Genetic and phenotypic identities of Staphylococcus coagulans isolated from pustules in dogs with superficial bacterial folliculitis

Genetic and phenotypic identities of Staphylococcus coagulans isolated from pustules in dogs with superficial bacterial folliculitis | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Genetic and phenotypic identities of Staphylococcus coagulans isolated from pustules in dogs with superficial bacterial folliculitis Takafumi Osumi, Yuuki Shinomiya, Thamonwan Wanganuttara, Ichiro Imanishi, and 6 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-7251543/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 19 Jan, 2026 Read the published version in BMC Veterinary Research → Version 1 posted 11 You are reading this latest preprint version Abstract Background: Staphylococcus coagulans is the second most common isolate from skin lesions of dogs with superficial bacterial folliculitis (SBF). However, the clinical significance of S. coagulans in canine SBF remains uncertain. This study aimed to investigate the prevalence, genotypic and phenotypic diversities of S. coagulans isolated from pustules in two dogs with SBF. Results: Two dogs with SBF were included in this study. S. coagulans was isolated as the sole organism in three pustules in case #1, whereas it coexisted with S. pseudintermedius in two of seven pustules in case #2. S. pseuintermedius was the sole organism in the remaining five pustules in case #2. Whole genome sequences and antimicrobial susceptibility tests revealed that S. coagulans isolated from the same pustules exhibited identical genotypic and phenotypic profiles, indicating clonal expansion. Meanwhile, S. coagulans isolated from different pustules exhibited similar yet distinct genotypic and phenotypic profiles. Conclusions: S. coagulans with identical genetic and phenotypic profiles can be identified as the sole organism or coexist with S. pseudintermedius in the pustules of the same dogs with SBF. Staphylococcus coagulans Staphylococcus pseudintermedius dog superficial bacterial folliculitis antimicrobial susceptibility disk diffusion test Figures Figure 1 Background Superficial bacterial folliculitis (SBF) is a bacterial skin disease commonly recognised in dogs. This disease is characterised by follicular-oriented papules and/or pustules, crusts, and epidermal collarettes, with cytology showing degenerative neutrophils containing intra- or extracellular cocci [ 1 , 2 ]. Staphylococcus pseudintermedius is the most common isolate, and S. coagulans , which was formerly called Staphylococcus schleiferi subsp. coagulans is the second most common isolate from the skin lesions of canine SBF[ 3 ]. Recent clinical guidelines for treating canine SBF recommend bacterial culturing and antimicrobial susceptibility testing to choose the optimum antimicrobials, especially in cases where empirical antimicrobial therapies are ineffective [ 4 ]. Veterinary clinicians typically collect samples for bacterial cultures from a representative skin lesion among multiple lesions. The samples are then disseminated on the agar plate, and a representative bacterial colony is selected for antimicrobial susceptibility testing. A previous study revealed that S. pseudintermedius isolates collected from the same pustules exhibited identical pulsed-field gel electrophoresis patterns, while those from papules, crusts, and epidermal collarettes did not [ 5 ]. The report concluded that pustules are the ideal lesions to sample for bacterial cultures and antimicrobial susceptibility testing. The diversity of the antimicrobial susceptibility profiles of S. coagulans in pustules from canine SBF remains insufficiently investigated. Additionally, to our knowledge, whether S. coagulans is a sole organism or it coexists with S. pseudintermedius in the same pustules on dogs with SBF is uncertain. Therefore, whether the isolated strain is the predominant bacterial strain when S. coagulans is cultured, even if multiple pustules are sampled, remains unclear. Failure to isolate the predominant bacterial strain may lead to the inappropriate selection of antimicrobials, resulting in treatment failure. Here, we report the genetic and phenotypic diversities, the latter of which refer to antimicrobial susceptibility profiles, of S. coagulans isolated from pustules in dogs with SBF. Methods Cases Two dogs referred to the Dermatology Clinic at the Animal Medical Center, Faculty of Agriculture, Tokyo University of Agriculture and Technology (TUAT-AMC) between April 2018 and May 2020 were included in this study. The details of the cases included in this study are shown in Table 1. Case #1 was a 9-year-old neutered male Pomeranian with a six-month history of pruritic skin lesions. The referring veterinarian prescribed topical gentamycin (GM) ointment (frequency unknown), which did not provide a successful outcome. At the initial visit, the dog exhibited follicular-oriented papules and pustules on the abdominal skin, as well as epidermal collarettes on the trunk. Diagnosis of SBF was made based on clinical signs, ruling out mite infestations or dermatophytosis by trichogram or skin scrapings, and cytology revealed degenerated neutrophils with intra- and extracellular cocci. Bacterial sampling from three pustules on the abdominal skin was performed at the initial visit. After the sampling, the dog was treated with twice-weekly bathing using a 2% miconazole nitrate and 2% chlorhexidine gluconate shampoo (Malaseb, Dermcare Vet, Slacks Creek, Australia), resulting in a successful outcome. Case #2 was a 1-year-7-month-old spayed female Shorty Bull with pruritic skin lesions, which were recognised when the dog was 3 months of age. The referring veterinarian prescribed oral amoxicillin (dose and duration unknown), cephalexin (CEX; dose and duration unknown), minocycline (MINO; dose and duration unknown) and orifloxacin (4.2 mg/kg, once daily for 8 weeks). However, none of these drugs provided a successful outcome. At TUAT-AMC, the dog was diagnosed as having SBF with the same diagnostic methods as in case #1. Bacterial culture and antimicrobial susceptibility tests identified a methicillin-resistant S. pseudintermedius strain susceptible to fosfomycin (FOM). Oral administration of FOM at 25 mg/kg, twice daily for 4 weeks, markedly improved the skin lesions; however, the lesions relapsed 20 weeks after discontinuation of the drug. Therefore, the first large-scale sampling for bacterial culture was conducted from four pustules on the abdominal skin. After the first large-scale sampling, the dog was treated with oral FOM at 25 mg/kg, twice daily for 4 weeks, based on the results of susceptibility tests for an S. pseudintermedius isolate. The skin lesions markedly improved with treatment but relapsed after discontinuation of the therapy. The second large-scale sampling was conducted from two pustules on the inguinal skin. All participating dog owners provided written informed consent to include the dogs in this study. The Clinical Animal Trials and Research Ethics Committee of the Tokyo University of Agriculture and Technology approved all studies (approval no. 0016023). Bacterial isolation Before sampling, the surface of the pustules was disinfected with 70% isopropanol, and 25-G injection needles were used to rupture the roof of the pustules. The pustule contents were collected with a sterile cotton swab and suspended in phosphate-buffered saline. The bacterial suspensions were spread on mannitol salt agar and incubated at 37ºC for 48 hours. Colonies on the agar were collected and suspended in 50% glycerol in Luria-Bertani (LB) broth (Invitrogen, San Diego, CA, USA) and then preserved at -80°C until use. Multiplex PCR Chromosomal DNA was extracted from the isolated bacteria using either the UltraClean Microbial DNA Isolation Kit (MO BIO, Carlsbad, CA, USA) or Achromopeptidase® (FUJIFILM Wako Pure Chemical Corporation, Osaka). The chromosomal DNA was used as a template to amplify thermonuclease genes for S. coagulans/S. schleiferi , S. pseudintermedius and S. aureus by multiplex PCR [ 6 ]. This method cannot distinguish S. coagulans from S. schleiferi , as the multiplex primers amplify the thermonuclease genes of both strains with an identical molecular weight (526 bp). The primers used were as follows: S. pseudintermedius (F: TRGGCAGTAGGATTCGTTAA, R: CTTTTGTGCTYCMTTTTGG), S. aureus (F: TCGCTTGCTATGATTGTGG, R: GCCAATGTTCTACCATAGC), S. coagulans ( S. schleiferi ) (F: AATGGCTACAATGATAATCACTAA, R: CATATCTGTCTTTCGGCGCG). PCR was performed using OneTaq 2X Master Mix with Standard Buffer (New England Biolabs Japan Inc., Tokyo). The initial reaction was at 94°C for 30 seconds, followed by 30 cycles of 94°C for 30 seconds, 55°C for 60 seconds, and 68°C for 60 seconds. After PCR, five µL of each amplified product was subjected to electrophoresis on a 2% agarose gel (Agarose KANTO S, Kanto Chemical Co., Inc., Tokyo), stained with ethidium bromide, and photographed under UV light using the Molecular Imager® ChemiDog™ XRS + with Image Lab™ Software (BIO-RAD Laboratories, Inc., Sharjah, UAE). The molecular weight marker used was the All-purpose Hi-Lo™ DNA Marker (Bionexus, CA, USA). Antimicrobial susceptibility tests Disk diffusion tests with KB disks (Eiken Chemical Co., Ltd., Kyoto, Japan), following the guidelines of the Clinical and Laboratory Standards Institute (CLSI), were used to determine the antimicrobial susceptibility. A suspension equivalent to the McFarland 0.5 standard was prepared by dissolving a single colony in glycerol saline, which was then spread evenly on Mueller-Hinton agar (Eiken) using a sterile swab and incubated at 37°C for 16–18 hours. The diameter of the inhibition zone was measured. The antimicrobials tested included oxacillin (MPIPC; 1 µg/disk), CEX (30 µg/disk), cefpodoxime (CPDX; 10 µg/disk), enrofloxacin (ERFX; 5 µg/disk), GM (10 µg/disk), clindamycin (CLDM; 2 µg/disk), doxycycline (DOXY; 30 µg/disk), MINO (30 µg/disk) chloramphenicol (CP; 30 µg/disk), FOM (50 µg/disk) and rifampicin (RFP; 5 µg/disk). The interpretative criteria for susceptible (S), intermediate (I) or resistant (R) followed the CLSI VET08 for MPIPC, CPDX, DOXY and RFP [ 7 ]; the CLSI M100-S3031 for ERFX, GM, CLDM, MINO and CP [ 8 ]; and the KB disc standard of Staphylococcus spp. for CEX and FOM [ 9 ]. Broth microdilution was also used to determine the antimicrobial susceptibility of MPIPC, GM, MINO, erythromycin (EM) and FOM with interpretative criteria following the CLSI M07 [ 10 ]. Whole genome sequencing (WGS) Bacterial DNA was extracted using an ISOSPIN Faecal DNA kit (Nippon Gene Co., Tokyo, Japan), and the DNA quantity was measured using a NanoDrop™ ND-1000 spectrophotometer (NanoDrop; Thermo Fisher Scientific, Inc., Wilmington, DE, USA). Sequencing libraries were prepared from 100 ng of DNA using Illumina DNA Prep and (M) Tagmentation. Paired-end sequencing (2 × 250 bp) was performed at Genome-Lead, Co., Ltd. (Kagawa, Japan) using the NovaSeq 6000 SP Reagent Kit v1.5 (300 cycles) on a NovaSeq 6000 system (Illumina). The resulting reads were filtered using fastp version 0.20.0 ( https://github.com/OpenGene/fastp ). The trimmed reads were assembled using SPAdes v.3.15.5 ( https://github.com/ablab/spades ). The sequence data were annotated using Dfast ( https://dfast.ddbj.nig.ac.jp/dfc ). All genome data were deposited into GenBank (Table S1 ). Whole-genome-based taxonomic analysis was conducted using the Genome BLAST Distance Phylogeny approach (GBDP) by uploading genome sequence data to the Type (Strain) Genome Server (TYGS; https://tygs.dsmz.de ). The results of digital DNA-DNA hybridisation (DDH) formula d4, which is the sum of all identities found in high-scoring segment pairs (HSPs) divided by the overall HSP length, were summarised. A phylogenetic tree was visualised using MEGA version 11.0.8 ( https://www.megasoftware.net ). Identification of antimicrobial and disinfectant resistance genes in S. coagulans ResFinder (Ver. 4.7.2: http://genepi.food.dtu.dk/resfinder ) was used to identify acquired antimicrobial resistance (AMR) genes, chromosomal mutations mediating AMR and acquired disinfectant resistance genes from the WGS data. The thresholds for %ID and minimum length for chromosomal point mutations, AMR genes, and acquired disinfectant resistance genes were set at 90% and 60%, respectively. Results Isolation of S. coagulans and S. pseudintermedius from pustules The results of the bacterial culture are summarised in Table 1. In case #1, bacterial samples were collected from three pustules (pustules #1-#3) on the abdominal skin at the initial visit. More than 50 colonies were formed on mannitol salt agar when the samples from any of the three pustules were cultured. Therefore, 20 colonies/pustule were randomly selected for further analysis. Multiplex PCR amplified bands with molecular weights corresponding to S. coagulans in all 60 isolates. In case #2, four pustules (pustules #4-#7) were selected for the 1st sampling, which isolated a total of 36 colonies (pustule #4: 12 colonies, pustule #5: 10 colonies, pustule #6: 2 colonies, pustule #7: 12 colonies). Multiplex PCR revealed that the majority of isolates were S. pseudintermedius (32 out of 36 isolates). In contrast, bands corresponding to S. coagulans were amplified in the remaining four isolates in pustule #7. Two pustules (pustules #8 and #9) were selected for the 2nd sampling, which isolated a total of 31 colonies (pustule #8: 25 colonies, pustule #9: 6 colonies). Multiplex PCR revealed that the most frequently isolated species was S. pseudintermedius (25 out of 31 isolates). In contrast, bands corresponding to S. coagulans were amplified in the remaining six isolates in pustule #8. S. aureus was not isolated from any of the pustules tested. S. coagulans isolated from the same pustules exhibited identical antimicrobial susceptibility profiles Table 2 shows the antimicrobial susceptibility profiles of S. coagulans isolated from case #1. Disk diffusion tests revealed that all 60 isolates were susceptible to CEX, CPDX, GM, CLDM, CP, FOM, and RFP but resistant to ERFX. For MPIPC, three isolates (#905 and #908 from pustule #1, #937 from pustule #2) had inhibition zone diameters below the resistant breakpoint (17 mm), while the others had diameters above the susceptible breakpoint (18 mm). In contrast, broth microdilution tests revealed that all 40 isolates collected from pustules #1 and #2 were susceptible to MPIPC (data not shown). In contrast, disk diffusion tests revealed that all 10 S. coagulans isolates collected from pustules #7 and #8 in case #2 were susceptible to CP and RFP but resistant to MPIPC, CEX, CPDX, ERFX and FOM (Table 3). For GM, an isolate in pustule #7 (#SI82) had an inhibitory zone diameter below the resistant breakpoint (12 mm), while the others had diameters above the susceptible breakpoint (15 mm). Similarly, two isolates, #TA84 and #TA94 in pustule #8, had inhibitory zone diameters within intermediate ranges to CLDM (15–20 mm) and GM (13–14 mm), respectively. The other isolates in the same pustule were above the susceptible breakpoints to CLDM (21 mm) and GM. In contrast, broth microdilution tests revealed that all 10 isolates collected from pustules #7 and #8 were susceptible to GM, and all six isolates collected from pustule #8 were susceptible to CLDM (data not shown). Meanwhile, all 61 S. pseudintermedius isolates, except for #29 collected from case #2 at the 1st and 2nd sampling, had diameters above the susceptible breakpoint of FOM (16 mm). S. coagulans isolated from the same pustules exhibited identical genetic profiles The WGS were performed to investigate the genetic profiles of S. coagulans isolated from the pustules. Four isolates from pustule #1 (#905, #906, #907 and #908), three isolates from pustule #2 (#936, #937 and #938), two isolates from pustule #3 (#942 and #943) and all 10 isolates from pustules #7 and #8 were randomly selected and subjected to the analysis. Analysis of genome annotation revealed that all isolates tested were annotated to S. coagulans (Table S1 ). The DDH values were summarised in Fig. 1 A. In case #1, all isolates collected from pustules #1, #2, and #3 were the exact clones, showing 100% identity in genomic sequences. Similarly, the isolates from the same pustules were identical clones in case #2. Genomic sequences of the isolates from pustule #7 exhibited 99% identity with those from pustule #8. Furthermore, the isolates from the two clinical cases were distinctive, with identities ranging from 89.3–89.5%. The phylogenetic tree based on whole-genome sequences also supported the above results (Fig. 1 B). S. coagulans isolated from different pustules exhibited distinct AMR gene and antimicrobial susceptibility profiles Moreover, the AMR and disinfectant-resistant gene profiles of S. coagulans isolates collected from three different pustules were analysed. The acquired AMR genes were not identified in the isolates from pustule #1, whereas five acquired AMR genes ( mecA , ant(6)-la , erm(B) , tet(O) , and tet(K) ) were identified in isolates from pustule #7. Moreover, six acquired AMR genes ( mecA , blaZ , aadD , aac(6’)-aph(2’’) , fosB6 , tet(O) , and bleO ) were identified in isolates from pustule #8 (Table 4). Chromosomal mutations mediating AMR or acquired disinfectant resistance genes were not identified in any of the isolates tested (data not shown). The AMR profiles for β-lactams, CLDM, and DOXY were consistent with the AMR gene profiles. Conversely, the AMR profiles for MINO and FOM in isolates from pustule #7, as well as that for GM in isolates from pustule #8, did not align with the genetic profiles. Therefore, a broth microdilution test for GM, MINO, and FOM was performed on representative isolates from pustules #1 (TA902), #7 (SI76), and #8 (TA79). However, the AMR patterns determined by the broth microdilution test were consistent with those determined by the disk diffusion test (Table S3 ). The broth microdilution test for EM revealed that the AMR profile was consistent with the presence of the erm(B) gene (Tables 4 and S3). Discussion This study revealed clonal expansion of S. coagulans in pustules of dogs with SBF. In case #1, S. coagulans with identical genetic and phenotypic profiles was identified as the sole organism in multiple pustules. In addition, genotypic profiles of S. coagulans isolates from different pustules in case #1 were identical, suggesting that the clone spread on the skin surface and caused pustule formation of SBF in the same dog. These findings imply that the S. coagulans strain alone can form pustules and may act as a pathogen, causing SBF in case #1. Similarly, S. coagulans was isolated from two pustules at different sampling times in case #2. The genotypic characteristics of S. coagulans isolated from the same pustules were identical, sharing 100% identity. The isolates in pustule #8 were considered derivative clones of #7, as they shared 99% identity in genomic sequences. The identification of clonal expansion of S. coagulans in the pustules suggests that pustules are the ideal lesions for sampling bacterial cultures and antimicrobial susceptibility testing for S. coagulans , as similarly reported in S. pseudintermedius [ 5 ]. However, the S. coagulans clones coexisted with S. pseudintermedius isolates in the same pustules in case #2. In addition, the skin lesions in case #2 markedly improved by the administration of oral FOM, to which almost all S. pseudintermedius isolates were susceptible. However, the S. coagulans clones isolated from the same pustules were resistant to FOM. Therefore, we thought that S. pseudintermedius was a primary pathogen causing SBF in case #2. Hence, the interpretation of culture results should be cautious if S. coagulans is isolated from the skin lesions of dogs with SBF, as it can coexist with S. pseudintermedius and may not play a significant role in the development of the skin lesions. The WGS analysis also provided genetic evidence of acquired AMR genes in S. coagulans isolates. S. coagulans isolates from pustule #1 did not harbour any AMR genes, and the results were consistent with the AMR profiles. Meanwhile, S. coagulans isolates from pustules #7 and #8 harboured the mecA gene, which supports resistance to MPIPC, CEX, and CPDX. The isolates from pustule #7 also harboured erm(B) , tet(O) and tet(K) genes, and exhibited resistance to CLDM, DOXY and EM, but not MINO. These findings suggest that the erm(B) and tet(K) genes, which are responsible for resistance to CLDM, EM, and DOXY, were translated, but the tet(O) gene, which is responsible for MINO resistance, was not. The isolates from pustule #8 harboured the aac(6’)-aph(2’’) gene, which is responsible for GM resistance. However, they were susceptible to GM, suggesting that the gene was not expressed in the isolates. Moreover, the fosB6 gene, which is responsible for FOM resistance, was identified only in the isolates from pustule #8, although FOM resistance was also recognised in the isolates from pustule #7. In Staphylococcus aureus , several factors unrelated to the fosB gene, such as genetic mutations in uhpT , glpT , and murA genes [11, 12], or overexpression of the tet38 gene encoding an efflux pump [13], also contribute to FOM resistance. It is possible that the bioinformatic analysis used in this study failed to detect such genetic changes in S. coagulans isolated from pustule #7. Future studies to discover new resistance mechanisms to FOM in S. coagulans are awaited. The main limitation of this study was the small sample size, which was insufficient to conclude that S. coagulans can be a primary pathogen causing pustules in multiple dogs with SBF similar to S. pseudintermedius . Future large-scale studies on the isolation rate of S. coagulans clones from pustules of dogs with SBF are expected. Conclusion This study revealed that S. coagulans , with identical genetic and phenotypic profiles, was identified as the sole organism or coexisted with S. pseudintermedius in the pustules of the same dogs with SBF. These findings suggest that S. coagulans proliferates clonally and may be the primary pathogen responsible for pustule formation in SBF in dogs. Abbreviations SBF superficial bacterial folliculitis GM gentamycin CEX cephalexin MINO minocycline FOM fosfomycin LB Luria-Bertani MPIPC oxacillin CPDX cefpodoxime ERFX enrofloxacin CLDM clindamycin DOXY doxycycline CP chloramphenicol RFP rifampicin EM erythromycin WGS whole genome sequencing AMR antimicrobial resistance Declarations Ethical approval and consent to participate The participating dog owner provided written informed consent. The Clinical Animal Trials and Research Ethics Committee of the Tokyo University of Agriculture and Technology approved all studies (approval no. 0016023). Consent for publication All authors have read and approved the final version of the manuscript. Availability of data and materials The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request. Competing interests The authors declare that there are no financial or non-financial competing interests. Funding The authors received no research funds for this study. Authors’ contributions T.O., J.U. and K.N. designed the experiments. T.O. and Y. S. corrected the clinical samples. T.O., Y.S., T.W., I.I. K.I., Y.T. and K.I. analysed the data. T.O wrote the main manuscript text and prepared all tables. T.W. and J.U. prepared figure 1. All authors reviewed the manuscript. Acknowledgements Not applicable References Bloom P. Canine superficial bacterial folliculitis: current understanding of its etiology, diagnosis and treatment. Vet J. 2014;199(2):217–22. Beco L, Guaguere E, Lorente Mendez C, Noli C, Nuttall T, Vroom M. Suggested guidelines for using systemic antimicrobials in bacterial skin infections (1): diagnosis based on clinical presentation, cytology and culture. Vet Rec. 2013;172(3):72–8. Kawakami T, Shibata S, Murayama N, Nagata M, Nishifuji K, Iwasaki T, Fukata T. Antimicrobial susceptibility and methicillin resistance in Staphylococcus pseudintermedius and Staphylococcus schleiferi subsp. coagulans isolated from dogs with pyoderma in Japan. J Vet Med Sci. 2010;72(12):1615–9. Loeffler A, Cain CL, Ferrer L, Nishifuji K, Varjonen K, Papich MG, Guardabassi L, Frosini SM, Barker EN, Weese JS. Antimicrobial use guidelines for canine pyoderma by the International Society for Companion Animal Infectious Diseases (ISCAID). Vet Dermatol. 2025;36(3):234–82. Larsen RF, Boysen L, Jessen LR, Guardabassi L, Damborg P. Diversity of Staphylococcus pseudintermedius in carriage sites and skin lesions of dogs with superficial bacterial folliculitis: potential implications for diagnostic testing and therapy. Vet Dermatol 2018. Sasaki T, Tsubakishita S, Tanaka Y, Sakusabe A, Ohtsuka M, Hirotaki S, Kawakami T, Fukata T, Hiramatsu K. Multiplex-PCR method for species identification of coagulase-positive staphylococci. J Clin Microbiol. 2010;48(3):765–9. CLSI. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals: approved standards – 4th ed. CLSI document VET08. Wayne, PA: Clinical and Laboratory Standards Institute , 2018. CLSI. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals: approved standards – 30th ed. CLSI document M100.8. Wayne, PA: Clinical and Laboratory Standards Institute , 2020. Iyori K, Shishikura T, Shimoike K, Minoshima K, Imanishi I, Toyoda Y. Influence of hospital size on antimicrobial resistance and advantages of restricting antimicrobial use based on cumulative antibiograms in dogs with Staphylococcus pseudintermedius infections in Japan. Vet Dermatol. 2021;32(6):668–e178. CLSI. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically, 12th Edition. Zimmer BL: Clinical and Laboratory Standards Institute 2024. Tables Table 1 to 4 are available in the Supplementary Files section. Additional Declarations No competing interests reported. Supplementary Files Table1.xlsx Table2.xlsx Table3.xlsx Table4.xlsx TableS1.xlsx TableS2.xlsx TableS3.xlsx Cite Share Download PDF Status: Published Journal Publication published 19 Jan, 2026 Read the published version in BMC Veterinary Research → Version 1 posted Editorial decision: Revision requested 01 Sep, 2025 Reviews received at journal 01 Sep, 2025 Reviews received at journal 20 Aug, 2025 Reviewers agreed at journal 12 Aug, 2025 Reviewers agreed at journal 11 Aug, 2025 Reviewers agreed at journal 10 Aug, 2025 Reviewers invited by journal 10 Aug, 2025 Editor invited by journal 31 Jul, 2025 Editor assigned by journal 31 Jul, 2025 Submission checks completed at journal 31 Jul, 2025 First submitted to journal 30 Jul, 2025 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-7251543","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":499454841,"identity":"a368b112-8e83-4ecc-a916-59f401a9d397","order_by":0,"name":"Takafumi Osumi","email":"","orcid":"","institution":"Tokyo University of Agriculture and Technology","correspondingAuthor":false,"prefix":"","firstName":"Takafumi","middleName":"","lastName":"Osumi","suffix":""},{"id":499454842,"identity":"78410d3d-0cc4-4e1d-9cb5-a60d5478e188","order_by":1,"name":"Yuuki Shinomiya","email":"","orcid":"","institution":"Tokyo University of Agriculture and Technology","correspondingAuthor":false,"prefix":"","firstName":"Yuuki","middleName":"","lastName":"Shinomiya","suffix":""},{"id":499454843,"identity":"74011cb7-f804-47f8-8d03-e320783977cb","order_by":2,"name":"Thamonwan Wanganuttara","email":"","orcid":"","institution":"Okayama University","correspondingAuthor":false,"prefix":"","firstName":"Thamonwan","middleName":"","lastName":"Wanganuttara","suffix":""},{"id":499454844,"identity":"cb6bda71-7d5a-468e-b905-bdf06d2d4107","order_by":3,"name":"Ichiro Imanishi","email":"","orcid":"","institution":"Tokyo University of Agriculture and Technology","correspondingAuthor":false,"prefix":"","firstName":"Ichiro","middleName":"","lastName":"Imanishi","suffix":""},{"id":499454845,"identity":"067b1f93-a17f-437d-b5af-5001099a4248","order_by":4,"name":"Yotaro Shimazaki","email":"","orcid":"","institution":"Tokyo University of Agriculture and Technology","correspondingAuthor":false,"prefix":"","firstName":"Yotaro","middleName":"","lastName":"Shimazaki","suffix":""},{"id":499454848,"identity":"24cfa4bc-c739-48cb-83e9-0df6afcf141c","order_by":5,"name":"Keita Iyori","email":"","orcid":"","institution":"1sec Co. Ltd","correspondingAuthor":false,"prefix":"","firstName":"Keita","middleName":"","lastName":"Iyori","suffix":""},{"id":499454849,"identity":"20ae779a-1e63-433f-ab91-62bce7879df1","order_by":6,"name":"Yoichi Toyoda","email":"","orcid":"","institution":"1sec Co. Ltd","correspondingAuthor":false,"prefix":"","firstName":"Yoichi","middleName":"","lastName":"Toyoda","suffix":""},{"id":499454850,"identity":"aac13118-f02f-4377-a399-6d6cde9c1d39","order_by":7,"name":"Kaori Ide","email":"","orcid":"","institution":"Tokyo University of Agriculture and Technology","correspondingAuthor":false,"prefix":"","firstName":"Kaori","middleName":"","lastName":"Ide","suffix":""},{"id":499454852,"identity":"8258ffda-ad45-4350-a03d-452c53e6b51c","order_by":8,"name":"Jumpei Uchiyama","email":"","orcid":"","institution":"Okayama University","correspondingAuthor":false,"prefix":"","firstName":"Jumpei","middleName":"","lastName":"Uchiyama","suffix":""},{"id":499454853,"identity":"9f737fdf-5cfe-4eaa-9678-63ea117a7a68","order_by":9,"name":"Koji Nishifuji","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAA8klEQVRIiWNgGAWjYBACCQaGhANASoYfXZigFh7JBiDvAEwxAS1gwGNwAFkLPiDZ3vDw0I0aCx7j44cfMH9ss6tjYD/8gMFyB24t0jwHEg7nHJPgMTuTZsBwsC1ZgoEHyJA8g1uLnEQCUAsbUMsNHgagFmagw3KAlrcR0vJPgsd4BlhLvQQD/xv8WqRBWnLbJHgMJMBaDkswSBCwRbIH6JfcPgkeCaBfDpw5d1yyTeKZwQF8fpE43pP8OedbnRx/++GHDyrKqvn5+ZMfPpbEE2LAGEmAMw+ACDYgPgyOWJyA/QCmGONHvFpGwSgYBaNghAEAXCNLIwzi+kMAAAAASUVORK5CYII=","orcid":"","institution":"Tokyo University of Agriculture and Technology","correspondingAuthor":true,"prefix":"","firstName":"Koji","middleName":"","lastName":"Nishifuji","suffix":""}],"badges":[],"createdAt":"2025-07-30 10:08:33","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-7251543/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-7251543/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12917-025-05250-5","type":"published","date":"2026-01-19T15:58:07+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":89259621,"identity":"309af28a-821c-4cc2-877f-85b1c4a48442","added_by":"auto","created_at":"2025-08-18 06:28:26","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":913166,"visible":true,"origin":"","legend":"\u003cp\u003eClonality of \u003cem\u003eS. coagulans\u003c/em\u003e isolated from pustules in cases #1 and #2. (A) Heatmap based on digital DNA-to-DNA hybridisation. (B) A phylogenetic tree based on whole genome sequence data. The strains sequenced in this study are shown in bold blue. The reference strains are shown in black.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-7251543/v1/a920fd95d0c9c41cb2c3035e.jpg"},{"id":101152045,"identity":"6e661783-acd2-4a0c-8d7b-97c9d163b3e5","added_by":"auto","created_at":"2026-01-26 16:09:17","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":2803408,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-7251543/v1/e052c55b-cd94-4151-849a-65ca45dde9b8.pdf"},{"id":89258225,"identity":"64fe60cb-e2a6-4d8e-9e05-8f70bc69261e","added_by":"auto","created_at":"2025-08-18 06:20:26","extension":"xlsx","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":18318,"visible":true,"origin":"","legend":"","description":"","filename":"Table1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7251543/v1/7313e7499c4e19a6276a516a.xlsx"},{"id":89259889,"identity":"9e2da49c-20ce-400b-8ce0-7a6246cd552a","added_by":"auto","created_at":"2025-08-18 06:36:26","extension":"xlsx","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":27246,"visible":true,"origin":"","legend":"","description":"","filename":"Table2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7251543/v1/9d6384947e357ded51b28956.xlsx"},{"id":89258229,"identity":"1fd39bc1-791e-4d39-819b-e9c763d86013","added_by":"auto","created_at":"2025-08-18 06:20:26","extension":"xlsx","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":23175,"visible":true,"origin":"","legend":"","description":"","filename":"Table3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7251543/v1/47360d8ca8f9b9bb80ea0987.xlsx"},{"id":89259630,"identity":"97ced424-da14-4c10-a950-08b549c8457d","added_by":"auto","created_at":"2025-08-18 06:28:26","extension":"xlsx","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":10905,"visible":true,"origin":"","legend":"","description":"","filename":"Table4.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7251543/v1/251f16782acffc8a0e1ff8a6.xlsx"},{"id":89258237,"identity":"b687a7ae-097f-471e-8e6b-2c03c5f14b80","added_by":"auto","created_at":"2025-08-18 06:20:26","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":10551,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7251543/v1/8687f5bf88fc8725a0100d0e.xlsx"},{"id":89258236,"identity":"200e9f39-7b71-4b10-9fde-d2b0e300c2c4","added_by":"auto","created_at":"2025-08-18 06:20:26","extension":"xlsx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":25198,"visible":true,"origin":"","legend":"","description":"","filename":"TableS2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7251543/v1/9bfc931b5d9518de9e6cb2bf.xlsx"},{"id":89258242,"identity":"d576674b-83b2-4eb9-9716-7832d042b2bd","added_by":"auto","created_at":"2025-08-18 06:20:26","extension":"xlsx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":10500,"visible":true,"origin":"","legend":"","description":"","filename":"TableS3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-7251543/v1/63ebe0b52c8b6b2a8bd5ab02.xlsx"}],"financialInterests":"No competing interests reported.","formattedTitle":"Genetic and phenotypic identities of Staphylococcus coagulans isolated from pustules in dogs with superficial bacterial folliculitis","fulltext":[{"header":"Background","content":"\u003cp\u003eSuperficial bacterial folliculitis (SBF) is a bacterial skin disease commonly recognised in dogs. This disease is characterised by follicular-oriented papules and/or pustules, crusts, and epidermal collarettes, with cytology showing degenerative neutrophils containing intra- or extracellular cocci [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e, \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. \u003cem\u003eStaphylococcus pseudintermedius\u003c/em\u003e is the most common isolate, and \u003cem\u003eS. coagulans\u003c/em\u003e, which was formerly called \u003cem\u003eStaphylococcus schleiferi\u003c/em\u003e subsp. \u003cem\u003ecoagulans\u003c/em\u003e is the second most common isolate from the skin lesions of canine SBF[\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eRecent clinical guidelines for treating canine SBF recommend bacterial culturing and antimicrobial susceptibility testing to choose the optimum antimicrobials, especially in cases where empirical antimicrobial therapies are ineffective [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e]. Veterinary clinicians typically collect samples for bacterial cultures from a representative skin lesion among multiple lesions. The samples are then disseminated on the agar plate, and a representative bacterial colony is selected for antimicrobial susceptibility testing. A previous study revealed that \u003cem\u003eS. pseudintermedius\u003c/em\u003e isolates collected from the same pustules exhibited identical pulsed-field gel electrophoresis patterns, while those from papules, crusts, and epidermal collarettes did not [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. The report concluded that pustules are the ideal lesions to sample for bacterial cultures and antimicrobial susceptibility testing.\u003c/p\u003e\u003cp\u003eThe diversity of the antimicrobial susceptibility profiles of \u003cem\u003eS. coagulans\u003c/em\u003e in pustules from canine SBF remains insufficiently investigated. Additionally, to our knowledge, whether \u003cem\u003eS. coagulans\u003c/em\u003e is a sole organism or it coexists with \u003cem\u003eS. pseudintermedius\u003c/em\u003e in the same pustules on dogs with SBF is uncertain. Therefore, whether the isolated strain is the predominant bacterial strain when \u003cem\u003eS. coagulans\u003c/em\u003e is cultured, even if multiple pustules are sampled, remains unclear. Failure to isolate the predominant bacterial strain may lead to the inappropriate selection of antimicrobials, resulting in treatment failure. Here, we report the genetic and phenotypic diversities, the latter of which refer to antimicrobial susceptibility profiles, of \u003cem\u003eS. coagulans\u003c/em\u003e isolated from pustules in dogs with SBF.\u003c/p\u003e"},{"header":"Methods","content":"\u003cp\u003e\u003cstrong\u003eCases\u003c/strong\u003e\u003c/p\u003e\u003cp\u003eTwo dogs referred to the Dermatology Clinic at the Animal Medical Center, Faculty of Agriculture, Tokyo University of Agriculture and Technology (TUAT-AMC) between April 2018 and May 2020 were included in this study. The details of the cases included in this study are shown in Table\u0026nbsp;1. Case #1 was a 9-year-old neutered male Pomeranian with a six-month history of pruritic skin lesions. The referring veterinarian prescribed topical gentamycin (GM) ointment (frequency unknown), which did not provide a successful outcome. At the initial visit, the dog exhibited follicular-oriented papules and pustules on the abdominal skin, as well as epidermal collarettes on the trunk. Diagnosis of SBF was made based on clinical signs, ruling out mite infestations or dermatophytosis by trichogram or skin scrapings, and cytology revealed degenerated neutrophils with intra- and extracellular cocci. Bacterial sampling from three pustules on the abdominal skin was performed at the initial visit. After the sampling, the dog was treated with twice-weekly bathing using a 2% miconazole nitrate and 2% chlorhexidine gluconate shampoo (Malaseb, Dermcare Vet, Slacks Creek, Australia), resulting in a successful outcome.\u003c/p\u003e\u003cp\u003eCase #2 was a 1-year-7-month-old spayed female Shorty Bull with pruritic skin lesions, which were recognised when the dog was 3 months of age. The referring veterinarian prescribed oral amoxicillin (dose and duration unknown), cephalexin (CEX; dose and duration unknown), minocycline (MINO; dose and duration unknown) and orifloxacin (4.2 mg/kg, once daily for 8 weeks). However, none of these drugs provided a successful outcome. At TUAT-AMC, the dog was diagnosed as having SBF with the same diagnostic methods as in case #1. Bacterial culture and antimicrobial susceptibility tests identified a methicillin-resistant \u003cem\u003eS. pseudintermedius\u003c/em\u003e strain susceptible to fosfomycin (FOM). Oral administration of FOM at 25 mg/kg, twice daily for 4 weeks, markedly improved the skin lesions; however, the lesions relapsed 20 weeks after discontinuation of the drug. Therefore, the first large-scale sampling for bacterial culture was conducted from four pustules on the abdominal skin. After the first large-scale sampling, the dog was treated with oral FOM at 25 mg/kg, twice daily for 4 weeks, based on the results of susceptibility tests for an \u003cem\u003eS. pseudintermedius\u003c/em\u003e isolate. The skin lesions markedly improved with treatment but relapsed after discontinuation of the therapy. The second large-scale sampling was conducted from two pustules on the inguinal skin.\u003c/p\u003e\u003cp\u003eAll participating dog owners provided written informed consent to include the dogs in this study. The Clinical Animal Trials and Research Ethics Committee of the Tokyo University of Agriculture and Technology approved all studies (approval no. 0016023).\u003c/p\u003e\u003cp\u003e\u003cb\u003eBacterial isolation\u003c/b\u003e\u003c/p\u003e\u003cp\u003eBefore sampling, the surface of the pustules was disinfected with 70% isopropanol, and 25-G injection needles were used to rupture the roof of the pustules. The pustule contents were collected with a sterile cotton swab and suspended in phosphate-buffered saline. The bacterial suspensions were spread on mannitol salt agar and incubated at 37ºC for 48 hours. Colonies on the agar were collected and suspended in 50% glycerol in Luria-Bertani (LB) broth (Invitrogen, San Diego, CA, USA) and then preserved at -80°C until use.\u003c/p\u003e\u003cp\u003e\u003cb\u003eMultiplex PCR\u003c/b\u003e\u003c/p\u003e\u003cp\u003eChromosomal DNA was extracted from the isolated bacteria using either the UltraClean Microbial DNA Isolation Kit (MO BIO, Carlsbad, CA, USA) or Achromopeptidase® (FUJIFILM Wako Pure Chemical Corporation, Osaka). The chromosomal DNA was used as a template to amplify thermonuclease genes for \u003cem\u003eS. coagulans/S. schleiferi\u003c/em\u003e, \u003cem\u003eS. pseudintermedius\u003c/em\u003e and \u003cem\u003eS. aureus\u003c/em\u003e by multiplex PCR [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e]. This method cannot distinguish \u003cem\u003eS. coagulans\u003c/em\u003e from \u003cem\u003eS. schleiferi\u003c/em\u003e, as the multiplex primers amplify the thermonuclease genes of both strains with an identical molecular weight (526 bp). The primers used were as follows: \u003cem\u003eS. pseudintermedius\u003c/em\u003e (F: TRGGCAGTAGGATTCGTTAA, R: CTTTTGTGCTYCMTTTTGG), \u003cem\u003eS. aureus\u003c/em\u003e (F: TCGCTTGCTATGATTGTGG, R: GCCAATGTTCTACCATAGC), \u003cem\u003eS. coagulans\u003c/em\u003e (\u003cem\u003eS. schleiferi\u003c/em\u003e) (F: AATGGCTACAATGATAATCACTAA, R: CATATCTGTCTTTCGGCGCG). PCR was performed using OneTaq 2X Master Mix with Standard Buffer (New England Biolabs Japan Inc., Tokyo). The initial reaction was at 94°C for 30 seconds, followed by 30 cycles of 94°C for 30 seconds, 55°C for 60 seconds, and 68°C for 60 seconds. After PCR, five µL of each amplified product was subjected to electrophoresis on a 2% agarose gel (Agarose KANTO S, Kanto Chemical Co., Inc., Tokyo), stained with ethidium bromide, and photographed under UV light using the Molecular Imager® ChemiDog™ XRS + with Image Lab™ Software (BIO-RAD Laboratories, Inc., Sharjah, UAE). The molecular weight marker used was the All-purpose Hi-Lo™ DNA Marker (Bionexus, CA, USA).\u003c/p\u003e\u003cp\u003e\u003cb\u003eAntimicrobial susceptibility tests\u003c/b\u003e\u003c/p\u003e\u003cp\u003eDisk diffusion tests with KB disks (Eiken Chemical Co., Ltd., Kyoto, Japan), following the guidelines of the Clinical and Laboratory Standards Institute (CLSI), were used to determine the antimicrobial susceptibility. A suspension equivalent to the McFarland 0.5 standard was prepared by dissolving a single colony in glycerol saline, which was then spread evenly on Mueller-Hinton agar (Eiken) using a sterile swab and incubated at 37°C for 16–18 hours. The diameter of the inhibition zone was measured. The antimicrobials tested included oxacillin (MPIPC; 1 µg/disk), CEX (30 µg/disk), cefpodoxime (CPDX; 10 µg/disk), enrofloxacin (ERFX; 5 µg/disk), GM (10 µg/disk), clindamycin (CLDM; 2 µg/disk), doxycycline (DOXY; 30 µg/disk), MINO (30 µg/disk) chloramphenicol (CP; 30 µg/disk), FOM (50 µg/disk) and rifampicin (RFP; 5 µg/disk). The interpretative criteria for susceptible (S), intermediate (I) or resistant (R) followed the CLSI VET08 for MPIPC, CPDX, DOXY and RFP [\u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e]; the CLSI M100-S3031 for ERFX, GM, CLDM, MINO and CP [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e]; and the KB disc standard of \u003cem\u003eStaphylococcus\u003c/em\u003e spp. for CEX and FOM [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e].\u003c/p\u003e\u003cp\u003eBroth microdilution was also used to determine the antimicrobial susceptibility of MPIPC, GM, MINO, erythromycin (EM) and FOM with interpretative criteria following the CLSI M07 [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e].\u003c/p\u003e\u003cp\u003e\u003cb\u003eWhole genome sequencing (WGS)\u003c/b\u003e\u003c/p\u003e\u003cp\u003eBacterial DNA was extracted using an ISOSPIN Faecal DNA kit (Nippon Gene Co., Tokyo, Japan), and the DNA quantity was measured using a NanoDrop™ ND-1000 spectrophotometer (NanoDrop; Thermo Fisher Scientific, Inc., Wilmington, DE, USA). Sequencing libraries were prepared from 100 ng of DNA using Illumina DNA Prep and (M) Tagmentation. Paired-end sequencing (2 × 250 bp) was performed at Genome-Lead, Co., Ltd. (Kagawa, Japan) using the NovaSeq 6000 SP Reagent Kit v1.5 (300 cycles) on a NovaSeq 6000 system (Illumina). The resulting reads were filtered using fastp version 0.20.0 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/OpenGene/fastp\u003c/span\u003e\u003cspan address=\"https://github.com/OpenGene/fastp\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The trimmed reads were assembled using SPAdes v.3.15.5 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/ablab/spades\u003c/span\u003e\u003cspan address=\"https://github.com/ablab/spades\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The sequence data were annotated using Dfast (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://dfast.ddbj.nig.ac.jp/dfc\u003c/span\u003e\u003cspan address=\"https://dfast.ddbj.nig.ac.jp/dfc\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). All genome data were deposited into GenBank (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e). Whole-genome-based taxonomic analysis was conducted using the Genome BLAST Distance Phylogeny approach (GBDP) by uploading genome sequence data to the Type (Strain) Genome Server (TYGS; \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://tygs.dsmz.de\u003c/span\u003e\u003cspan address=\"https://tygs.dsmz.de\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e). The results of digital DNA-DNA hybridisation (DDH) formula d4, which is the sum of all identities found in high-scoring segment pairs (HSPs) divided by the overall HSP length, were summarised. A phylogenetic tree was visualised using MEGA version 11.0.8 (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://www.megasoftware.net\u003c/span\u003e\u003cspan address=\"https://www.megasoftware.net\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e).\u003c/p\u003e\u003cp\u003e\u003cb\u003eIdentification of antimicrobial and disinfectant resistance genes in\u003c/b\u003e \u003cb\u003eS. coagulans\u003c/b\u003e\u003c/p\u003e\u003cp\u003eResFinder (Ver. 4.7.2: \u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://genepi.food.dtu.dk/resfinder\u003c/span\u003e\u003cspan address=\"http://genepi.food.dtu.dk/resfinder\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used to identify acquired antimicrobial resistance (AMR) genes, chromosomal mutations mediating AMR and acquired disinfectant resistance genes from the WGS data. The thresholds for %ID and minimum length for chromosomal point mutations, AMR genes, and acquired disinfectant resistance genes were set at 90% and 60%, respectively.\u003c/p\u003e"},{"header":"Results","content":"\u003cp\u003e\u003cb\u003eIsolation of\u003c/b\u003e \u003cb\u003eS. coagulans\u003c/b\u003e \u003cb\u003eand\u003c/b\u003e \u003cb\u003eS. pseudintermedius\u003c/b\u003e \u003cb\u003efrom pustules\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe results of the bacterial culture are summarised in Table\u0026nbsp;1. In case #1, bacterial samples were collected from three pustules (pustules #1-#3) on the abdominal skin at the initial visit. More than 50 colonies were formed on mannitol salt agar when the samples from any of the three pustules were cultured. Therefore, 20 colonies/pustule were randomly selected for further analysis. Multiplex PCR amplified bands with molecular weights corresponding to \u003cem\u003eS. coagulans\u003c/em\u003e in all 60 isolates.\u003c/p\u003e\u003cp\u003eIn case #2, four pustules (pustules #4-#7) were selected for the 1st sampling, which isolated a total of 36 colonies (pustule #4: 12 colonies, pustule #5: 10 colonies, pustule #6: 2 colonies, pustule #7: 12 colonies). Multiplex PCR revealed that the majority of isolates were \u003cem\u003eS. pseudintermedius\u003c/em\u003e (32 out of 36 isolates). In contrast, bands corresponding to \u003cem\u003eS. coagulans\u003c/em\u003e were amplified in the remaining four isolates in pustule #7.\u003c/p\u003e\u003cp\u003eTwo pustules (pustules #8 and #9) were selected for the 2nd sampling, which isolated a total of 31 colonies (pustule #8: 25 colonies, pustule #9: 6 colonies). Multiplex PCR revealed that the most frequently isolated species was \u003cem\u003eS. pseudintermedius\u003c/em\u003e (25 out of 31 isolates). In contrast, bands corresponding to \u003cem\u003eS. coagulans\u003c/em\u003e were amplified in the remaining six isolates in pustule #8. \u003cem\u003eS. aureus\u003c/em\u003e was not isolated from any of the pustules tested.\u003c/p\u003e\u003cp\u003e\u003cb\u003eS. coagulans\u003c/b\u003e \u003cb\u003eisolated from the same pustules exhibited identical antimicrobial susceptibility profiles\u003c/b\u003e\u003c/p\u003e\u003cp\u003eTable\u0026nbsp;2 shows the antimicrobial susceptibility profiles of \u003cem\u003eS. coagulans\u003c/em\u003e isolated from case #1. Disk diffusion tests revealed that all 60 isolates were susceptible to CEX, CPDX, GM, CLDM, CP, FOM, and RFP but resistant to ERFX. For MPIPC, three isolates (#905 and #908 from pustule #1, #937 from pustule #2) had inhibition zone diameters below the resistant breakpoint (17 mm), while the others had diameters above the susceptible breakpoint (18 mm). In contrast, broth microdilution tests revealed that all 40 isolates collected from pustules #1 and #2 were susceptible to MPIPC (data not shown).\u003c/p\u003e\u003cp\u003eIn contrast, disk diffusion tests revealed that all 10 \u003cem\u003eS. coagulans\u003c/em\u003e isolates collected from pustules #7 and #8 in case #2 were susceptible to CP and RFP but resistant to MPIPC, CEX, CPDX, ERFX and FOM (Table\u0026nbsp;3). For GM, an isolate in pustule #7 (#SI82) had an inhibitory zone diameter below the resistant breakpoint (12 mm), while the others had diameters above the susceptible breakpoint (15 mm). Similarly, two isolates, #TA84 and #TA94 in pustule #8, had inhibitory zone diameters within intermediate ranges to CLDM (15\u0026ndash;20 mm) and GM (13\u0026ndash;14 mm), respectively. The other isolates in the same pustule were above the susceptible breakpoints to CLDM (21 mm) and GM. In contrast, broth microdilution tests revealed that all 10 isolates collected from pustules #7 and #8 were susceptible to GM, and all six isolates collected from pustule #8 were susceptible to CLDM (data not shown). Meanwhile, all 61 \u003cem\u003eS. pseudintermedius\u003c/em\u003e isolates, except for #29 collected from case #2 at the 1st and 2nd sampling, had diameters above the susceptible breakpoint of FOM (16 mm).\u003c/p\u003e\u003cp\u003e\u003cb\u003eS. coagulans\u003c/b\u003e \u003cb\u003eisolated from the same pustules exhibited identical genetic profiles\u003c/b\u003e\u003c/p\u003e\u003cp\u003eThe WGS were performed to investigate the genetic profiles of \u003cem\u003eS. coagulans\u003c/em\u003e isolated from the pustules. Four isolates from pustule #1 (#905, #906, #907 and #908), three isolates from pustule #2 (#936, #937 and #938), two isolates from pustule #3 (#942 and #943) and all 10 isolates from pustules #7 and #8 were randomly selected and subjected to the analysis. Analysis of genome annotation revealed that all isolates tested were annotated to \u003cem\u003eS. coagulans\u003c/em\u003e (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e).\u003c/p\u003e\u003cp\u003eThe DDH values were summarised in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA. In case #1, all isolates collected from pustules #1, #2, and #3 were the exact clones, showing 100% identity in genomic sequences. Similarly, the isolates from the same pustules were identical clones in case #2. Genomic sequences of the isolates from pustule #7 exhibited 99% identity with those from pustule #8. Furthermore, the isolates from the two clinical cases were distinctive, with identities ranging from 89.3\u0026ndash;89.5%. The phylogenetic tree based on whole-genome sequences also supported the above results (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e\u003cp\u003e\u003c/p\u003e\u003cp\u003e\u003cb\u003eS. coagulans\u003c/b\u003e \u003cb\u003eisolated from different pustules exhibited distinct AMR gene and antimicrobial susceptibility profiles\u003c/b\u003e\u003c/p\u003e\u003cp\u003eMoreover, the AMR and disinfectant-resistant gene profiles of S. coagulans isolates collected from three different pustules were analysed. The acquired AMR genes were not identified in the isolates from pustule #1, whereas five acquired AMR genes (\u003cem\u003emecA\u003c/em\u003e, \u003cem\u003eant(6)-la\u003c/em\u003e, \u003cem\u003eerm(B)\u003c/em\u003e, \u003cem\u003etet(O)\u003c/em\u003e, and \u003cem\u003etet(K)\u003c/em\u003e) were identified in isolates from pustule #7. Moreover, six acquired AMR genes (\u003cem\u003emecA\u003c/em\u003e, \u003cem\u003eblaZ\u003c/em\u003e, \u003cem\u003eaadD\u003c/em\u003e, \u003cem\u003eaac(6\u0026rsquo;)-aph(2\u0026rsquo;\u0026rsquo;)\u003c/em\u003e, \u003cem\u003efosB6\u003c/em\u003e, \u003cem\u003etet(O)\u003c/em\u003e, and \u003cem\u003ebleO\u003c/em\u003e) were identified in isolates from pustule #8 (Table\u0026nbsp;4). Chromosomal mutations mediating AMR or acquired disinfectant resistance genes were not identified in any of the isolates tested (data not shown).\u003c/p\u003e\u003cp\u003eThe AMR profiles for β-lactams, CLDM, and DOXY were consistent with the AMR gene profiles. Conversely, the AMR profiles for MINO and FOM in isolates from pustule #7, as well as that for GM in isolates from pustule #8, did not align with the genetic profiles. Therefore, a broth microdilution test for GM, MINO, and FOM was performed on representative isolates from pustules #1 (TA902), #7 (SI76), and #8 (TA79). However, the AMR patterns determined by the broth microdilution test were consistent with those determined by the disk diffusion test (Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e). The broth microdilution test for EM revealed that the AMR profile was consistent with the presence of the \u003cem\u003eerm(B)\u003c/em\u003e gene (Tables\u0026nbsp;4 and S3).\u003c/p\u003e"},{"header":"Discussion","content":"\u003cp\u003eThis study revealed clonal expansion of \u003cem\u003eS. coagulans\u003c/em\u003e in pustules of dogs with SBF. In case #1, \u003cem\u003eS. coagulans\u003c/em\u003e with identical genetic and phenotypic profiles was identified as the sole organism in multiple pustules. In addition, genotypic profiles of \u003cem\u003eS. coagulans\u003c/em\u003e isolates from different pustules in case #1 were identical, suggesting that the clone spread on the skin surface and caused pustule formation of SBF in the same dog. These findings imply that the \u003cem\u003eS. coagulans\u003c/em\u003e strain alone can form pustules and may act as a pathogen, causing SBF in case #1.\u003c/p\u003e\u003cp\u003eSimilarly, \u003cem\u003eS. coagulans\u003c/em\u003e was isolated from two pustules at different sampling times in case #2. The genotypic characteristics of \u003cem\u003eS. coagulans\u003c/em\u003e isolated from the same pustules were identical, sharing 100% identity. The isolates in pustule #8 were considered derivative clones of #7, as they shared 99% identity in genomic sequences. The identification of clonal expansion of S. coagulans in the pustules suggests that pustules are the ideal lesions for sampling bacterial cultures and antimicrobial susceptibility testing for \u003cem\u003eS. coagulans\u003c/em\u003e, as similarly reported in \u003cem\u003eS. pseudintermedius\u003c/em\u003e [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e]. However, the \u003cem\u003eS. coagulans\u003c/em\u003e clones coexisted with \u003cem\u003eS. pseudintermedius\u003c/em\u003e isolates in the same pustules in case #2. In addition, the skin lesions in case #2 markedly improved by the administration of oral FOM, to which almost all \u003cem\u003eS. pseudintermedius\u003c/em\u003e isolates were susceptible. However, the \u003cem\u003eS. coagulans\u003c/em\u003e clones isolated from the same pustules were resistant to FOM. Therefore, we thought that \u003cem\u003eS. pseudintermedius\u003c/em\u003e was a primary pathogen causing SBF in case #2. Hence, the interpretation of culture results should be cautious if \u003cem\u003eS. coagulans\u003c/em\u003e is isolated from the skin lesions of dogs with SBF, as it can coexist with \u003cem\u003eS. pseudintermedius\u003c/em\u003e and may not play a significant role in the development of the skin lesions.\u003c/p\u003e\u003cp\u003eThe WGS analysis also provided genetic evidence of acquired AMR genes in \u003cem\u003eS. coagulans\u003c/em\u003e isolates. \u003cem\u003eS. coagulans\u003c/em\u003e isolates from pustule #1 did not harbour any AMR genes, and the results were consistent with the AMR profiles. Meanwhile, \u003cem\u003eS. coagulans\u003c/em\u003e isolates from pustules #7 and #8 harboured the \u003cem\u003emecA\u003c/em\u003e gene, which supports resistance to MPIPC, CEX, and CPDX. The isolates from pustule #7 also harboured \u003cem\u003eerm(B)\u003c/em\u003e, \u003cem\u003etet(O)\u003c/em\u003e and \u003cem\u003etet(K)\u003c/em\u003e genes, and exhibited resistance to CLDM, DOXY and EM, but not MINO. These findings suggest that the \u003cem\u003eerm(B)\u003c/em\u003e and \u003cem\u003etet(K)\u003c/em\u003e genes, which are responsible for resistance to CLDM, EM, and DOXY, were translated, but the \u003cem\u003etet(O)\u003c/em\u003e gene, which is responsible for MINO resistance, was not. The isolates from pustule #8 harboured \u003cem\u003ethe aac(6\u0026rsquo;)-aph(2\u0026rsquo;\u0026rsquo;)\u003c/em\u003e gene, which is responsible for GM resistance. However, they were susceptible to GM, suggesting that the gene was not expressed in the isolates. Moreover, the \u003cem\u003efosB6\u003c/em\u003e gene, which is responsible for FOM resistance, was identified only in the isolates from pustule #8, although FOM resistance was also recognised in the isolates from pustule #7. In \u003cem\u003eStaphylococcus aureus\u003c/em\u003e, several factors unrelated to the \u003cem\u003efosB\u003c/em\u003e gene, such as genetic mutations in \u003cem\u003euhpT\u003c/em\u003e, \u003cem\u003eglpT\u003c/em\u003e, and \u003cem\u003emurA\u003c/em\u003e genes [11, 12], or overexpression of the \u003cem\u003etet38\u003c/em\u003e gene encoding an efflux pump [13], also contribute to FOM resistance. It is possible that the bioinformatic analysis used in this study failed to detect such genetic changes in \u003cem\u003eS. coagulans\u003c/em\u003e isolated from pustule #7. Future studies to discover new resistance mechanisms to FOM in \u003cem\u003eS. coagulans\u003c/em\u003e are awaited.\u003c/p\u003e\u003cp\u003eThe main limitation of this study was the small sample size, which was insufficient to conclude that \u003cem\u003eS. coagulans\u003c/em\u003e can be a primary pathogen causing pustules in multiple dogs with SBF similar to \u003cem\u003eS. pseudintermedius\u003c/em\u003e. Future large-scale studies on the isolation rate of \u003cem\u003eS. coagulans\u003c/em\u003e clones from pustules of dogs with SBF are expected.\u003c/p\u003e"},{"header":"Conclusion","content":"\u003cp\u003eThis study revealed that \u003cem\u003eS. coagulans\u003c/em\u003e, with identical genetic and phenotypic profiles, was identified as the sole organism or coexisted with \u003cem\u003eS. pseudintermedius\u003c/em\u003e in the pustules of the same dogs with SBF. These findings suggest that \u003cem\u003eS. coagulans\u003c/em\u003e proliferates clonally and may be the primary pathogen responsible for pustule formation in SBF in dogs.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003cdiv class=\"DefinitionList\"\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eSBF\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003esuperficial bacterial folliculitis\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eGM\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003egentamycin\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eCEX\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ecephalexin\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eMINO\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eminocycline\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eFOM\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003efosfomycin\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eLB\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eLuria-Bertani\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eMPIPC\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eoxacillin\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eCPDX\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ecefpodoxime\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eERFX\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eenrofloxacin\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eCLDM\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eclindamycin\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eDOXY\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003edoxycycline\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eCP\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003echloramphenicol\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eRFP\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003erifampicin\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eEM\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eerythromycin\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eWGS\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003ewhole genome sequencing\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003cdiv class=\"DefinitionListEntry\"\u003e\u003cdiv class=\"Term\"\u003e\u003cb\u003eAMR\u003c/b\u003e\u003c/div\u003e\u003cdiv class=\"Description\"\u003e\u003cp\u003eantimicrobial resistance\u003c/p\u003e\u003c/div\u003e\u003c/div\u003e\u003c/div\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eEthical approval\u003c/strong\u003e\u003cstrong\u003e\u0026nbsp;and consent to participate\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe participating dog owner provided written informed consent. The Clinical Animal Trials and Research Ethics Committee of the Tokyo University of Agriculture and Technology approved all studies (approval no. 0016023).\u0026nbsp;\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors have read and approved the final version of the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare that there are no financial or non-financial competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors received no research funds for this study.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAuthors\u0026rsquo; contributions\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eT.O., J.U. and K.N. designed the experiments. T.O. and Y. S. corrected the clinical samples. T.O., Y.S., T.W., I.I. K.I., Y.T. and K.I. analysed the data. T.O wrote the main manuscript text and prepared all tables. T.W. and J.U. prepared figure 1. All authors reviewed the manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAcknowledgements\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable\u003cstrong\u003e\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\u003cli\u003e\u003cspan\u003eBloom P. Canine superficial bacterial folliculitis: current understanding of its etiology, diagnosis and treatment. Vet J. 2014;199(2):217\u0026ndash;22.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eBeco L, Guaguere E, Lorente Mendez C, Noli C, Nuttall T, Vroom M. Suggested guidelines for using systemic antimicrobials in bacterial skin infections (1): diagnosis based on clinical presentation, cytology and culture. Vet Rec. 2013;172(3):72\u0026ndash;8.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eKawakami T, Shibata S, Murayama N, Nagata M, Nishifuji K, Iwasaki T, Fukata T. Antimicrobial susceptibility and methicillin resistance in Staphylococcus pseudintermedius and Staphylococcus schleiferi subsp. coagulans isolated from dogs with pyoderma in Japan. J Vet Med Sci. 2010;72(12):1615\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLoeffler A, Cain CL, Ferrer L, Nishifuji K, Varjonen K, Papich MG, Guardabassi L, Frosini SM, Barker EN, Weese JS. Antimicrobial use guidelines for canine pyoderma by the International Society for Companion Animal Infectious Diseases (ISCAID). Vet Dermatol. 2025;36(3):234\u0026ndash;82.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eLarsen RF, Boysen L, Jessen LR, Guardabassi L, Damborg P. Diversity of Staphylococcus pseudintermedius in carriage sites and skin lesions of dogs with superficial bacterial folliculitis: potential implications for diagnostic testing and therapy. Vet Dermatol 2018.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eSasaki T, Tsubakishita S, Tanaka Y, Sakusabe A, Ohtsuka M, Hirotaki S, Kawakami T, Fukata T, Hiramatsu K. Multiplex-PCR method for species identification of coagulase-positive staphylococci. J Clin Microbiol. 2010;48(3):765\u0026ndash;9.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCLSI. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals: approved standards \u0026ndash; 4th ed. CLSI document VET08. \u003cem\u003eWayne, PA: Clinical and Laboratory Standards Institute\u003c/em\u003e, 2018.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCLSI. Performance standards for antimicrobial disk and dilution susceptibility tests for bacteria isolated from animals: approved standards \u0026ndash; 30th ed. CLSI document M100.8. \u003cem\u003eWayne, PA: Clinical and Laboratory Standards Institute\u003c/em\u003e, 2020.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eIyori K, Shishikura T, Shimoike K, Minoshima K, Imanishi I, Toyoda Y. Influence of hospital size on antimicrobial resistance and advantages of restricting antimicrobial use based on cumulative antibiograms in dogs with Staphylococcus pseudintermedius infections in Japan. Vet Dermatol. 2021;32(6):668\u0026ndash;e178.\u003c/span\u003e\u003c/li\u003e\u003cli\u003e\u003cspan\u003eCLSI. Methods for Dilution Antimicrobial Susceptibility Tests for Bacteria That Grow Aerobically, 12th Edition. \u003cem\u003eZimmer BL: Clinical and Laboratory Standards Institute\u003c/em\u003e 2024.\u003c/span\u003e\u003c/li\u003e\u003c/ol\u003e"},{"header":"Tables","content":"\u003cp\u003eTable 1 to 4 are available in the Supplementary Files section.\u003c/p\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"Staphylococcus coagulans, Staphylococcus pseudintermedius, dog, superficial bacterial folliculitis, antimicrobial susceptibility, disk diffusion test","lastPublishedDoi":"10.21203/rs.3.rs-7251543/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-7251543/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003ch2\u003eBackground:\u003c/h2\u003e\u003cp\u003e\u003cem\u003eStaphylococcus coagulans\u003c/em\u003e is the second most common isolate from skin lesions of dogs with superficial bacterial folliculitis (SBF). However, the clinical significance of \u003cem\u003eS. coagulans\u003c/em\u003e in canine SBF remains uncertain. This study aimed to investigate the prevalence, genotypic and phenotypic diversities of \u003cem\u003eS. coagulans\u003c/em\u003e isolated from pustules in two dogs with SBF.\u003c/p\u003e\u003ch2\u003eResults:\u003c/h2\u003e\u003cp\u003eTwo dogs with SBF were included in this study. \u003cem\u003eS. coagulans\u003c/em\u003e was isolated as the sole organism in three pustules in case #1, whereas it coexisted with \u003cem\u003eS. pseudintermedius\u003c/em\u003e in two of seven pustules in case #2. \u003cem\u003eS. pseuintermedius\u003c/em\u003e was the sole organism in the remaining five pustules in case #2. Whole genome sequences and antimicrobial susceptibility tests revealed that \u003cem\u003eS. coagulans\u003c/em\u003e isolated from the same pustules exhibited identical genotypic and phenotypic profiles, indicating clonal expansion. Meanwhile, \u003cem\u003eS. coagulans\u003c/em\u003e isolated from different pustules exhibited similar yet distinct genotypic and phenotypic profiles.\u003c/p\u003e\u003ch2\u003eConclusions:\u003c/h2\u003e\u003cp\u003e\u003cem\u003eS. coagulans\u003c/em\u003e with identical genetic and phenotypic profiles can be identified as the sole organism or coexist with \u003cem\u003eS. pseudintermedius\u003c/em\u003e in the pustules of the same dogs with SBF.\u003c/p\u003e","manuscriptTitle":"Genetic and phenotypic identities of Staphylococcus coagulans isolated from pustules in dogs with superficial bacterial folliculitis","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2025-08-18 06:20:21","doi":"10.21203/rs.3.rs-7251543/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2025-09-02T03:51:34+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-09-01T08:12:07+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2025-08-20T15:02:59+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"151816988174970377586471550573606342536","date":"2025-08-12T11:17:17+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"66546584623121584013536088532922076872","date":"2025-08-11T14:38:29+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"152112154628514221382874327188512701068","date":"2025-08-11T00:01:45+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2025-08-10T11:01:08+00:00","index":"","fulltext":""},{"type":"editorInvited","content":"","date":"2025-07-31T11:33:24+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2025-07-31T08:55:36+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2025-07-31T08:54:24+00:00","index":"","fulltext":""},{"type":"submitted","content":"BMC Veterinary Research","date":"2025-07-30T10:01:53+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"bmc-veterinary-research","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"","sideBox":"Learn more about [BMC Veterinary Research](http://bmcvetres.biomedcentral.com/)","snPcode":"12917","submissionUrl":"https://submission.nature.com/new-submission/12917/3?","title":"BMC Veterinary Research","twitterHandle":"@BMC_series","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"stoa","reportingPortfolio":"BMC Series","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"70d7afaa-1988-4799-96fb-0d42d69b4106","owner":[],"postedDate":"August 18th, 2025","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2026-01-26T16:06:14+00:00","versionOfRecord":{"articleIdentity":"rs-7251543","link":"https://doi.org/10.1186/s12917-025-05250-5","journal":{"identity":"bmc-veterinary-research","isVorOnly":false,"title":"BMC Veterinary Research"},"publishedOn":"2026-01-19 15:58:07","publishedOnDateReadable":"January 19th, 2026"},"versionCreatedAt":"2025-08-18 06:20:21","video":"","vorDoi":"10.1186/s12917-025-05250-5","vorDoiUrl":"https://doi.org/10.1186/s12917-025-05250-5","workflowStages":[]},"version":"v1","identity":"rs-7251543","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-7251543","identity":"rs-7251543","version":["v1"]},"buildId":"8U1c8b4HqxoKbykW_rLl7","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}