported to normalize body weight, improve fasting glycemia, reduce adiposity, and restore systemic insulin responsiveness [ 15 ]. However, its potential effects on insulin sensitivity in skeletal muscle had not been previously explored. The present findings demonstrate that a short-term DSF treatment lasting three weeks reduced body weight in HFD-induced obese mice without altering food intake (Fig. 3 ). This suggests that, at the examined time point, DSF exerts tissue-specific effects rather than through modulation of feeding behavior. This finding is consistent with previous reports indicating a weight-lowering effect of DSF [ 15 ] and extends them by demonstrating its efficacy over a shorter intervention period. The absence of changes in dietary intake suggests that DSF may modulate mechanisms of energy expenditure or metabolic efficiency [ 35 , 36 ]. In DSF-treated HFD-obese mice, we observed a decrease in IPGTT and fasting blood glucose with reduced plasma IL-1β concentrations, suggesting a link between improved glucose homeostasis and attenuation of inflammation. Moreover, DSF-treated mice exhibit improved glycemic control in response to insulin, consistent with previous reports for long-term treatment [ 15 , 37 , 38 ]. Our results provide new evidence supporting the notion that short-term DFS treatment enhances insulin sensitivity in skeletal muscle under obesity-induced IR, showing a new aspect of its metabolic effects. Consistent with improved insulin responsiveness, DSF treatment increased insulin-stimulated phosphorylation of Akt at S473 in skeletal muscle from HFD-fed mice (Fig. 4 a), indicating enhanced insulin signaling downstream of the insulin receptor. In concordance, DSF-treated HFD-fed mice also exhibit improved insulin-stimulated glucose uptake (Fig. 4 b), suggesting a functional increase in glucose disposal. These results suggest that DSF may affect insulin signaling pathways in skeletal muscle and contribute to improved peripheral glucose utilization [ 36 ]. Nevertheless, skeletal muscle also expresses GLUT1, an insulin-independent glucose transporter with constitutive activity [ 39 ]. Interestingly, glucose uptake was also increased in DSF-treated HFD mice, even in the absence of exogenous insulin stimulation, suggesting that DSF may increase basal glucose levels through insulin-independent mechanisms. Future experiments will help determine whether these effects are mediated by specific components of the insulin receptor pathway or through GLUT4-translocation at the sarcolemma. Furthermore, we found that DSF reduced GSDMD-NT oligomerization and IL-1β release from the gastrocnemius muscle from HFD-fed mice (Fig. 5 ). These findings suggest that DSF exerts anti-inflammatory effects through the modulation of NLRP3-related pathways, which may contribute to its overall metabolic improvements observed in our model. In this context, repurposing DSF as an anti-inflammatory agent represents a promising therapeutic strategy [ 37 ], particularly in metabolic diseases where chronic skeletal muscle inflammation plays a central role. Conclusion Our findings support the potential use of DSF as a treatment for metabolic diseases characterized by chronic low-grade inflammation. By specifically targeting GSDMD-NT oligomerization, DSF disrupts a key step in the inflammatory cascade, thereby reducing the release of IL-1β, a central mediator of inflammation in metabolic tissues. This mechanism shows the important role of GSDMD-NT in inflammation-related metabolic problems. In parallel, DSF not only attenuates inflammatory signaling in skeletal muscle but also improves insulin responsiveness and glucose disposal. Given its established safety profile, DSF emerges as a promising therapeutic candidate targeting GSDMD for potential application in obesity-associated insulin resistance and type 2 diabetes. Future clinical studies will be essential to confirm its efficacy and determine how it could be used to treat human metabolic disorders. Limitations This study provides experimental evidence suggesting a role for GSDMD-NT in skeletal muscle inflammation and insulin resistance. It shows that pharmacological inhibition with DSF improves glucose homeostasis in a diet-induced obesity model. However, some limitations should be acknowledged. First, although our results support a functional effect of DSF on insulin signaling, the study was not designed to dissect its molecular targets beyond GSDMD-NT. Second, our data indicate metabolic benefits in skeletal muscle from short-term DSF treatment; however, its long-term effects and translational relevance remain to be explored in future studies. Abbreviations AUC: area under the curve DSF: disulfiram FDB: flexor digitorum brevis GSDMD: gasdermin D GSDMD-NT: N-terminal fragment of gasdermin D GLUT4: glucose transporter type 4 HFD: high-fat diet IL-1β: interleukin-1β IPGTT: intraperitoneal glucose tolerance test IR: insulin resistance NCD: normal-chow diet NLRP3: NOD-, LRR-, pyrin domain-containing protein 3 S: sarcolemma T: triads TXNIP: thioredoxin-interacting protein Declarations Data availability The datasets and/or analyses during the current study are available from the corresponding author on reasonable request. Ethics approval All animal experiments were approved by the Animal Bioethics Committee of the Faculty of Dentistry, University of Chile (Protocol CBA 240423 FOUCH). Contributions Cynthia Cadagan : Writing – review & editing, Writing – original draft, Visualization, Supervision, Methodology, Investigation, Conceptualization, Formal analysis, Data curation. Javier Russell-Guzmán: Writing – review & editing, Writing – original draft, Visualization, Supervision, Methodology, Investigation, Conceptualization, Formal analysis, Data curation. Luan Americo da Silva: Writing – review & editing, Investigation, Formal analysis. Paula Montaña: Writing – review & editing, Methodology, Investigation, Formal analysis. Genaro Barrientos: Writing – review & editing, Investigation, Methodology. Sonja Buvinic : Writing – review & editing, Funding acquisition, Investigation. Gladys Tapia : Writing – review & editing, Supervision, Investigation. Manuel Estrada : Writing – review & editing, Writing – original draft, Visualization, Supervision. Paola Llanos : Writing – review & editing, Writing – original draft, Visualization, Supervision, Project administration, Investigation, Resources, Funding acquisition. Declaration of competing interest The authors have declared no competing interests and no personal financial interests. Acknowledgments We thank Mr. Matías Ayala for providing isolated muscle fibers and his valuable technical assistance. Funding This work was supported by FONDECYT 1231103 (Paola Llanos) and 1241661 (Sonja Buvinic). References Saeedi P, Petersohn I, Salpea P, et al (2019) Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: Results from the International Diabetes Federation Diabetes Atlas, 9th edition. Diabetes Res Clin Pract 157:107843. https://doi.org/10.1016/j.diabres.2019.107843 James DE, Stöckli J, Birnbaum MJ (2021) The aetiology and molecular landscape of insulin resistance. Nat Rev Mol Cell Biol 22(11):751–771. https://doi.org/10.1038/s41580-021-00390-6 Kim MS, Shim I, Fahed AC, et al (2024) Association of genetic risk, lifestyle, and their interaction with obesity and obesity-related morbidities. Cell Metab 36(7):1494-1503.e3. https://doi.org/10.1016/j.cmet.2024.06.004 DeFronzo RA, Gunnarsson R, Björkman O, Olsson M, Wahren J (1985) Effects of insulin on peripheral and splanchnic glucose metabolism in noninsulin-dependent (type II) diabetes mellitus. J Clin Invest 76(1):149–155. https://doi.org/10.1172/JCI111938 Saltiel AR, Olefsky JM (2017) Inflammatory mechanisms linking obesity and metabolic disease. J Clin Invest 127(1):1–4. https://doi.org/10.1172/JCI92035 Kelley N, Jeltema D, Duan Y, He Y (2019) The NLRP3 Inflammasome: An Overview of Mechanisms of Activation and Regulation. Int J Mol Sci 20(13):3328. https://doi.org/10.3390/ijms20133328 Rheinheimer J, de Souza BM, Cardoso NS, Bauer AC, Crispim D (2017) Current role of the NLRP3 inflammasome on obesity and insulin resistance: A systematic review. Metabolism 74:1–9. https://doi.org/10.1016/j.metabol.2017.06.002 Américo-Da-Silva L, Aguilera J, Quinteros-Waltemath O, et al (2021) Activation of the NLRP3 Inflammasome Increases the IL-1β Level and Decreases GLUT4 Translocation in Skeletal Muscle during Insulin Resistance. Int J Mol Sci 22(19):10212. https://doi.org/10.3390/ijms221910212 Lieberman J, Wu H, Kagan JC (2019) Gasdermin D activity in inflammation and host defense. Sci Immunol 4(39):eaav1447. https://doi.org/10.1126/sciimmunol.aav1447 Yang J, Liu Z, Wang C, et al (2018) Mechanism of gasdermin D recognition by inflammatory caspases and their inhibition by a gasdermin D-derived peptide inhibitor. Proc Natl Acad Sci U S A 115(26):6792–6797. https://doi.org/10.1073/pnas.1800562115 Kuang S, Zheng J, Yang H, et al (2017) Structure insight of GSDMD reveals the basis of GSDMD autoinhibition in cell pyroptosis. Proc Natl Acad Sci U S A 114(40):10642–10647. https://doi.org/10.1073/pnas.1708194114 Heilig R, Dick MS, Sborgi L, Meunier E, Hiller S, Broz P (2018) The Gasdermin-D pore acts as a conduit for IL-1β secretion in mice. Eur J Immunol 48(4):584–592. https://doi.org/10.1002/eji.201747404 Hu JJ, Liu X, Xia S, et al (2020) FDA-approved disulfiram inhibits pyroptosis by blocking gasdermin D pore formation. Nat Immunol 21(7):736–745. https://doi.org/10.1038/s41590-020-0669-6 Fuller RK, Branchey L, Brightwell DR, et al (1986) Disulfiram treatment of alcoholism. A Veterans Administration cooperative study. JAMA 256(11):1449–1455 Bernier M, Mitchell SJ, Wahl D, et al (2020) Disulfiram Treatment Normalizes Body Weight in Obese Mice. Cell Metab 32(2):203-214.e4. https://doi.org/10.1016/j.cmet.2020.04.019 Bernier M, Harney D, Koay YC, et al (2020) Elucidating the mechanisms by which disulfiram protects against obesity and metabolic syndrome. NPJ Aging Mech Dis 6:8. https://doi.org/10.1038/s41514-020-0046-6 Sánchez-Aguilera P, Diaz-Vegas A, Campos C, et al (2018) Role of ABCA1 on membrane cholesterol content, insulin-dependent Akt phosphorylation and glucose uptake in adult skeletal muscle fibers from mice. Biochim Biophys Acta Mol Cell Biol Lipids 1863(12):1469–1477. https://doi.org/10.1016/j.bbalip.2018.09.005 Hidalgo C, Jorquera J, Tapia V, Donoso P (1993) Triads and transverse tubules isolated from skeletal muscle contain high levels of inositol 1,4,5-trisphosphate. J Biol Chem 268(20):15111–15117 Shoelson SE, Lee J, Goldfine AB (2006) Inflammation and insulin resistance. J Clin Invest 116(7):1793–1801. https://doi.org/10.1172/JCI29069 Ellulu MS, Patimah I, Khaza’ai H, Rahmat A, Abed Y (2017) Obesity and inflammation: the linking mechanism and the complications. Arch Med Sci AMS 13(4):851–863. https://doi.org/10.5114/aoms.2016.58928 Soták M, Clark M, Suur BE, Börgeson E (2025) Inflammation and resolution in obesity. Nat Rev Endocrinol 21(1):45–61. https://doi.org/10.1038/s41574-024-01047-y D’Espessailles A, Mora YA, Fuentes C, Cifuentes M (2018) Calcium-sensing receptor activates the NLRP3 inflammasome in LS14 preadipocytes mediated by ERK1/2 signaling. J Cell Physiol 233(8):6232–6240. https://doi.org/10.1002/jcp.26490 Csak T, Ganz M, Pespisa J, Kodys K, Dolganiuc A, Szabo G (2011) Fatty acid and endotoxin activate inflammasomes in mouse hepatocytes that release danger signals to stimulate immune cells. Hepatol Baltim Md 54(1):133–144. https://doi.org/10.1002/hep.24341 Russell-Guzmán J, Américo-Da Silva L, Cadagan C, et al (2024) Activation of the ROS/TXNIP/NLRP3 pathway disrupts insulin-dependent glucose uptake in skeletal muscle of insulin-resistant obese mice. Free Radic Biol Med 222:187–198. https://doi.org/10.1016/j.freeradbiomed.2024.06.011 Vandanmagsar B, Youm Y-H, Ravussin A, et al (2011) The NLRP3 inflammasome instigates obesity-induced inflammation and insulin resistance. Nat Med 17(2):179–188. https://doi.org/10.1038/nm.2279 Mari SA, Pluhackova K, Pipercevic J, et al (2022) Gasdermin-A3 pore formation propagates along variable pathways. Nat Commun 13(1):2609. https://doi.org/10.1038/s41467-022-30232-8 Schaefer SL, Hummer G (2022) Sublytic gasdermin-D pores captured in atomistic molecular simulations. eLife 11:e81432. https://doi.org/10.7554/eLife.81432 Margheritis E, Kappelhoff S, Danial J, et al (2024) Gasdermin D cysteine residues synergistically control its palmitoylation-mediated membrane targeting and assembly. EMBO J 43(19):4274–4297. https://doi.org/10.1038/s44318-024-00190-6 Devant P, Boršić E, Ngwa EM, et al (2023) Gasdermin D pore-forming activity is redox-sensitive. Cell Rep 42(1):112008. https://doi.org/10.1016/j.celrep.2023.112008 Merz KE, Thurmond DC (2020) Role of Skeletal Muscle in Insulin Resistance and Glucose Uptake. Compr Physiol 10(3):785–809. https://doi.org/10.1002/cphy.c190029 Pedersen BK, Febbraio MA (2012) Muscles, exercise and obesity: skeletal muscle as a secretory organ. Nat Rev Endocrinol 8(8):457–465. https://doi.org/10.1038/nrendo.2012.49 Artlett CM (2012) The Role of the NLRP3 Inflammasome in Fibrosis. Open Rheumatol J 6:80–86. https://doi.org/10.2174/1874312901206010080 Jorquera G, Russell J, Monsalves-Álvarez M, et al (2021) NLRP3 Inflammasome: Potential Role in Obesity Related Low-Grade Inflammation and Insulin Resistance in Skeletal Muscle. Int J Mol Sci 22(6):3254. https://doi.org/10.3390/ijms22063254 Kudo S, Mizuno K, Hirai Y, Shimizu T (1990) Clearance and tissue distribution of recombinant human interleukin 1 beta in rats. Cancer Res 50(18):5751–5755 Gill RM, O’Brien M, Young A, Gardiner D, Mailloux RJ (2018) Protein S-glutathionylation lowers superoxide/hydrogen peroxide release from skeletal muscle mitochondria through modification of complex I and inhibition of pyruvate uptake. PloS One 13(2):e0192801. https://doi.org/10.1371/journal.pone.0192801 Hirschenson J, Mailloux RJ (2021) The glutathionylation agent disulfiram augments superoxide/hydrogen peroxide production when liver mitochondria are oxidizing ubiquinone pool-linked and branched chain amino acid substrates. Free Radic Biol Med 172:1–8. https://doi.org/10.1016/j.freeradbiomed.2021.05.030 Omran Z, Sheikh R, Baothman OA, Zamzami MA, Alarjah M (2020) Repurposing Disulfiram as an Anti-Obesity Drug: Treating and Preventing Obesity in High-Fat-Fed Rats. Diabetes Metab Syndr Obes Targets Ther 13:1473–1480. https://doi.org/10.2147/DMSO.S254267 Nagai N, Murao T, Okamoto N, Ito Y (2009) Disulfiram reduces elevated blood glucose levels in Otsuka Long-Evans Tokushima Fatty (OLETF) rats, a model of type 2 diabetes. J Oleo Sci 58(9):485–490. https://doi.org/10.5650/jos.58.485 Jones JP, Tapscott EB, Olson AL, Pessin JE, Dohm GL (1998) Regulation of glucose transporters GLUT-4 and GLUT-1 gene transcription in denervated skeletal muscle. J Appl Physiol Bethesda Md 1985 84(5):1661–1666. https://doi.org/10.1152/jappl.1998.84.5.1661 Additional Declarations No competing interests reported. Supplementary Files S1.tif Supplementary Figure 1. Localization of GSDMD NT in the FDB muscle of mice fed with NCD and HFD. Representative confocal microscopy images of isolated FDB muscle fibers (intermediate section) from the NCD and HFD groups, showing the localization of GSDMD-NT (green) and NLRP3 (red). A profile plot analysis was performed in the areas marked by white boxes, representing the area under the curve (AUC) of fluorescence intensity. Scale bar = 40 μm. NCD: normal-control diet; HFD: high-fat diet; FDB: flexor digitorum brevis. S2.tif Supplementary Figure 2. A High-fat diet increases the co-localization of GSDMD-NT with DHPR in the FDB muscle of insulin-resistant mice in the FDB muscle of mice fed with NCD and HFD. (a) Enlarged representative confocal microscopy images of isolated FDB muscle fibers from the NCD and HFD groups, illustrating the localization of GSDMD-NT (green) and DHPR (red). Scale bar = 40 μm. (b) Manders' M1 and M2 co-localization coefficients for GSDMD-NT/DHPR and DHPR/GSDMD-NT, respectively (n = 4 independent experiments). Co-localization analysis was performed using the JACoP plugin in Fiji, with intensity threshold determined by the Costes randomization method. Values are presented as mean ± SEM and expressed relative to the NCD condition. The data were analyzed using the Mann-Whitney U test for statistical evaluation. ** p < 0.01 vs NCD. (c) Representative images of a Western blot assay for GSDMD-NT in triads isolated by microsomal fractionation. Ponceau Red membrane staining and representative bands showing the localization of GSDMD-NT in triads and sarcoplasm (n = 3 for 1 experiment). T: Triads; S: Sarcoplasm. NCD: normal control diet; HFD: high-fat diet; FDB: flexor digitorum brevis. S3.tif Supplementary Figure 3. Increased IL-1β levels in the culture medium of FDB and gastrocnemius from mice fed with NCD and HFD. IL-1β release levels were measured in the culture medium of FDB (n = 7) and gastrocnemius (n = 10), respectively, and expressed as pg/mL. Values are presented as mean ± SEM and expressed relative to the NCD condition. The data were analyzed using the Mann-Whitney U test for statistical evaluation. * p < 0.05 and *** p < 0.001 vs NCD. NCD: normal-control diet; HFD: high-fat diet; FDB: flexor digitorum brevis. S4.tif Supplementary Figure 4. Body mass, fasting blood glucose and intraperitoneal glucose tolerance test in HFD-fed mice before disulfiram treatment. HFD-fed 7-week-old mice were analyzed for different procedures prior to administration of either a vehicle (HFD) or disulfiram (HFD+DSF). (a) Body mass (n = 10). (b) Fasting blood glucose (n = 10). (c) Intraperitoneal glucose tolerance test (IPGTT) and its area under the curve (AUC) (n = 10). Results are presented as mean ± SEM. The data were analyzed using the Mann-Whitney U test for statistical evaluation. HFD: high-fat diet. Cite Share Download PDF Status: Published Journal Publication published 26 Nov, 2025 Read the published version in Scientific Reports → Version 1 posted Editorial decision: Revision requested 08 Sep, 2025 Reviews received at journal 07 Sep, 2025 Reviewers agreed at journal 25 Aug, 2025 Reviews received at journal 18 Aug, 2025 Reviewers agreed at journal 16 Aug, 2025 Reviewers invited by journal 04 Aug, 2025 Editor assigned by journal 01 Aug, 2025 Editor invited by journal 24 Jul, 2025 Submission checks completed at journal 18 Jul, 2025 First submitted to journal 18 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7117118","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Article","associatedPublications":[],"authors":[{"id":495838834,"identity":"d0d0548c-c2fa-45fc-b2b5-6d54eaab9828","order_by":0,"name":"Cynthia Cadagan","email":"","orcid":"","institution":"Universidad de Chile","correspondingAuthor":false,"prefix":"","firstName":"Cynthia","middleName":"","lastName":"Cadagan","suffix":""},{"id":495838835,"identity":"c6336874-c7dd-419b-a250-a84fafe74717","order_by":1,"name":"Javier Russell-Guzmán","email":"","orcid":"","institution":"Universidad Santo Tomás","correspondingAuthor":false,"prefix":"","firstName":"Javier","middleName":"","lastName":"Russell-Guzmán","suffix":""},{"id":495838836,"identity":"7594de93-19c9-4da0-8860-20c94e562555","order_by":2,"name":"Luan Américo-Da-Silva","email":"","orcid":"","institution":"Universidad de Chile","correspondingAuthor":false,"prefix":"","firstName":"Luan","middleName":"","lastName":"Américo-Da-Silva","suffix":""},{"id":495838837,"identity":"86af9a51-1fe7-4c72-90be-9319fefe79e8","order_by":3,"name":"Paula Montaña","email":"","orcid":"","institution":"Universidad de Chile","correspondingAuthor":false,"prefix":"","firstName":"Paula","middleName":"","lastName":"Montaña","suffix":""},{"id":495838838,"identity":"4dcc9449-2d17-4ac9-9fc3-16c981144e29","order_by":4,"name":"Genaro Barrientos","email":"","orcid":"","institution":"CEMC, Universidad de Chile","correspondingAuthor":false,"prefix":"","firstName":"Genaro","middleName":"","lastName":"Barrientos","suffix":""},{"id":495838839,"identity":"31bcd457-5c18-4724-8076-21d7b2d13e5c","order_by":5,"name":"Sonja Buvinic","email":"","orcid":"","institution":"Universidad de Chile","correspondingAuthor":false,"prefix":"","firstName":"Sonja","middleName":"","lastName":"Buvinic","suffix":""},{"id":495838840,"identity":"7f6bc7d0-1332-4811-afe3-e72292bd4260","order_by":6,"name":"Gladys Tapia","email":"","orcid":"","institution":"ICBM, Universidad de Chile","correspondingAuthor":false,"prefix":"","firstName":"Gladys","middleName":"","lastName":"Tapia","suffix":""},{"id":495838841,"identity":"26cb9279-a40e-47a0-894b-4772557427e3","order_by":7,"name":"Manuel Estrada","email":"","orcid":"","institution":"ICBM, Universidad de Chile","correspondingAuthor":false,"prefix":"","firstName":"Manuel","middleName":"","lastName":"Estrada","suffix":""},{"id":495838842,"identity":"ffcb6abd-62d7-4c47-8247-04379ebfa87a","order_by":8,"name":"Paola Llanos","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAABKElEQVRIie2RMUvEMBTHUx4kS+qtgZP2K/Q48BQFR79Gi2AXD27scJRKIJNwq4LgV/C+QUqgLv0Agg4F4SaHgOMtpi3eDaa4Cua3PHjkx3v/PIQcjr8IgaItAUJxW48Rgq4v6UFbGosCXqdMO0UitldwW+JhJSl2So9EQ8oMvJvPRZanK3JZveuMBeEFNECXb4eYFJ62KCfc4+O7Ws3vbzdpJGs2nSgcAa02FFMJzKJEyivGvpDzp5frI1YKlqw5isAvFMUsxrbFjMK3vsjTaK8Q3SthM6QIMwXinfII9HsKsiomiziltZqYLFesNllMkEX5UBmFJtyWZUa4eqVZHo7Mj7EsOwvC1fO6+Viq8xFRpdaWxX52ZHuUjv5kvyuh9Z3D4XD8Z74ADEhiGDYvDf4AAAAASUVORK5CYII=","orcid":"","institution":"Universidad de Chile","correspondingAuthor":true,"prefix":"","firstName":"Paola","middleName":"","lastName":"Llanos","suffix":""}],"badges":[],"createdAt":"2025-07-14 05:24:51","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7117118/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7117118/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1038/s41598-025-30058-6","type":"published","date":"2025-11-26T15:58:20+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":88428452,"identity":"32de840f-ed84-4452-9ea2-bb7ca343bf12","added_by":"auto","created_at":"2025-08-06 10:15:40","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":43711220,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eHigh-fat diet feeding increases protein levels of GSDMD-NT in the FDB muscle of insulin-resistant mice.\u003c/strong\u003e (a) Relative mRNA levels of GSDMD in isolated adult fibers quantified by RT-qPCR and normalized to the housekeeping gene RplpO (n = 6). (b) Representative Western blot and densitometric quantification of GSDMD-NT protein levels in muscle homogenates (n = 5). β-tubulin was used as a loading control. (c) Representative confocal microscopy images of isolated FDB fibers from the NCD and HFD groups, illustrating the localization of GSDMD-NT (green) and NLRP3 (red), along with the quantification of the average fluorescence intensity of GSDMD-NT and NLRP3 in both groups (n = 3 independent experiments). Scale bar = 40 μm. Results are presented as mean ± SEM and expressed relative to the NCD group. The data were analyzed using the Mann-Whitney \u003cem\u003eU \u003c/em\u003etest for statistical evaluation. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 and ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001 vs NCD. NCD: normal-control diet; HFD: high-fat diet; FDB: flexor digitorum brevis.\u003c/p\u003e","description":"","filename":"Figure1.png","url":"https://assets-eu.researchsquare.com/files/rs-7117118/v1/f76d0dcb437374604f86bba3.png"},{"id":88427123,"identity":"18ad095b-093f-49ae-bbf1-c95eb49c5f6e","added_by":"auto","created_at":"2025-08-06 10:07:40","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":8930621,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA high-fat diet enhances GSDMD-NT oligomerization and promotes IL-1β release in the skeletal muscle of insulin-resistant mice.\u003c/strong\u003e (a) Representative Western blot assay and quantification of the oligomer/monomer ratio of GSDMD-NT in non-reducing gels from FDB muscle (n = 4). (b) IL-1β release levels were measured in the culture medium of FDB (n = 7) and gastrocnemius (n = 10), respectively, and expressed as pg/mg of protein. Data are presented as mean ± SEM and expressed relative to values from the NCD group. The data were analyzed using the Mann-Whitney \u003cem\u003eU\u003c/em\u003e test for statistical analysis. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 vs NCD. NCD: normal-control diet; HFD: high-fat diet; FDB: flexor digitorum brevis.\u003c/p\u003e","description":"","filename":"Figure2.png","url":"https://assets-eu.researchsquare.com/files/rs-7117118/v1/a2da28e1be0a7db0d3bf4082.png"},{"id":88427111,"identity":"a4a83c3e-6856-4ec1-b960-d5b89c397ba7","added_by":"auto","created_at":"2025-08-06 10:07:39","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":18759710,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDisulfiram administration improves physiological parameters in obese insulin-resistant mice.\u003c/strong\u003e HFD-fed 7-week-old mice were intraperitoneally injected with DSF 50 mg/kg or vehicle three times per week for 3 weeks. (a) Body mass progression (n = 10). (b) Weekly variation in food intake (n = 10). (c) Intraperitoneal glucose tolerance test (IPGTT) and its area under the curve (AUC). (n = 10). (d) Epididymal adipose tissue mass (n = 9). (e) Fasting insulinemia (n = 9). (f) Plasma IL-1β levels in HFD-fed mice (n = 7). Results are presented as mean ± SEM and expressed relative to the HFD group. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, ***\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 and ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001 vs. HFD. HFD: High-fat diet, HFD DSF: High-fat diet injected with disulfiram, FDB: flexor digitorum brevis.\u003c/p\u003e","description":"","filename":"Figure3.png","url":"https://assets-eu.researchsquare.com/files/rs-7117118/v1/5e48f8be829eeb0256d037f1.png"},{"id":88427153,"identity":"fea47ef2-e7fc-46c5-8931-0bf60e767af9","added_by":"auto","created_at":"2025-08-06 10:07:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":75441116,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDisulfiram promotes insulin-dependent Akt phosphorylation and increases glucose uptake in FDB muscle fibers in insulin-resistant mice.\u003c/strong\u003e Ratio of phosphorylated to total Akt (P-Akt/Akt) in FDB and 2-NBDG uptake assay in FDB muscle fibers. (a) Representative Western blot assay and quantification of P-Akt protein levels in muscle homogenates (n = 4). Total Akt was used as a loading control. (b) Representative epifluorescence images (green fluorescence) and quantification of 2-NBDG uptake (n = 4 independent experiments). 2-NBDG was used at 300 µmol/L; insulin at 100 nmol/L for 20 minutes. (Scale bar = 50 µm). For the analysis of four groups, a two-way ANOVA with Tukey’s multiple comparisons test was performed. Results are presented as mean ± SEM and expressed relative to the HFD group. * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, and ****\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.0001 vs. HFD. HFD: High-fat diet, HFD+DSF: High-fat diet injected with 50 mg/kg three times per week for 3 weeks. FDB: flexor digitorum brevis.\u003c/p\u003e","description":"","filename":"Figure4.png","url":"https://assets-eu.researchsquare.com/files/rs-7117118/v1/a37ea8800a9e2faedfd6adfb.png"},{"id":88427115,"identity":"91f4c5ba-3680-4839-92a3-ef4b6e80627a","added_by":"auto","created_at":"2025-08-06 10:07:39","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":23803722,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDisulfiram administration reduces GSDMD-NT oligomerization and IL-1β \u0026nbsp;release from the gastrocnemius muscle of mice fed a high-fat diet.\u003c/strong\u003e (a) Representative Western blot assay and quantification of the oligomer/monomer ratio of GSDMD-NT in non-reducing gels (n = 4). (b) IL-1β release levels were measured in the culture medium (n = 6) and expressed as pg/mg of protein. Values are presented as the mean ± SEM and expressed relative to the HFD condition incubated with DMSO. The data were analyzed using the Mann-Whitney \u003cem\u003eU\u003c/em\u003e test for statistical evaluation. *\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 vs HFD. HFD: high-fat diet, DMSO: Dimethyl sulfoxide, DSF: Disulfiram at a concentration of 10 nmol/L.\u003c/p\u003e","description":"","filename":"Figure5.png","url":"https://assets-eu.researchsquare.com/files/rs-7117118/v1/0110e3bf3b4b0983cea25051.png"},{"id":88427098,"identity":"f8998205-840f-443c-b16d-5a3a8084e19b","added_by":"auto","created_at":"2025-08-06 10:07:37","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":551999,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7117118/v1/f221c2a2-eb64-41bc-9b8f-5cfd74e85d2e.pdf"},{"id":88427117,"identity":"c04fbce1-015c-443c-9fd6-60c3cef6dfbd","added_by":"auto","created_at":"2025-08-06 10:07:39","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":22951594,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure 1. Localization of GSDMD NT in the FDB muscle of mice fed with NCD and HFD. \u003c/strong\u003eRepresentative confocal microscopy images of isolated FDB muscle fibers (intermediate section) from the NCD and HFD groups, showing the localization of GSDMD-NT (green) and NLRP3 (red). A profile plot analysis was performed in the areas marked by white boxes, representing the area under the curve (AUC) of fluorescence intensity. Scale bar = 40 μm. NCD: normal-control diet; HFD: high-fat diet; FDB: flexor digitorum brevis.\u003c/p\u003e","description":"","filename":"S1.tif","url":"https://assets-eu.researchsquare.com/files/rs-7117118/v1/b8995ba046f869278533e3d4.tif"},{"id":88427121,"identity":"f8bded9b-f5c6-4fbf-a8a9-6f3a69b184e3","added_by":"auto","created_at":"2025-08-06 10:07:40","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":29400362,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure 2. A High-fat diet increases the co-localization of GSDMD-NT with DHPR in the FDB muscle of insulin-resistant mice in the FDB muscle of mice fed with NCD and HFD. \u003c/strong\u003e(a) Enlarged representative confocal microscopy images of isolated FDB muscle fibers from the NCD and HFD groups, illustrating the localization of GSDMD-NT (green) and DHPR (red). Scale bar = 40 μm. (b) Manders' M1 and M2 co-localization coefficients for GSDMD-NT/DHPR and DHPR/GSDMD-NT, respectively (n = 4 independent experiments). Co-localization analysis was performed using the JACoP plugin in Fiji, with intensity threshold determined by the Costes randomization method. Values are presented as mean ± SEM and expressed relative to the NCD condition. The data were analyzed using the Mann-Whitney \u003cem\u003eU\u003c/em\u003e test for statistical evaluation. **\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 vs NCD. (c) Representative images of a Western blot assay for GSDMD-NT in triads isolated by microsomal fractionation. Ponceau Red membrane staining and representative bands showing the localization of GSDMD-NT in triads and sarcoplasm (n = 3 for 1 experiment). T: Triads; S: Sarcoplasm. NCD: normal control diet; HFD: high-fat diet; FDB: flexor digitorum brevis.\u003c/p\u003e","description":"","filename":"S2.tif","url":"https://assets-eu.researchsquare.com/files/rs-7117118/v1/54f5bad1edd70bf18cca4c95.tif"},{"id":88427112,"identity":"b22fc3a9-0086-40db-9be6-480c5ef9a207","added_by":"auto","created_at":"2025-08-06 10:07:39","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":1357746,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure 3. Increased IL-1β levels in the culture medium of FDB and gastrocnemius from mice fed with NCD and HFD.\u003c/strong\u003e IL-1β release levels were measured in the culture medium of FDB (n = 7) and gastrocnemius (n = 10), respectively, and expressed as pg/mL. Values are presented as mean ± SEM and expressed relative to the NCD condition. The data were analyzed using the Mann-Whitney \u003cem\u003eU\u003c/em\u003e test for statistical evaluation. * \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 and *** \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 vs NCD. NCD: normal-control diet; HFD: high-fat diet; FDB: flexor digitorum brevis.\u003c/p\u003e","description":"","filename":"S3.tif","url":"https://assets-eu.researchsquare.com/files/rs-7117118/v1/07328ba46ff638e4f4834840.tif"},{"id":88427130,"identity":"7ede61a4-17b3-4fb3-af67-3d994a07c2f7","added_by":"auto","created_at":"2025-08-06 10:07:40","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":3242398,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSupplementary Figure 4.\u003c/strong\u003e \u003cstrong\u003eBody mass, fasting blood glucose and intraperitoneal glucose tolerance test in HFD-fed mice before disulfiram treatment.\u003c/strong\u003e HFD-fed 7-week-old mice were analyzed for different procedures prior to administration of either a vehicle (HFD) or disulfiram (HFD+DSF). (a) Body mass (n = 10). (b) Fasting blood glucose (n = 10). (c) Intraperitoneal glucose tolerance test (IPGTT) and its area under the curve (AUC) (n = 10). Results are presented as mean ± SEM. The data were analyzed using the Mann-Whitney \u003cem\u003eU\u003c/em\u003e test for statistical evaluation. HFD: high-fat diet.\u003c/p\u003e","description":"","filename":"S4.tif","url":"https://assets-eu.researchsquare.com/files/rs-7117118/v1/acb78910ead8a8114e65c2d4.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Disulfiram inhibits Gasdermin D pores formation and improves insulin-dependent glucose uptake and glucose homeostasis in skeletal muscle of obesity-induced insulin-resistant mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eObesity is a multifactorial condition arising from the interplay of genetic, environmental, and lifestyle factors, and is associated with chronic metabolic dysfunction [1], a key driver of insulin resistance (IR) [2]. This metabolic impairment is closely linked to the development of type 2 diabetes mellitus, dyslipidemia, and cardiovascular disease, all of which are major contributors to global morbidity and mortality [3]. Skeletal muscle plays a central role in glucose homeostasis and serves as the primary site for insulin-stimulated glucose uptake [4]. Additionally, it functions as a source of proinflammatory cytokines, thereby linking obesity to systemic low-grade inflammation [5]. A critical mechanism connecting innate immunity to metabolic dysfunction is the activation of inflammasomes, a multiprotein complex that drives the release of proinflammatory cytokines. Among these, the NLRP3 (NOD-, LRR-, pyrin domain-containing protein 3) inflammasome is the most extensively studied in chronic disease contexts, playing a central role through activation of caspase-1, which promotes the maturation and secretion of interleukin-1β (IL-1β) [6, 7]. We recently demonstrated that NLRP3 components are expressed in skeletal muscle, where they contribute to impaired glucose metabolism and promote IR [8]. Skeletal muscle from IR-obese mice exhibited NLRP3 hyperactivation, increased IL-1β expression, and reduced GLUT4 translocation in insulin response, which were reversed by pharmacological inhibition of NLRP3 [8].\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGasdermin D (GSDMD), a principal substrate of caspase-1, is a key effector of pyroptosis, a lytic proinflammatory form of programmed cell death downstream of NLRP3 activation [9]. Upon cleavage by caspase-1, the C-terminal inhibitory domain is removed, liberating the N-terminal fragment (GSDMD-NT), which oligomerizes and integrates into the plasma membrane to form pores. These pores facilitate the release of proinflammatory cytokines, notably IL-1β, also independently of complete cell lysis [10–12]. This sublytic activity provides a mechanism for sustained inflammatory signaling in metabolically active tissues. Previously, we observed increased full-length GSDMD protein abundance and localization in skeletal muscle fibers from high-fat diet (HFD)-fed mice [8], implicating a possible role for GSDMD in the pathogenesis of obesity-induced IR. By enabling cytokine release without overt pyroptosis, GSDMD may sustain a local proinflammatory milieu that impairs insulin signaling. Thus, the NLRP3–GSDMD axis emerges as a critical molecular link between obesity-induced inflammation and metabolic dysfunction in skeletal muscle.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eDisulfiram (DSF), a pharmacological inhibitor of GSDMD-NT pore formation, has gained attention for suppressing inflammation downstream of NLRP3 activation, without interfering with upstream signaling pathways [13]. Originally approved by the FDA for the treatment of chronic alcoholism as an aldehyde dehydrogenase inhibitor [14]. DSF has recently demonstrated metabolic benefits in rodent models, including reductions in body weight, adiposity, hyperglycemia, and IR as well as reversal of HFD–induced hepatic steatosis [15]. Despite these promising systemic effects, the role of this compound in skeletal muscle insulin sensitivity has not been explored. Omics analyzes showed that DSF modulates lipid metabolism, redox balance, and influences autophagic pathways in hepatic cells [16]. At the molecular level, DSF inhibits GSDMD-NT-dependent pore formation through covalent modification of a critical cysteine residue (Cys191 in humans, Cys192 in mice), which prevents oligomerization and IL-1β release without altering inflammasome assembly [16]. This selective blockade of downstream proinflammatory signaling and preservation of the innate immune sensing position DSF as a compelling candidate for drug repurposing in metabolic diseases. Nevertheless, its direct effects on skeletal muscle metabolism and insulin responsiveness remain to be elucidated.\u003c/p\u003e\n\u003cp\u003eIn this study, we tested the hypothesis that GSDMD-NT contributes to IL-1β-mediated skeletal muscle inflammation and IR, and that pharmacological inhibition with DSF can restore insulin responsiveness by preventing GSDMD-NT oligomerization and pore formation. To address this, we employed HFD-fed mice, a well-established model of obesity-induced IR. This study aims to elucidate a novel mechanistic link between inflammasome activation and muscle insulin sensitivity, and to explore further the therapeutic potential of targeting GSDMD as a strategy to mitigate metabolic inflammation and improve glucose homeostasis.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cem\u003eEthics statement\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAll animal procedures were approved by the Animal Bioethics Committee of the Faculty of Dentistry, University of Chile (Protocol CBA 240423 FOUCH). All methods were carried out in accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of the U.S. Department of Health and Human Services and American Veterinary Medical Association (AVMA) guidelines. The selected procedures were designed to minimize discomfort and distress while allowing for the collection of relevant metabolic and molecular data. Additionally, the study is reported in accordance with the ARRIVE guidelines (https://arriveguidelines.org).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eAnimals\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eA total of 96 male C57BL/6 mice, provided by the Animal Facility of the Faculty of Dentistry at the University of Chile, were used in this study. Animals were specific-pathogen-free (SPF), with no prior procedures before enrollment in the study. Prior to procedures, animals were maintained at 21\u0026deg;C with a 12:12-h light-dark cycle. Environmental enrichment was provided and included nesting materials, cardboard cones for shelter and exploration, and social housing with compatible animals. After 21 days, the animals were assigned to two groups: normal chow diet (NCD, n = 35), which received a standard diet (10% fat, 20% protein, and 70% carbohydrates). In contrast, the experimental group (n = 35) received, by 8 weeks, a high-fat diet (HFD) (60% fat, 20% protein, and 20% carbohydrates; D12492, Research Diets, New Brunswick, NJ, USA). A subgroup of HFD-fed mice (n = 20) received intraperitoneal injections of either vehicle (sunflower oil; HFD control) or disulfiram (HFD + DSF; Sigma) at 50 mg/kg body weight, 3 times per week from week 7 to 10. A separate group of HFD-fed mice was allocated for \u003cem\u003eex vivo\u003c/em\u003e muscle incubation experiments (n = 6). Each experimental group was assigned a numerical code, and tissue collection was performed in a randomized order based on this coding. Handling procedures were consistent across groups to minimize potential bias. For euthanasia, animals were placed in a plexiglass chamber, anesthetized with 5% isoflurane for 5 minutes, and then subjected to cervical dislocation.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIntraperitoneal glucose tolerance test (IPGTT)\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eFollowing a 4-hour fast, mice received an intraperitoneal glucose bolus (2 g/kg). Blood glucose levels were measured from tail vein samples at 0, 15, 30, 60, and 120 minutes using a One Touch II glucometer (Lifescan, Johnson \u0026amp; Johnson, Switzerland).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eCulture of isolated skeletal muscle fibers\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eAs previously described by [17], isolated fibers from the flexor digitorum brevis (FDB) muscle were obtained through enzymatic digestion with IV collagenase (Worthington, USA) for 90 minutes at 37 \u0026deg;C. Next, muscle tissue was mechanically dissociated by passing it through fire-polished Pasteur pipettes. The resulting fibers were plated on coverslips coated with Matrigel (Sigma-Aldrich, Burlington, MA, USA) and cultured in DMEM (25 mmol/L glucose), supplemented with 10% horse serum (Invitrogen, Waltham, MA, USA). Cultures were maintained in an incubator at 37 \u0026deg;C, 95% humidity, and 5% CO\u003csub\u003e2\u003c/sub\u003e.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003e2-NBDG uptake\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eThe assay was performed as reported previously [17]. Isolated FDB muscle fibers were cultured for 24 hours in serum-free DMEM, incubated for 5 minutes in glucose-free Krebs\u0026minus;Ringer buffer, and then stimulated with insulin (100 nmol/L, Actrapid, Novo Nordisk, Denmark) for 20 minutes. Fibers were exposed to fluorescent glucose\u003c/p\u003e\n\u003cp\u003eanalog 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl) amino]-2-deoxy-D-glucose (2-NBDG, 300 \u0026micro;mol/L; Invitrogen, Waltham, MA, USA) for 15 minutes, washed, and transferred to Krebs\u0026minus;Ringer buffer with 5.6 mmol/L glucose. Intracellular fluorescence images were acquired using a Cell Observer Z1 epifluorescence microscope (Carl Zeiss AG, Germany). The probe was excited at 488 nm, and the resulting emission was recorded at 525 nm using a bandpass filter, with a 40X objective (numerical aperture 0.55) and a 0.63X adapter. Fluorescence intensity was calculated by averaging intracellular signal measurements from 3 distinct regions of each fiber and subtracting the background fluorescence signal recorded in the extracellular medium. Approximately 128 individual fibers were analyzed for each condition. Image analysis and region of interest (ROI) quantification were performed using Fiji software (NIH, Bethesda, MD, USA).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003emRNA expression\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTotal RNA was extracted from FDB muscles using TRIzol\u0026reg; reagent (Invitrogen, USA), following the manufacturer\u0026rsquo;s protocol. Complementary DNA (cDNA) was synthesized via reverse transcription using 1 \u0026mu;g of total RNA and random primers. Quantitative PCR (qPCR) was carried out as previously described [8], employing the following primers (Integrated DNA Technologies, Ann Arbor, MI, USA): GSDMD (forward: TGAAGCACGTCTTGGAACAG; reverse: TCTTTTCATCCCAGCAGTCC). Expression levels were normalized against the housekeeping gene Rplp0 (forward: CTCCAAGCAGATGCAGCAGA; reverse: ATAGCCTTGCGCATCATGGT) and quantified using the 2\u003csup\u003e\u0026minus;\u0026Delta;\u0026Delta;Ct\u003c/sup\u003e method.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eWestern blotting\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTissue samples were lysed using a manual homogenizer and sonication at 4\u0026deg;C in RIPA buffer. Next, lysates were centrifuged at 3,000 \u0026times; g for 15 minutes. Protein (30 or 60 \u0026mu;g) from FDB and gastrocnemius samples, respectively, was resolved on 10% to 15% SDS-PAGE gels. The proteins were transferred to PVDF membranes and blocked with 5% bovine serum albumin (BSA). The membranes were incubated overnight at 4\u0026ordm;C with the following primary antibodies: NLRP3 (1:500, anti-rat, R\u0026amp;D Systems, Minneapolis, MN, USA), \u0026beta;-tubulin (1:2,000), GAPDH (1:10,000), phospho-Akt Ser473 (1:2,000), and total Akt (1:2,000), all from Cell Signaling Technology (anti-rabbit, Danvers, MA, USA); and GSDMD-NT (1:500, anti-rabbit, Abcam, Cambridge, MA). After incubation with species-specific secondary antibodies for 2 hours, protein bands were visualized using the LI-COR Odyssey\u0026reg; XF imaging system and Image Studio software (Lincoln, NE, USA). Densitometric analyses were performed using Fiji software (NIH, Bethesda, MD, USA), and figures were prepared using the Sciugo platform.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eEvaluation of GSDMD Oligomers\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eTo assess GSDMD oligomerization in FDB or gastrocnemius muscle, homogenate samples were initially incubated for 5 minutes with 10 \u0026mu;g/mLcatalase (Sigma-Aldrich, Burlington, MA, USA), followed by 10 minutes incubation in cold phosphate-buffered saline (PBS) containing 100 mmol/LN-ethylmaleimide (NEM; Sigma) at 4 \u0026deg;C to alkylate free cysteine residues. Tissue homogenization was then carried out at 4 \u0026deg;C using a handheld homogenizer (D1000, Biolab, Madrid, Spain), followed by sonication in cold RIPA lysis buffer (Sigma-Aldrich, Burlington, MA, USA) supplemented with protease inhibitors (Basilea, Switzerland) and 100 mmol/L NEM. Lysis and supernatant collection were carried out as previously described for Western blot analysis. To evaluate the effect of disulfiram (DSF), gastrocnemius muscles from HFD-fed mice were enzymatically dissociated with type IV collagenase for 30 minutes and cultured \u003cem\u003eex vivo\u003c/em\u003e for 24 hours in the presence or absence of 10 nmol/LDSF.\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eMicrosomal fractionation\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eSkeletal muscles from the trunk and lower limbs of NCD- or HFD-fed mice were homogenized using an Ultra-Turrax\u0026reg; homogenizer (IKA, Germany) in buffer A (150 mmol/L KCl, 5 mmol/LMgSO\u003csub\u003e4\u003c/sub\u003e, 20 mmol/LMOPS/Tris, pH 6.8) containing protease inhibitors [leupeptin (1 \u0026micro;g/mL), pepstatin (1 \u0026micro;g/mL), benzamidine (0.4 mmol/L), and phenylmethylsulfonyl fluoride (1 mmol/L)]. Homogenates were centrifuged at 1,380 \u0026times; g for 30 minutes at 4 \u0026deg;C. Pellets were re-extracted, and the combined supernatant was centrifuged at 17,000 \u0026times; g for 30 minutes at 4\u0026deg;C to isolate membrane fractions. Pellets were resuspended in buffer A and centrifuged again at 1,380 x g to remove contractile proteins. The resulting supernatant was subjected to a second 17,000 x g centrifugation for 30 minutes at 4\u0026deg;C. The final pellet, enriched in triad structures (T-tubule), was washed in buffer B (300 mmol/L sucrose, 20 mmol/L MOPS/Tris, pH 6.8) with protease inhibitors, centrifuged again, resuspended in a minimal volume of buffer B, snap-frozen in liquid nitrogen, and stored at \u0026minus;80\u0026deg;C [18].\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eImmunofluorescence imaging\u0026nbsp;\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eIsolated FDB fibers plated on 12 mm Matrigel-coated coverslips were fixed in 4% paraformaldehyde, permeabilized with 0.01% Triton X-100, and blocked in 1% BSA/PBS for 1 hour. Fibers were incubated overnight at 4 \u0026deg;C with primary antibodies against anti-GSDMD-NT (1:300, anti-rabbit, Abcam, Cambridge, MA), anti-NLRP3 (1:500, R\u0026amp;D Systems, Minneapolis, MN, USA), and anti-DPHR (1:500, Invitrogen, Waltham, MA, USA), followed by Alexa Fluor-conjugated secondary antibodies (1:250, Invitrogen, Waltham, MA, USA) for 1 hour. Fluorescence images were acquired using a Nikon C2+ confocal microscope (40X, NA 1.3) and analyzed using Fiji software (NIH, Bethesda, MD, USA).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eIL-1\u0026beta; levels in plasma and cultured muscle fibers\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003ePlasma levels of IL-1\u0026beta; in NCD, HFD, and HFD + DSF mice were determined using a commercial ELISA kit (R\u0026amp;D Systems, USA) according to the manufacturer\u0026apos;s instructions. To assess IL-1\u0026beta; in culture media of muscle fibers, FDB and gastrocnemius muscle from NCD and HFD mice were digested with type IV collagenase for 30 minutes and cultured for 24 hours with or without 10 nmol/L DSF. IL-1\u0026beta; levels were normalized to muscle weight (pg/mg).\u003c/p\u003e\n\u003cp\u003e\u003cem\u003eStatistical analysis\u003c/em\u003e\u003c/p\u003e\n\u003cp\u003eData are presented as mean \u0026plusmn; SEM. Comparisons between and within multiple groups were assessed using two-way ANOVA followed by Tukey \u003cem\u003epost-hoc\u003c/em\u003e test. The Mann\u0026ndash;Whitney \u003cem\u003eU\u003c/em\u003e test was used to compare two independent groups, and the Wilcoxon signed-rank test was applied for paired comparisons of cultures derived from the same animal under two distinct conditions. A \u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05 was considered statistically significant. All analyses and graphical representations were performed using GraphPad Prism 9 (GraphPad Software Inc., San Diego, CA, USA).\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cem\u003eElevated GSDMD-NT protein levels in skeletal muscle from HDF-fed mice.\u003c/em\u003e\u003c/p\u003e\u003cp\u003eWe analyzed whether GSDMD-NT was differentially expressed in the skeletal muscle of obesity-induced IR mice. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e, no significant differences were observed in the mRNA expression levels of GSDMD in muscle fibers isolated from HFD-fed mice compared to NCD-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ea). Nevertheless, we detected an immunoreactive band at 30 kDa for the GSDMD-NT protein, which was significantly increased (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.032) in HFD-fed mice (2.76\u0026thinsp;\u0026plusmn;\u0026thinsp;0.43-fold) compared to NCD-fed mice (1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.34-fold), as determined by Western blot analysis in FDB muscle homogenates (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eb). In addition, we analyzed the localization of GSDMD-NT in isolated skeletal muscle fibers (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003ec). Immunofluorescence detection of the GSDMD-NT and NLRP3 proteins showed an increased fluorescence intensity for both proteins in isolated fibers from HFD-fed mice compared to NCD-fed mice. Of note, immunostaining experiments revealed a peripheral signal in the medial portion of the skeletal fibers (Fig. Supp.\u0026nbsp;1). To determine whether GSDMD-NT co-localizes with DHPR, a well-established marker of the T-tubule membrane, we performed immunostaining and Western blot analysis on both the isolated microsomal fraction (enriched in sarcolemma membranes) and the triad membrane (enriched in T-tubules flanked by sarcoplasmic reticulum). As shown in Figure Supp.\u0026nbsp; 2, GSDMD-NT co-localizes with DHPR in HFD-fed mice, reaching an M1 Manders coefficient of 0.98\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01, compared to NCD-fed mice (0.90\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05, Fig. Suppl. 2b). In addition, we detected an immunoreactive band in the Western Blotting analysis of GSDMD-NT in both the microsomal fraction and T-tubule membrane, with increased signal in membranes isolated from HFD-fed mice compared to NCD-fed mice (Fig. Suppl. 2c).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eAn HFD induces oligomerization of GSDMD-NT and enhances IL-1β release in skeletal muscle.\u003c/em\u003e\u003c/p\u003e\u003cp\u003eIt has been suggested that GSDMD-NT monomers can be inserted into the plasma membrane and subsequently assembled into pore-forming oligomers, facilitating the release of inflammatory mediators such as IL-1β. We performed Western blot analysis using a non-denaturing gel to assess whether this process also occurs in skeletal muscle. A significant increase (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.029) in the oligomer-to-monomer ratio was observed in HFD-fed mice compared to NCD-fed mice (4.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.89-fold and 1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.22-fold, respectively) (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea), indicating increased pore assembly in skeletal muscle. Subsequently, we measured IL-1β release in ex vivo FDB and gastrocnemius muscle (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb \u0026amp; Fig. Suppl. 3). IL-1β levels were significantly elevated in HFD-fed mice, reaching values of 2.29\u0026thinsp;\u0026plusmn;\u0026thinsp;0.44 pg/mg protein in the FDB (p\u0026thinsp;=\u0026thinsp;0.018) and 0.66\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 pg/mg protein in the gastrocnemius (p\u0026thinsp;=\u0026thinsp;0.032), compared to 1.10\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16 pg/mg and 0.48\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05 pg/mg, respectively, in NCD-fed controls. These results suggest that GSDMD-NT oligomerization contributes to IL-1β release in skeletal muscle from obesity-induced IR mice.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eDisulfiram reduced the IL-1β plasma levels in HFD-fed mice.\u003c/em\u003e\u003c/p\u003e\u003cp\u003eTo investigate the effects of DSF on glucose handling and plasma IL-1β levels, we intraperitoneally injected HFD-fed mice three times per week with DSF (50 mg/kg) or vehicle for 3 weeks. Before treatment, the HFD-fed group exhibited similar body mass, fasting blood glucose, and IPGTT (Fig. Suppl. 4). Post-treatment, mice injected with either DSF or vehicle showed no significant changes in food intake or insulinemia (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). In contrast, DSF treatment reduced both total body mass (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.027) and epididymal adipose tissue (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.026), restored fasting blood glucose levels (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001), which remained significantly elevated in vehicle-treated mice, and led to an improvement in the IPGTT (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.0001) with an AUG of 27,197\u0026thinsp;\u0026plusmn;\u0026thinsp;1,076 (mg\u0026middot;min/dL) and 36,240\u0026thinsp;\u0026plusmn;\u0026thinsp;838 (mg\u0026middot;min/dL), respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003ea-d). These results suggest that DSF reduces glucose levels in obesity-induced IR mice after three weeks of treatment. IL-1β plasma levels were also diminished (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.041) in DSF-treated mice (3.08\u0026thinsp;\u0026plusmn;\u0026thinsp;0.17 pg/mL) compared to vehicle-treated mice (4.65\u0026thinsp;\u0026plusmn;\u0026thinsp;0.53 pg/mL).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eDisulfiram increases insulin-dependent Akt phosphorylation and glucose uptake in skeletal muscle.\u003c/em\u003e\u003c/p\u003e\u003cp\u003eTo determine whether DSF modulates insulin signaling activation, we assessed Akt phosphorylation at serine 473 (S473) in whole-muscle homogenates from FDB using Western blot analysis (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea). As expected, in HFD-fed mice, insulin pre-incubation did not alter Akt phosphorylation at S473 (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.583) in vehicle-treated mice compared to basal conditions (2.02\u0026thinsp;\u0026plusmn;\u0026thinsp;0.13-fold vs. 1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.07-fold, respectively). In contrast, DSF-treated HFD-fed mice show an increase in insulin-stimulated Akt phosphorylation at S473 (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.031), reaching 4.14\u0026thinsp;\u0026plusmn;\u0026thinsp;0.89-fold compared to their basal levels (1.60\u0026thinsp;\u0026plusmn;\u0026thinsp;0.65-fold). To further assess this point, glucose uptake was determined by measuring 2-NBDG incorporation, a fluorescent glucose analogue. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb, insulin increased 2-NBDG uptake in fibers isolated from DSF-treated HFD-fed mice, from 1.25\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01-fold under basal conditions to 1.45\u0026thinsp;\u0026plusmn;\u0026thinsp;0.01-fold with insulin stimulation (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.047). Conversely, fibers from vehicle-injected mice showed a 2-NBDG uptake of 1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.08-fold in basal conditions and 1.17\u0026thinsp;\u0026plusmn;\u0026thinsp;0.05-fold after insulin stimulation (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.091). Moreover, insulin-stimulated 2-NBDG uptake was higher in muscle fibers from DSF-treated HFD-fed mice than in those from vehicle-treated mice (p\u0026thinsp;=\u0026thinsp;0.006).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cem\u003eDisulfiram reduces GSDMD-NT oligomerization and IL-1β release in skeletal muscle from HFD-fed mice.\u003c/em\u003e\u003c/p\u003e\u003cp\u003eTo assess whether DSF modulates the inflammatory processes, we performed Western blot and ELISA in the whole skeletal muscle. In both experiments, skeletal muscle was incubated with 10 nmol/L DSF for 24 hours. This treatment significantly reduced (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.029) the GSDMD-NT oligomer-to-monomer ratio in the gastrocnemius muscle of HFD-fed mice, reaching values of 0.49\u0026thinsp;\u0026plusmn;\u0026thinsp;0.06-fold compared to 1.00\u0026thinsp;\u0026plusmn;\u0026thinsp;0.21-fold in DMSO-treated muscle (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003ea). Accordingly, IL-1β release from \u003cem\u003eex vivo\u003c/em\u003e skeletal muscle was also diminished (\u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.028) following DSF incubation (0.46\u0026thinsp;\u0026plusmn;\u0026thinsp;0.03 pg/mg) compared to DMSO-treated muscle (0.72\u0026thinsp;\u0026plusmn;\u0026thinsp;0.16 pg/mg) (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eb). These findings suggest that DSF inhibits IL-1β release through GSDMD-NT oligomerization in skeletal muscle under metabolic stress conditions.\u003c/p\u003e\u003cp\u003e\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eChronic low-grade inflammation contributes to the pathogenesis of IR during obesity [\u003cspan additionalcitationids=\"CR20\" citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. NLRP3 activation plays a main role in this response, primarily mediated by immune cells [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]. Nevertheless, its expression and activation have also been demonstrated in non-immune tissues, including human adipocytes [\u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e], hepatocytes [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], and skeletal muscle [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. We previously showed that NLRP3 inflammasome activation inhibits GLUT4 translocation and disrupts insulin signaling in skeletal muscle [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e, \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. These findings align with NLRP3-mediated inflammatory activity linked to metabolic dysfunction in skeletal muscle [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e]. In this study, we determined that GSDMD contributes to IL-1β release and disrupts glucose homeostasis in skeletal muscle under NLRP3-mediated metabolic inflammation. Moreover, DSF treatment mitigates these alterations by reducing GSDMD-NT oligomerization and pore formation, supporting GSDMD as a potential target to attenuate metabolic inflammation and improve glucose handling in obesity-induced IR.\u003c/p\u003e\u003cp\u003eIn HFD-fed mice, GSDMD-NT protein levels were increased and localized primarily to the sarcolemma and T-tubules in skeletal muscle. This spatial distribution may be particularly relevant for facilitating IL-1β release, promoting a local positive feedback loop that sustains NLRP3 inflammasome activation and drives chronic inflammation, contributing to metabolic dysfunction and IR (Figs.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e \u0026amp; \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The detection of oligomers within the 170\u0026ndash;235 kDa range supports the active pore formation in sarcolemma and T-tubule. Approximately 6\u0026ndash;8 GSDMD-NT molecules oligomerize to form a pore in FDB skeletal muscle fibers (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003ea), a stoichiometry lower than that reported in previous studies using atomic force microscopy, which have shown GSDMD-NT pores composed of 18 to 36 subunits [\u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Although GSDMD-NT oligomerization is associated with pyroptosis, it has been suggested that IL-1β can be released through sublytic pores without causing complete membrane rupture in macrophages, dendritic cells, and partially in neutrophils [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. Recent studies have demonstrated that small oligomers, such as pentamers, can form stable pores exhibiting sublytic activity with limited membrane disruption [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. Although the precise mechanism of pore formation remains unclear, cysteine residues are emerging as key modulators of the oligomerization process. Notably, Cys39, Cys57, and particularly Cys191/192 (Cys191 in humans; Cys192 in mice) have been identified as key mediators of this process [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In the context of IR, oxidative stress is known to activate the NLRP3 inflammasome via interaction with thioredoxin-interacting protein (TXNIP) in skeletal muscle [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Reactive oxygen species (ROS) have also been shown to promote GSDMD-NT oligomerization, with Cys192 being essential for ROS sensitivity [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. Moreover, the S-palmitoylation of Cys192 has been implicated in regulating GSDMD membrane targeting [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. Nevertheless, whether these or other cysteine residues contribute specifically to GSDMD-NT oligomerization in skeletal muscle remains to be determined.\u003c/p\u003e\u003cp\u003eIt is well-established that skeletal muscle is active in secreting inflammatory factors and bioactive peptides, known as myokines, under IR conditions [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. We observed increased IL-1β levels in the culture media of FDB and gastrocnemius muscles from IR mice, suggesting the contribution of skeletal muscle tissue to the inflammation associated with this metabolic dysfunction. IL-1β is secreted through several non-classical mechanisms, including lysosomal exocytosis, microvesicle shedding, fusion of multivesicular bodies and exosomes, GSDMD-NT pore formation, and passive release following cell lysis [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e]. Our results show elevated GSDMD oligomerization in skeletal muscle fibers (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eb), suggesting that IL-1β may be exported through GSDMD-formed pores, contributing to local signaling events that impair insulin sensitivity [\u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Due to its half-life in plasma (19.0 minutes in rats), IL-1β-associated vesicles and/or exosomes may mediate effects in distant sites rather than only at the local inflammatory tissue [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eDSF, originally approved for the treatment of chronic alcohol dependence, exhibits a well-established safety profile in adherent patients, and long-term administration has not been associated with the development of pharmacological tolerance [\u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. DSF covalently modifies a conserved cysteine residue Cys191/192 in GSDMD, inhibiting pore formation and pyroptosis [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e]. Recently, prolonged disulfiram treatment for 40 to 60 weeks in obese mice has been reported to normalize body weight, improve fasting glycemia, reduce adiposity, and restore systemic insulin responsiveness [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. However, its potential effects on insulin sensitivity in skeletal muscle had not been previously explored. The present findings demonstrate that a short-term DSF treatment lasting three weeks reduced body weight in HFD-induced obese mice without altering food intake (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e). This suggests that, at the examined time point, DSF exerts tissue-specific effects rather than through modulation of feeding behavior. This finding is consistent with previous reports indicating a weight-lowering effect of DSF [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e] and extends them by demonstrating its efficacy over a shorter intervention period. The absence of changes in dietary intake suggests that DSF may modulate mechanisms of energy expenditure or metabolic efficiency [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e, \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. In DSF-treated HFD-obese mice, we observed a decrease in IPGTT and fasting blood glucose with reduced plasma IL-1β concentrations, suggesting a link between improved glucose homeostasis and attenuation of inflammation. Moreover, DSF-treated mice exhibit improved glycemic control in response to insulin, consistent with previous reports for long-term treatment [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e, \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Our results provide new evidence supporting the notion that short-term DFS treatment enhances insulin sensitivity in skeletal muscle under obesity-induced IR, showing a new aspect of its metabolic effects.\u003c/p\u003e\u003cp\u003eConsistent with improved insulin responsiveness, DSF treatment increased insulin-stimulated phosphorylation of Akt at S473 in skeletal muscle from HFD-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003ea), indicating enhanced insulin signaling downstream of the insulin receptor. In concordance, DSF-treated HFD-fed mice also exhibit improved insulin-stimulated glucose uptake (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eb), suggesting a functional increase in glucose disposal. These results suggest that DSF may affect insulin signaling pathways in skeletal muscle and contribute to improved peripheral glucose utilization [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e]. Nevertheless, skeletal muscle also expresses GLUT1, an insulin-independent glucose transporter with constitutive activity [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Interestingly, glucose uptake was also increased in DSF-treated HFD mice, even in the absence of exogenous insulin stimulation, suggesting that DSF may increase basal glucose levels through insulin-independent mechanisms. Future experiments will help determine whether these effects are mediated by specific components of the insulin receptor pathway or through GLUT4-translocation at the sarcolemma.\u003c/p\u003e\u003cp\u003eFurthermore, we found that DSF reduced GSDMD-NT oligomerization and IL-1β release from the gastrocnemius muscle from HFD-fed mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003e). These findings suggest that DSF exerts anti-inflammatory effects through the modulation of NLRP3-related pathways, which may contribute to its overall metabolic improvements observed in our model. In this context, repurposing DSF as an anti-inflammatory agent represents a promising therapeutic strategy [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e], particularly in metabolic diseases where chronic skeletal muscle inflammation plays a central role.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eOur findings support the potential use of DSF as a treatment for metabolic diseases characterized by chronic low-grade inflammation. By specifically targeting GSDMD-NT oligomerization, DSF disrupts a key step in the inflammatory cascade, thereby reducing the release of IL-1β, a central mediator of inflammation in metabolic tissues. This mechanism shows the important role of GSDMD-NT in inflammation-related metabolic problems. In parallel, DSF not only attenuates inflammatory signaling in skeletal muscle but also improves insulin responsiveness and glucose disposal. Given its established safety profile, DSF emerges as a promising therapeutic candidate targeting GSDMD for potential application in obesity-associated insulin resistance and type 2 diabetes. Future clinical studies will be essential to confirm its efficacy and determine how it could be used to treat human metabolic disorders.\u003c/p\u003e\u003cp\u003e\u003cb\u003eLimitations\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThis study provides experimental evidence suggesting a role for GSDMD-NT in skeletal muscle inflammation and insulin resistance. It shows that pharmacological inhibition with DSF improves glucose homeostasis in a diet-induced obesity model. However, some limitations should be acknowledged. First, although our results support a functional effect of DSF on insulin signaling, the study was not designed to dissect its molecular targets beyond GSDMD-NT. Second, our data indicate metabolic benefits in skeletal muscle from short-term DSF treatment; however, its long-term effects and translational relevance remain to be explored in future studies.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cp\u003eAUC: area under the curve\u003c/p\u003e\n\u003cp\u003eDSF: disulfiram\u003c/p\u003e\n\u003cp\u003eFDB: flexor digitorum brevis\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGSDMD: gasdermin D\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGSDMD-NT: N-terminal fragment of gasdermin D\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eGLUT4: glucose transporter type 4\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eHFD: high-fat diet\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIL-1β: interleukin-1β\u003c/p\u003e\n\u003cp\u003eIPGTT: intraperitoneal glucose tolerance test\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eIR: insulin resistance\u003c/p\u003e\n\u003cp\u003eNCD: normal-chow diet\u003c/p\u003e\n\u003cp\u003eNLRP3: NOD-, LRR-, pyrin domain-containing protein 3\u0026nbsp;\u003c/p\u003e\n\u003cp\u003eS: sarcolemma\u003c/p\u003e\n\u003cp\u003eT: triads\u003c/p\u003e\n\u003cp\u003eTXNIP: thioredoxin-interacting protein\u0026nbsp;\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets and/or analyses during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eEthics approval\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll animal experiments were approved by the Animal Bioethics Committee of the Faculty of Dentistry, University of Chile (Protocol CBA 240423 FOUCH).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eContributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCynthia Cadagan\u003c/strong\u003e: Writing – review \u0026amp; editing, Writing – original draft, Visualization, Supervision, Methodology, Investigation, Conceptualization, Formal analysis, Data curation.\u0026nbsp;\u003cstrong\u003eJavier Russell-Guzmán:\u003c/strong\u003e Writing – review \u0026amp; editing, Writing – original draft, Visualization, Supervision, Methodology, Investigation, Conceptualization, Formal analysis, Data curation.\u0026nbsp;\u003cstrong\u003eLuan Americo da Silva:\u003c/strong\u003e Writing – review \u0026amp; editing, Investigation, Formal analysis.\u0026nbsp;\u003cstrong\u003ePaula Montaña:\u003c/strong\u003e Writing – review \u0026amp; editing, Methodology, Investigation, Formal analysis.\u0026nbsp;\u003cstrong\u003eGenaro Barrientos:\u003c/strong\u003e Writing – review \u0026amp; editing, Investigation, Methodology.\u0026nbsp;\u003cstrong\u003eSonja Buvinic\u003c/strong\u003e: Writing – review \u0026amp; editing, Funding acquisition, Investigation.\u0026nbsp;\u003cstrong\u003eGladys Tapia\u003c/strong\u003e: Writing – review \u0026amp; editing, Supervision, Investigation.\u0026nbsp;\u003cstrong\u003eManuel Estrada\u003c/strong\u003e: Writing – review \u0026amp; editing, Writing – original draft, Visualization, Supervision.\u0026nbsp;\u003cstrong\u003ePaola Llanos\u003c/strong\u003e: Writing – review \u0026amp; editing, Writing – original draft, Visualization, Supervision, Project administration, Investigation, Resources, Funding acquisition.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors have declared no competing interests and no personal financial interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgments\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eWe thank Mr. Matías Ayala for providing isolated muscle fibers and his valuable technical assistance.\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by FONDECYT 1231103 (Paola Llanos) and 1241661 (Sonja Buvinic).\u0026nbsp;\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n \u003cli\u003eSaeedi P, Petersohn I, Salpea P, et al (2019) Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: Results from the International Diabetes Federation Diabetes Atlas, 9th edition. Diabetes Res Clin Pract 157:107843. https://doi.org/10.1016/j.diabres.2019.107843\u003c/li\u003e\n \u003cli\u003eJames DE, St\u0026ouml;ckli J, Birnbaum MJ (2021) The aetiology and molecular landscape of insulin resistance. Nat Rev Mol Cell Biol 22(11):751\u0026ndash;771. https://doi.org/10.1038/s41580-021-00390-6\u003c/li\u003e\n \u003cli\u003eKim MS, Shim I, Fahed AC, et al (2024) Association of genetic risk, lifestyle, and their interaction with obesity and obesity-related morbidities. Cell Metab 36(7):1494-1503.e3. https://doi.org/10.1016/j.cmet.2024.06.004\u003c/li\u003e\n \u003cli\u003eDeFronzo RA, Gunnarsson R, Bj\u0026ouml;rkman O, Olsson M, Wahren J (1985) Effects of insulin on peripheral and splanchnic glucose metabolism in noninsulin-dependent (type II) diabetes mellitus. J Clin Invest 76(1):149\u0026ndash;155. https://doi.org/10.1172/JCI111938\u003c/li\u003e\n \u003cli\u003eSaltiel AR, Olefsky JM (2017) Inflammatory mechanisms linking obesity and metabolic disease. J Clin Invest 127(1):1\u0026ndash;4. https://doi.org/10.1172/JCI92035\u003c/li\u003e\n \u003cli\u003eKelley N, Jeltema D, Duan Y, He Y (2019) The NLRP3 Inflammasome: An Overview of Mechanisms of Activation and Regulation. Int J Mol Sci 20(13):3328. https://doi.org/10.3390/ijms20133328\u003c/li\u003e\n \u003cli\u003eRheinheimer J, de Souza BM, Cardoso NS, Bauer AC, Crispim D (2017) Current role of the NLRP3 inflammasome on obesity and insulin resistance: A systematic review. Metabolism 74:1\u0026ndash;9. https://doi.org/10.1016/j.metabol.2017.06.002\u003c/li\u003e\n \u003cli\u003eAm\u0026eacute;rico-Da-Silva L, Aguilera J, Quinteros-Waltemath O, et al (2021) Activation of the NLRP3 Inflammasome Increases the IL-1\u0026beta; Level and Decreases GLUT4 Translocation in Skeletal Muscle during Insulin Resistance. Int J Mol Sci 22(19):10212. https://doi.org/10.3390/ijms221910212\u003c/li\u003e\n \u003cli\u003eLieberman J, Wu H, Kagan JC (2019) Gasdermin D activity in inflammation and host defense. Sci Immunol 4(39):eaav1447. https://doi.org/10.1126/sciimmunol.aav1447\u003c/li\u003e\n \u003cli\u003eYang J, Liu Z, Wang C, et al (2018) Mechanism of gasdermin D recognition by inflammatory caspases and their inhibition by a gasdermin D-derived peptide inhibitor. Proc Natl Acad Sci U S A 115(26):6792\u0026ndash;6797. https://doi.org/10.1073/pnas.1800562115\u003c/li\u003e\n \u003cli\u003eKuang S, Zheng J, Yang H, et al (2017) Structure insight of GSDMD reveals the basis of GSDMD autoinhibition in cell pyroptosis. Proc Natl Acad Sci U S A 114(40):10642\u0026ndash;10647. https://doi.org/10.1073/pnas.1708194114\u003c/li\u003e\n \u003cli\u003eHeilig R, Dick MS, Sborgi L, Meunier E, Hiller S, Broz P (2018) The Gasdermin-D pore acts as a conduit for IL-1\u0026beta; secretion in mice. Eur J Immunol 48(4):584\u0026ndash;592. https://doi.org/10.1002/eji.201747404\u003c/li\u003e\n \u003cli\u003eHu JJ, Liu X, Xia S, et al (2020) FDA-approved disulfiram inhibits pyroptosis by blocking gasdermin D pore formation. Nat Immunol 21(7):736\u0026ndash;745. https://doi.org/10.1038/s41590-020-0669-6\u003c/li\u003e\n \u003cli\u003eFuller RK, Branchey L, Brightwell DR, et al (1986) Disulfiram treatment of alcoholism. A Veterans Administration cooperative study. JAMA 256(11):1449\u0026ndash;1455\u003c/li\u003e\n \u003cli\u003eBernier M, Mitchell SJ, Wahl D, et al (2020) Disulfiram Treatment Normalizes Body Weight in Obese Mice. Cell Metab 32(2):203-214.e4. https://doi.org/10.1016/j.cmet.2020.04.019\u003c/li\u003e\n \u003cli\u003eBernier M, Harney D, Koay YC, et al (2020) Elucidating the mechanisms by which disulfiram protects against obesity and metabolic syndrome. NPJ Aging Mech Dis 6:8. https://doi.org/10.1038/s41514-020-0046-6\u003c/li\u003e\n \u003cli\u003eS\u0026aacute;nchez-Aguilera P, Diaz-Vegas A, Campos C, et al (2018) Role of ABCA1 on membrane cholesterol content, insulin-dependent Akt phosphorylation and glucose uptake in adult skeletal muscle fibers from mice. Biochim Biophys Acta Mol Cell Biol Lipids 1863(12):1469\u0026ndash;1477. https://doi.org/10.1016/j.bbalip.2018.09.005\u003c/li\u003e\n \u003cli\u003eHidalgo C, Jorquera J, Tapia V, Donoso P (1993) Triads and transverse tubules isolated from skeletal muscle contain high levels of inositol 1,4,5-trisphosphate. J Biol Chem 268(20):15111\u0026ndash;15117\u003c/li\u003e\n \u003cli\u003eShoelson SE, Lee J, Goldfine AB (2006) Inflammation and insulin resistance. J Clin Invest 116(7):1793\u0026ndash;1801. https://doi.org/10.1172/JCI29069\u003c/li\u003e\n \u003cli\u003eEllulu MS, Patimah I, Khaza\u0026rsquo;ai H, Rahmat A, Abed Y (2017) Obesity and inflammation: the linking mechanism and the complications. Arch Med Sci AMS 13(4):851\u0026ndash;863. https://doi.org/10.5114/aoms.2016.58928\u003c/li\u003e\n \u003cli\u003eSot\u0026aacute;k M, Clark M, Suur BE, B\u0026ouml;rgeson E (2025) Inflammation and resolution in obesity. Nat Rev Endocrinol 21(1):45\u0026ndash;61. https://doi.org/10.1038/s41574-024-01047-y\u003c/li\u003e\n \u003cli\u003eD\u0026rsquo;Espessailles A, Mora YA, Fuentes C, Cifuentes M (2018) Calcium-sensing receptor activates the NLRP3 inflammasome in LS14 preadipocytes mediated by ERK1/2 signaling. J Cell Physiol 233(8):6232\u0026ndash;6240. https://doi.org/10.1002/jcp.26490\u003c/li\u003e\n \u003cli\u003eCsak T, Ganz M, Pespisa J, Kodys K, Dolganiuc A, Szabo G (2011) Fatty acid and endotoxin activate inflammasomes in mouse hepatocytes that release danger signals to stimulate immune cells. Hepatol Baltim Md 54(1):133\u0026ndash;144. https://doi.org/10.1002/hep.24341\u003c/li\u003e\n \u003cli\u003eRussell-Guzm\u0026aacute;n J, Am\u0026eacute;rico-Da Silva L, Cadagan C, et al (2024) Activation of the ROS/TXNIP/NLRP3 pathway disrupts insulin-dependent glucose uptake in skeletal muscle of insulin-resistant obese mice. Free Radic Biol Med 222:187\u0026ndash;198. https://doi.org/10.1016/j.freeradbiomed.2024.06.011\u003c/li\u003e\n \u003cli\u003eVandanmagsar B, Youm Y-H, Ravussin A, et al (2011) The NLRP3 inflammasome instigates obesity-induced inflammation and insulin resistance. Nat Med 17(2):179\u0026ndash;188. https://doi.org/10.1038/nm.2279\u003c/li\u003e\n \u003cli\u003eMari SA, Pluhackova K, Pipercevic J, et al (2022) Gasdermin-A3 pore formation propagates along variable pathways. Nat Commun 13(1):2609. https://doi.org/10.1038/s41467-022-30232-8\u003c/li\u003e\n \u003cli\u003eSchaefer SL, Hummer G (2022) Sublytic gasdermin-D pores captured in atomistic molecular simulations. eLife 11:e81432. https://doi.org/10.7554/eLife.81432\u003c/li\u003e\n \u003cli\u003eMargheritis E, Kappelhoff S, Danial J, et al (2024) Gasdermin D cysteine residues synergistically control its palmitoylation-mediated membrane targeting and assembly. EMBO J 43(19):4274\u0026ndash;4297. https://doi.org/10.1038/s44318-024-00190-6\u003c/li\u003e\n \u003cli\u003eDevant P, Bor\u0026scaron;ić E, Ngwa EM, et al (2023) Gasdermin D pore-forming activity is redox-sensitive. Cell Rep 42(1):112008. https://doi.org/10.1016/j.celrep.2023.112008\u003c/li\u003e\n \u003cli\u003eMerz KE, Thurmond DC (2020) Role of Skeletal Muscle in Insulin Resistance and Glucose Uptake. Compr Physiol 10(3):785\u0026ndash;809. https://doi.org/10.1002/cphy.c190029\u003c/li\u003e\n \u003cli\u003ePedersen BK, Febbraio MA (2012) Muscles, exercise and obesity: skeletal muscle as a secretory organ. Nat Rev Endocrinol 8(8):457\u0026ndash;465. https://doi.org/10.1038/nrendo.2012.49\u003c/li\u003e\n \u003cli\u003eArtlett CM (2012) The Role of the NLRP3 Inflammasome in Fibrosis. Open Rheumatol J 6:80\u0026ndash;86. https://doi.org/10.2174/1874312901206010080\u003c/li\u003e\n \u003cli\u003eJorquera G, Russell J, Monsalves-\u0026Aacute;lvarez M, et al (2021) NLRP3 Inflammasome: Potential Role in Obesity Related Low-Grade Inflammation and Insulin Resistance in Skeletal Muscle. Int J Mol Sci 22(6):3254. https://doi.org/10.3390/ijms22063254\u003c/li\u003e\n \u003cli\u003eKudo S, Mizuno K, Hirai Y, Shimizu T (1990) Clearance and tissue distribution of recombinant human interleukin 1 beta in rats. Cancer Res 50(18):5751\u0026ndash;5755\u003c/li\u003e\n \u003cli\u003eGill RM, O\u0026rsquo;Brien M, Young A, Gardiner D, Mailloux RJ (2018) Protein S-glutathionylation lowers superoxide/hydrogen peroxide release from skeletal muscle mitochondria through modification of complex I and inhibition of pyruvate uptake. PloS One 13(2):e0192801. https://doi.org/10.1371/journal.pone.0192801\u003c/li\u003e\n \u003cli\u003eHirschenson J, Mailloux RJ (2021) The glutathionylation agent disulfiram augments superoxide/hydrogen peroxide production when liver mitochondria are oxidizing ubiquinone pool-linked and branched chain amino acid substrates. Free Radic Biol Med 172:1\u0026ndash;8. https://doi.org/10.1016/j.freeradbiomed.2021.05.030\u003c/li\u003e\n \u003cli\u003eOmran Z, Sheikh R, Baothman OA, Zamzami MA, Alarjah M (2020) Repurposing Disulfiram as an Anti-Obesity Drug: Treating and Preventing Obesity in High-Fat-Fed Rats. Diabetes Metab Syndr Obes Targets Ther 13:1473\u0026ndash;1480. https://doi.org/10.2147/DMSO.S254267\u003c/li\u003e\n \u003cli\u003eNagai N, Murao T, Okamoto N, Ito Y (2009) Disulfiram reduces elevated blood glucose levels in Otsuka Long-Evans Tokushima Fatty (OLETF) rats, a model of type 2 diabetes. J Oleo Sci 58(9):485\u0026ndash;490. https://doi.org/10.5650/jos.58.485\u003c/li\u003e\n \u003cli\u003eJones JP, Tapscott EB, Olson AL, Pessin JE, Dohm GL (1998) Regulation of glucose transporters GLUT-4 and GLUT-1 gene transcription in denervated skeletal muscle. J Appl Physiol Bethesda Md 1985 84(5):1661\u0026ndash;1666. https://doi.org/10.1152/jappl.1998.84.5.1661\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"GSDMD-NT, glucose uptake, IL-1β release, insulin signaling, NALP3 inflammasome","lastPublishedDoi":"10.21203/rs.3.rs-7117118/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7117118/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eInsulin resistance (IR), which involves impaired insulin signaling diminished insulin sensitivity in skeletal muscle, is closely associated with chronic low-grade inflammation. A key mediator of this process is the NLRP3 inflammasome, which activates Gasdermin D (GSDMD). Upon cleavage, the N-terminal fragment of GSDMD (GSDMD-NT) forms membrane pores that facilitate interleukin-1β (IL-1β) release. Disulfiram (DSF), an FDA-approved drug that also inhibits GSDMD-NT pore formation, has emerged as a potential therapeutic for inflammasome-mediated inflammation. However, the role of GSDMD in skeletal muscle during IR remains poorly understood. This study evaluated whether GSDMD-NT-mediated IL-1β release contributes to skeletal muscle inflammation and IR, and whether DSF can restore insulin sensitivity. Male C57BL/6 mice were fed a normal chow diet (NCD) or a high-fat diet (HFD) for 8 weeks; a subgroup of HFD-fed mice received intraperitoneal DSF (50 mg/kg) for 3 weeks. The flexor digitorum brevis (FDB) and gastrocnemius muscles were collected for single-fiber isolation, quantitative PCR, immunoblotting, and immunofluorescence. IL-1β levels were measured by ELISA. Insulin sensitivity was assessed via 2-NBDG uptake, Akt phosphorylation, and glucose tolerance tests (IPGTT). HFD-fed mice exhibited increased GSDMD-NT and oligomer levels, localized to the sarcolemma and T-tubules, along with elevated IL-1β in skeletal muscle. DSF administration reduced weight gain, fasting glycemia, IPGTT, and systemic IL-1β, while enhancing insulin-stimulated 2-NBDG uptake and Akt phosphorylation in FDB. Moreover, DSF reduced GSDMD-NT oligomerization and IL-1β release in the gastrocnemius muscle. These findings suggest a novel pathogenic role for GSDMD in skeletal muscle IR and support DSF as a potential candidate for metabolic disease intervention.\u003c/p\u003e","manuscriptTitle":"Disulfiram inhibits Gasdermin D pores formation and improves insulin-dependent glucose uptake and glucose homeostasis in skeletal muscle of obesity-induced insulin-resistant mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-06 10:07:32","doi":"10.21203/rs.3.rs-7117118/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-08T15:43:29+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-07T18:06:10+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"172980324792940169339125281607143940779","date":"2025-08-25T04:01:05+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-19T00:33:48+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"180268876118382917698496204008884729045","date":"2025-08-16T07:05:52+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-04T10:01:00+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-08-01T11:18:23+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-07-24T16:44:15+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-07-18T19:05:47+00:00","index":"","fulltext":""},{"type":"submitted","content":"Scientific Reports","date":"2025-07-18T19:01:37+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"scientific-reports","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"scirep","sideBox":"Learn more about [Scientific Reports](http://www.nature.com/srep/)","snPcode":"","submissionUrl":"","title":"Scientific Reports","twitterHandle":"","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"Scientific Reports","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"b4ae4e9e-1cda-4cc4-b191-d05a4797e67d","owner":[],"postedDate":"August 6th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[{"id":52661620,"name":"Health sciences/Diseases"},{"id":52661621,"name":"Health sciences/Endocrinology"},{"id":52661622,"name":"Biological sciences/Immunology"},{"id":52661623,"name":"Biological sciences/Physiology"}],"tags":[],"updatedAt":"2025-12-01T16:03:46+00:00","versionOfRecord":{"articleIdentity":"rs-7117118","link":"https://doi.org/10.1038/s41598-025-30058-6","journal":{"identity":"scientific-reports","isVorOnly":false,"title":"Scientific Reports"},"publishedOn":"2025-11-26 15:58:20","publishedOnDateReadable":"November 26th, 2025"},"versionCreatedAt":"2025-08-06 10:07:32","video":"","vorDoi":"10.1038/s41598-025-30058-6","vorDoiUrl":"https://doi.org/10.1038/s41598-025-30058-6","workflowStages":[]},"version":"v1","identity":"rs-7117118","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7117118","identity":"rs-7117118","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.