Full text
26,731 characters
· extracted from
preprint-html
· click to expand
Beating the gold standard: A review of Mycobacterium tuberculosis lysis using bead beating and the need for standardization | bioRxiv /* */ /* */ <!-- <!-- /*! * yepnope1.5.4 * (c) WTFPL, GPLv2 */ (function(a,b,c){function d(a){return"[object Function]"==o.call(a)}function e(a){return"string"==typeof a}function f(){}function g(a){return!a||"loaded"==a||"complete"==a||"uninitialized"==a}function h(){var a=p.shift();q=1,a?a.t?m(function(){("c"==a.t?B.injectCss:B.injectJs)(a.s,0,a.a,a.x,a.e,1)},0):(a(),h()):q=0}function i(a,c,d,e,f,i,j){function k(b){if(!o&&g(l.readyState)&&(u.r=o=1,!q&&h(),l.onload=l.onreadystatechange=null,b)){"img"!=a&&m(function(){t.removeChild(l)},50);for(var d in y[c])y[c].hasOwnProperty(d)&&y[c][d].onload()}}var j=j||B.errorTimeout,l=b.createElement(a),o=0,r=0,u={t:d,s:c,e:f,a:i,x:j};1===y[c]&&(r=1,y[c]=[]),"object"==a?l.data=c:(l.src=c,l.type=a),l.width=l.height="0",l.onerror=l.onload=l.onreadystatechange=function(){k.call(this,r)},p.splice(e,0,u),"img"!=a&&(r||2===y[c]?(t.insertBefore(l,s?null:n),m(k,j)):y[c].push(l))}function j(a,b,c,d,f){return q=0,b=b||"j",e(a)?i("c"==b?v:u,a,b,this.i++,c,d,f):(p.splice(this.i++,0,a),1==p.length&&h()),this}function k(){var a=B;return a.loader={load:j,i:0},a}var l=b.documentElement,m=a.setTimeout,n=b.getElementsByTagName("script")[0],o={}.toString,p=[],q=0,r="MozAppearance"in l.style,s=r&&!!b.createRange().compareNode,t=s?l:n.parentNode,l=a.opera&&"[object Opera]"==o.call(a.opera),l=!!b.attachEvent&&!l,u=r?"object":l?"script":"img",v=l?"script":u,w=Array.isArray||function(a){return"[object Array]"==o.call(a)},x=[],y={},z={timeout:function(a,b){return b.length&&(a.timeout=b[0]),a}},A,B;B=function(a){function b(a){var a=a.split("!"),b=x.length,c=a.pop(),d=a.length,c={url:c,origUrl:c,prefixes:a},e,f,g;for(f=0;f<d;f++)g=a[f].split("="),(e=z[g.shift()])&&(c=e(c,g));for(f=0;f<b;f++)c=x[f](c);return c}function g(a,e,f,g,h){var i=b(a),j=i.autoCallback;i.url.split(".").pop().split("?").shift(),i.bypass||(e&&(e=d(e)?e:e[a]||e[g]||e[a.split("/").pop().split("?")[0]]),i.instead?i.instead(a,e,f,g,h):(y[i.url]?i.noexec=!0:y[i.url]=1,f.load(i.url,i.forceCSS||!i.forceJS&&"css"==i.url.split(".").pop().split("?").shift()?"c":c,i.noexec,i.attrs,i.timeout),(d(e)||d(j))&&f.load(function(){k(),e&&e(i.origUrl,h,g),j&&j(i.origUrl,h,g),y[i.url]=2})))}function h(a,b){function c(a,c){if(a){if(e(a))c||(j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}),g(a,j,b,0,h);else if(Object(a)===a)for(n in m=function(){var b=0,c;for(c in a)a.hasOwnProperty(c)&&b++;return b}(),a)a.hasOwnProperty(n)&&(!c&&!--m&&(d(j)?j=function(){var a=[].slice.call(arguments);k.apply(this,a),l()}:j[n]=function(a){return function(){var b=[].slice.call(arguments);a&&a.apply(this,b),l()}}(k[n])),g(a[n],j,b,n,h))}else!c&&l()}var h=!!a.test,i=a.load||a.both,j=a.callback||f,k=j,l=a.complete||f,m,n;c(h?a.yep:a.nope,!!i),i&&c(i)}var i,j,l=this.yepnope.loader;if(e(a))g(a,0,l,0);else if(w(a))for(i=0;i (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0];var j=d.createElement(s);var dl=l!='dataLayer'?'&l='+l:'';j.src='//www.googletagmanager.com/gtm.js?id='+i+dl;j.type='text/javascript';j.async=true;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-M677548'); Skip to main content Home About Submit ALERTS / RSS Search for this keyword Advanced Search New Results Beating the gold standard: A review of Mycobacterium tuberculosis lysis using bead beating and the need for standardization View ORCID Profile Jason D Limberis , John Z Metcalfe doi: https://doi.org/10.1101/2025.07.07.663234 Jason D Limberis 1 Division of Pulmonary and Critical Care Medicine, Zuckerberg San Francisco General Hospital and Trauma Centre, University of California , San Francisco, San Francisco, CA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site ORCID record for Jason D Limberis For correspondence: jason.limberis{at}ucsf.edu John Z Metcalfe 1 Division of Pulmonary and Critical Care Medicine, Zuckerberg San Francisco General Hospital and Trauma Centre, University of California , San Francisco, San Francisco, CA, USA Find this author on Google Scholar Find this author on PubMed Search for this author on this site Abstract Full Text Info/History Metrics Preview PDF Abstract Bead beating is widely used for mechanical lysis of Mycobacterium tuberculosis , a bacterium with a highly resistant, lipid-rich cell wall. Despite its status as a de facto gold standard for mycobacterial lysis, there is no standardized protocol for bead beating, resulting in significant variability across studies. We conducted a literature review of 73 studies, identifying 38 with explicit mycobacterial bead beating protocols. Our analysis revealed heterogeneity in bead types, sizes, device models, and operational parameters, with 37% of studies failing to report critical details such as lysis speed. We experimentally assessed the impact of key variables—tube type, bead quantity, and device settings—on lysis efficiency using qPCR of M. tuberculosis DNA. Results showed that even minor changes, such as tube shape or bead volume, can significantly affect DNA yield. These findings underscore the need for standardized bead-beating protocols to improve reproducibility and comparability. Future efforts should prioritize developing consensus methods tailored to sample type and analytical application. Main Text Researchers commonly use bead beating to mechanically disrupt cells by agitating small beads at high speed. It is considered the gold standard Mycobacterial cell lysing due to their robust, mycolic acid-rich cell walls that are resistant to chemical disruption. Recently, the Gates Foundation Global Grand Challenges stated in their Enhancing HIV and TB Diagnosis application call: “The solution must break open the MTB cells (>50% lysis efficiency compared to mechanical lysis via bead beating or sonication) without damaging target DNA.” 1 But there is no standardization for bead beating with different bead sizes, tube sizes and types, bead beating devices, shaking speed (measured in RPM, Hz, oscillations.min −1 or m.s −1 ), duration, rest time between cycles, and total number of cycles. We performed a literature review on PubMed on June 29th, 2025, using the search term “(bead-beater) OR (bead-beating) OR (beadbeater) OR (bead beater) OR (bead beating) OR (bead homogenizer) OR ribolysis OR (MP bio) OR (MP Biomedicals) OR MPBio OR beadbug OR (BioSpec Products) OR (Bullet Blender) OR (Mechanical lysis) OR (bead ruptor) AND (mycobacterium OR tuberculosis OR m tuberculosis OR Mtb)”. This search yielded 73 papers, of which 38 included mycobacterial bead beating protocols ( Table 1 ). View this table: View inline View popup Download powerpoint Table 1: Bead beating parameters for Mycobacterium tuberculosis lysis reported in the literature. NA indicates not applicable (single cycle protocols); “Not stated” means the parameter was not specified in the original study. Our literature review revealed significant heterogeneity in bead beating parameters. Zirconium predominated the bead material (77%), while 0.1mm beads were the most common bead size (63%). Researchers most frequently used Mini-beadbeater devices from Biospec Products (60%), followed by the MP Bio FastPrep series (20%). Treatment durations typically ranged from 30-300 seconds, and sample volumes ranged from 50-1000μl (excluding one study with a sample volume of 350ml). We found critical gaps in parameter reporting. Thirty-seven percent of studies failed to report speed parameters, and those that did used inconsistent units, making direct comparisons difficult. This lack of standardization hinders reproducibility and cross-study comparisons. Multiple factors that we found to be poorly reported likely affect bacterial lysis efficiency, including tube shape, tube orientation, bead volume, liquid volume, bacterial count, bead type and size, and oscillation speed ( Table 1 ). To test this hypothesis, we selected representative parameters for which we had device access. We used Mycobacterium tuberculosis MC 2 7901 at 500 000 CFU/ml in 10mM Tris-HCl buffer and performed bead beating using 0.1mm zirconium/silica beads (Biospec Products, USA) as outlined in Table 2 , with six replicates per condition. We centrifuged the tubes at 16 000RCF for 5 minutes following bead beating, and 2µl of supernatant was used for a qPCR assay in quadruplicates. We performed reactions in 10μl volumes using Luna Universal qPCR master mix (NEB, USA) targeting atpE with the following primers and probe: “GTAACGCGCTTATCTCCGGT”,“AGTATGCCGCCTCAACCAAA”,and“5’-VIC-CAACCCGAGGCGCAAGGGC-MGB-3’”.We calculated relative quantities using FastPrep-24 at 6.5m.s? 1 for two cycles of 45s in a 1.5ml tube containing 200mg 0.1mm Zirconium beads and 600µl of sample as the reference condition. The relative quantification formula was: RQ = 2^(−ΔΔCt), where ΔΔCt = ΔCt(test samples) − ΔCt(reference samples) and ΔCt = Ct(target gene) − Ct(reference gene). We calculated differences between groups using pairwise Wilcoxon tests with Bonferroni correction for multiple comparisons. View this table: View inline View popup Download powerpoint Table 2: Bead beating conditions used in this study. Several samples showed substantially different DNA amounts ( Figure 1 ). The 2ml tubes yielded a relative quantity of only 0.2 (IQR 0.08, 0.37), probably due to their differing shape compared to the reference tubes. Somewhat counterintuitively, bead beating with fewer beads increased the detectable DNA nearly 4-fold. This finding highlights how seemingly minor parameter variations can dramatically affect results. Our findings demonstrate that many factors affect bead-beating efficiency. Furthermore, this technique lacks standardization beyond mycobacterial applications, and extraction methods introduce significant bias in microbiome profiling. Zymogen developed the ZymoBIOMICS Microbial Community Standard to address standardization challenges. 2 This mixed microbial community contains well-defined ratios of three easy-to-lyse Gram-negative bacteria ( Pseudomonas aeruginosa, Escherichia coli , and Salmonella enterica ), five tough-to-lyse Gram-positive bacteria ( Listeria monocytogenes, Bacillus subtilis, Lactobacillus fermentum, Enterococcus faecalis , and Staphylococcus aureus ), and two tough-to-lyse yeasts ( Saccharomyces cerevisiae and Cryptococcus neoformans ). Zymogen recommends using their 2ml BashingBead tubes containing 0.6ml dry volume of mixed 0.5mm and 0.1mm ZR BashingBead lysis matrix. Their protocol involves bead beating for 1 minute at 6.5m.s -1 for five cycles with 5-minute rests between cycles using the MP Bio Fastprep-24 (Classic or 5G) or the Biospec Mini-BeadBeater-16, and for 5 minutes at maximum speed for four cycles with 5-minute rests between cycles using the Biospec Mini-BeadBeater-96 with 2ml tubes. In the product manuals, BioSpec recommends using 0.1mm beads (quantity not reported) and using up to 400mg of wet weight biomaterial per ml of buffer and running for 2-3 minutes using the Mini-beadbeater-16 (single speed of 3450 oscillations.min −1 ); while MPBio recommends using Lysing Matrix A (Garnet matrix and one 6.35mm ceramic sphere), B (0.1mm silica spheres), F (1.6mm aluminum oxide and silicon carbide particles), or J (2mm yellow zirconia beads and 1.6mm aluminum oxide particles) for bacterial lysis and two rounds of 6m.s -1 for 45s with a 5min rest period for mycobacterial cell lysis using the FastPrep-24 5G. 3 , 4 Download figure Open in new tab Figure 1: Many variables affect the lysis of Mycobacterium tuberculosis by bead-beating. qPCR on lysates from six different bead-beating conditions are shown. We set FastPrep-24 at 6.5m.s -1 for two cycles of 45s in a 1.5ml tube containing 200mg 0.1mm zirconium beads and 600µl of sample as the reference condition for relative quantification calculations. Box plots show the distribution of relative quantification values, with the center line representing the median, boxes showing the interquartile range (IQR), and whiskers extending to 1.5 times the IQR and diamonds at the mean. The dashed horizontal line at y=1 represents the mean quantification level of the standard protocol. Statistical significance was determined using pairwise Wilcoxon tests with Bonferroni correction for multiple comparisons (* p ≤ 0.05, ** p ≤ 0.01, *** p ≤ 0.001, **** p ≤ 0.0001). There is a need to compare and standardize bead-beating protocols for mycobacteria across different sample types (sputum, tissue, blood, environmental samples) and analytical purposes (PCR, sequencing, proteomics). Our findings demonstrate that seemingly minor parameter variations—such as tube geometry, bead quantity, and device selection—can dramatically alter lysis efficiency. Without standardized protocols, researchers cannot reliably compare results across studies or laboratories, hindering progress. Future work should thus focus on developing consensus protocols that account for the multiple variables affecting lysis efficiency while maintaining reproducibility across different laboratory settings and analytical applications. References 1. ↵ Enhancing HIV and TB Diagnosis: Adjunct Technologies for Sam . Accessed June 27, 2025 . https://gcgh.grandchallenges.org/challenge/enhancing-hiv-and-tb-diagnosis-adjunct-technologies-sample-collection-and-processing 2. ↵ ZymoBIOMICS Microbial Community Standard . Accessed June 30, 2025 . https://www.zymoresearch.com/products/zymobiomics-microbial-community-standard?srsltid=AfmBOooJ4_HKB7yXvYFe4jKIpXnlwmhnX_M7ywdnjvcrqJ2yA31Evevb 3. ↵ FastPrep ® System The Ultimate Grinding and Cell Lysis Technology Delivering the Most DNA, RNA and Proteins from Any Sample Type in Just Seconds! Higher Yields Consistent Quality Super Fast . Accessed July 1, 2025 . www.mpbio.com 4. ↵ Miller-Martin LR . MP Biomedicals, LLC FastPrep-24 TM 5G Instruction Manual (v2.7) . Accessed July 1, 2025 . https://www.mpbio.com 5. Hurley Splitter SSGA , Welch RA . Rapid lysis technique for mycobacterial species . J Clin Microbiol . 1987 ; 25 ( 11 ): 2227 – 2229 . doi: 10.1128/JCM.25.11.2227-2229.1987 OpenUrl Abstract / FREE Full Text 6. Rantakokko-Jalava K , Jalava J. Optimal DNA isolation method for detection of bacteria in clinical specimens by broad-range PCR . J Clin Microbiol . 2002 ; 40 ( 11 ): 4211 – 4217 . doi: 10.1128/JCM.40.11.4211-4217.2002/ASSET/2F3A145D-A550-4389-B948-8BDF4BAA6E05/ASSETS/GRAPHIC/JM1120610002.JPEG OpenUrl Abstract / FREE Full Text 7. Jaki BU , Franzblau SG , Cho SH , Pauli GF . Development of an extraction method for mycobacterial metabolome analysis . J Pharm Biomed Anal . 2006 ; 41 ( 1 ): 196 – 200 . doi: 10.1016/J.JPBA.2005.10.022 OpenUrl CrossRef PubMed Web of Science 8. Lucas M , Ryan JM , Watkins J , et al. Extraction and Separation of Mycobacterial Proteins . Methods in Molecular Biology . 2021 ; 2314 : 77 – 107 . doi: 10.1007/978-1-0716-1460-0_3/FIGURES/6 OpenUrl CrossRef PubMed 9. Ma S , Bryson BD , Sun C , Fortune SM , Lu C. RNA Extraction from a Mycobacterium under Ultrahigh Electric Field Intensity in a Microfluidic Device . Anal Chem . 2016 ; 88 ( 10 ): 5053 – 5057 . doi: 10.1021/ACS.ANALCHEM.6B00381/SUPPL_FILE/AC6B00381_SI_002.AVI OpenUrl CrossRef 10. Epperson LE , Strong M. A scalable, eHicient, and safe method to prepare high quality DNA from mycobacteria and other challenging cells . J Clin Tuberc Other Mycobact Dis . 2020 ; 19 : 100150 . doi: 10.1016/J.JCTUBE.2020.100150 OpenUrl CrossRef PubMed 11. Acharya KR , Dhand NK , Whittington RJ , Plain KM . Culture-Independent Identification of Mycobacterium avium Subspecies paratuberculosis in Ovine Tissues: Comparison with Bacterial Culture and Histopathological Lesions . Front Vet Sci . 2017 ; 4 : 232 . doi: 10.3389/FVETS.2017.00232 OpenUrl CrossRef PubMed 12. Ravva S V. , Harden LA , Sarreal CZ . Characterization and diHerentiation of mycobacterium avium subsp. Paratuberculosis from other mycobacteria using matrix assisted laser desorption/ionization time-of-flight mass spectrometry . Front Cell Infect Microbiol . 2017 ; 7 ( JUN ): 264662 . doi: 10.3389/FCIMB.2017.00297/BIBTEX OpenUrl CrossRef 13. Rabodoarivelo MS , Aerts M , Vandamme P , Palomino JC , Rasolofo V , Martin A. Optimizing of a protein extraction method for Mycobacterium tuberculosis proteome analysis using mass spectrometry . J Microbiol Methods . 2016 ; 131 : 144 – 147 . doi: 10.1016/J.MIMET.2016.10.021 OpenUrl CrossRef PubMed 14. Madiraju MVVS , Qin MH , Rajagopalan M. Development of simple and eHicient protocol for isolation of plasmids from mycobacteria using zirconia beads . Lett Appl Microbiol . 2000 ; 30 ( 1 ): 38 – 41 . doi: 10.1046/J.1472-765X.2000.00619.X OpenUrl CrossRef PubMed 15. Lanigan MD , Vaughan JA , Shiell BJ , Beddome GJ , Michalski WP . Mycobacterial proteome extraction: Comparison of disruption methods . Proteomics . 2004 ; 4 ( 4 ): 1094 – 1100 . doi: 10.1002/PMIC.200300672 OpenUrl CrossRef PubMed Web of Science 16. Hiebert MR , Sharma MK , Go A , et al. RNA extraction and RNA-sequencing method for transcriptomic analysis of Mycobacterium tuberculosis . Biotechniques . 2025 ; 77 ( 1 ): 23 – 34 . doi: 10.1080/07366205.2025.2457887 OpenUrl CrossRef PubMed 17. Vandeventer PE , Weigel KM , Salazar J , et al. Mechanical disruption of lysis-resistant bacterial cells by use of a miniature, low-power, disposable device . J Clin Microbiol . 2011 ; 49 ( 7 ): 2533 – 2539 . doi: 10.1128/JCM.02171-10/SUPPL_FILE/SUPPLEMENTARYMATERIAL_FINAL.PDF OpenUrl Abstract / FREE Full Text 18. Kim M , Wu L , Kim B , Hung DT , Han J. Continuous and High-throughput Electromechanical Lysis of Bacterial Pathogens using Ion Concentration Polarization . Anal Chem . 2017 ; 90 ( 1 ): 872 . doi: 10.1021/ACS.ANALCHEM.7B03746 OpenUrl CrossRef 19. Herthnek D , Englund S , Willemsen PTJ , Bölske G. Sensitive detection of Mycobacterium avium subsp. paratuberculosis in bovine semen by real-time PCR . J Appl Microbiol . 2006 ; 100 ( 5 ): 1095 – 1102 . doi: 10.1111/J.1365-2672.2006.02924.X OpenUrl CrossRef PubMed 20. De Bruin OM , Birnboim HC . A method for assessing eHiciency of bacterial cell disruption and DNA release . BMC Microbiol . 2016 ; 16 ( 1 ): 1 – 10 . doi: 10.1186/S12866-016-0815-3/TABLES/2 OpenUrl CrossRef PubMed 21. Heiniger EK , Buser JR , Mireles L , et al. Comparison of point-of-care-compatible lysis methods for bacteria and viruses . J Microbiol Methods . 2016 ; 128 : 80 – 87 . doi: 10.1016/J.MIMET.2016.07.007 OpenUrl CrossRef PubMed 22. Blackwood KS , Burdz T V. , Turenne CY , Sharma MK , Kabani AM , Wolfe JN . Viability testing of material derived from Mycobacterium tuberculosis prior to removal from a Containment Level-III Laboratory as part of a Laboratory Risk Assessment Program . BMC Infect Dis . 2005 ; 5 : 4 . doi: 10.1186/1471-2334-5-4 OpenUrl CrossRef PubMed 23. Mühlig A , Bocklitz T , Labugger I , et al. LOC-SERS: A promising closed system for the identification of mycobacteria . Anal Chem . 2016 ; 88 ( 16 ): 7998 – 8004 . doi: 10.1021/ACS.ANALCHEM.6B01152/SUPPL_FILE/AC6B01152_SI_001.PDF OpenUrl CrossRef 24. de Bruin OM , Chiefari A , Wroblewski D , Egan C , Kelly-Cirino CD . A novel chemical lysis method for maximum release of DNA from diHicult-to-lyse bacteria . Microb Pathog . 2019 ; 126 : 292 – 297 . doi: 10.1016/J.MICPATH.2018.11.008 OpenUrl CrossRef PubMed 25. Tell LA , Foley J , Needham ML , Walker RL . Comparison of Four Rapid DNA Extraction Techniques for Conventional Polymerase Chain Reaction Testing of Three Mycobacterium spp. that AHect Birds . 101637/7070. 2003 ; 47 ( 4 ):p1486-1490. doi: 10.1637/7070 OpenUrl CrossRef PubMed 26. Adams LL , Salee P , Dionne K , Carroll K , Parrish N. A novel protein extraction method for identification of mycobacteria using MALDI-ToF MS . J Microbiol Methods . 2015 ; 119 : 1 – 3 . doi: 10.1016/J.MIMET.2015.09.010 OpenUrl CrossRef PubMed 27. Toney NC , Zhu W , Jensen B , et al. Evaluation of MALDI Biotyper Mycobacteria Library for Identification of Nontuberculous Mycobacteria . J Clin Microbiol . 2022 ; 60 ( 9 ). doi: 10.1128/JCM.00217-22/SUPPL_FILE/JCM.00217-22-S0001.PDF OpenUrl CrossRef 28. Hermans N , de Zwaan R , Mulder A , et al. Mycobacterium tuberculosis complex sample processing by mechanical lysis, an essential step for reliable whole genome sequencing . J Microbiol Methods . 2024 ; 227 : 107053 . doi: 10.1016/J.MIMET.2024.107053 OpenUrl CrossRef PubMed 29. Bacanelli G , Araujo FR , Verbisck NV . Improved MALDI-TOF MS Identification of Mycobacterium tuberculosis by Use of an Enhanced Cell Disruption Protocol . Microorganisms . 2023 ; 11 ( 7 ): 1692 . doi: 10.3390/MICROORGANISMS11071692 OpenUrl CrossRef PubMed 30. Michael Dunne W , Doing K , Miller E , et al. Rapid Inactivation of Mycobacterium and Nocardia Species before identification using matrix-assisted laser desorption ionization-time of flight mass spectrometry . J Clin Microbiol . 2014 ; 52 ( 10 ): 3654 – 3659 . doi: 10.1128/JCM.01728-14/ASSET/E4DA41D7-E8DE-46FF-9573-CF6002D4AED5/ASSETS/GRAPHIC/ZJM9990937560003.JPEG OpenUrl Abstract / FREE Full Text 31. Radomski N , Kreitmann L , McIntosh F , Behr MA . The Critical Role of DNA Extraction for Detection of Mycobacteria in Tissues . PLoS One . 2013 ; 8 ( 10 ): e78749 . doi: 10.1371/JOURNAL.PONE.0078749 OpenUrl CrossRef PubMed 32. Plain KM , Waldron AM , Begg DJ , De Silva K , Purdie AC , Whittington RJ . EHicient, validated method for detection of mycobacterial growth in liquid culture media by use of bead beating, magnetic-particle-based nucleic acid isolation, and quantitative PCR . J Clin Microbiol . 2015 ; 53 ( 4 ): 1121 – 1128 . doi: 10.1128/JCM.03521-14/ASSET/CF0936D9-FFFC-4AD3-BBB8-B93213291D3F/ASSETS/GRAPHIC/ZJM9990941180005.JPEG OpenUrl Abstract / FREE Full Text 33. Rezwan M , Lanéelle MA , Sander P , DaHé M. Breaking down the wall: Fractionation of mycobacteria . J Microbiol Methods . 2007 ; 68 ( 1 ): 32 – 39 . doi: 10.1016/J.MIMET.2006.05.016 OpenUrl CrossRef PubMed 34. Cook KL , Britt JS . Optimization of methods for detecting Mycobacterium avium subsp. paratuberculosis in environmental samples using quantitative, real-time PCR . J Microbiol Methods . 2007 ; 69 ( 1 ): 154 – 160 . doi: 10.1016/J.MIMET.2006.12.017 OpenUrl CrossRef PubMed Web of Science 35. Amaro A , Duarte E , Amado A , Ferronha H , Botelho A. Comparison of three DNA extraction methods for Mycobacterium bovis, Mycobacterium tuberculosis and Mycobacterium avium subsp. avium . Lett Appl Microbiol . 2008 ; 47 ( 1 ): 8 – 11 . doi: 10.1111/J.1472-765X.2008.02372.X OpenUrl CrossRef PubMed Web of Science 36. Thirumalapura NR , Feria W , Hue E , Zellers C , Tewari D. Evaluation of a high-throughput nucleic acid extraction method for the detection of Mycobacterium avium subsp. paratuberculosis in bovine fecal samples by PCR . J Vet Diagn Invest . 2021 ; 33 ( 2 ): 375 . doi: 10.1177/1040638721991118 OpenUrl CrossRef PubMed 37. Zinniel DK , Fenton RJ , Halouska S , Powers R , Barletta RG . Sample Preparation of Mycobacterium tuberculosis Extracts for Nuclear Magnetic Resonance Metabolomic Studies . J Vis Exp . 2012 ;( 67 ): 3673 . doi: 10.3791/3673 OpenUrl CrossRef 38. Leite FL , Stokes KD , Robbe-Austerman S , Stabel JR . Comparison of fecal DNA extraction kits for the detection of Mycobacterium avium subsp. paratuberculosis by polymerase chain reaction . Journal of Veterinary Diagnostic Investigation . 2013 ; 25 ( 1 ): 27 – 34 . doi: 10.1177/1040638712466395 OpenUrl CrossRef PubMed 39. Plain KM , Marsh IB , Waldron AM , et al. High-throughput direct fecal PCR assay for detection of Mycobacterium avium subsp. Paratuberculosis in sheep and cattle . J Clin Microbiol . 2014 ; 52 ( 3 ): 745 – 757 . doi: 10.1128/JCM.03233-13/SUPPL_FILE/ZJM999093173SO1.PDF OpenUrl Abstract / FREE Full Text 40. Dziri S , Marin J , Quagliaro P , et al. Optimization of Mycobacterium tuberculosis DNA processing prior to whole genome sequencing . Tuberculosis . 2024 ; 148 : 102543 . doi: 10.1016/J.TUBE.2024.102543 OpenUrl CrossRef PubMed 41. Bazzi AM , Sunki AA , Hamdi MJ , Khaldi AO , Al-Tawfiq JA . Direct identification of Mycobacterium species from liquid medium (MGIT) using FastPrep-2 bead beating system and MALDI-TOF mass spectrometry technology: a comparison with solid media and PCR-based method . Pract Lab Med . 2025 ; 46 : e00479 . doi: 10.1016/J.PLABM.2025.E00479 OpenUrl CrossRef View the discussion thread. Back to top Previous Next Posted July 07, 2025. Download PDF Email Thank you for your interest in spreading the word about bioRxiv. NOTE: Your email address is requested solely to identify you as the sender of this article. Your Email * Your Name * Send To * Enter multiple addresses on separate lines or separate them with commas. You are going to email the following Beating the gold standard: A review of Mycobacterium tuberculosis lysis using bead beating and the need for standardization Message Subject (Your Name) has forwarded a page to you from bioRxiv Message Body (Your Name) thought you would like to see this page from the bioRxiv website. Your Personal Message CAPTCHA This question is for testing whether or not you are a human visitor and to prevent automated spam submissions. Share Beating the gold standard: A review of Mycobacterium tuberculosis lysis using bead beating and the need for standardization Jason D Limberis , John Z Metcalfe bioRxiv 2025.07.07.663234; doi: https://doi.org/10.1101/2025.07.07.663234 Share This Article: Copy Citation Tools Beating the gold standard: A review of Mycobacterium tuberculosis lysis using bead beating and the need for standardization Jason D Limberis , John Z Metcalfe bioRxiv 2025.07.07.663234; doi: https://doi.org/10.1101/2025.07.07.663234 Citation Manager Formats BibTeX Bookends EasyBib EndNote (tagged) EndNote 8 (xml) Medlars Mendeley Papers RefWorks Tagged Ref Manager RIS Zotero Tweet Widget Facebook Like Google Plus One Subject Area Molecular Biology Subject Areas All Articles Animal Behavior and Cognition (7642) Biochemistry (17715) Bioengineering (13907) Bioinformatics (42003) Biophysics (21470) Cancer Biology (18624) Cell Biology (25533) Clinical Trials (138) Developmental Biology (13390) Ecology (19935) Epidemiology (2067) Evolutionary Biology (24356) Genetics (15617) Genomics (22529) Immunology (17753) Microbiology (40432) Molecular Biology (17200) Neuroscience (88681) Paleontology (667) Pathology (2840) Pharmacology and Toxicology (4828) Physiology (7653) Plant Biology (15161) Scientific Communication and Education (2046) Synthetic Biology (4304) Systems Biology (9826) Zoology (2271)
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.