Result
1. Higher LTag and P53 expression in JCV-positive
DNA was extracted from the formalin-fixed paraffin-embedded (FFPE) tumor tissues of 100 bladder cancer patients (BL01-BL100). 28 JCV-positive samples were identified from 100 patients through polymerase chain reaction (PCR), the patients information is shown in supplementary Table 1. The expression of LTag and p53 were detected by immunohistochemistry in 28 JCV-positive samples, while 28 JCV-negative samples (BL29-BL56) were randomly selected for comparison. Statistical analysis revealed that LTag expression was significantly higher in JCV-positive tissues than in JCV-negative tissues (P < 0.0001; Fig. 1 a and b). Similarly, p53 expression was also significantly higher in JCV-positive tissues compared to the negative (P < 0.001; Fig.1c and d). In conclusion, the elevated expression of LTag and p53 in JCV-positive samples suggests a correlation between their expression and JCV infection, indicating that JCV infection may play a critical role in the pathogenesis and progression of bladder cancer.
2. Virome found JCV is widely present in the urine of bladder cancer patients, and there are mutations in JCV NCCR
Since urine samples were more accessible, 45 urine samples (BL101-BL145) from bladder cancer patients were subsequently collected, and DNA was extracted. Eight samples were randomly selected for virome. By analyzing the read percentages for each specimen (Fig. 2a), polyomaviridae related sequences were detected in seven out of the eight samples but were absent in the remaining one. Through comparative analysis, it was found that among the seven samples, NCCR of samples BL106, BL113, BL119 and BL145 showed no mutations, whereas the sequences of samples BL112, BL126 and BL135 exhibited a deletion of five base pairs in the JCV NCCR (NC_001699.1) (Fig. 2b). The mutation frequency was calculated to be 42.86%.
3. The qPCR-assay for the detection of JCV and the
jabbrv-ltwa-all.ldf jabbrv-ltwa-en.ldf subtype of NCCR was established
To investigate whether NCCR classification can be utilized for bladder cancer diagnosis, we designed primers specific to JCV NCCR (NCCR F Primer and NCCR R Primer), as well as probes targeting NCCR Wild type (JCVWP) and NCCR Mutant type (JCVMP) (Table 1). Plasmids of both NCCR Wild type and NCCR Mutant type were constructed (Fig. 3 a and d) and subsequently amplified using the PCR amplification system outlined in Table 2 and the program described in the methods section. With this system, we are not only able to detect the presence of JCV but also distinguish between the NCCR wild type and mutant type. Both plasmids generated smooth ”S”-shaped amplification curves with CT values below 40 (Fig. 3 b and e), confirming successful system construction. To evaluate the accuracy of the detection system, the two plasmids were serially diluted to concentrations of 10 5, 10 4, 10 3, 10 2, and 10 copies/μL, with three replicates per concentration. The results demonstrated that all dilutions produced smooth ”S”-shaped amplification curves with CT values consistently below 40 (Fig. 3 c and f), meeting the established criteria and validating the successful establishment of the qPCR-assay.
4. To analyze the JCV infection and NCCR mutation in the urine of healthy individuals and patients with bladder cancer by the qPCR-assay.
DNA was extract from the urine samples of bladder cancer patients (BL101-BL145) and the urine samples of normal individuals (H01-H74), and analyzed using the qPCR-assay. The patients information is shown in supplementary Table 2 and Supplementary Table 3. The results indicated that JCV was detected in 37 out of 45 bladder cancer patients, yielding a positive rate of 82.22%. NCCR mutations were identified in 26 of the 37 JCV-positive patients, accounting for 57.78% of all. Among the 74 healthy individuals, JCV was detected in 36 individuals, resulting in a positive rate of 48.64%. NCCR mutations were observed in 19 of the 36 JCV-positive individuals, representing 25.68% of the total (Table 3). These findings suggest that bladder cancer patients are more likely to be infected with JCV and exhibit a higher NCCR mutation rate, indicating tumor specificity. Additionally, 10 amplification products were randomly selected for Sanger sequencing, which demonstrated a 100% concordance rate between qPCR and Sanger sequencing results (Fig. 4 a-f). The summary of the results is presented in supplementary table 2.
5. Mutations in NCCR affect its transcriptional activity
PcDNA3.1-NCCR Forward Wild-EGFP, pcDNA3.1-NCCR Forward Mutant-EGFP, pcDNA3.1-NCCR Reverse Wild-EGFP, and pcDNA3.1-NCCR Reverse Mutant-EGFP plasmids were constructed and transfected into the bladder cancer cell line 5637 to investigate the effects of forward and reverse NCCR, as well as NCCR mutations, on the transcriptional activity in bladder cancer (Fig. 5a). The results demonstrated that the fluorescence expression of NCCR Wild was significantly stronger than that of NCCR Mutant in both the forward and reverse of NCCR (Fig. 5 b and c). In a similar manner, the dual-luciferase reporter assay was conducted (Fig. 5d). The results demonstrated that the RLU1/RLU2 ratios for NCCR Wild were markedly higher than those for NCCR Mutant (Fig. 5e). These results suggest that NCCR mutations can influence its transcriptional activity.
6. Specific binding protein of NCCR Mutant sequence in tumor cells
Using bladder cancer cells (5637), the target proteins combined with NCCR Wild or NCCR Mutant were pulled down by Co-IP assay (Fig. 6a). Subsequently, these proteins were analyzed using Immunopurification and Mass Spectrometry (IPMS). The IPMS results indicated that the NCCR Wild group contained 969 unique proteins, while the NCCR Mutant group contained 873 unique proteins, with 678 related proteins shared between the two groups (Fig. 6b). Further cluster analysis revealed that the detected proteins were significantly enriched in multiple signaling pathways related to transcriptional regulation (Fig. 6 c and d). In-depth investigation found that NCCR mutations could up-regulate the expression of multiple proteins including CEBPB, etc., while down-regulating the expression levels of GRB2 etc. This result indicates that NCCR mutations have a profound impact on the transcriptional regulatory functions of these proteins.
Discussion
It is estimated that more than 1.4 million cancer cases annually are attributable to viral infections, representing approximately 10% of the global cancer burden [35]. The majority of these cases are linked to the seven carcinogenic viruses explicitly classified by the IARC as Group 1 (carcinogenic to humans) and Group 2A (probably carcinogenic to humans) [35-37]. JC polyomavirus has exhibited clear carcinogenic potential in experimental animals; however, its carcinogenicity in humans remains to be further elucidated. Consequently, it has been categorized by the IARC as possibly carcinogenic to humans (Group 2B) [12]. In recent years, with the identification of additional polyomaviruses and ongoing in-depth investigations into their mechanisms of action [38], a more comprehensive understanding of the biological characteristics of the polyomavirus family members and their implications for human health has emerged. Simultaneously, research on the carcinogenicity of JCV has garnered increasing attention from the scientific community.
The epidemiological investigation reveals that the seropositivity rate of human polyomavirus JCV in the adult population exceeds 50%. Initial infection typically occurs during childhood and is generally asymptomatic. Following the initial infection, the virus that has not been cleared may disseminate via the bloodstream to other tissues, entering a latent infection phase. Notably, urothelial tissue serves as one of the primary sites for JCV latency [18-19, 29]. Based on this background, this study conducted an investigation of JCV and selected urine samples as research subjects. Urine samples are not only highly representative for JCV detection but also offer the advantages of being easily obtainable, minimally invasive to patients, and clinically significant.
The JCV genome can be divided into three distinct regions: the early region, the late region, and NCCR. Proteins expressed in the early region include LTag and STag. In the host cell, the binding of LTag to P53 inhibits the activity of P53[39]. Moreover, the expression of LTag also prevents P53 from normally inducing cell apoptosis, driving cells into the S phase and promoting tumor transformation [40-41]. At the same time, the binding of LTag to P53 alters the conformation of P53, causing some P53 to be unable to be degraded, resulting in the accumulation of P53 and forming a ”high expression-low activity” contradiction state [41]. In Figure 1 of this study, we observed that the expression levels of LTag and p53 in bladder cancer tissue infected with JCV were significantly higher. This suggests that in JCV-positive bladder cancer, the LTag encoded by JCV binds to p53, leading to the inactivation of its tumor suppressor function. The resultant effects promote cell cycle progression into the S phase, thereby supporting viral replication, inhibiting apoptosis, and ultimately contributing to the development of bladder cancer. Due to the lack of commercially available JCV LTag-specific antibodies, a commercialized SV40 T-antigen antibody (Abcam) was utilized as a surrogate. Notably, some bladder cancer tissue samples that tested negative for JCV exhibited positive results in LTag immunohistochemical staining. This discrepancy could potentially be explained by nucleic acid degradation in the FFPE tumor tissues, which may cause false-negative PCR results, or by cross-reactivity between the LTag antibody and LTag proteins from other polyomavirus strains, thereby leading to false-positive immunohistochemical findings.
The NCCR of JCV plays a significant role in regulating the expression of the oncogenic protein LTag, thereby influencing viral genome replication and pathogenicity. Based on the characteristics of NCCR, JCV can be classified into prototypical and mutant types [29, 42]. In the JCV genome, the NCCR exhibits a higher degree of variability compared to the highly conserved early and late coding regions. During host immune suppression, rearrangements within the NCCR can occur. Studies have demonstrated that these rearrangements result from deletions and/or duplications in the prototypical sequence, leading to alterations in promoter activity [43-44]. Such changes are hypothesized to contribute to viral pathogenicity by modifying its cellular tropism [33].
Through Virome detection in this study, we identified that the NCCR of JCV in the urine DNA of bladder cancer patients may have a deletion of five bases. It is hypothesized that in bladder cancer, mutations in NCCR affect its transcriptional activity. Subsequently, immunofluorescence and dual-luciferase reporter assay were performed, revealing that after the mutation, the transcriptional capability was attenuated. We speculate that JCV diminishes its transcriptional function via NCCR mutations, thereby reducing viral activity and promoting viral latency within the host. Further clustering analysis of the detected proteins demonstrated enrichment in multiple transcription-related regulatory pathways (Figure 6.c), indicating that NCCR mutations significantly impact their transcriptional regulatory functions. Further analysis revealed that in the NCCR mutant group, the protein GRB2, which plays a critical role in transcription regulation, was significantly downregulated. Existing research on bladder cancer demonstrates that GRB2 is highly expressed in bladder transitional cell carcinoma tissues. GRB2 binds to EGFR to activate Ras, subsequently activating the MAPK signaling pathway and promoting processes such as the proliferation and differentiation of bladder cancer cells [45]. In the NCCR mutant group, the downregulation of GRB2 expression suggests a weakening of the proliferative and differentiation effects on bladder cancer cells. This may potentially facilitate the latency of JCV in epithelial tissues.
At present, cystoscopy combined with pathological biopsy remains the gold standard for diagnosing bladder cancer and monitoring its recurrence and progression post-treatment. However, this technique is invasive, limited by factors such as physician expertise and tumor location, and is not suitable for rapid detection and analysis in clinical laboratories. Therefore, building upon previous experimental findings, this study developed an qPCR-assay for bladder cancer that integrates urine JCV load measurement with NCCR-specific detection. The objective is to establish a non-invasive, convenient, and accurate diagnostic method to complement traditional approaches, enhance bladder cancer detection, and further elucidate its pathogenesis, thereby providing novel insights and strategies for diagnosis and treatment.
1.Sample Collection
In accordance with ethical guidelines, the FFPE tumor tissues were collected from 100 patients with bladder cancer, and the urine samples were collected from 45 patients with bladder cancer and 74 healthy individuals. The study was approved by the Research Ethics Committee of Shenzhen Luohu People’s Hospital. DNA was extracted from the FFP tumor tissues sections and urine sediment using commercial kits, and the concentrations and absorbance of all DNA were determined using Nanodrop OneC (Thermo Fisher Scientific, Inc.).
2. Virome
After collecting DNA from the sediment of urine, viral-like particles (VLP) in the solution were purified and concentrated by using virological separation methods such as filtration, ultracentrifugation or precipitation. For the urine sediment DNA samples that passed the quality inspection, random fragmentation was carried out using an ultrasonic disintegrator, and sequencing libraries were constructed. The qualified libraries were sequenced on the Illumina platform. After sequencing, low-quality data and host sequences were removed. Subsequently, the data were assembled using assembly software such as IDBA and SPAdes, and potential viral sequence sets were predicted using CheckV software. Finally, these sequences were annotated for viral taxonomy using PhaGCN2 software.
jabbrv-ltwa-all.ldf jabbrv-ltwa-en.ldf 3.Immunohistochemistry
Tissue sections of JCV-positive samples screened by PCR and randomly selected JCV-negative samples were dewaxed, graded alcohol hydrated step by step, and equilibrated in PBS; incubated with freshly prepared 0.3% hydrogen peroxide for 30 mins at room temperature to seal the endogenous peroxidase activity; sections were then placed in 0.01 M citrate buffer for antigen microwave repair in a microwave oven; secondary antibody of consistent normal serum source was closed at room temperature for 30 mins; P53 Rabbit mAb (Cellsignal) was diluted at 1:160 and Anti-SV40 T-antigen antibody (abcam) was diluted at 1:100 and incubated overnight at 4°C, followed by incubation with the corresponding secondary antibody for 1 h at 37°C; After a series of operations, the microscopic analysis was completed by DAB color development, microscopic Observation and timely termination of the reaction; hematoxylin re-staining, PBS blue return; conventional dehydration and transparency, neutral resin sealing.
jabbrv-ltwa-all.ldf jabbrv-ltwa-en.ldf 4. Statistical analysis of immunohistochemical results
Using Image J, subtract the cell signal from the original image, leaving the DAB staining signal, convert it to a grayscale image and quantify the optical density values, and finally, divide the cumulative optical density values by the area of the target distribution region to obtain the average density value of the target substance. For each film, three fields of vision are selected for statistical analysis.
5.Cell culture and plasmid transfection
5637 cells were cultured with RPMI Medium 1640 basic (containing 10% fetal bovine serum and 100 U/ml penicillin and streptomycin) in an incubator at 37 °C and 5% CO2; cells were passaged when they grew to a full monolayer, washed twice with PBS, and digested by trypsin until the cells became round, and the digestion was terminated by serum-free medium; the cells were washed by resuspension with PBS buffer after centrifugation, and inoculated into the culture dish at 30% density. The next day, 5637 cells were transfected with plasmid and Lipofectamine™ 3000 Transfection Reagent (Invitrogen) in the ratio of the instructions, and the culture medium (without double antibodies) was changed to fresh after transfection for 4-6 h. The cells were subsequently used for fluorescence microscopy and flow cytometry. The cell line is from China Center for Type Culture Collection.
6. Immunopurification and Mass Spectrometry assay
Specific DNA probes targeting NCCR wild-type and mutant forms were designed and labeled with biotin through desulfonation. These probes were incubated with the protein mixture obtained from lysed cells to achieve specific binding between DNA probes and target proteins. After washing to remove non-specifically bound proteins, the DNA probe-protein complexes were separated using elution buffer. Subsequently, the significant differences were cut, and mass spectrometry (MS) analysis was performed. The peptide samples after enzymatic digestion were centrifuged and dried, then re-dissolved in Nano-LC mobile phase A (0.1% formic acid / water), bottled for sample loading, and subjected to online MS analysis. The samples were loaded onto the nanoViper C18 pre-column at a volume of 2 μL, and then rinsed with 20 μL volume for desalting. The liquid chromatography was performed using an Easy nLC 1200 nanoscale liquid chromatography system (ThermoFisher, USA), and the mass spectrometry analysis was conducted using the ThermoFisher Q Exactive system (ThermoFisher, USA) combined with the nanospray Nano Flex ion source (ThermoFisher, USA). The raw.wiff file captured by the mass spectrometer was processed and analyzed using the PEAKS Studio 8.5 software (version 8.5, Bioinformatics Solutions Inc., Waterloo, Canada), and the database was the human comprehensive protein database downloaded from Uniprot.
7.Quantitative Real-time PCR (q-PCR)
In order to detect JCV NCCR and classify it, we designed specific primers and probes. The primer sequences for JCV NCCR are as follows: 5’ forward primer: TGGCCTCCTAAAAAGCCTCC 3’; 5’ reverse primer: GGTGACAAGCCAAAACAGCTC 3’. In addition, two probes were designed: one for wild-type JCV NCCR (5’ HEX-AACATGTTCCCCTGGCT-BHQ1 3’), and the other for mutant-type JCV NCCR (5’ FAM-CAAAACATGCTGGCTG-BHQ1 3’). Subsequently, PCR amplification reactions were carried out. The amplification system is detailed in Table 3. The PCR reaction program was set as follows: first, pre-denaturation at 94℃ for 3 minutes, then 40 cycles, each cycle including: 94℃ denaturation for 20 seconds, 60℃ annealing and extension for 30 seconds. If the amplification curve shows a typical ”S” shape and the CT value is less than 40, it is considered that the amplification is successful. The copy number of plasmids was quantitatively analyzed using a fluorescence quantitative PCR instrument, and a standard curve was constructed. Under the same conditions, the infection status of JCV in urine samples from healthy individuals undergoing physical examinations and bladder cancer patients was detected using this method, and the classification of JCV NCCR was also completed simultaneously.
Author contributions
Yinyan Xu: Data curation; formal analysis; investigation; methodology; project administration; resources; validation; visualization; writing-original draf.
Ran Tao: Resources; data curation.
Jinqian Li: Writing-review and editing; data curation.
Tong Ou: Conceptualization; funding acquisition; investigation; methodology; project administration; resources; supervision; writing-review and editing.
Funding statement
This work was supported by the Guangdong Basic and Applied Basic Research Foundation (2022A1515220005), Shenzhen Science and Technology Program (JCYJ 20210 324121613037, CJGJZD20230724092800001) and Municipal Financial Subsidy of Shenzhen Medical Key Discipline Construction (NO. SZXK054).
jabbrv-ltwa-all.ldf jabbrv-ltwa-en.ldf Conflict of interest statement
The authors declare that they have no competing interests.
jabbrv-ltwa-all.ldf jabbrv-ltwa-en.ldf Ethics statement
The study was approved by the Research Ethics Committee of Shenzhen Luohu People’s Hospital.
Data availability statement
All data supporting this study are contained within the article or Supplementary tables, or available from the corresponding authors on reasonable request.
jabbrv-ltwa-all.ldf jabbrv-ltwa-en.ldf Reference
[1] Lopez-Beltran A, Cookson M S, Guercio B J, et al. Advances in diagnosis and treatment of bladder cancer[J]. bmj, 2024, 384.
[2] Dyrskjøt L, Hansel D E, Efstathiou J A, et al. Bladder cancer[J]. Nature Reviews Disease Primers, 2023, 9(1): 58.
[3] Thomas W Flaig, Philippe E Spiess, Michael Abern, et al. NCCN Guidelines Insights: Bladder Cancer, Version 3.2024.[J]. J Natl Compr Canc Netw. 2024 May;22(4):216-225.
[4] Lenis A T, Lec P M, Chamie K. Bladder cancer: a review[J]. Jama, 2020, 324(19): 1980-1991.
[5] Siegel R L, Miller K D, Wagle N S, et al. Cancer statistics, 2023[J]. Ca Cancer J Clin, 2023, 73(1): 17-48.
[6] Siegel R L, Giaquinto A N, Jemal A. Cancer statistics, 2024[J]. CA: a cancer journal for clinicians, 2024, 74(1): 12-49.
[7] Cancer incidence and mortality in China, 2022.
[8] Burger M, Catto J W F, Dalbagni G, et al. Epidemiology and risk factors of urothelial bladder cancer[J]. European urology, 2013, 63(2): 234-241.
[9] Lin M V, King L Y, Chung R T. Hepatitis C virus–associated cancer[J]. Annual Review of Pathology: Mechanisms of Disease, 2015, 10: 345-370.
[10] Holland J F, Melana S, Nartey T, et al. Human mammary tumor virus (HMTV) is a breast cancer pathogen[J]. Cancer research, 2016, 76(14_Supplement): 4062-4062.
[11] Moore, P.; Chang, Y. Why do viruses cause cancer? Highlights of the first century of human tumor virology. Nat. Rev. Cancer 2010, 10, 878–88.
[12] Bouvard V, Baan RA, Grosse Y, Lauby-Secretan B, El Ghissassi F, Benbrahim-Tallaa L, Guha N, Straif K, Group WIAfRoCMW: Carcinogenicity of malaria and of some polyomaviruses. The Lancet Oncology 2012, 13(4):339-340.
[13] Padgett, B.; Walker, D.; ZuRhein, G.; Eckroade, R.; Dessel, B. Cultivation of papova-like virus from human brain with progressive multifocal leucoencephalopathy. Lancet 1971, 297, 1257–1260.
[14] Radhakrishnan S, Otte J, Enam S, et al. JC virus-induced changes in cellular gene expression in primary human astrocytes[J]. Journal of virology, 2003, 77(19): 10638-10644.
[15] Rocchi A, Sariyer I K, Berger J R. Revisiting JC virus and progressive multifocal leukoencephalopathy[J]. c
[16] Delbue S, Comar M, Ferrante P. Review on the relationship between human polyomaviruses-associated tumors and host immune system[J]. Journal of Immunology Research, 2012, 2012.
[17] Querido S, Fernandes I, Weigert A, et al. High-grade urothelial carcinoma in a kidney transplant recipient after JC virus nephropathy: The first evidence of JC virus as a potential oncovirus in bladder cancer. Am J Transplant. 2020. 20(4): 1188-1191.
[18] Elia, F.; Villani, S.; Ambrogi, F.; Signorini, L.; Dallari, S.; Binda, S.; Primache, V.; Pellegrinelli, L.; Ferrante, P.; Delbue, S. JC virus infection is acquired very early in life: Evidence from a longitudinal serological study. J. NeuroVirol. 2016, 23, 99–105.
[19] Kean, J.M.; Rao, S.; Wang, M.; Garcea, R.L. Seroepidemiology of human polyomaviruses. PLoS Pathog. 2009, 5, e1000363.
[20] Butel J S, Lednicky J A. Cell and molecular biology of simian virus 40: implications for human infections and disease[J]. Journal of the National Cancer Institute, 1999, 91(2): 119-134.
[21] Khalili K, Krynska B, Del Valle L, et al. Medulloblastomas and the human neurotropic polyomavirus JC virus[J]. The Lancet, 1999, 353(9159): 1152-1153.
[22] Valle L D, Gordon J, Assimakopoulou M, et al. Detection of JC virus DNA sequences and expression of the viral regulatory protein T-antigen in tumors of the central nervous system[J]. Cancer research, 2001, 61(10): 4287-4293.
[23] Rollison D E M, Utaipat U, Ryschkewitsch C, et al. Investigation of human brain tumors for the presence of polyomavirus genome sequences by two independent laboratories[J]. International journal of cancer, 2005, 113(5): 769-774.
[24] Enam S, Del Valle L, Lara C, et al. Association of human polyomavirus JCV with colon cancer: evidence for interaction of viral T-antigen and β-catenin[J]. Cancer research, 2002, 62(23): 7093-7101.
[25] Del Valle L, White M K, Enam S, et al. Detection of JC virus DNA sequences and expression of viral T antigen and agnoprotein in esophageal carcinoma[J]. Cancer, 2005, 103(3): 516-527.
[26] Abdel-Aziz H O, Murai Y, Hong M, et al. Detection of the JC virus genome in lung cancers: possible role of the T-antigen in lung oncogenesis[J]. Applied Immunohistochemistry & Molecular Morphology, 2007, 15(4): 394-400.
[27] Gorish B M T. JC Polyoma Virus as a Possible Risk Factor for Prostate Cancer Development-Immunofluorescence and Molecular Based Case Control Study[J]. Cancer Control, 2022, 29: 10732748221140785.
[28] Bofill-Mas, S.; Clemente-Casares, P.; Major, E.O.; Curfman, B.; Gironés, R. Analysis of the excreted JC virus strains and their potential oral transmission. J. NeuroVirol. 2003, 9, 498–507.
[29] Hirsch HH, Kardas P, Kranz D, Leboeuf C: The human JC polyomavirus: virological background and clinical implications. Apmis 2013, 121(8):685-727.
[30] Shin J, Phelan P J, Chhum P, et al. Analysis of JC virus DNA replication using a quantitative and high-throughput assay[J]. Virology, 2014, 468: 113-125.
[31] Ryschkewitsch C F, Jensen P N, Major E O. Multiplex qPCR assay for ultrasensitive detection of JCV DNA with simultaneous identification of genotypes that discriminates non-virulent from virulent variants[J]. Journal of Clinical Virology, 2013, 57(3): 243-248.
[32] Sahragard I, Yaghobi R, Mohammadi A, et al. Impact of BK Polyomavirus NCCR variations in post kidney transplant outcomes[J]. Gene, 2024: 148376.
[33] Nakamichi K, Shimokawa T. Database and statistical analyses of transcription factor binding sites in the non-coding control region of JC virus[J]. Viruses, 2021, 13(11): 2314.
[34] Iannetta M, Bellizzi A, Lo Menzo S, et al. HIV-associated progressive multifocal leukoencephalopathy: longitudinal study of JC virus non-coding control region rearrangements and host immunity[J]. Journal of NeuroVirology, 2013, 19: 274-279.
[35] Schiller J T, Lowy D R. An introduction to virus infections and human cancer[J]. Viruses and human cancer: from basic science to clinical prevention, 2021: 1-11.
[36] Pipas J M. DNA tumor viruses and their contributions to molecular biology[J]. Journal of Virology, 2019, 93(9): 10.1128/jvi. 01524-18.
[37] Khatami A, Salavatiha Z, Razizadeh M H. Bladder cancer and human papillomavirus association: a systematic review and meta-analysis[J]. Infectious Agents and Cancer, 2022, 17(1): 3.
[38] Moens U, Van Ghelue M, Ehlers B: Are human polyomaviruses co‐factors for cancers induced by other oncoviruses? Reviews in Medical Virology 2014, 24(5):343-360.
[39] Stewart, Nancy, and S. Bacchetti. ”Expression of SV40 large T antigen, but not small t antigen, is required for the induction of chromosomal aberrations in transformed human cells.” 180.1(1991):49-57.
[40] Hopkins-Donaldson, Sally, et al. ”p53-induced apoptosis occurs in the absence of p14(ARF) in malignant pleural mesothelioma. ” Neoplasia 8.7(2006):551-559.
[41] Testa, Joseph R., and A. Giordano. ”SV40 and cell cycle perturbations in malignant mesothelioma.” Seminars in Cancer Biology 11.1(2001):31-38.
[42] Shin J, Phelan PJ, Chhum P, Bashkenova N, Yim S, Parker R, Gagnon D, Gjoerup O, Archambault J, Bullock PA: Analysis of JC virus DNA replication using a quantitative and high-throughput assay. Virology 2014, 468:113-125.
[43] Nakamichi K, Tajima S, Lim CK, Saijo M. High-resolution melting analysis for mutation scanning in the non-coding control region of JC Polyomavirus from patients with progressive multifocal leukoencephalopathy. Arch Virol. 2014;159(7):1687–96.
[44] Haghi Navand A, Jalilian S, Ahmadi Angali K, et al. A new evaluation of the rearranged non-coding control region of JC virus in patients with colorectal cancer[J]. BMC cancer, 2024, 24(1): 1001.
[45] WATANABE T,SH INOHARA N,MORIA K,et a1.Signicance of the GRB2 and son of sevenless (SoS ) proteins in human bladder cancer cell lines [J] .IUBMB Life,2000,49 (4 );317-320.
Information & Authors
Information
Version history
Copyright
This work is licensed under a Non Exclusive No Reuse License.