The potential contribution of light-intensity exercise-induced miR-486a-3p secretion on enhancing empathic behavior in mice

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Empathy plays a crucial role in the maintenance of interpersonal relationships among mammals. Remarkably, engaging in light-intensity exercise has been identified as a facilitator of empathic behavior, a phenomenon associated with the upregulation of miR-486a-3p in the insular cortex. However, it remains to cover the contribution of miR-486a-3p and the mechanisms of changing levels of that in the insular cortex with light-intensity exercise. We initially assessed the impact of light-intensity exercise (7.0 m/min, 30 min/day, five days/week for four weeks) on helping behavior, mRNA in their insular cortex, and the secretion of exosomal miR-486a-3p from their gastrocnemius muscle. Subsequently, we explored the effects of a daily intraperitoneal injection of miR-486a-3p mimic over a two-week period on helping behavior. The intervention of light-intensity exercise, which enhanced helping behavior, resulted in elevated levels of miR-486a-3p in the insular cortex and exosomal miR-486a-3p in the plasma. Interestingly, there was no significant change observed in the levels of gastrocnemius muscle-derived exosomal miR-486a-3p. Moreover, the administration of mmu-miR-486a-3p mimic exhibited a similar enhancement of helping behavior in mice. Notably, both the exercise intervention and miR-486a-3p mimic treatment led to the downregulation of Pten mRNA and upregulation of Bdnf mRNA in the insular cortex. Our findings suggest that the increase in exosomal miR-486a-3p, originating from a source other than the gastrocnemius muscle, contributes to the empathy enhancement induced by light-intensity exercise. Furthermore, it is proposed that miR-486a-3p mimics the effects of light-intensity exercise, presenting a potential avenue for treating empathy-related behaviors.
Full text 103,792 characters · extracted from preprint-html · click to expand
The potential contribution of light-intensity exercise-induced miR-486a-3p secretion on enhancing empathic behavior in mice | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article The potential contribution of light-intensity exercise-induced miR-486a-3p secretion on enhancing empathic behavior in mice Takeru Shima, Keisuke Yoshii, Yuika Yoshikawa, Chiho Terashima This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4859054/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Empathy plays a crucial role in the maintenance of interpersonal relationships among mammals. Remarkably, engaging in light-intensity exercise has been identified as a facilitator of empathic behavior, a phenomenon associated with the upregulation of miR-486a-3p in the insular cortex. However, it remains to cover the contribution of miR-486a-3p and the mechanisms of changing levels of that in the insular cortex with light-intensity exercise. We initially assessed the impact of light-intensity exercise (7.0 m/min, 30 min/day, five days/week for four weeks) on helping behavior, mRNA in their insular cortex, and the secretion of exosomal miR-486a-3p from their gastrocnemius muscle. Subsequently, we explored the effects of a daily intraperitoneal injection of miR-486a-3p mimic over a two-week period on helping behavior. The intervention of light-intensity exercise, which enhanced helping behavior, resulted in elevated levels of miR-486a-3p in the insular cortex and exosomal miR-486a-3p in the plasma. Interestingly, there was no significant change observed in the levels of gastrocnemius muscle-derived exosomal miR-486a-3p. Moreover, the administration of mmu-miR-486a-3p mimic exhibited a similar enhancement of helping behavior in mice. Notably, both the exercise intervention and miR-486a-3p mimic treatment led to the downregulation of Pten mRNA and upregulation of Bdnf mRNA in the insular cortex. Our findings suggest that the increase in exosomal miR-486a-3p, originating from a source other than the gastrocnemius muscle, contributes to the empathy enhancement induced by light-intensity exercise. Furthermore, it is proposed that miR-486a-3p mimics the effects of light-intensity exercise, presenting a potential avenue for treating empathy-related behaviors. Helping behavior Exercise Exosome miR-486a-3p Bdnf Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Introduction Empathy, intricately tied to perspective-taking and emotional contagion [ 1 ], denotes the capacity to discern and engage with the emotions of others, fostering interpersonal connections [ 2 , 3 ]. The decline in empathy is not only a catalyst for diminished prosocial behavior [ 4 ] but also constitutes a significant pathophysiological factor in individuals with autism spectrum disorder [ 5 ], emphasizing the pivotal role of human empathy as a crucial clinical focus. Notably, empathic behavior extends beyond the human domain, manifesting in other mammals, exemplified by rodents' helping behavior [ 6 ]. Consequently, employing behavioral tests in animal experiments proves valuable for devising innovative strategies aimed at augmenting empathy. Exercise emerges as a prospective approach for empathy treatment, as prior research has indicated its potential to amplify both empathic behavior and the neuronal systems associated with empathy [ 7 , 8 ]. Our investigation unveils a correlation between regular physical activity levels and heightened empathy in healthy young adults [ 9 – 12 ], suggesting the susceptibility of empathy to exercise. Notably, brain-derived neurotrophic factor (BDNF), a neuropeptide implicated in neuroplasticity enhancement, has been linked to empathic behavior as well as oxytocin [ 13 , 14 ]. The upregulation of BDNF expressions in the insular cortex, a brain region intricately tied to empathy, is posited as a catalyst for the augmentation of empathic behavior [ 15 ]. Recent studies propose that light-intensity exercise intervention fosters empathic behavior through increased BDNF expressions in the insular cortex [ 16 , 17 ]. This exercise regimen would hold promise as an optimal therapeutic strategy for enhancing empathy, not only in healthy individuals but also in autism spectrum disorders patients with motor impairments [ 18 ]. However, the precise mechanisms underlying the effects of exercise remain inadequately understood, necessitating further exploration to devise efficient strategies for empathy treatment. The impact of exercise on the brain is influenced not only by intrinsic brain mechanisms but also by the biochemical factors secreted from peripheral organs, such as “exerkines” [ 19 , 20 ]. A number of studies proposed that the release of exosomes constitutes a key mechanism underlying the effects of exercise. Exosomes, small extracellular vesicles ranging from 40 to 160 nm, are secreted by various organs and contain microRNAs (miRNAs). These miRNAs, short non-coding RNAs approximately 21–25 nucleotides in length, bind to complementary regions of messenger RNAs (mRNAs), leading to mRNA degradation or the inhibition of translation [ 21 ]. Notably, some indications suggest that exercise-induced exosomal miRNAs released from muscles enhance biological and physiological functions not only in peripheral organs but also in the brain [ 22 – 24 ]. Additionally, previous studies have suggested that miRNAs derived from adipocytes and mesenchymal stromal cells contribute to the enhancement of brain function and neuroplasticity [ 25 , 26 ]. Therefore, it is crucial to investigate peripheral organs-to-brain crosstalk to understand the detailed mechanisms underlying the effects of exercise. A previous study has documented that light-intensity exercise intervention, known to augment empathy, results in an increase of miR-486a-3p along with the upregulation of Bdnf mRNA levels in the insular cortex [ 16 ]. The miR-486a-3p is recognized for its involvement in the growth of various cells and its suppression of mRNA levels in phosphatase and tensin homolog ( Pten ) [ 27 , 28 ], a major tumor suppressor gene. PTEN serves as a down-regulator of the PI3K/AKT signaling pathway and influences BDNF expressions [ 29 , 30 ]; thus, the elevation of miR-486a-3p levels in the insular cortex constitutes an underlying mechanism for the light-intensity exercise-induced enhancement in empathic behavior. However, it remains unclear whether miR-486a-3p derived from peripheral organs contributes to the effects of light-intensity exercise on empathy. Here, our initial examination focused on evaluating the impact of light-intensity exercise intervention on the helping behavior, indicative of empathy, in mice, along with the secretion of exosomal miR-486a-3p from muscles. Subsequently, we delved into an investigation of the effects of daily intraperitoneal injections of mmu-miR-486a-3p mimic on empathic behavior in mice. Materials and methods Animals Male C57BL/6J mice, eight weeks of age, were procured from SLC Inc. (Japan) and were accommodated in a controlled environment with temperatures maintained between 21–23℃, operating on a 12-hour light/dark cycle (lights on from 8 AM to 8 PM). These mice had access to a standard pellet diet (Rodent Diet CE-2, CLEA Japan Inc., Japan) and water ad libitum. The experiments were reviewed and approved by the Gunma University Animal Care and Experimentation Committee (approval No. 22 − 012). Exercise training After a week of acclimatization to the housing environment, the mice were divided into exercise groups and non-exercise (sedentary) groups. Mice in the exercise group underwent running habituation on a forced exercise wheel bed without electric stimulation, ranging from 3.0 to 7.0 m/min for 30 min/day, five days/week, with two consecutive days of training followed by three consecutive days of training next to a rest day, spanning one week. Subsequently, they engaged in light-intensity exercise at 7.0 m/min on the same equipment for 30 min/day, five days/week, over a period of three weeks [ 16 ]. All sessions were conducted during the light period (from 8 AM to 10 AM). Helping behavior tests were administered to both exercise and sedentary groups for five days, concurrently with the exercise regimen during the fourth week. Intraperitoneal injection of mmu-miR-486a-3p mimic Following one week of acclimatization to the housing environment, the mice were divided into miR-486a-3p mimic-treated and non-treated (vehicle) groups. The mice in miR-486a-3p mimic-treated groups received daily intraperitoneal injections of mmu-miR-486a-3p mimic for 2 weeks. An 80 nmol/l solution of mmu-miR-486a-3p mimic was prepared by diluting it in 0.9% saline with 0.02% TE buffer. Mice received an injection of 10 µl/g body weight of the solution during the light period (0.8 nmol/kg body weight, once a day from 8 AM to 9 AM). Saline (Otsuka Pharmaceutical Factory, Japan) with 0.02% TE buffer was used as the vehicle. These mice did not undergo exercise training. The empathic behavior test was conducted for five days following a two-week treatment period. Empathic behavior test Experimental equipment previously described was used to test empathic behavior [ 16 , 31 ]. Empathy-like behavior was defined as the act of door-opening to help a cage mate. The behavioral test took place from 7 AM to 8 AM, with all mice undergoing a four-day training period to learn the door-opening behavior using the empathy test equipment. On the fifth day, the mice were tested. Both learning and testing sessions lasting 3 min per mouse. During the test, a mouse was positioned in the ground area, while its cage mate was situated in the water pool area. The helping behavior of the mouse in the ground area was recorded for 3 min. Earlier instances of door opening indicated higher empathy in mice. It is crucial to note that cage mates in the water pool area were not subjected to an evaluation of helping behavior. Tissue preparation Two days after the testing session of the empathic behavior test, mice were anesthetized using isoflurane (Dainippon Sumitomo Pharma Co., Japan), and the blood samples were obtained from cardiac puncture. Subsequently, the insular cortex was collected and preserved in RNAlater™ Stabilization Solution (Invitrogen™, USA). The collected blood samples were put into microtubes with EDTA-2K (MHT-02; Health Wave Japan Inc., Japan), and then plasma was separated by centrifugation at 3,000 rpm. These samples were stored at -20℃ for subsequent biochemical analysis. Additionally, gastrocnemius muscle and plasma were collected and utilized for the extraction of exosomes. Extraction of RNAs and exosomal miRNAs According to the manufacturer's instructions, total RNAs and miRNAs were extracted from the tissue of the insular cortex utilizing the RNeasy Mini Kit and the miRNeasy Micro Kit (Qiagen Inc., USA), respectively. Gastrocnemius muscle tissues obtained from mice were immediately incubated in DMEM (Gibco-Thermo Fisher Scientific Inc., USA) supplemented with 10% of exosome-depleted FBS (EXO-FBSHI-50A-1; SBI LLC., USA) and 1% of Pen-Strep-Glutamine (Gibco-Thermo Fisher Scientific Inc., USA) for 24 hours in a humidified incubator at 37°C and 5% CO 2 . The medium was then collected and filtered through 22 µm filters. Gastrocnemius muscle-derived exosomes in the medium were then precipitated using Exo-Prep (HBM-EXP-C25; HansaBioMed Life Sciences, Estonia). On the other hand, exosomes in plasma samples were precipitated using Exo-Prep (HBM-EXP-B5; HansaBioMed Life Sciences, Estonia). Subsequent to precipitation, miRNAs were extracted from the isolated exosomes using the miRNeasy Micro Kit (Qiagen Inc., USA). Real-time PCR Following the extraction of RNAs from the insular cortex, DNase I treatment was performed, and RNA quantification was conducted using the Qubit 4.0 (Invitrogen™, USA). For detection of the mRNA levels in the insular cortex, 1000 ng of RNA underwent reverse transcription to cDNA using the GeneAce cDNA Synthesis Kit (Nippon Gene, Japan). Subsequently, the mRNA levels of target genes were measured using 5.0 ng of cDNA, primers for each target gene, and the PowerTrack™ SYBR™ Green Master Mix in the StepOne Plus Real-Time PCR 96-well system (Thermo Fisher Scientific Inc., USA). The sequences of primers (forward and reverse) used in the current study are as follows: Pten , TGGCGGAACTTGCAATCCTCAGT, and TCCCGTCGTGTGGGTCCTGA; Bdnf , GATGAGGACCAGAAGGTTCG, and GATTGGGTAGTTCGGCATTG; Trkb , TGACGAGTTTGTCCAGGAGA, and TTGCTGCTCTCATTGAGGC; Creb1 , TCAGCCGGGTACTACCATTC, and TCTCTTGCTGCTTCCCTGTT; β-actin , TATGCCAACACAGTGCTGTCTGG, and TACTCCTGCTTGCTGATCCACAT. The relative levels of each mRNA were calculated using the ΔΔCT method and normalized by β-actin mRNA levels. Following the extraction of miRNAs from the insular cortex and exosomes, DNase I treatment was performed, and miRNA quantification was conducted using the Qubit 4.0 (Invitrogen™, USA). For the detection of miRNA levels in the insular cortex, gastrocnemius muscle- and plasma-derived exosomes, ten ng of miRNA was reverse transcribed to cDNA using the Taqman™ MicroRNA Reverse Transcription Kit and the Taqman™ MicroRNA Assay (miR-486a-3p: 002093, and U6 snRNA: 001973; Thermo Fisher Scientific Inc., USA). Then, miR-486a-3p and U6 levels were measured using 0.67 ng of cDNA, the Taqman™ MicroRNA Assay, and the Taqman™ Fast Advanced Master Mix in the StepOne Plus (Thermo Fisher Scientific Inc., USA). The relative levels of miR-486a-3p were calculated by ΔΔCT method and normalized by U6 snRNA levels. Statistical analysis Data are expressed as mean ± standard error (SEM) and were analyzed using Prism version 10 (MDF, Japan). Before analyzing comparisons between groups, we checked the normality of raw data distribution using histograms. When the data were normally distributed, parametric tests (unpaired t-test) were used for statistical analyses. If we could not confirm that data were distributed normally, non-parametric tests (Mann-Whitney test) were used for statistical analyses. On the other hand, before analyzing correlations, we checked the normality of raw data distribution by Kolmogorov-Smirnov test. When the data were normally distributed, Pearson correlation was used for statistical analyses. If the data were not distributed normally, Spearman correlation was used. Statistical significance was set at p < 0.05. Results The effects of light-intensity exercise on empathic behavior and miR-486a-3p levels The mice with light-intensity exercise intervention showed significant shorter duration until the door opening compared to the sedentary mice (Fig. 1 A; p = 0.0247). While levels of gastrocnemius muscle-derived exosomal miR-486a-3p were no difference (Fig. 1 B; p = 0.2823), there were significant higher levels of plasma exosomal miR-486a-3p in the mice with light-intensity exercise than that in the sedentary mice (Fig. 1 C; p = 0.0485). Furthermore, miR-486a-3p levels in the insular cortex were significantly higher in the mice with light-intensity exercise than that in the sedentary mice (Fig. 1 D; p = 0.0062), demonstrating a correlation trend with door opening (Fig. 1 E; r = -0.5071, p = 0.0562). The plasma exosomal miR-486a-3p levels exhibited a correlation trend with the miR-486a-3p levels in the insular cortex (Fig. 1 F; r = 0.4496, p = 0.0927), but did not show a correlation trend with the gastrocnemius muscle-derived exosomal miR-486a-3p levels (Fig. 1 G; r = -0.2789, p = 0.3141). The effects of light-intensity exercise on mRNA levels in the insular cortex The mice with light-intensity exercise intervention showed significant lower levels of Pten mRNA in the insular cortex compared to the sedentary mice (Fig. 2 A; p = 0.0306). Additionally, Bdnf mRNA levels in the insular cortex were significantly higher in the mice with light-intensity exercise than that in the sedentary mice (Fig. 2 B; p = 0.0401). However, the insular cortical mRNA levels of Trkb and cAMP response element binding protein ( Creb1 ), acting as the receptor and downstream factor for BDNF, respectively, were no difference between two groups (Fig. 2 C and D; Trkb : p = 0.0661, Creb1 : p = 0.0668). Furthermore, Fndc5 , a BDNF modulator, did not show difference (Fig. 2 E; p = 0.2290). The changes of empathic behavior, miR-486a-3p levels, and mRNA levels with intraperitoneal injection of miR-486a-3p mimic As well as the effects of light-intensity exercise intervention, the mice received daily intraperitoneal injection of miR-486a-3p mimic showed significant shorter duration until door opening compared to the non-treated mice (Fig. 3 ; p = 0.0097). There was a trend towards increased levels of plasma miR-486a-3p in the mice treated with miR-486a-3p mimic compared to the non-treated mice (Fig. 4 A; p = 0.0658). Additionally, miR-486a-3p levels in the insular cortex were significant higher in the mice treated with miR-486a-3p mimic than that in the non-treated mice (Fig. 4 B; p = 0.0131). The mice treated with miR-486a-3p mimic also showed significant lower Pten mRNA levels in the insular cortex than the non-treated mice (Fig. 4 A; p = 0.0144). The mRNA levels of Bdnf , Trkb , and Creb1 in the insular cortex were significant higher in the mice treated with miR-486a-3p mimic than that in the non-treated mice (Fig. 4 B; Bdnf : p = 0.0232, Trkb : p = 0.0001, Creb1 : p = 0.0068). Conversely, Fndc5 mRNA levels did not show difference (Fig. 4 E; p = 0.1051). Discussion In the current study, we investigated the involvement of muscle-derived exosomal miR-486a-3p in the light-intensity exercise-induced enhancement of empathic behavior in mice. Our findings indicated that the mice with light-intensity exercise intervention showed significant higher levels of exosomal miR-486a-3p in plasma than the sedentary mice, while there is no significant difference observed in gastrocnemius muscle-derived exosomal miR-486a-3p levels. Furthermore, the mice with exercise intervention showed significant higher levels of miR-486a-3p and Bdnf mRNA in the insular cortex compared to the sedentary mice, concomitant with the better helping behavior. Moreover, the mice received daily intraperitoneal injection of miR-486a-3p mimic showed significant better helping behavior in mice, mimicking the effects observed with light-intensity exercise intervention. The current result (Fig. 1 A) revealed an enhancement of helping behavior with light-intensity exercise, aligning with previous observations in young adults and rodents [ 10 , 16 , 17 ]. This suggests that light-intensity exercise intervention would hold promising potential for the treatment of empathy. Consistent with other reports [ 16 ], the current study also confirmed an increase of miR-486a-3p in the insular cortex with the light-intensity exercise regimen, which was associated with empathic behavior (Fig. 1 D and E). Exercise-induced upregulation of circulating exosomal miR-486 levels has been previously reported [ 23 ], and the current exercise regimen significantly elevated exosomal miR-486a-3p levels in plasma (Fig. 1 C). Additionally, the plasma exosomal miR-486a-3p levels showed a correlation trend with the miR-486a-3p levels in the insular cortex (Fig. 1 F), suggesting that increased plasma exosomal miR-486a-3p may contribute to higher miR-486a-3p levels in the insular cortex. In contrast, the exosomal miR-486a-3p levels derived from the gastrocnemius muscle remained unchanged (Fig. 1 B) and did not correlate with the plasma exosomal miR-486a-3p levels (Fig. 1 G). Although it is essential to investigate exosome secretion from other types of muscles (e.g., plantaris, such a major fast-twitch muscle), our current results suggest that peripheral organs other than muscles may contribute to the elevation of exosomal miR-486a-3p levels in plasma. Exercise has the potential to alter the profiles of exosome secretion not only from muscles but also from various organs [ 32 , 33 ]. Further, prior reports have proposed that exosomal miRNAs, such as miR-9-3p derived from adipocytes and miR-132-3p derived from mesenchymal stromal cells, play a role in promoting brain function and neuroplasticity [ 25 , 26 ]. Future studies should explore the changes in the secretions of exosomal miR-486a-3p from organs and cell types other than muscles with the current exercise regimen. The current exercise regimen resulted in the upregulation of miR-486a-3p levels and the downregulation of Pten mRNA levels in the insular cortex (Fig. 2 A). Additionally, exercise intervention significantly increased Bdnf mRNA levels in the insular cortex (Fig. 2 B). Notably, miR-486a-3p is recognized as a suppressor of Pten mRNA [ 27 , 28 ], and the knockdown in PTEN expression contributes to an increase BDNF expression in the brain [ 30 ]. Consequently, the elevated levels of Bdnf mRNA with exercise in the current study would occur through the PTEN/BDNF pathway. The miR-486a-3p is also predicted as a potential modulator for Fndc5 on miRDB ( http://www.mirdb.org ); FNDC5 enhances BDNF expressions [ 34 ]. However, mRNA levels of Fndc5 remained unchanged in the insular cortex (Fig. 2 E). These results imply that the current exercise regimen increases Bdnf mRNA levels through the PTEN/BDNF pathway but not the FNDC5/BDNF pathway in the insular cortex. To date, oxytocin has been considered a pivotal molecule in empathy [ 35 ], modulating neuronal plasticity in the insular cortex [ 36 , 37 ]. Conversely, some prior studies have reported uncertain effects of oxytocin on empathy [ 38 , 39 ]. Based on our findings, miR-486a-3p emerges as a novel molecule with the potential to treat empathy, offering an innovative approach to therapeutic strategies compared to oxytocin. The daily intraperitoneal injection of mmu-miR-486a-3p mimic enhanced empathic behavior in mice with upregulation of miR-486a-3p levels in their insular cortex (Figs. 3 and 4 ). Furthermore, miR-486a-3p mimic treatment resulted in reduced Pten mRNA levels and increased Bdnf mRNA levels in the insular cortex (Fig. 4 A and B). These findings suggest that miR-486a-3p holds the potential to mimic the effects of light-intensity exercise in treating empathy. In the current study, we focused on the effects of intraperitoneal injection; thus, further investigation is necessary to elucidate the action mechanism using local injection of miR-486a-3p mimic into the insular cortex. While Trkb and Creb1 mRNA levels in the insular cortex remained unaltered with light-intensity exercise intervention (Fig. 2 C and D), miR-486a-3p mimic treatment significantly increased these mRNA levels in the insular cortex (Fig. 4 C and D). Exercise induces complex physiological alterations, and changes in TrkB levels with exercise are indeterminate [ 40 , 41 ]. Given that PTEN is a down-regulator of the PI3K/AKT signaling pathway [ 29 ] and the activation of PI3K/AKT signaling contributes to enhancing BDNF and TrkB expressions in neuronal cells [ 42 ], a straightforward treatment, such as an injection of miR-486a-3p mimic, might be more effective in increasing Trkb mRNA compared to exercise intervention. The current study has some limitations. Firstly, it's important to note that the current study demonstrated a restricted approach of analyzing only miR-486a-3p and evaluated its relative expressions but not absolute number of copies. Thus, further studies should address this aspect comprehensively. Second, our focus was limited to the insular cortex in the present study, neglecting other brain regions and their sub-regions associated with empathic behavior. Future investigations are warranted to explore these brain regions and their connections with the insular cortex. Finally, we exclusively measured mRNA levels, lacking information on protein levels and phosphorylation. It is imperative to delve into these aspects to elucidate the mechanism underlying the empathy-enhancing effect. In conclusion, our current findings represent the first demonstration that light-intensity exercise intervention enhances empathic behavior with an increase in exosomal miR-486a-3p in the plasma, but not in gastrocnemius muscle-derived exosomal miR-486a-3p levels. Furthermore, the treatment of miR-486a-3p mimic enhanced empathic behavior in mice, suggesting that the secretion of exosomal miR-486a-3p, originating from a source other than the gastrocnemius muscle, contributes to the effects of light-intensity exercise in treating empathy. These findings have the potential to advance and develop innovative therapeutic strategies for the treatment of empathy. Declarations Funding: This research has been supported by the Uehara Memorial Foundation, and the Meiji Yasuda Life Foundation of Health and Welfare. Data availability: The datasets in the current study are available from the corresponding author on reasonable request. Declaration of competing interest The authors inform no conflicts of interest. Author contribution TS: Conceptualization, Methodology, Resources, Investigation, Writing–original draft, Writing–review & editing, Funding acquisition; KY, YY and CT: Investigation, Writing–review & editing. References Healey ML, Grossman M (2018) Cognitive and Affective Perspective-Taking: Evidence for Shared and Dissociable Anatomical Substrates. Front Neurol 9:1–8. https://doi.org/10.3389/fneur.2018.00491 Preston SD, de Waal FBM (2002) Empathy: Its ultimate and proximate bases. Behav Brain Sci 25:1–20. https://doi.org/10.1017/S0140525X02000018 Decety J, Jackson PL (2004) The Functional Architecture of Human Empathy. Behav Cogn Neurosci Rev 3:71–100. https://doi.org/10.1177/1534582304267187 Van Lissa CJ, Hawk ST, Meeus WHJ (2017) The effects of affective and cognitive empathy on adolescents’ behavior and outcomes in conflicts with mothers. J Exp Child Psychol 158:32–45. https://doi.org/10.1016/j.jecp.2017.01.002 Fontes-Dutra M, Della-Flora Nunes G, Santos-Terra J et al (2019) Abnormal empathy-like pro-social behaviour in the valproic acid model of autism spectrum disorder. Behav Brain Res 364:11–18. https://doi.org/10.1016/j.bbr.2019.01.034 de Waal FBM, Preston SD (2017) Mammalian empathy: behavioural manifestations and neural basis. Nat Rev Neurosci 18:498–509. https://doi.org/10.1038/nrn.2017.72 Yüksel O, Ateş M, Kızıldağ S et al (2019) Regular Aerobic Voluntary Exercise Increased Oxytocin in Female Mice: The Cause of Decreased Anxiety and Increased Empathy-Like Behaviors. Balkan Med J 36:257–262. https://doi.org/10.4274/balkanmedj.galenos.2019.2018.12.87 Xu Z, Wang Z-R, Li J et al (2020) Effect of Acute Moderate-Intensity Exercise on the Mirror Neuron System: Role of Cardiovascular Fitness Level. Front Psychol 11:312. https://doi.org/10.3389/fpsyg.2020.00312 Shima T, Jesmin S, Nakao H et al (2021) Association between self-reported empathy and level of physical activity in healthy young adults. J Phys Fit Sports Med 10:45–49. https://doi.org/10.7600/jpfsm.10.45 Shima T, Jesmin S, Nakao H et al (2021) Small Amounts of Physical Activity During the COVID-19 Pandemic May Contribute to Improve Empathy in Young Adults: An Observational Study. Asia Pac J Public Health 33:635–637. https://doi.org/10.1177/10105395211016333 Shima T, Tai K, Nakao H et al (2021) Association between self-reported empathy and sport experience in young adults. J Phys Educ Sport 21:66–72. https://doi.org/10.7752/jpes.2021.01009 Shima T, Jesmin S, Onishi H et al (2022) Physical activity associates empathy in Japanese young adults with specific gene variations of oxytocin receptor and vasopressin V1B receptor. Physiol Behav 255:113930. https://doi.org/10.1016/j.physbeh.2022.113930 Laviola G, Zoratto F, Ingiosi D et al (2017) Low empathy-like behaviour in male mice associates with impaired sociability, emotional memory, physiological stress reactivity and variations in neurobiological regulations. PLoS ONE 12:e0188907. https://doi.org/10.1371/journal.pone.0188907 Ito W, Huang H, Brayman V, Morozov A (2019) Impaired social contacts with familiar anesthetized conspecific in CA3-restricted brain-derived neurotrophic factor knockout mice. Genes Brain Behav 18:e12513. https://doi.org/10.1111/gbb.12513 Asadi E, Khodagholi F, Asadi S et al (2021) Quality of early-life maternal care predicts empathy-like behavior in adult male rats: Linking empathy to BDNF gene expression in associated brain regions. Brain Res 1767:147568. https://doi.org/10.1016/j.brainres.2021.147568 Shima T, Kawabata-Iwakawa R, Onishi H et al (2022) Four weeks of light-intensity exercise enhances empathic behavior in mice: The possible involvement of BDNF. Brain Res 1787:147920. https://doi.org/10.1016/j.brainres.2022.147920 Shima T, Kawabata-Iwakawa R, Onishi H et al (2024) Circulating miRNAs as potential biomarkers for light intensity exercise-induced enhancements in empathy. Sport Sci Health 20:387–393. https://doi.org/10.1007/s11332-023-01111-6 Ming X, Brimacombe M, Wagner GC (2007) Prevalence of motor impairment in autism spectrum disorders. Brain Dev 29:565–570. https://doi.org/10.1016/j.braindev.2007.03.002 Heo J, Noble EE, Call JA (2023) The role of exerkines on brain mitochondria: a mini-review. J Appl Physiol 134:28–35. https://doi.org/10.1152/japplphysiol.00565.2022 Chow LS, Gerszten RE, Taylor JM et al (2022) Exerkines in health, resilience and disease. Nat Rev Endocrinol 18:273–289. https://doi.org/10.1038/s41574-022-00641-2 Bartel DP (2004) MicroRNAs: Genomics, Biogenesis, Mechanism, and Function. Cell 116:281–297. https://doi.org/10.1016/S0092-8674(04)00045-5 Castaño C, Mirasierra M, Vallejo M et al (2020) Delivery of muscle-derived exosomal miRNAs induced by HIIT improves insulin sensitivity through down-regulation of hepatic FoxO1 in mice. Proc Natl Acad Sci U S A 117:30335–30343. https://doi.org/10.1073/pnas.2016112117 Hou Z, Qin X, Hu Y et al (2019) Longterm Exercise-Derived Exosomal miR-342-5p. Circ Res 124:1386–1400. https://doi.org/10.1161/CIRCRESAHA.118.314635 Nederveen JP, Warnier G, Di Carlo A et al (2021) Extracellular Vesicles and Exosomes: Insights From Exercise Science. https://doi.org/10.3389/fphys.2020.604274 . Front Physiol 11: Wang J, Li L, Zhang Z et al (2022) Extracellular vesicles mediate the communication of adipose tissue with brain and promote cognitive impairment associated with insulin resistance. Cell Metab 34:1264–1279e8. https://doi.org/10.1016/j.cmet.2022.08.004 Geng W, Tang H, Luo S et al (2019) Exosomes from mirna-126-modified adscs promotes functional recovery after stroke in rats by improving neurogenesis and suppressing microglia activation. Am J Transl Res 11:780–792 Li D, Xie X, Wang J et al (2015) MiR-486 regulates lactation and targets the PTEN gene in cow mammary glands. PLoS ONE 10:1–16. https://doi.org/10.1371/journal.pone.0118284 Masliah-Planchon J, Pasmant E, Luscan A et al (2013) MicroRNAome profiling in benign and malignant neurofibromatosis type 1-associated nerve sheath tumors: Evidences of PTEN pathway alterations in early NF1 tumorigenesis. BMC Genomics 14. https://doi.org/10.1186/1471-2164-14-473 Small EM, O’Rourke JR, Moresi V et al (2010) Regulation of PI3-kinase/Akt signaling by muscle-enriched microRNA-486. Proc Natl Acad Sci U S A 107:4218–4223. https://doi.org/10.1073/pnas.1000300107 Chen L, Gong WK, Yang C ping, et al (2021) Pten is a key intrinsic factor regulating raphe 5-HT neuronal plasticity and depressive behaviors in mice. Transl Psychiatry 11:1–14. https://doi.org/10.1038/s41398-021-01303-z Sato N, Tan L, Tate K, Okada M (2015) Rats demonstrate helping behavior toward a soaked conspecific. Anim Cogn 18:1039–1047. https://doi.org/10.1007/s10071-015-0872-2 Estébanez B, Jiménez-Pavón D, Huang CJ et al (2021) Effects of exercise on exosome release and cargo in in vivo and ex vivo models: A systematic review. J Cell Physiol 236:3336–3353. https://doi.org/10.1002/jcp.30094 Li G, Liu H, Ma C et al (2019) Exosomes are the novel players involved in the beneficial effects of exercise on type 2 diabetes. J Cell Physiol 234:14896–14905. https://doi.org/10.1002/jcp.28319 Belviranlı M, Okudan N (2018) Exercise Training Protects Against Aging-Induced Cognitive Dysfunction via Activation of the Hippocampal PGC-1α / FNDC5 / BDNF Pathway. Neuromolecular Med 20:386–400. https://doi.org/10.1007/s12017-018-8500-3 Meyer-Lindenberg A, Domes G, Kirsch P, Heinrichs M (2011) Oxytocin and vasopressin in the human brain: social neuropeptides for translational medicine. Nat Rev Neurosci 12:524–538. https://doi.org/10.1038/nrn3044 Rogers-Carter MM, Varela JA, Gribbons KB et al (2018) Insular cortex mediates approach and avoidance responses to social affective stimuli. Nat Neurosci 21:404–414. https://doi.org/10.1038/s41593-018-0071-y Eres R, Decety J, Louis WR, Molenberghs P (2015) Individual differences in local gray matter density are associated with differences in affective and cognitive empathy. NeuroImage 117:305–310. https://doi.org/10.1016/j.neuroimage.2015.05.038 Keech B, Crowe S, Hocking DR (2018) Intranasal oxytocin, social cognition and neurodevelopmental disorders: A meta-analysis. Psychoneuroendocrinology 87:9–19. https://doi.org/10.1016/j.psyneuen.2017.09.022 Cai Q, Feng L, Yap KZ (2018) Systematic review and meta-analysis of reported adverse events of long-term intranasal oxytocin treatment for autism spectrum disorder. Psychiatry Clin Neurosci 72:140–151. https://doi.org/10.1111/pcn.12627 Chou W, Liu YF, Lin CH et al (2018) Exercise Rehabilitation Attenuates Cognitive Deficits in Rats with Traumatic Brain Injury by Stimulating the Cerebral HSP20/BDNF/TrkB Signalling Axis. Mol Neurobiol 55:8602–8611. https://doi.org/10.1007/s12035-018-1011-2 Chen K, Zhang L, Tan M et al (2017) Treadmill exercise suppressed stress-induced dendritic spine elimination in mouse barrel cortex and improved working memory via BDNF/TrkB pathway. https://doi.org/10.1038/tp.2017.41 . Transl Psychiatry 7: Yao RQ, Qi DS, Yu HL et al (2012) Quercetin attenuates cell apoptosis in focal cerebral ischemia rat brain via activation of BDNF-TrkB-PI3K/Akt signaling pathway. Neurochem Res 37:2777–2786. https://doi.org/10.1007/s11064-012-0871-5 Additional Declarations No competing interests reported. Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4859054","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":343428226,"identity":"a4d52695-e36f-4aa2-89e8-380ea5c9da4a","order_by":0,"name":"Takeru Shima","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA70lEQVRIiWNgGAWjYJACZgYDBgZ+FCEJPMp5YFokG0jTAgQGB4h1lD37AebPBQXb5I3PrzF7dKOGIbGB/fADBssdeGzhSWCTnmFw23DbjTfmxjnHgFp40gwYJM/gc1j+N2Yeg9uM226cMZPOYfuf2MCQA/RZGx4t/A+YPwO12G+eAdLyD2gL/xsCWiQSGKSBWhI38PeYSee2AbVIELLlxgM2kJbkGTfYyqRz+xiM2ySeGRzA5xf2/gSgw/7ctu3vP7xNOucbg2w/f/LDx5J4QgwBgC4EAzYgPowasbgA/wEEm/EjUVpGwSgYBaNghAAA4exJKUgD1MYAAAAASUVORK5CYII=","orcid":"","institution":"Gunma University","correspondingAuthor":true,"prefix":"","firstName":"Takeru","middleName":"","lastName":"Shima","suffix":""},{"id":343428227,"identity":"dda6155e-5f29-42b5-a29b-88a81b2908d9","order_by":1,"name":"Keisuke Yoshii","email":"","orcid":"","institution":"Gunma University","correspondingAuthor":false,"prefix":"","firstName":"Keisuke","middleName":"","lastName":"Yoshii","suffix":""},{"id":343428228,"identity":"c633e517-3f29-4462-bba5-89812e847af3","order_by":2,"name":"Yuika Yoshikawa","email":"","orcid":"","institution":"Gunma University","correspondingAuthor":false,"prefix":"","firstName":"Yuika","middleName":"","lastName":"Yoshikawa","suffix":""},{"id":343428229,"identity":"c9330b6a-4fbd-477c-a1cd-22655c9b078a","order_by":3,"name":"Chiho Terashima","email":"","orcid":"","institution":"Gunma University","correspondingAuthor":false,"prefix":"","firstName":"Chiho","middleName":"","lastName":"Terashima","suffix":""}],"badges":[],"createdAt":"2024-08-05 03:59:13","currentVersionCode":1,"declarations":{"humanSubjects":false,"vertebrateSubjects":false,"conflictsOfInterestStatement":false,"humanSubjectEthicalGuidelines":false,"humanSubjectConsent":false,"humanSubjectClinicalTrial":false,"humanSubjectCaseReport":false,"vertebrateSubjectEthicalGuidelines":false},"doi":"10.21203/rs.3.rs-4859054/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4859054/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":63650707,"identity":"d3aaf64b-bbea-4822-8583-0df233f5bf19","added_by":"auto","created_at":"2024-08-30 14:58:41","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":624825,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of light intensity exercise on door-opening behavior (A), gastrocnemius muscle-derived exosomal miR-486a-3p (B), exosomal miR-486a-3p in plasma (C), and miR-486a-3p in insular cortex (D). Sed, sedentary mice; Ex, exercised mice. Data are expressed as mean ± SEM, n = 7 mice for Sed group, n = 8 mice for Ex group. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 vs sedentary mice. The correlations between miR-486a-3p in the insular cortex and door-opening behavior (E). The red dashed line in the scatter diagram indicates a correlation trend. The correlations between exosomal miR-486a-3p in plasma and miR-486a-3p in the insular cortex (F). The red dashed line in the scatter diagram indicates a correlation trend. The correlations between gastrocnemius muscle-derived exosomal miR-486a-3p and exosomal miR-486a-3p in plasma (G).\u003c/p\u003e","description":"","filename":"Onlinefloatimage1.png","url":"https://assets-eu.researchsquare.com/files/rs-4859054/v1/17a9a3a5257b43eb28c816e3.png"},{"id":63650711,"identity":"5a5a6bcc-f666-468d-9201-2ebaca8df65a","added_by":"auto","created_at":"2024-08-30 14:58:41","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":247619,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of light-intensity exercise on mRNA levels of \u003cem\u003ePten\u003c/em\u003e(A), \u003cem\u003eBdnf\u003c/em\u003e (B), \u003cem\u003eTrkb\u003c/em\u003e (C), \u003cem\u003eCreb1\u003c/em\u003e (D), \u003cem\u003eFndc5\u003c/em\u003e (E) in the insular cortex. \u0026nbsp;Sedentary group was normalized as 100%. Sed, sedentary mice; Ex, exercised mice. Data are expressed as mean ± SEM, n = 7 mice for Sed group, n = 8 mice for Ex group. *\u003cem\u003ep\u003c/em\u003e\u0026lt; 0.05 vs sedentary mice.\u003c/p\u003e","description":"","filename":"Onlinefloatimage2.png","url":"https://assets-eu.researchsquare.com/files/rs-4859054/v1/67fb5f5145dd23186debd78c.png"},{"id":63651412,"identity":"ccc2057a-734f-4add-a572-81f80e65a77a","added_by":"auto","created_at":"2024-08-30 15:06:41","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":64801,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of daily i.p. injection of mmu-miR-486a-3p mimic on door-opening behavior. Data are expressed as mean ± SEM, n = 10 mice for each group. \u003csup\u003e**\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01 vs mice treated vehicle.\u003c/p\u003e","description":"","filename":"Onlinefloatimage3.png","url":"https://assets-eu.researchsquare.com/files/rs-4859054/v1/23faebc212f4e9525aaae13b.png"},{"id":63650708,"identity":"28f23951-5cb8-4c52-8a77-360c3a00f043","added_by":"auto","created_at":"2024-08-30 14:58:41","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":541767,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of daily i.p. injection of mmu-miR-486a-3p mimic on miR-486a-3p levels in the plasma (A) and the insular cortex (B). The group treated vehicle was normalized as 100%. Data are expressed as mean ± SEM, n = 10 mice for each group. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 vs mice treated vehicle.\u003c/p\u003e","description":"","filename":"Onlinefloatimage4.png","url":"https://assets-eu.researchsquare.com/files/rs-4859054/v1/fe3085353c795740cf7416d6.png"},{"id":63650709,"identity":"51d1853d-7840-44bc-b760-d7eae20bd01b","added_by":"auto","created_at":"2024-08-30 14:58:41","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":138489,"visible":true,"origin":"","legend":"\u003cp\u003eEffect of daily i.p. injection of mmu-miR-486a-3p mimic on mRNA levels of \u003cem\u003ePten\u003c/em\u003e (A), \u003cem\u003eBdnf\u003c/em\u003e (B), \u003cem\u003eTrkb\u003c/em\u003e (C), \u003cem\u003eCreb1\u003c/em\u003e (D), \u003cem\u003eFndc5\u003c/em\u003e (E) in the insular cortex. The group treated vehicle was normalized as 100%. Data are expressed as mean ± SEM, n = 10 mice for each group. \u003csup\u003e*\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.05, \u003csup\u003e**\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.01, \u003csup\u003e***\u003c/sup\u003e\u003cem\u003ep\u003c/em\u003e \u0026lt; 0.001 vs mice treated vehicle.\u003c/p\u003e","description":"","filename":"Onlinefloatimage5.png","url":"https://assets-eu.researchsquare.com/files/rs-4859054/v1/7988fa1a3566e7b437e1bdb9.png"},{"id":71581113,"identity":"3b996af8-fb72-44f8-b5fc-f0cf0522f493","added_by":"auto","created_at":"2024-12-17 00:16:31","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3203993,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4859054/v1/0eb47b10-6fdd-46ed-b51d-8df83408c472.pdf"}],"financialInterests":"No competing interests reported.","formattedTitle":"The potential contribution of light-intensity exercise-induced miR-486a-3p secretion on enhancing empathic behavior in mice","fulltext":[{"header":"Introduction","content":"\u003cp\u003eEmpathy, intricately tied to perspective-taking and emotional contagion [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e], denotes the capacity to discern and engage with the emotions of others, fostering interpersonal connections [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e, \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e]. The decline in empathy is not only a catalyst for diminished prosocial behavior [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e] but also constitutes a significant pathophysiological factor in individuals with autism spectrum disorder [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], emphasizing the pivotal role of human empathy as a crucial clinical focus. Notably, empathic behavior extends beyond the human domain, manifesting in other mammals, exemplified by rodents' helping behavior [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. Consequently, employing behavioral tests in animal experiments proves valuable for devising innovative strategies aimed at augmenting empathy.\u003c/p\u003e \u003cp\u003eExercise emerges as a prospective approach for empathy treatment, as prior research has indicated its potential to amplify both empathic behavior and the neuronal systems associated with empathy [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]. Our investigation unveils a correlation between regular physical activity levels and heightened empathy in healthy young adults [\u003cspan additionalcitationids=\"CR10 CR11\" citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e], suggesting the susceptibility of empathy to exercise. Notably, brain-derived neurotrophic factor (BDNF), a neuropeptide implicated in neuroplasticity enhancement, has been linked to empathic behavior as well as oxytocin [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The upregulation of BDNF expressions in the insular cortex, a brain region intricately tied to empathy, is posited as a catalyst for the augmentation of empathic behavior [\u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e]. Recent studies propose that light-intensity exercise intervention fosters empathic behavior through increased BDNF expressions in the insular cortex [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. This exercise regimen would hold promise as an optimal therapeutic strategy for enhancing empathy, not only in healthy individuals but also in autism spectrum disorders patients with motor impairments [\u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e18\u003c/span\u003e]. However, the precise mechanisms underlying the effects of exercise remain inadequately understood, necessitating further exploration to devise efficient strategies for empathy treatment.\u003c/p\u003e \u003cp\u003eThe impact of exercise on the brain is influenced not only by intrinsic brain mechanisms but also by the biochemical factors secreted from peripheral organs, such as \u0026ldquo;exerkines\u0026rdquo; [\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e, \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. A number of studies proposed that the release of exosomes constitutes a key mechanism underlying the effects of exercise. Exosomes, small extracellular vesicles ranging from 40 to 160 nm, are secreted by various organs and contain microRNAs (miRNAs). These miRNAs, short non-coding RNAs approximately 21\u0026ndash;25 nucleotides in length, bind to complementary regions of messenger RNAs (mRNAs), leading to mRNA degradation or the inhibition of translation [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Notably, some indications suggest that exercise-induced exosomal miRNAs released from muscles enhance biological and physiological functions not only in peripheral organs but also in the brain [\u003cspan additionalcitationids=\"CR23\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Additionally, previous studies have suggested that miRNAs derived from adipocytes and mesenchymal stromal cells contribute to the enhancement of brain function and neuroplasticity [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Therefore, it is crucial to investigate peripheral organs-to-brain crosstalk to understand the detailed mechanisms underlying the effects of exercise.\u003c/p\u003e \u003cp\u003eA previous study has documented that light-intensity exercise intervention, known to augment empathy, results in an increase of miR-486a-3p along with the upregulation of \u003cem\u003eBdnf\u003c/em\u003e mRNA levels in the insular cortex [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. The miR-486a-3p is recognized for its involvement in the growth of various cells and its suppression of mRNA levels in phosphatase and tensin homolog (\u003cem\u003ePten\u003c/em\u003e) [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], a major tumor suppressor gene. PTEN serves as a down-regulator of the PI3K/AKT signaling pathway and influences BDNF expressions [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]; thus, the elevation of miR-486a-3p levels in the insular cortex constitutes an underlying mechanism for the light-intensity exercise-induced enhancement in empathic behavior. However, it remains unclear whether miR-486a-3p derived from peripheral organs contributes to the effects of light-intensity exercise on empathy.\u003c/p\u003e \u003cp\u003eHere, our initial examination focused on evaluating the impact of light-intensity exercise intervention on the helping behavior, indicative of empathy, in mice, along with the secretion of exosomal miR-486a-3p from muscles. Subsequently, we delved into an investigation of the effects of daily intraperitoneal injections of mmu-miR-486a-3p mimic on empathic behavior in mice.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003eMale C57BL/6J mice, eight weeks of age, were procured from SLC Inc. (Japan) and were accommodated in a controlled environment with temperatures maintained between 21\u0026ndash;23℃, operating on a 12-hour light/dark cycle (lights on from 8 AM to 8 PM). These mice had access to a standard pellet diet (Rodent Diet CE-2, CLEA Japan Inc., Japan) and water ad libitum. The experiments were reviewed and approved by the Gunma University Animal Care and Experimentation Committee (approval No. 22\u0026thinsp;\u0026minus;\u0026thinsp;012).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eExercise training\u003c/h2\u003e \u003cp\u003eAfter a week of acclimatization to the housing environment, the mice were divided into exercise groups and non-exercise (sedentary) groups. Mice in the exercise group underwent running habituation on a forced exercise wheel bed without electric stimulation, ranging from 3.0 to 7.0 m/min for 30 min/day, five days/week, with two consecutive days of training followed by three consecutive days of training next to a rest day, spanning one week. Subsequently, they engaged in light-intensity exercise at 7.0 m/min on the same equipment for 30 min/day, five days/week, over a period of three weeks [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e]. All sessions were conducted during the light period (from 8 AM to 10 AM). Helping behavior tests were administered to both exercise and sedentary groups for five days, concurrently with the exercise regimen during the fourth week.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eIntraperitoneal injection of mmu-miR-486a-3p mimic\u003c/h2\u003e \u003cp\u003eFollowing one week of acclimatization to the housing environment, the mice were divided into miR-486a-3p mimic-treated and non-treated (vehicle) groups. The mice in miR-486a-3p mimic-treated groups received daily intraperitoneal injections of mmu-miR-486a-3p mimic for 2 weeks. An 80 nmol/l solution of mmu-miR-486a-3p mimic was prepared by diluting it in 0.9% saline with 0.02% TE buffer. Mice received an injection of 10 \u0026micro;l/g body weight of the solution during the light period (0.8 nmol/kg body weight, once a day from 8 AM to 9 AM). Saline (Otsuka Pharmaceutical Factory, Japan) with 0.02% TE buffer was used as the vehicle. These mice did not undergo exercise training. The empathic behavior test was conducted for five days following a two-week treatment period.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eEmpathic behavior test\u003c/h2\u003e \u003cp\u003eExperimental equipment previously described was used to test empathic behavior [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e]. Empathy-like behavior was defined as the act of door-opening to help a cage mate. The behavioral test took place from 7 AM to 8 AM, with all mice undergoing a four-day training period to learn the door-opening behavior using the empathy test equipment. On the fifth day, the mice were tested. Both learning and testing sessions lasting 3 min per mouse. During the test, a mouse was positioned in the ground area, while its cage mate was situated in the water pool area. The helping behavior of the mouse in the ground area was recorded for 3 min. Earlier instances of door opening indicated higher empathy in mice. It is crucial to note that cage mates in the water pool area were not subjected to an evaluation of helping behavior.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eTissue preparation\u003c/h2\u003e \u003cp\u003eTwo days after the testing session of the empathic behavior test, mice were anesthetized using isoflurane (Dainippon Sumitomo Pharma Co., Japan), and the blood samples were obtained from cardiac puncture. Subsequently, the insular cortex was collected and preserved in RNAlater\u0026trade; Stabilization Solution (Invitrogen\u0026trade;, USA). The collected blood samples were put into microtubes with EDTA-2K (MHT-02; Health Wave Japan Inc., Japan), and then plasma was separated by centrifugation at 3,000 rpm. These samples were stored at -20℃ for subsequent biochemical analysis. Additionally, gastrocnemius muscle and plasma were collected and utilized for the extraction of exosomes.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eExtraction of RNAs and exosomal miRNAs\u003c/h2\u003e \u003cp\u003eAccording to the manufacturer's instructions, total RNAs and miRNAs were extracted from the tissue of the insular cortex utilizing the RNeasy Mini Kit and the miRNeasy Micro Kit (Qiagen Inc., USA), respectively. Gastrocnemius muscle tissues obtained from mice were immediately incubated in DMEM (Gibco-Thermo Fisher Scientific Inc., USA) supplemented with 10% of exosome-depleted FBS (EXO-FBSHI-50A-1; SBI LLC., USA) and 1% of Pen-Strep-Glutamine (Gibco-Thermo Fisher Scientific Inc., USA) for 24 hours in a humidified incubator at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. The medium was then collected and filtered through 22 \u0026micro;m filters. Gastrocnemius muscle-derived exosomes in the medium were then precipitated using Exo-Prep (HBM-EXP-C25; HansaBioMed Life Sciences, Estonia). On the other hand, exosomes in plasma samples were precipitated using Exo-Prep (HBM-EXP-B5; HansaBioMed Life Sciences, Estonia). Subsequent to precipitation, miRNAs were extracted from the isolated exosomes using the miRNeasy Micro Kit (Qiagen Inc., USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eReal-time PCR\u003c/h2\u003e \u003cp\u003eFollowing the extraction of RNAs from the insular cortex, DNase I treatment was performed, and RNA quantification was conducted using the Qubit 4.0 (Invitrogen\u0026trade;, USA). For detection of the mRNA levels in the insular cortex, 1000 ng of RNA underwent reverse transcription to cDNA using the GeneAce cDNA Synthesis Kit (Nippon Gene, Japan). Subsequently, the mRNA levels of target genes were measured using 5.0 ng of cDNA, primers for each target gene, and the PowerTrack\u0026trade; SYBR\u0026trade; Green Master Mix in the StepOne Plus Real-Time PCR 96-well system (Thermo Fisher Scientific Inc., USA). The sequences of primers (forward and reverse) used in the current study are as follows: \u003cem\u003ePten\u003c/em\u003e, TGGCGGAACTTGCAATCCTCAGT, and TCCCGTCGTGTGGGTCCTGA; \u003cem\u003eBdnf\u003c/em\u003e, GATGAGGACCAGAAGGTTCG, and GATTGGGTAGTTCGGCATTG; \u003cem\u003eTrkb\u003c/em\u003e, TGACGAGTTTGTCCAGGAGA, and TTGCTGCTCTCATTGAGGC; \u003cem\u003eCreb1\u003c/em\u003e, TCAGCCGGGTACTACCATTC, and TCTCTTGCTGCTTCCCTGTT; \u003cem\u003eβ-actin\u003c/em\u003e, TATGCCAACACAGTGCTGTCTGG, and TACTCCTGCTTGCTGATCCACAT. The relative levels of each mRNA were calculated using the ΔΔCT method and normalized by β-actin mRNA levels.\u003c/p\u003e \u003cp\u003eFollowing the extraction of miRNAs from the insular cortex and exosomes, DNase I treatment was performed, and miRNA quantification was conducted using the Qubit 4.0 (Invitrogen\u0026trade;, USA). For the detection of miRNA levels in the insular cortex, gastrocnemius muscle- and plasma-derived exosomes, ten ng of miRNA was reverse transcribed to cDNA using the Taqman\u0026trade; MicroRNA Reverse Transcription Kit and the Taqman\u0026trade; MicroRNA Assay (miR-486a-3p: 002093, and U6 snRNA: 001973; Thermo Fisher Scientific Inc., USA). Then, miR-486a-3p and U6 levels were measured using 0.67 ng of cDNA, the Taqman\u0026trade; MicroRNA Assay, and the Taqman\u0026trade; Fast Advanced Master Mix in the StepOne Plus (Thermo Fisher Scientific Inc., USA). The relative levels of miR-486a-3p were calculated by ΔΔCT method and normalized by U6 snRNA levels.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eData are expressed as mean\u0026thinsp;\u0026plusmn;\u0026thinsp;standard error (SEM) and were analyzed using Prism version 10 (MDF, Japan). Before analyzing comparisons between groups, we checked the normality of raw data distribution using histograms. When the data were normally distributed, parametric tests (unpaired t-test) were used for statistical analyses. If we could not confirm that data were distributed normally, non-parametric tests (Mann-Whitney test) were used for statistical analyses. On the other hand, before analyzing correlations, we checked the normality of raw data distribution by Kolmogorov-Smirnov test. When the data were normally distributed, Pearson correlation was used for statistical analyses. If the data were not distributed normally, Spearman correlation was used. Statistical significance was set at \u003cem\u003ep\u003c/em\u003e\u0026thinsp;\u0026lt;\u0026thinsp;0.05.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eThe effects of light-intensity exercise on empathic behavior and miR-486a-3p levels\u003c/h2\u003e \u003cp\u003eThe mice with light-intensity exercise intervention showed significant shorter duration until the door opening compared to the sedentary mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0247). While levels of gastrocnemius muscle-derived exosomal miR-486a-3p were no difference (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.2823), there were significant higher levels of plasma exosomal miR-486a-3p in the mice with light-intensity exercise than that in the sedentary mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0485). Furthermore, miR-486a-3p levels in the insular cortex were significantly higher in the mice with light-intensity exercise than that in the sedentary mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0062), demonstrating a correlation trend with door opening (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE; \u003cem\u003er\u003c/em\u003e = -0.5071, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0562). The plasma exosomal miR-486a-3p levels exhibited a correlation trend with the miR-486a-3p levels in the insular cortex (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF; \u003cem\u003er\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.4496, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0927), but did not show a correlation trend with the gastrocnemius muscle-derived exosomal miR-486a-3p levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG; \u003cem\u003er\u003c/em\u003e = -0.2789, \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.3141).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003eThe effects of light-intensity exercise on mRNA levels in the insular cortex\u003c/h2\u003e \u003cp\u003eThe mice with light-intensity exercise intervention showed significant lower levels of \u003cem\u003ePten\u003c/em\u003e mRNA in the insular cortex compared to the sedentary mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0306). Additionally, \u003cem\u003eBdnf\u003c/em\u003e mRNA levels in the insular cortex were significantly higher in the mice with light-intensity exercise than that in the sedentary mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0401). However, the insular cortical mRNA levels of \u003cem\u003eTrkb\u003c/em\u003e and cAMP response element binding protein (\u003cem\u003eCreb1\u003c/em\u003e), acting as the receptor and downstream factor for BDNF, respectively, were no difference between two groups (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and D; \u003cem\u003eTrkb\u003c/em\u003e: \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0661, \u003cem\u003eCreb1\u003c/em\u003e: \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0668). Furthermore, \u003cem\u003eFndc5\u003c/em\u003e, a BDNF modulator, did not show difference (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.2290).\u003c/p\u003e \u003cp\u003e \u003cb\u003eThe changes of empathic behavior, miR-486a-3p levels, and mRNA levels with intraperitoneal injection of miR-486a-3p mimic\u003c/b\u003e \u003c/p\u003e \u003cp\u003eAs well as the effects of light-intensity exercise intervention, the mice received daily intraperitoneal injection of miR-486a-3p mimic showed significant shorter duration until door opening compared to the non-treated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0097). There was a trend towards increased levels of plasma miR-486a-3p in the mice treated with miR-486a-3p mimic compared to the non-treated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0658). Additionally, miR-486a-3p levels in the insular cortex were significant higher in the mice treated with miR-486a-3p mimic than that in the non-treated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0131). The mice treated with miR-486a-3p mimic also showed significant lower \u003cem\u003ePten\u003c/em\u003e mRNA levels in the insular cortex than the non-treated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0144). The mRNA levels of \u003cem\u003eBdnf\u003c/em\u003e, \u003cem\u003eTrkb\u003c/em\u003e, and \u003cem\u003eCreb1\u003c/em\u003e in the insular cortex were significant higher in the mice treated with miR-486a-3p mimic than that in the non-treated mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB; \u003cem\u003eBdnf\u003c/em\u003e: \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0232, \u003cem\u003eTrkb\u003c/em\u003e: \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0001, \u003cem\u003eCreb1\u003c/em\u003e: \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.0068). Conversely, \u003cem\u003eFndc5\u003c/em\u003e mRNA levels did not show difference (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eE; \u003cem\u003ep\u003c/em\u003e\u0026thinsp;=\u0026thinsp;0.1051).\u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIn the current study, we investigated the involvement of muscle-derived exosomal miR-486a-3p in the light-intensity exercise-induced enhancement of empathic behavior in mice. Our findings indicated that the mice with light-intensity exercise intervention showed significant higher levels of exosomal miR-486a-3p in plasma than the sedentary mice, while there is no significant difference observed in gastrocnemius muscle-derived exosomal miR-486a-3p levels. Furthermore, the mice with exercise intervention showed significant higher levels of miR-486a-3p and \u003cem\u003eBdnf\u003c/em\u003e mRNA in the insular cortex compared to the sedentary mice, concomitant with the better helping behavior. Moreover, the mice received daily intraperitoneal injection of miR-486a-3p mimic showed significant better helping behavior in mice, mimicking the effects observed with light-intensity exercise intervention.\u003c/p\u003e \u003cp\u003eThe current result (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) revealed an enhancement of helping behavior with light-intensity exercise, aligning with previous observations in young adults and rodents [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e, \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e, \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e17\u003c/span\u003e]. This suggests that light-intensity exercise intervention would hold promising potential for the treatment of empathy. Consistent with other reports [\u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e16\u003c/span\u003e], the current study also confirmed an increase of miR-486a-3p in the insular cortex with the light-intensity exercise regimen, which was associated with empathic behavior (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD and E). Exercise-induced upregulation of circulating exosomal miR-486 levels has been previously reported [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e], and the current exercise regimen significantly elevated exosomal miR-486a-3p levels in plasma (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Additionally, the plasma exosomal miR-486a-3p levels showed a correlation trend with the miR-486a-3p levels in the insular cortex (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eF), suggesting that increased plasma exosomal miR-486a-3p may contribute to higher miR-486a-3p levels in the insular cortex. In contrast, the exosomal miR-486a-3p levels derived from the gastrocnemius muscle remained unchanged (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB) and did not correlate with the plasma exosomal miR-486a-3p levels (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eG). Although it is essential to investigate exosome secretion from other types of muscles (e.g., plantaris, such a major fast-twitch muscle), our current results suggest that peripheral organs other than muscles may contribute to the elevation of exosomal miR-486a-3p levels in plasma. Exercise has the potential to alter the profiles of exosome secretion not only from muscles but also from various organs [\u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. Further, prior reports have proposed that exosomal miRNAs, such as miR-9-3p derived from adipocytes and miR-132-3p derived from mesenchymal stromal cells, play a role in promoting brain function and neuroplasticity [\u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e25\u003c/span\u003e, \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e26\u003c/span\u003e]. Future studies should explore the changes in the secretions of exosomal miR-486a-3p from organs and cell types other than muscles with the current exercise regimen.\u003c/p\u003e \u003cp\u003eThe current exercise regimen resulted in the upregulation of miR-486a-3p levels and the downregulation of \u003cem\u003ePten\u003c/em\u003e mRNA levels in the insular cortex (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). Additionally, exercise intervention significantly increased \u003cem\u003eBdnf\u003c/em\u003e mRNA levels in the insular cortex (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). Notably, miR-486a-3p is recognized as a suppressor of \u003cem\u003ePten\u003c/em\u003e mRNA [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e, \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e], and the knockdown in PTEN expression contributes to an increase BDNF expression in the brain [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. Consequently, the elevated levels of \u003cem\u003eBdnf\u003c/em\u003e mRNA with exercise in the current study would occur through the PTEN/BDNF pathway. The miR-486a-3p is also predicted as a potential modulator for \u003cem\u003eFndc5\u003c/em\u003e on miRDB (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.mirdb.org\u003c/span\u003e\u003cspan address=\"http://www.mirdb.org\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e); FNDC5 enhances BDNF expressions [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. However, mRNA levels of \u003cem\u003eFndc5\u003c/em\u003e remained unchanged in the insular cortex (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eE). These results imply that the current exercise regimen increases \u003cem\u003eBdnf\u003c/em\u003e mRNA levels through the PTEN/BDNF pathway but not the FNDC5/BDNF pathway in the insular cortex. To date, oxytocin has been considered a pivotal molecule in empathy [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e], modulating neuronal plasticity in the insular cortex [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e, \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. Conversely, some prior studies have reported uncertain effects of oxytocin on empathy [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e, \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Based on our findings, miR-486a-3p emerges as a novel molecule with the potential to treat empathy, offering an innovative approach to therapeutic strategies compared to oxytocin.\u003c/p\u003e \u003cp\u003eThe daily intraperitoneal injection of mmu-miR-486a-3p mimic enhanced empathic behavior in mice with upregulation of miR-486a-3p levels in their insular cortex (Figs.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003e and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003e). Furthermore, miR-486a-3p mimic treatment resulted in reduced \u003cem\u003ePten\u003c/em\u003e mRNA levels and increased \u003cem\u003eBdnf\u003c/em\u003e mRNA levels in the insular cortex (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA and B). These findings suggest that miR-486a-3p holds the potential to mimic the effects of light-intensity exercise in treating empathy. In the current study, we focused on the effects of intraperitoneal injection; thus, further investigation is necessary to elucidate the action mechanism using local injection of miR-486a-3p mimic into the insular cortex. While \u003cem\u003eTrkb\u003c/em\u003e and \u003cem\u003eCreb1\u003c/em\u003e mRNA levels in the insular cortex remained unaltered with light-intensity exercise intervention (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC and D), miR-486a-3p mimic treatment significantly increased these mRNA levels in the insular cortex (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC and D). Exercise induces complex physiological alterations, and changes in \u003cem\u003eTrkB\u003c/em\u003e levels with exercise are indeterminate [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e, \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e]. Given that PTEN is a down-regulator of the PI3K/AKT signaling pathway [\u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e] and the activation of PI3K/AKT signaling contributes to enhancing BDNF and TrkB expressions in neuronal cells [\u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e], a straightforward treatment, such as an injection of miR-486a-3p mimic, might be more effective in increasing \u003cem\u003eTrkb\u003c/em\u003e mRNA compared to exercise intervention.\u003c/p\u003e \u003cp\u003eThe current study has some limitations. Firstly, it's important to note that the current study demonstrated a restricted approach of analyzing only miR-486a-3p and evaluated its relative expressions but not absolute number of copies. Thus, further studies should address this aspect comprehensively. Second, our focus was limited to the insular cortex in the present study, neglecting other brain regions and their sub-regions associated with empathic behavior. Future investigations are warranted to explore these brain regions and their connections with the insular cortex. Finally, we exclusively measured mRNA levels, lacking information on protein levels and phosphorylation. It is imperative to delve into these aspects to elucidate the mechanism underlying the empathy-enhancing effect.\u003c/p\u003e \u003cp\u003eIn conclusion, our current findings represent the first demonstration that light-intensity exercise intervention enhances empathic behavior with an increase in exosomal miR-486a-3p in the plasma, but not in gastrocnemius muscle-derived exosomal miR-486a-3p levels. Furthermore, the treatment of miR-486a-3p mimic enhanced empathic behavior in mice, suggesting that the secretion of exosomal miR-486a-3p, originating from a source other than the gastrocnemius muscle, contributes to the effects of light-intensity exercise in treating empathy. These findings have the potential to advance and develop innovative therapeutic strategies for the treatment of empathy.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eFunding:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis research has been supported by the Uehara Memorial Foundation, and the Meiji Yasuda Life Foundation of Health and Welfare.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability:\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets in the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eDeclaration of competing interest\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors inform no conflicts of interest.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthor contribution\u0026nbsp;\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eTS: Conceptualization, Methodology, Resources, Investigation, Writing\u0026ndash;original draft, Writing\u0026ndash;review \u0026amp; editing, Funding acquisition; KY, YY and CT: Investigation, Writing\u0026ndash;review \u0026amp; editing.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eHealey ML, Grossman M (2018) Cognitive and Affective Perspective-Taking: Evidence for Shared and Dissociable Anatomical Substrates. Front Neurol 9:1\u0026ndash;8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fneur.2018.00491\u003c/span\u003e\u003cspan address=\"10.3389/fneur.2018.00491\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ePreston SD, de Waal FBM (2002) Empathy: Its ultimate and proximate bases. Behav Brain Sci 25:1\u0026ndash;20. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1017/S0140525X02000018\u003c/span\u003e\u003cspan address=\"10.1017/S0140525X02000018\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eDecety J, Jackson PL (2004) The Functional Architecture of Human Empathy. Behav Cogn Neurosci Rev 3:71\u0026ndash;100. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/1534582304267187\u003c/span\u003e\u003cspan address=\"10.1177/1534582304267187\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eVan Lissa CJ, Hawk ST, Meeus WHJ (2017) The effects of affective and cognitive empathy on adolescents\u0026rsquo; behavior and outcomes in conflicts with mothers. J Exp Child Psychol 158:32\u0026ndash;45. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.jecp.2017.01.002\u003c/span\u003e\u003cspan address=\"10.1016/j.jecp.2017.01.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eFontes-Dutra M, Della-Flora Nunes G, Santos-Terra J et al (2019) Abnormal empathy-like pro-social behaviour in the valproic acid model of autism spectrum disorder. Behav Brain Res 364:11\u0026ndash;18. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.bbr.2019.01.034\u003c/span\u003e\u003cspan address=\"10.1016/j.bbr.2019.01.034\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003ede Waal FBM, Preston SD (2017) Mammalian empathy: behavioural manifestations and neural basis. Nat Rev Neurosci 18:498\u0026ndash;509. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrn.2017.72\u003c/span\u003e\u003cspan address=\"10.1038/nrn.2017.72\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eY\u0026uuml;ksel O, Ateş M, Kızıldağ S et al (2019) Regular Aerobic Voluntary Exercise Increased Oxytocin in Female Mice: The Cause of Decreased Anxiety and Increased Empathy-Like Behaviors. Balkan Med J 36:257\u0026ndash;262. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.4274/balkanmedj.galenos.2019.2018.12.87\u003c/span\u003e\u003cspan address=\"10.4274/balkanmedj.galenos.2019.2018.12.87\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eXu Z, Wang Z-R, Li J et al (2020) Effect of Acute Moderate-Intensity Exercise on the Mirror Neuron System: Role of Cardiovascular Fitness Level. Front Psychol 11:312. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fpsyg.2020.00312\u003c/span\u003e\u003cspan address=\"10.3389/fpsyg.2020.00312\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShima T, Jesmin S, Nakao H et al (2021) Association between self-reported empathy and level of physical activity in healthy young adults. J Phys Fit Sports Med 10:45\u0026ndash;49. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7600/jpfsm.10.45\u003c/span\u003e\u003cspan address=\"10.7600/jpfsm.10.45\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShima T, Jesmin S, Nakao H et al (2021) Small Amounts of Physical Activity During the COVID-19 Pandemic May Contribute to Improve Empathy in Young Adults: An Observational Study. Asia Pac J Public Health 33:635\u0026ndash;637. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1177/10105395211016333\u003c/span\u003e\u003cspan address=\"10.1177/10105395211016333\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShima T, Tai K, Nakao H et al (2021) Association between self-reported empathy and sport experience in young adults. J Phys Educ Sport 21:66\u0026ndash;72. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.7752/jpes.2021.01009\u003c/span\u003e\u003cspan address=\"10.7752/jpes.2021.01009\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShima T, Jesmin S, Onishi H et al (2022) Physical activity associates empathy in Japanese young adults with specific gene variations of oxytocin receptor and vasopressin V1B receptor. Physiol Behav 255:113930. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.physbeh.2022.113930\u003c/span\u003e\u003cspan address=\"10.1016/j.physbeh.2022.113930\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLaviola G, Zoratto F, Ingiosi D et al (2017) Low empathy-like behaviour in male mice associates with impaired sociability, emotional memory, physiological stress reactivity and variations in neurobiological regulations. PLoS ONE 12:e0188907. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0188907\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0188907\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eIto W, Huang H, Brayman V, Morozov A (2019) Impaired social contacts with familiar anesthetized conspecific in CA3-restricted brain-derived neurotrophic factor knockout mice. Genes Brain Behav 18:e12513. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/gbb.12513\u003c/span\u003e\u003cspan address=\"10.1111/gbb.12513\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eAsadi E, Khodagholi F, Asadi S et al (2021) Quality of early-life maternal care predicts empathy-like behavior in adult male rats: Linking empathy to BDNF gene expression in associated brain regions. Brain Res 1767:147568. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.brainres.2021.147568\u003c/span\u003e\u003cspan address=\"10.1016/j.brainres.2021.147568\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShima T, Kawabata-Iwakawa R, Onishi H et al (2022) Four weeks of light-intensity exercise enhances empathic behavior in mice: The possible involvement of BDNF. Brain Res 1787:147920. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.brainres.2022.147920\u003c/span\u003e\u003cspan address=\"10.1016/j.brainres.2022.147920\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eShima T, Kawabata-Iwakawa R, Onishi H et al (2024) Circulating miRNAs as potential biomarkers for light intensity exercise-induced enhancements in empathy. Sport Sci Health 20:387\u0026ndash;393. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11332-023-01111-6\u003c/span\u003e\u003cspan address=\"10.1007/s11332-023-01111-6\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMing X, Brimacombe M, Wagner GC (2007) Prevalence of motor impairment in autism spectrum disorders. Brain Dev 29:565\u0026ndash;570. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.braindev.2007.03.002\u003c/span\u003e\u003cspan address=\"10.1016/j.braindev.2007.03.002\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHeo J, Noble EE, Call JA (2023) The role of exerkines on brain mitochondria: a mini-review. J Appl Physiol 134:28\u0026ndash;35. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1152/japplphysiol.00565.2022\u003c/span\u003e\u003cspan address=\"10.1152/japplphysiol.00565.2022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChow LS, Gerszten RE, Taylor JM et al (2022) Exerkines in health, resilience and disease. Nat Rev Endocrinol 18:273\u0026ndash;289. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41574-022-00641-2\u003c/span\u003e\u003cspan address=\"10.1038/s41574-022-00641-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBartel DP (2004) MicroRNAs: Genomics, Biogenesis, Mechanism, and Function. Cell 116:281\u0026ndash;297. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/S0092-8674(04)00045-5\u003c/span\u003e\u003cspan address=\"10.1016/S0092-8674(04)00045-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCasta\u0026ntilde;o C, Mirasierra M, Vallejo M et al (2020) Delivery of muscle-derived exosomal miRNAs induced by HIIT improves insulin sensitivity through down-regulation of hepatic FoxO1 in mice. Proc Natl Acad Sci U S A 117:30335\u0026ndash;30343. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.2016112117\u003c/span\u003e\u003cspan address=\"10.1073/pnas.2016112117\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eHou Z, Qin X, Hu Y et al (2019) Longterm Exercise-Derived Exosomal miR-342-5p. Circ Res 124:1386\u0026ndash;1400. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1161/CIRCRESAHA.118.314635\u003c/span\u003e\u003cspan address=\"10.1161/CIRCRESAHA.118.314635\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eNederveen JP, Warnier G, Di Carlo A et al (2021) Extracellular Vesicles and Exosomes: Insights From Exercise Science. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.3389/fphys.2020.604274\u003c/span\u003e\u003cspan address=\"10.3389/fphys.2020.604274\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Front Physiol 11:\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eWang J, Li L, Zhang Z et al (2022) Extracellular vesicles mediate the communication of adipose tissue with brain and promote cognitive impairment associated with insulin resistance. Cell Metab 34:1264\u0026ndash;1279e8. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.cmet.2022.08.004\u003c/span\u003e\u003cspan address=\"10.1016/j.cmet.2022.08.004\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eGeng W, Tang H, Luo S et al (2019) Exosomes from mirna-126-modified adscs promotes functional recovery after stroke in rats by improving neurogenesis and suppressing microglia activation. Am J Transl Res 11:780\u0026ndash;792\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi D, Xie X, Wang J et al (2015) MiR-486 regulates lactation and targets the PTEN gene in cow mammary glands. PLoS ONE 10:1\u0026ndash;16. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1371/journal.pone.0118284\u003c/span\u003e\u003cspan address=\"10.1371/journal.pone.0118284\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMasliah-Planchon J, Pasmant E, Luscan A et al (2013) MicroRNAome profiling in benign and malignant neurofibromatosis type 1-associated nerve sheath tumors: Evidences of PTEN pathway alterations in early NF1 tumorigenesis. BMC Genomics 14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1186/1471-2164-14-473\u003c/span\u003e\u003cspan address=\"10.1186/1471-2164-14-473\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSmall EM, O\u0026rsquo;Rourke JR, Moresi V et al (2010) Regulation of PI3-kinase/Akt signaling by muscle-enriched microRNA-486. Proc Natl Acad Sci U S A 107:4218\u0026ndash;4223. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1073/pnas.1000300107\u003c/span\u003e\u003cspan address=\"10.1073/pnas.1000300107\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen L, Gong WK, Yang C ping, et al (2021) Pten is a key intrinsic factor regulating raphe 5-HT neuronal plasticity and depressive behaviors in mice. Transl Psychiatry 11:1\u0026ndash;14. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41398-021-01303-z\u003c/span\u003e\u003cspan address=\"10.1038/s41398-021-01303-z\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eSato N, Tan L, Tate K, Okada M (2015) Rats demonstrate helping behavior toward a soaked conspecific. Anim Cogn 18:1039\u0026ndash;1047. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s10071-015-0872-2\u003c/span\u003e\u003cspan address=\"10.1007/s10071-015-0872-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEst\u0026eacute;banez B, Jim\u0026eacute;nez-Pav\u0026oacute;n D, Huang CJ et al (2021) Effects of exercise on exosome release and cargo in in vivo and ex vivo models: A systematic review. J Cell Physiol 236:3336\u0026ndash;3353. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jcp.30094\u003c/span\u003e\u003cspan address=\"10.1002/jcp.30094\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eLi G, Liu H, Ma C et al (2019) Exosomes are the novel players involved in the beneficial effects of exercise on type 2 diabetes. J Cell Physiol 234:14896\u0026ndash;14905. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1002/jcp.28319\u003c/span\u003e\u003cspan address=\"10.1002/jcp.28319\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eBelviranlı M, Okudan N (2018) Exercise Training Protects Against Aging-Induced Cognitive Dysfunction via Activation of the Hippocampal PGC-1α / FNDC5 / BDNF Pathway. Neuromolecular Med 20:386\u0026ndash;400. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12017-018-8500-3\u003c/span\u003e\u003cspan address=\"10.1007/s12017-018-8500-3\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eMeyer-Lindenberg A, Domes G, Kirsch P, Heinrichs M (2011) Oxytocin and vasopressin in the human brain: social neuropeptides for translational medicine. Nat Rev Neurosci 12:524\u0026ndash;538. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/nrn3044\u003c/span\u003e\u003cspan address=\"10.1038/nrn3044\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eRogers-Carter MM, Varela JA, Gribbons KB et al (2018) Insular cortex mediates approach and avoidance responses to social affective stimuli. Nat Neurosci 21:404\u0026ndash;414. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/s41593-018-0071-y\u003c/span\u003e\u003cspan address=\"10.1038/s41593-018-0071-y\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eEres R, Decety J, Louis WR, Molenberghs P (2015) Individual differences in local gray matter density are associated with differences in affective and cognitive empathy. NeuroImage 117:305\u0026ndash;310. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.neuroimage.2015.05.038\u003c/span\u003e\u003cspan address=\"10.1016/j.neuroimage.2015.05.038\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eKeech B, Crowe S, Hocking DR (2018) Intranasal oxytocin, social cognition and neurodevelopmental disorders: A meta-analysis. Psychoneuroendocrinology 87:9\u0026ndash;19. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1016/j.psyneuen.2017.09.022\u003c/span\u003e\u003cspan address=\"10.1016/j.psyneuen.2017.09.022\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eCai Q, Feng L, Yap KZ (2018) Systematic review and meta-analysis of reported adverse events of long-term intranasal oxytocin treatment for autism spectrum disorder. Psychiatry Clin Neurosci 72:140\u0026ndash;151. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1111/pcn.12627\u003c/span\u003e\u003cspan address=\"10.1111/pcn.12627\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChou W, Liu YF, Lin CH et al (2018) Exercise Rehabilitation Attenuates Cognitive Deficits in Rats with Traumatic Brain Injury by Stimulating the Cerebral HSP20/BDNF/TrkB Signalling Axis. Mol Neurobiol 55:8602\u0026ndash;8611. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s12035-018-1011-2\u003c/span\u003e\u003cspan address=\"10.1007/s12035-018-1011-2\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eChen K, Zhang L, Tan M et al (2017) Treadmill exercise suppressed stress-induced dendritic spine elimination in mouse barrel cortex and improved working memory via BDNF/TrkB pathway. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1038/tp.2017.41\u003c/span\u003e\u003cspan address=\"10.1038/tp.2017.41\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e. Transl Psychiatry 7:\u003c/span\u003e\u003c/li\u003e \u003cli\u003e\u003cspan\u003eYao RQ, Qi DS, Yu HL et al (2012) Quercetin attenuates cell apoptosis in focal cerebral ischemia rat brain via activation of BDNF-TrkB-PI3K/Akt signaling pathway. Neurochem Res 37:2777\u0026ndash;2786. \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://doi.org/10.1007/s11064-012-0871-5\u003c/span\u003e\u003cspan address=\"10.1007/s11064-012-0871-5\" targettype=\"DOI\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Helping behavior, Exercise, Exosome, miR-486a-3p, Bdnf","lastPublishedDoi":"10.21203/rs.3.rs-4859054/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4859054/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003eEmpathy plays a crucial role in the maintenance of interpersonal relationships among mammals. Remarkably, engaging in light-intensity exercise has been identified as a facilitator of empathic behavior, a phenomenon associated with the upregulation of miR-486a-3p in the insular cortex. However, it remains to cover the contribution of miR-486a-3p and the mechanisms of changing levels of that in the insular cortex with light-intensity exercise. We initially assessed the impact of light-intensity exercise (7.0 m/min, 30 min/day, five days/week for four weeks) on helping behavior, mRNA in their insular cortex, and the secretion of exosomal miR-486a-3p from their gastrocnemius muscle. Subsequently, we explored the effects of a daily intraperitoneal injection of miR-486a-3p mimic over a two-week period on helping behavior. The intervention of light-intensity exercise, which enhanced helping behavior, resulted in elevated levels of miR-486a-3p in the insular cortex and exosomal miR-486a-3p in the plasma. Interestingly, there was no significant change observed in the levels of gastrocnemius muscle-derived exosomal miR-486a-3p. Moreover, the administration of mmu-miR-486a-3p mimic exhibited a similar enhancement of helping behavior in mice. Notably, both the exercise intervention and miR-486a-3p mimic treatment led to the downregulation of \u003cem\u003ePten\u003c/em\u003e mRNA and upregulation of \u003cem\u003eBdnf\u003c/em\u003e mRNA in the insular cortex. Our findings suggest that the increase in exosomal miR-486a-3p, originating from a source other than the gastrocnemius muscle, contributes to the empathy enhancement induced by light-intensity exercise. Furthermore, it is proposed that miR-486a-3p mimics the effects of light-intensity exercise, presenting a potential avenue for treating empathy-related behaviors.\u003c/p\u003e","manuscriptTitle":"The potential contribution of light-intensity exercise-induced miR-486a-3p secretion on enhancing empathic behavior in mice","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-30 14:58:36","doi":"10.21203/rs.3.rs-4859054/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"f4d591b0-203f-4d96-a385-040411737615","owner":[],"postedDate":"August 30th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-12-17T00:08:14+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-30 14:58:36","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4859054","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4859054","identity":"rs-4859054","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00