Tet1-mediated 5hmC regulates hippocampal neuroinflammation via wnt signaling as a novel mechanism in obstructive sleep apnoea leads to cognitive deficit

preprint OA: closed
Full text JSON View at publisher

Abstract

Abstract Background: Obstructive sleep apnoea (OSA) is a sleep-disordered breathing characterized by intermittent hypoxia (IH) that may cause cognitive dysfunction. However, the impact of IH on molecular processes involved in cognitive function remains unclear. Methods: C57BL / 6J mice were exposed to either normoxia (control) or IH for 6 weeks. DNA hydroxymethylation was quantified by hydroxymethylated DNA immunoprecipitation (hMeDIP) sequencing. ten-eleven translocation 1 (Tet1) was knocked down by lentivirus. Specifically, cognitive function was assessed by behavioral experiments, pathological features were assessed by HE staining, the hippocampal DNA hydroxymethylation was examined by DNA dot blot and immunohistochemical staining, while the Wnt signaling pathway and its downstream effects were studied using qRT-PCR, immunofluorescence staining, and Luminex liquid suspension chip analysis. Results: IH mice showed pathological changes and cognitive dysfunction in the hippocampus. Compared with the control group, IH mice exhibited global DNA hydroxylmethylation in the hippocampus, and the expression of three hydroxylmethylases increased significantly. The Wnt signaling pathway was activated, and the mRNA and 5hmC levels of Wnt3a, Ccnd2, and Prickle2 were significantly up-regulated. Further caused downstream neurogenesis abnormalities and neuroinflammatory activation, manifested as increased expression of IBA1 (a marker of microglia), GFAP (a marker of astrocytes), and DCX (a marker of immature neurons), as well as a range of inflammatory cytokines (e.g. TNF-a, IL-3, IL-9, and IL-17A). After Tet1 knocked down, the above indicators return to normal. Conclusion: Activation of Wnt signaling pathway by hippocampal Tet1 is associated with cognitive dysfunction induced by IH.
Full text 188,440 characters · extracted from preprint-html · click to expand
Tet1-mediated 5hmC regulates hippocampal neuroinflammation via wnt signaling as a novel mechanism in obstructive sleep apnoea leads to cognitive deficit | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Tet1-mediated 5hmC regulates hippocampal neuroinflammation via wnt signaling as a novel mechanism in obstructive sleep apnoea leads to cognitive deficit yaru kong, Jie Ji, Xiaojun Zhan, Weiheng Yan, Fan Liu, Pengfei Ye, and 2 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4251801/v1 This work is licensed under a CC BY 4.0 License Status: Published Journal Publication published 21 Aug, 2024 Read the published version in Journal of Neuroinflammation → Version 1 posted 11 You are reading this latest preprint version Abstract Background: Obstructive sleep apnoea (OSA) is a sleep-disordered breathing characterized by intermittent hypoxia (IH) that may cause cognitive dysfunction. However, the impact of IH on molecular processes involved in cognitive function remains unclear. Methods: C57BL / 6J mice were exposed to either normoxia (control) or IH for 6 weeks. DNA hydroxymethylation was quantified by hydroxymethylated DNA immunoprecipitation (hMeDIP) sequencing. ten-eleven translocation 1 ( Tet1) was knocked down by lentivirus. Specifically, cognitive function was assessed by behavioral experiments, pathological features were assessed by HE staining, the hippocampal DNA hydroxymethylation was examined by DNA dot blot and immunohistochemical staining, while the Wnt signaling pathway and its downstream effects were studied using qRT-PCR, immunofluorescence staining, and Luminex liquid suspension chip analysis. Results: IH mice showed pathological changes and cognitive dysfunction in the hippocampus. Compared with the control group, IH mice exhibited global DNA hydroxylmethylation in the hippocampus, and the expression of three hydroxylmethylases increased significantly. The Wnt signaling pathway was activated, and the mRNA and 5hmC levels of Wnt3a, Ccnd2, and Prickle2 were significantly up-regulated. Further caused downstream neurogenesis abnormalities and neuroinflammatory activation, manifested as increased expression of IBA1 (a marker of microglia), GFAP (a marker of astrocytes), and DCX (a marker of immature neurons), as well as a range of inflammatory cytokines (e.g. TNF-a, IL-3, IL-9, and IL-17A). After Tet1 knocked down, the above indicators return to normal. Conclusion: Activation of Wnt signaling pathway by hippocampal Tet1 is associated with cognitive dysfunction induced by IH. 5hmC1 IH2 Tet1 3 Wnt pathway4 hippocampus5 Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Introduction Obstructive sleep apnoea (OSA) is the most common type of sleep-disordered breathing, affecting approximately 1 billion adults worldwide; the largest number of OSA in China [ 1 ]. OSA is characterized by recurrent upper airway obstruction during sleep, resulting in intermittent hypoxia (IH), sleep fragmentation, further systemic inflammation and oxidative stress [ 2 ]. Untreated OSA is widely recognized to be associated with an increased risk of hypertension [ 3 ], diabetes [ 4 ], and cognitive dysfunction [ 5 ], leading to substantial health and social burdens. In particular, the consequences of cognitive dysfunction, which includes impaired neurodevelopment in children [ 6 , 7 ] and neurodegenerative diseases in elderly individuals [ 8 ], have received extensive attention in recent years. Cognitive dysfunction in OSA patients may be related to regional hippocampal volume changes; an increase in the volume suggests inflammation and glial activation and a decrease in volume may be a result of long-term neuronal damage [ 9 ]. IH may play a central role in causing attention, memory and executive function impairment in OSA patients [ 10 ]. In vivo experiments have demonstrated that IH can drive cognitive dysfunction through microglia-mediated hippocampal inflammatory injury in mice [ 11 ]. However, the specific molecular mechanism involved is unclear. DNA methylation, one of the most studied epigenetic modifications, occurs at the 5-carbon position of cytosine residues to generate 5-methylcytosine (5mC), which was once considered to be stable [ 12 ]. The ten-eleven translocation (TET) enzymes TET1-3 are members of the 2-oxoglutarate-dependent dioxygenase (2-OGDD) family and oxidize DNA 5mC to 5-hydroxymethylcytosine (5hmC), suggesting a novel mechanism for DNA demethylation [ 13 , 14 ]. The importance of 5hmc-mediated epigenetic modifications in physiological processes is being revealed, as it dynamically regulates development and aging, and its dysregulation induces tumours and neurodegenerative diseases [ 15 – 19 ]. While the levels of 5mC are comparable across organs throughout the body, the distribution of 5hmC varies depending on tissue or cell type, with particularly high levels in neurons in the central nervous system (CNS) [ 20 ]. Therefore, TETs mediated DNA hydroxymethylation may be involved in regulating neuronal activity and cognitive processes. TET1 has been found to be the most characterized member of the TET family involved in learning and memory; however, this phenomenon is also controversial [ 21 ]. Both the loss and overexpression of Tet1 have been reported to enhance or impair memory, which may be related to the cell type specificity of TET1 [ 22 – 27 ]. For instance, knockdown of Tet1 specifically in astrocytes resulted in abnormal neuronal development and impaired cognitive function in the hippocampus of mice [ 23 ]. However, Tet1 overexpression in hippocampal CA1 pyramidal cells contributed to long-term memory impairment after episodic fear conditioning [ 24 ]. Although it is well established that TET requires oxygen for catalytic activity, the data reported on the response of TET to hypoxia are conflicting. In a variety of tumour cells, hypoxia can directly reduce the oxidative activity of TETs to promote DNA demethylation [ 28 , 29 ]. However, hypoxia increases Tet1 expression and 5hmC levels in certain types of cells, such as neuroblastoma [ 28 , 30 ] and glioblastoma cells [ 31 ], probably because Tet1 coactivates with HIF independently of enzymatic activity [ 30 , 32 , 33 ]. To date, changes in Tet1 and 5hmC in the hippocampus and their effects on cognitive function in IH patients have not been studied. Here, we assessed the role of DNA demethylation in cognitive dysfunction in IH mice. In addition, the therapeutic effect of hippocampal-specific knockdown of Tet1 was investigated. This study aims to reveal the neuroinflammation -related molecular regulatory mechanism of OSA whit cognitive dysfunction from the perspective of Wnt signaling activation in hippocampal microglia. Materials and methods Animals 8-week-old male BALB/c mice, weighing 18–20 g, were purchased from Beijing Shenghe Experimental Animal Technology Co., Ltd. The mice were kept at a specific pathogen-free condition of 18–26 ℃ and 40–70% humidity, accompanied by a standard light-dark cycle. Experiments were performed in strict accordance with institutional ethical codes and were approved by the Animal Care and Use Ethics Committee of the Capital Institute of Pediatrics (DWLL2021016). Cell culture and transfection Human embryonic kidney cell line 293T and mouse brain neuroma cell line N2A were obtained from the Capital Institute of Pediatrics Cell Bank. The cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, USA) with 10% fetal bovine serum (FBS; Gibco), 100 µg/mL penicillin and 100 µg/mL streptomycin (Gibco) at 37°C and 5% CO 2 . To interfere the expression of Tet1 , a shRNA interference sequence targeting Tet1 (5'-3': GCAATCAGTTAGCAGACTTGA) was designed and synthesized and named shTet1 . The negative control virus was named shNC. These are purchased from Genechem (Shanghai, China). 293Ts were used for infections with a MOI of 1. N2As were used for infections with a MOI of 20. 72 h after transfection, the relative amount of green fluorescence in 293Ts was observed under a high-content microscope (Theo Fisher, USA), and N2As were collected for PCR identification. Group, modeling and treatment Group After three days of acclimatization to the new environment, a total of 80 mice were randomly divided into 4 groups (n = 20/group): control group, IH group, IH + shNC group, and IH + sh Tet1 group. Modeling IH group, IH + shNC group, and IH + sh Tet1 group were exposed to IH for 6 weeks using a hyperbaric oxygen chamber (Beijing Zhongshi Dichuang Technology Development Co., Ltd., China). The IH mode was 1 min alternating cycle (oxygen concentration 5%-21%) for 8 h / d (8:00 am to 4:00 pm) [ 34 ]. The control group was maintained in room air. At the end of the 4th week, the body weight and the hippocampal partial pressure of oxygen (PaO 2 ) were measured in the control and IH groups. Treatment After 4 weeks of IH treatment, IH + shNC and IH + sh Tet1 mice were injected with shNC and sh Tet1 in the hippocampus, respectively. In brief, mice were anesthetized with isoflurane and fixed in the stereotaxy (Beijing Zhongshi Dichuang Technology Development Co., Ltd.). Artificial tear ointment was applied to the eyes of the mice. Hair was cut off from the top of the skull and a longitudinal incision was made in the skin. Blunt dissection was used to remove connective tissue overlying the skull. Two holes were made in the skull using a small dental drill, with coordinates of ± 1.9 mm inter-aural, − 1.4 mm relative to the bregma, and + 1.8 mm from the dural surface [ 35 ]. The injection infusion rate was set at 0.8 µL/min, and the total infusion volume was 1µL/hemisphere. After infusion, the needle was left in place for 1min to minimize diffusion and then slowly withdrawn. Finally, the incision was sutured and the mice were returned to their cages. At the end of the 6th week, a portion of each group of mice was euthanized, and brains were rapidly removed and processed for study. The other part was used for behavioral assessment and then euthanized. Partial pressure of oxygen (PO 2 ) in the hippocampus The PO 2 value in the hippocampus of mice was detected by tissue oxygen partial pressure detection device (Beijing Zhongshi Dichuang Technology Development Co., Ltd.). In brief, a stereotaxy was used to fix isoflurane-anesthetized mice and guide the probe into the hippocampus. PO 2 was detected in real time. It was recorded until PO 2 values were in the 10% range for 3 min. The left and right hippocampi were averaged. Functional magnetic resonance imaging (fMRI) data acquisition and analysis The MRI scanning was performed by the BRUKER 7.0-T MRI (Bruker Pharmasca 7.0/16us, Germany) scanner. Anatomical images were acquired using rapid acquisition with relaxation enhancement (RARE) sequence with the following parameters: matrix size 256 × 256, field of view (FOV) = 2 cm × 2 cm, repetition time (TR)/ echo time (TE) = 4500/45 ms, and number of excitation (NEX) = 4. Functional scans were acquired using gradient-echo planar imaging (EPI): slice thickness = 1 mm, matrix size = 80 x 64, FOV = 2.43 cm x 2.1 cm, TR/TE = 2000/15 ms, and NEX = 1. Statistical parametric mapping software was used for image pre-processing and statistical analysis. The blood oxygenation level dependent (BOLD) values were analyzed and compared between the the control and IH groups. All functional image post-processing was done by an experienced observer who was blinded to the scanned objects. The voxel-level height threshold was P < 0.05, and the clusterextent threshold was 20 voxels. RNA-sequencing and transcriptomics analysis Total RNA was extracted by Trizol (Invitrogen, USA). Ribo-Zero rRNA Removal kit (Illumina, USA) was used to remove rRNAs from the total RNA. High-quality RNA was preprocessed by TruSeq Stranded Total RNA Library Prep kit (Illumina) to construct cDNA libraries. The libraries were qualified and quantified with BioAnalyzer 2100 system (Agilent Technologies, USA). High-quality libraries were denatured into single-stranded DNA, captured on Illumina flowcell and amplified into clusters in situ, and then 150 cycle sequencing was performed on NovaSeq 6000 sequencer (Illumina). The sequencing data were imported into R Platform 4.2.0 to screen differentially expressed genes (DEGs). Genes with adjust P values < 0.05 and |log2 (Fold change)| ≥ 1 were considered to have differential expression. DEGs were used for Gene ontology (GO) analysis, Kyoto encyclopedia of genes and genomes (KEGG) pathway analysis and protein-protein interaction (PPI) network construction. Hydroxymethylated / methylated DNA immunoprecipitation (hMeDIP / MeDIP) Sequencing Genomic DNA was extracted from the hippocampus of mice in the control and IH groups using the DNeasy kit (QIAGEN, Germany) and sonicated to fragments ranging from 100 to 300 bp. Subsequently, the fragmented DNA was end repaired with the Universal DNA Library Prep kit (GenSeq, China), adding dA tails and adaptor sequences. A portion of the DNA labeled input (about 10%) after the adaptor was added was retained, and the remaining was subjected to immunoprecipitation reaction with the 5mC MeDIP kit and 5hmC MeDIP kit (GenSeq), respectively. The Illumina PCR Primers and 2×HiFi PCR Mix (GenSeq) were used for library amplification and purification of immunoprecipitated DNA as well as Input DNA that had not been immunoprecipitated. Purified DNA libraries were quantified by Qubit (ThermoFisher) fluorescence assay and sequenced with NovaSeq 6000 sequencer. hMeDIP-PCR DNA samples were fragmented to 100 to 300 bp, and each sample was divided into purified immunoprecipitated DNA and input DNA. The purified DNA was used to verify the target gene. Primer sequences are shown in Supplementary Table S1 . Quantitative real-time (qRT)-PCR Total RNA was extracted by Trizol. Reverse transcription of cDNA using PrimeScriptTM RT kit (ABM, Canada). qRT-PCR with the LightCycler 480 system (Roche, Switzerland) was performed using Maxima SYBR Green/ROX qPCR Master Mix (ABM). The relative expression level was calculated by 2 − ΔΔCt. Primer sequences are shown in Supplementary Table S1 . Cell-type annotation According to the existing annotations of the brain in the CellMarker database ( http://biocc.hrbmu.edu.cn/CellMarker/ ) [ 36 ], DEGs, differentially methylated/demethylated genes (DMG/DDG)-enriched cell types were marked. DNA extraction and dot blot The TIANamp Genomic DNA Kit (Tiangen, Beijing, China) was used to extract genomic DNA from mice hippocampus. Genomic DNA was denatured and dot onto a nitrocellulose filter membrane (Whatman, UK) and violet cross-linked. The membrane was blocked with 5% milk and then incubated with primary antibodies against 5hmC (dilution 1: 1000; Cell Signaling Technology) and 5mC (dilution 1:1000; Cell Signaling Technology) antibodies overnight at 4°C. After washing with TBST, membrane was incubated with peroxidase-coupled secondary antibodies for 1 h at 37°C and then developed using enhanced chemiluminescence (7sea biotech, Shanghai, China). The signals were quantified using ImageJ software. In addition, 0.02% methylene blue was stained in 0.3 M sodium acetate (pH 5.2) to visualize DNA as a total genomic DNA loading control. Hematoxylin-eosin (HE) staining Brain tissues were fixed in 4% paraformaldehyde for 48h. The tissues were washed with phosphate buffered saline (PBS), dehydrated with ethanol, embedded in paraffin, and sliced. Sections were stained with H&E and examined under a light microscope (Nikon, 80i, Japan). Representative images were obtained at high magnifications of 400×. Immunohistochemistry (IHC) staining The tissue antigen was repaired. Sections were blocked with 5% goat serum protein and then incubated with primary antibodies against TET1 (dilution 1:500; GeneTex, USA), TET2 (dilution 1:200; Cell Signaling Technology), and TET3 (dilution 1:500; GeneTex) antibodies overnight at 4°C. After washing with PBS, the sections were incubated with peroxidase-coupled secondary antibodies for 30 min at 37°C. Representative images were obtained at high magnifications of 400×. Image J software was used to analyze the images. Immunofluorescence (IF) staining Sections were incubated with primary antibodies against TET1 (dilution 1:100; GeneTex), DCX (dilution 1:100; Cell Signaling Technology), Iba-1 (dilution 1:100; Cell Signaling Technology), GFAP (dilution 1:100; Cell Signaling Technology) antibodies overnight at 4°C and subsequently incubated with Cy5-labeled secondary antibodies for 30min at 37°C. Nuclei were stained with DAPI. Representative images were observed under a fluorescence microscope (Leica, Wetzlar, Germany). Representative images were obtained at high magnifications of 400×. Luminex liquid suspension chip analysis Luminex liquid suspension chip analysis was performed using the Bio-Plex Pro Mouse Cytokine Grp I Panel 23-plex Assay (Bio-Rad, USA). In brief, mouse hippocampi were incubated for 30min in 96-well plates embedded with microspheres, followed by 30min incubation with detection antibodies. Subsequently, Streptavidin-PE was added for 10min and values were read using the Bio-Plex 200 system (Luminex Corporation, USA). Behavior assessment Barnes maze Mice were assessed for behavior 2 weeks after stereotaxic injection. Short-term and long-term spatial learning and memory were assessed using the Barnes maze [ 37 ]. The maze consisted of a circular platform with 20 holes arranged equally spaced at the edges, one of which was connected to a dark chamber, the target hole. The stimulus of light (a 200 W white light lamp) forced mice to search for the target hole. Each mouse was allowed to adapt for 2 min the day before testing. During the training session, each mouse underwent a 4-day spatial acquisition phase in which two 3-min trials spaced 15 min apart were performed each day. Each mouse was placed in the center of the platform and covered with an opaque chamber for 5 s. The chamber was subsequently removed and the mice allowed to explore freely for 3 min. Aversive light was turned on to encourage the mouse to run and escape into the target hole. When the target hole failed to be entered within 3 min, the mice were gently guided into the target hole using a transparent chamber. Mice were allowed to explore the target hole for 1min before being returned to their main cage and the platform cleaned with 70% ethanol. Mice were tested for short-term memory on day 5 and long-term memory on day 12. The time to find the target hole was recorded for each trial, and the trajectory was depicted using the Tracking Master system v4.0 (Beijing Zhongshi Technology Co., Ltd.). Y-maze maze Y-maze maze consisted of three equiangularly arranged arms, labeled A, B, and C, each 40 cm long, 5 cm wide, and 13 cm high [ 38 ]. Each mouse was placed distal to arm A and moved freely through the maze over an 8-min period, and the order and number of its arm entries were recorded. Consecutive entry into all three arms (i.e., ABC, BAC, CBA) was considered a single spontaneous alternating behavior. Percentage alternation was calculated as the ratio of actual and possible alternation (the total number of entries into the arm minus 2), multiplied by 100. The number of entering arms was used as an indicator of motor function. Novel object recognition (NOR) NOR was performed in an open field 0.3m long, 0.3m wide, and 0.45 m high [ 39 ]. Mice were trained for 5min, during which time they were placed in the center of the arena in the presence of two identical objects. After 1h of training, mice were replaced into the open field for testing in which one of the objects was replaced by a novel object. Time spent exploring old and new objects was quantified using the Tracking Master system v4.0. The discrimination index was calculated as (T novel - T Familiar ) / (T Novel + T Familiar ). Statistical analysis All data are in average ± standard deviation (SD) and repeated at least 3 times. All data were analyzed using GraphPad Prism v9.4. The differences between the groups were determined by the student T-test (two groups) or one-way analysis of variance (ANOVA). P values < 0.05 for difference was statistically significant. Results IH exposure induced the upregulation of TETs and total 5hmC in the hippocampus of mice The IH mouse model was established as described in previous studies (Fig. 1 A). The body weight and hippocampal PO 2 in the IH group were significantly lower than those in the control group (Fig. 1 B). fMRI analysis of the IH mice revealed significantly lower BOLD signal activation in the hippocampus, especially on the left side, than in the control mice (Fig. 1 C). Previous studies have shown that TETs mediated 5hmC modification plays an important role in regulating cognitive function. The total amount of 5hmC in the hippocampus of control and IH mice was quantified using standard dot blot analysis. As shown in Fig. 1 D, 5hmC levels were significantly increased by IH compared with those in the controls. We determined the expression of TET1, TET2 and TET3 enzymes in the hippocampus by immunohistochemistry (IHC) and qPCR. As shown in Fig. 1 E, compared with those in the controls, the mRNA expression levels of Tet1 , Tet2 , and Tet3 in the IH group increased significantly. Interestingly, Tet1 level increased approximately 2-fold. Meanwhile, the protein expression levels of TET1, TET2 and TET3 were also increased in the hippocampal dentate gyrus of IH mice (Fig. 1 E). Overall, IH induced the expression of DNA hydroxymethyltransferase TET and modification of global 5hmC. IH exposure caused DEGs in the hippocampus of mice The hMeDIP-seq process is shown in Fig. 2 A. To evaluate the effect of IH on the hippocampus, the hippocampi of the control and IH mice were subjected to transcriptome sequencing. A total of 3263 DEGs were identified, including 1 309 upregulated DEGs and 1 954 downregulated DEGs (Supplementary Table S2 ). Hierarchical clustering and volcano plot were used to analyse the DEGs and visualize the genomic data (Fig. 2 B, Supplementary Figure S1 A). The PPI network was constructed and the degree was calculated to obtain the key target protein. The top 20 target proteins are mostly related to cell cycle (e.g., Cdk1, Ccnb1, Bub1) or Wnt (e.g., Wnt3a, Wnt2) (Supplementary Figure S1 B). GO and KEGG pathway enrichment analyses were subsequently performed using the DEGs. A total of 1 703 GO terms were obtained, including 3 676 BP, 303 CC, and 573 MF (adjusted P value < 0.05) (Supplementary Table S3 ). As shown in Fig. 2 C, compared with those in the controls, the regulated transcripts in the hippocampi of IH mice were associated with the BP terms axonogenesis, axon guidance, and the pattern specification process, MF terms, such as ion and gated channel activity, and in CC terms, such as the synaptic membrane and ion channel complex. A total of 88 Signaling pathways were enriched according to KEGG pathway analysis (P value < 0.05) (Supplementary Table S4 ). Twenty pathways, including neuroactive ligand‒receptor interaction, the cAMP Signaling pathway, the Wnt Signaling pathway, and the MAPK Signaling pathway, were screened for visualization based on the P value (Fig. 2 D). These results showed that IH altered the expression of inflammatory- and neuroactive-related genes in the hippocampus. IH exposure caused DMG/DDG in the hippocampus of mice MeDIP-seq and hMeDIP-seq were performed on 5mC and 5hmC, respectively, to map the genome differences between the hippocampi of control and IH mice. As shown in Fig. 3 A, there were significant differences in the mean normalized counts of 5mC- and 5hmC-enriched regions in the hippocampus between control and IH mice. Heatmap clustering was used to visualize the 5 kb distribution of 5mC and 5hmC peaks upstream and downstream of the transcription start site (TSS) (Fig. 3 B). Compared with control mice, IH mice presented decreased enrichment of 5mC in this genomic region, whereas the corresponding level of 5hmC increased (Fig. 3 C). Genes containing altered 5hmC peaks were analysed, and 12 606 genes were found to be differentially demethylated in the hippocampus between control and IH mice; 10 994 of these genes were demethylated, and 1 612 were not demethylated (Supplementary Table S5 ). GO analysis of the DDGs revealed a total of 5 824 enriched GO items, including 4 723 BP, 392 CC, and 709 MF terms (Supplementary Table S6 ). According to the adjusted P value, 30 GO terms were screened for visual analysis. As shown in Fig. 3 D, compared with controls, DDGs in the hippocampus of IH mice were involved in axonogenesis, synapse organization and cell junction assembly to BP, which were found to play a role in MF such as GTPase regulator activity and nucleoside-triphosphatase regulator activity and in CC such as glutamatergic synapse and neuron to neuron synapse. Genes containing altered 5mC peaks were analysed, and 16 033 genes were found to be differentially methylated in the hippocampus between control and IH mice, 15 620 of which were methylated and 413 of which were unmethylated (Supplementary Table S7 ). GO analysis of the DMGs revealed a total of 4 732 enriched GO items, including 3 977 BP, 288 CC, and 467 MF terms (Supplementary Table S8 ). According to the adjusted P value, 30 GO terms were screened for visual analysis. As shown in Fig. 3 E, compared with controls, DMGs in the hippocampus of IH mice were involved in axonogenesis, positive regulation of kinase activity and synapse organization to BP, which were found to play a role in MF such as metal ion transmembrane transporter activity and gated channel activity and in CC such as receptor complex and synaptic membrane. Moreover, they were enriched in CCs such as receptor complexes and synaptic membranes. KEGG analysis of the DDGs and DMGs revealed 121 and 123 enriched Signaling pathways, respectively (Supplementary Table S9 , Supplementary Table S10 ). According to the adjusted P value, 10 pathways were screened separately for visualization; among these pathways, the DDG-enriched pathways included axon guidance, the cAMP Signaling pathway, and the Wnt Signaling pathway, and the corresponding DMGs included the calcium Signaling pathway, the PI3K-Akt Signaling pathway, and axon guidance (Fig. 3 F). The cell types enriched in the upregulated and downregulated DEGs, upregulated DDGs, and upregulated DMGs are marked. As shown in Fig. 3 G, the upregulated DEGs were enriched mainly in neurons and basket cells, and the downregulated DEGs were enriched mainly in ependymal cells and the other 4 cell types. The upregulated DMGs were enriched mainly in ependymal cells and the other 7 cell types, and the upregulated DDGs were enriched mainly in 10 cell types, including smooth muscle cells, Cajal–Retzius cells, olfactory ensheathing glia, oligodendrocytes, endothelial cells and Bergmann glial cells. These data indicated that IH induced global enrichment of 5hmC markers, especially in genes related to inflammation and neural activity. IH exposure promoted the binding of 5hmC to Wnt pathway genes in the hippocampi of mice Given the critical function of 5hmC alterations in controlling gene expression, we investigated the relationship between 5hmC and mRNA levels. Supplementary Figure S2 A shows the proportion of 5mC and 5hmC peaks in each genomic region. Significant differences were found by comparing the enrichment of 5mC and 5hmC in promoter regions in the hippocampus of control and IH mice (Supplementary Figure S2 B). The RNA-sequencing data was combined with the methylation, demethylation and gene expression in promoter regions data (Fig. 4 A, Supplementary Table S11 , S12). Compared with those in the control group, the expression and demethylation levels of genes involved in the Wnt ( Wnt3a , Ccnd2 and Prickle2 ), synaptic vesicle cycle ( Snap25 , Syt1 ), MAPK ( Il1b , Fgf13 ) and cAMP ( Htr4 , Adcy1 ) Signaling pathways were increased. The expression of the above genes in the hippocampi of control and IH mice was examined by qPCR. The results showed that the above genes were upregulated after IH stimulation (Fig. 4 B). 5hmC profiles revealed high 5hmC levels during IH treatment (Fig. 4 C, Supplementary Figure S3 ). The demethylation levels of specific regions in Wnt3a , Ccnd2 and Prickle2 were validated by hMeDIP-qPCR. The results showed that IH stimulation increased the binding of the above genes to 5hmC (Fig. 4 D). These findings suggested that 5hmC modification may play an epigenetic regulatory role in the expression of Wnt3a , Ccnd2 and Prickle2 in the Wnt pathway in the hippocampi of IH-treated mice. Tet1 intervention improved hippocampal cognitive dysfunction in IH mice Tet1 intervention improved hippocampal cognitive dysfunction in IH mice Taken together, our data demonstrate that the expression of DNA hydroxymethyltransferases, especially TET1, is significantly altered in the hippocampus of IH mice, suggesting a critical role for DNA hydroxymethylation. To investigate IH further, we altered the DNA hydroxymethylation levels in the hippocampus by knocking down Tet1 using a lentivirus plasmid (Fig. 5 A). IH mice treated with shNC or sh Tet1 are shown in Fig. 5 A. Figure 5 B illustrates the design of the lentivirus carrying sh Tet1 . 293T cells were transfected with shNC or sh Tet1 for 72 h, and green fluorescence was observed under a high-content microscope, confirming successful transfection (Supplementary Figure S4 ). The qPCR results showed that the Tet1 mRNA level in N2A cells transfected with sh Tet1 was significantly lower than that in N2A cells transfected with shNC, while there was no significant difference between the shNC-transfected cells and the control cells (Fig. 5 C). IHC and qPCR showed that both the staining and relative mRNA expression of total TET1 in the hippocampus of sh Tet1 -treated mice were significantly lower than those in the IH group (Fig. 5 D). Immunofluorescence (IF) staining demonstrated the subcellular localization of TET1 in the hippocampus, and the localization changes after IH treatment and Tet1 knockdown (Fig. 5 E). Hippocampus is an important brain region responsible for encoding and storing memories. Therefore, behavioral assessments were performed after IH, including Barnes maze, Y maze, and NOR tests. The exploratory trajectories of the Barnes maze-treated mice on Days 5 and 12 showed that the short-term and long-term memory deficits, respectively, were impaired after IH exposure but recovered after Tet1 knockdown (Fig. 6 A). The latency to identify target box was significantly greater in the IH group than in the control group, while it was significantly lower in the IH + sh Tet1 group than in the IH group (Fig. 6 B). Figure 6 C shows the changes in latency to reach the target box during the 4-day training period in each group of mice. The Y-maze test showed that spontaneous alternation behaviour was significantly lower in the IH group than in the control group but was significantly greater in the IH + sh Tet1 group than in the IH group (Fig. 6 D). There was no significant difference in the total number of arm entries between the groups, suggesting that the changes in spontaneous alternation behaviour were not due to motor deficits (Fig. 6 E). The NOR test showed that the preference of mice for new objects was significantly lower in the IH group than in the control group but was significantly greater in the IH + sh Tet1 group than in the IH group (Fig. 6 F). There was no significant difference in the total interaction time with old or new objects between the groups, suggesting that the changes in the discrimination index were not due to lack of interest (Fig. 6 G). These findings suggested that Tet1 knockdown can ameliorate the short-term and long-term memory impairment caused by IH. Tet1 knockdown decreased hippocampal gliocytes and immature neurons Moderate neurogenesis and neuroinflammation have beneficial effects on the brain; however, their excess is often catastrophic. In our study, neurons in the hippocampi of control mice were arranged in order, clearly stained, and had a normal microstructure under normal oxygen conditions. The pathological changes in the IH group were obvious; the neurons were loosely arranged, the staining was light, and neuron loss and nuclear pyknosis were observed (Fig. 7 A). The morphology of all the tissues tended to normalize after treatment with sh Tet1 (Fig. 7 A). IF staining was used to examine the expression of DCX (a marker of immature neurons), IBA1 (a marker of microglia) and GFAP (a marker of astrocytes). IH treatment significantly increased the expression of DCX, IBA1, and GFAP, of which DCX and GFAP were significantly decreased after sh Tet1 injection, and IBA1, although not significantly, also tended to decrease (Fig. 7 B-E). These findings suggested that IH caused abnormal neurogenesis and neuroinflammation in the hippocampus, which was abolished by Tet1 intervention. Tet1 knockdown alleviated IH-induced hippocampal neuroinflammation in mice Wnt pathway is a key pathway regulating neurogenesis and neuroinflammation, and its dysregulation causes a variety of neuropathologies. Compared with those in the hippocampi of IH mice, the Wnt3a , Ccnd2 , and Prickle2 mRNA levels were significantly lower in the hippocampi of sh Tet1 mice, as determined by qPCR (Fig. 8 A). Compared with that in the hippocampi of IH mice, the 5hmC level in the hippocampi of sh Tet1 mice was decreased, as determined by standard dot blot (Fig. 8 B). Luminex liquid suspension chip analysis was used to compare the differential expression of 23 cytokines in the hippocampus of the control group, IH group and IH + sh Tet1 group (Fig. 8 C). Thirteen cytokines were significantly upregulated after IH, and the five most upregulated proteins were MIP1a, IL17A, KC, IL3 and IL12 (p40). The expression of eight cytokines, such as TNFa, IL3, IL9 and IL17A, decreased significantly after sh Tet1 injection (Fig. 8 C, Supplementary Table S13 ). Taken together, these data indicate that Tet1 -targeted therapy may be effective against IH-induced hippocampal inflammation, possibly by limiting the excessive levels of 5hmC and Wnt pathway genes. Discussion IH is an important feature of OSA and plays a major role in hippocampal oxidative stress injury and cognitive dysfunction [ 40 ]; however, the exact mechanism involved remains poorly understood. In this study, for the first time, we revealed the effects of IH on the DNA demethylation process in the mouse hippocampus and linked these effects with changes in hippocampus-related cognitive functions. In addition, we found that IH regulated neuroinflammation and neurogenesis through the demethylation of Wnt Signaling pathway genes, which was reversed by Tet1 knockdown. The enzymatic activity of TETs, members of the 2-OGDD superfamily, may be regulated by oxygen availability and redox-based mechanisms, thereby catalysing the progressive oxidation of 5mC from DNA [ 41 , 42 ]. There has been some understanding of the effect of hypoxia on the enzymatic activity and expression of TET in different tumors. Hypoxia can reduce oxygen-dependent TET enzyme activity without increasing TET expression in several tumour cell lines [ 28 ]. In neuroblastoma, however, hypoxia causes a strong compensatory increase in TET expression [ 28 , 30 ]. In thyroid cancer, TET1 changes from a tumour suppressor under normoxia to an oncogene under hypoxia [ 43 ]. These counterexamples may reflect the oxygen state-dependent nonenzymatic function of TET1. The TET-mediated demethylation intermediate 5hmC is a stable epigenetic marker that generally promotes gene expression [ 44 , 45 ]. 5hmC is most abundant in the central nervous system, and its continuous increase in the hippocampus and other brain regions of mice from early postnatal to adulthood and possibly into old age indicates its close association with brain function and disease [ 45 , 46 ]. Interestingly, TET1, TET2, and TET3 expression as well as total 5hmC levels were significantly higher in the hippocampi of IH mice than in those of control mice. It is possible that IH, as a moderate chronic hypoxia, is not sufficient to cause a substantial reduction in TET enzyme activity or that TETs at least partially play a direct nonenzymatic role. Among the TET enzymes, TET1 is the most studied and highly controversial in the field of neuroscience, and both its loss and overexpression have been reported to enhance or impair memory, which may be partially attributed to the differential regulation of its two isoforms in neurons and glial cells, respectively [ 22 – 27 ]. Tet1 S is highly enriched in neurons, and its repression enhances hippocampus-dependent memory in mice, whereas Tet1 FL is more abundant in glial cells, and its repression impairs memory [ 27 ]. However, overexpression of Tet1 specifically in hippocampal CA1 pyramidal cells caused memory impairment [ 24 ]. Thus, it seems that the regulation of hippocampus-mediated cognitive function by Tet1 is more complex than expected. Tet2 also has cell type specificity in regulating cognitive processes, as its loss in adult neural progenitor cells impairs neurogenesis and cognitive function, whereas its loss in neurons enhances hippocampus-dependent memory by modulating synaptic plasticity [ 47 , 48 ]. Loss of Tet3 in brain neurons impairs hippocampal spatial orientation and short-term memory [ 49 , 50 ]. Therefore, we hypothesized that IH-induced hippocampus-related cognitive dysfunction in mice may be associated with 5hmC modification mediated by TETs. We found that IH mice exhibited significant decreases in spatial learning and short-term and long-term memory. Pathological changes were found in the hippocampus by HE staining, and a decreased BOLD signal was found by fMRI, especially on the left side of the hippocampus. We will further investigate the reasons for this bilateral asymmetry in the future. Studies have showen that IH can cause hippocampal inflammatory damage and subsequent cognitive dysfunction, which may be mediated mainly by microglia [ 11 , 51 , 52 ]. We found several Signaling pathways that were enriched in the DDGs and DEGs. These genes were found to be involved in neuroregulation-related pathways, including axon guidance, neuroactive ligand‒receptor interaction, and calcium Signaling pathways, as well as inflammation-related pathways, such as MAPK Signaling pathways, NF-κB Signaling pathways and Th17 cell differentiation. Strikingly, the Wnt Signaling pathway, which is considered to regulate both neurogenesis and neuroinflammation [ 53 ], was also enriched. The Wnt Signaling pathway is divided into the canonical Wnt/β-catenin pathway and the noncanonical Wnt Signaling pathway, which include the calcium pathway and planar cell polarity pathway [ 54 ]. Neurogenesis, a highly dynamic process that continues throughout the lifetime in rodents and humans, plays an important role in hippocampus-dependent learning and memory [ 55 ]. Loss of normal neurogenesis or the generation of abnormal neurogenesis can disrupt hippocampal neural circuits, leading to cognitive dysfunction [ 56 ]. The Wnt Signaling pathway is the main factor controlling adult hippocampal neurogenesis, and proper Wnt Signaling pathway activation is required to regulate the proliferation, differentiation and maturation of neurons [ 57 , 58 ]. During the early stages of neurogenesis, canonical Wnt Signaling determines cell proliferation and maturation and subsequently, together with noncanonical Wnt Signaling, regulates differentiation and morphological development [ 59 – 61 ]. However, excessive activation of this pathway may impair the maturation of neurons, causing dendrite, spine and synapse dysplasia [ 61 – 63 ]. The effect of the Wnt Signaling pathway on neuroinflammation is mainly achieved by regulating microglial activation. In a variety of CNS diseases, microglial activation mediated by canonical Wnt Signaling is generally characterized by an anti-inflammatory protective effect, while noncanonical Wnt Signaling-mediated microglial activation is proinflammatory and promotes disease progression [ 64 – 71 ]. Even if, for instance, Wnt/β-catenin activity coincides with early neuronal damage and microglial inflammation in the hippocampi of mice with experimental autoimmune encephalomyelitis, this change can be interpreted as active inflammation activating Wnt Signaling, triggering hippocampal neurogenesis, and replenishing damaged neurons [ 72 ]. However, Wnt3a plays dual regulatory roles in microglial and may be related to the activation of other inflammatory pathways. Intraventrically injected GSK3β inhibitors to activate canonical Signaling pathways in premature rabbits with intraventricular haemorrhage inhibited microglial inflammation, while rt-Wnt3a promoted inflammation [ 73 ]. In vitro, Wnt3a can convert microglia to a proinflammatory phenotype, probably through its activation of the ERK1/2 pathway in addition to the canonical Wnt pathway [ 74 , 75 ]. Activation of the NF-κB pathway can be observed when a Wnt/β-catenin pathway agonist is added to microglia, and vice versa; this bidirectional positive feedback effect may cause sustained activation of both pathways and exacerbate inflammatory damage [ 76 ]. In addition, activated microglia can also enhance the neurotoxicity of astrocytes by secreting a variety of inflammatory mediators to jointly drive inflammatory damage in the CNS [ 11 , 77 ]. Therefore, we identified Wnt3a , Prickle2 and Ccnd2 in the Wnt Signaling pathway as key demethylation regulators and demonstrated increased demethylation and gene expression in the hippocampi of IH mice. The levels of IBA1 (a marker of microglia), GFAP (a marker of astrocytes) and DCX (a marker of immature neurons) in the DG region of the hippocampus were significantly increased after IH, and the levels of a variety of inflammatory cytokines were significantly upregulated. Given the importance and complexity of TET1 in regulating hippocampal cognitive function shown in the literature and its significant upregulation in the hippocampi of IH mice, we decided to validate the induced phenotypic changes by eliminating demethylation via hippocampus-specific knockdown of Tet1 . TET1 was found to be expressed only in specific cells in the DG region by IF staining, and we will investigate its colocalization in the future. As we predicted, sh Tet1 treatment resulted in significant improvements in spatial learning and memory, significant reductions in Wnt Signaling pathway gene demethylation and gene expression, and normalization of neurological function markers and some cytokines. Conclusions Our results demonstrated that Wnt pathway gene demethylation was involved in the development of IH-induced cognitive dysfunction in mice by regulating hippocampal neuroinflammation and neurogenesis, which could be reversed by specific knockdown of hippocampal Tet1 . We hope that our study contributes to the understanding of the underlying mechanisms of cognitive impairment in OSA patients and suggests a potentially effective target for intervention. Abbreviations 2-OGDD 2-oxoglutarate-dependent dioxygenase 5hmC 5-hydroxymethylcytosine 5mC 5-methylcytosine BOLD blood oxygenation level dependent CNS central nervous system DDGs differentially demethylated genes DEGs differentially expressed genes DMGs differentially methylated genes fMRI functional magnetic resonance imaging HE hematoxylin-eosin hMeDIP hydroxymethylated DNA immunoprecipitation IF immunofluorescence IHC immunohistochemistry IH intermittent hypoxia MeDIP methylated DNA immunoprecipitation NOR novel object recognition OSA obstructive sleep apnoea PO 2 partial pressure of oxygen qRT-PCR quantitative real-time qRT-PCR TET ten-eleven translocation Declarations Authour Contribution All authors contributed to the conception and design of the study. KY and JJ conducted most of the experiments, prepared the manuscript and contributed equally. ZX, LF, and YP help analyze data and comment on previous manuscripts. All the authors approved the final draft. Dr. Fei Yang and Dr. Shan wang are the guarantor of this work, and as such, they has full access to all the data in the study and is responsible for the integrity of the data and the accuracy of the data analysis. All authors read and approved the final manuscript. Funding This work was supported by grants from Public service development and reform pilot project of Beijing Medical Research Institute (BMR2021-3), National natural science foundation of China (81970900), Capital's Funds for Health Improvement and Research (2022-2-1132),Beijing Hospitals Authority’s Ascent Plan (DFL20221102), and Research Foundation of Capital Institute of Pediatrics (LCY-2023-23). Availability of data and materials All data generated or analyzed during this study are included in the published article (and its additional files) and are available from the corresponding author upon reasonable request. The raw RNA-seq, hMeDIP-seq and MeDIP-seq generated during and/or analyzed during the current study is available from the corresponding author upon reasonable request. Ethics approval and consent to participate All experiments were approved by the Animal Care and Use Ethics Committee of the Capital Institute of Pediatrics (DWLL2021016). Anesthesia and euthanasia of animals were consulted with the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals (2020). Consent for publication Not applicable. Competing interests The authors declare no competing interests. Data availability The data analyzed during this study are included in this published article and the supplemental data files. Additional supporting data are available from the corresponding authors upon reasonable request. References Benjafield AV, Ayas NT, Eastwood PR, Heinzer R, Ip MSM, Morrell MJ, Nunez CM, Patel SR, Penzel T, Pepin JL et al : Estimation of the global prevalence and burden of obstructive sleep apnoea: a literature-based analysis . Lancet Respir Med 2019, 7 (8):687-698. Patel SR: Obstructive Sleep Apnea . Ann Intern Med 2019, 171 (11):ITC81-ITC96. Hou H, Zhao Y, Yu W, Dong H, Xue X, Ding J, Xing W, Wang W: Association of obstructive sleep apnea with hypertension: A systematic review and meta-analysis . J Glob Health 2018, 8 (1):010405. Wang C, Tan J, Miao Y, Zhang Q: Obstructive sleep apnea, prediabetes and progression of type 2 diabetes: A systematic review and meta-analysis . J Diabetes Investig 2022, 13 (8):1396-1411. Liu X, Ma Y, Ouyang R, Zeng Z, Zhan Z, Lu H, Cui Y, Dai Z, Luo L, He C et al : The relationship between inflammation and neurocognitive dysfunction in obstructive sleep apnea syndrome . J Neuroinflammation 2020, 17 (1):229. da Silva Gusmao Cardoso T, Pompeia S, Miranda MC: Cognitive and behavioral effects of obstructive sleep apnea syndrome in children: a systematic literature review . Sleep Med 2018, 46 :46-55. Yu C, Fu Y, Lu Y, Huang Y, Chen F, Wei J, Li L, Ampadu JA, Wang Y, Zheng W et al : Alterations of brain gray matter volume in children with obstructive sleep apnea . Frontiers in neurology 2023, 14 :1107086. Bubu OM, Andrade AG, Umasabor-Bubu OQ, Hogan MM, Turner AD, de Leon MJ, Ogedegbe G, Ayappa I, Jean-Louis GG, Jackson ML et al : Obstructive sleep apnea, cognition and Alzheimer's disease: A systematic review integrating three decades of multidisciplinary research . Sleep Med Rev 2020, 50 :101250. Macey PM, Prasad JP, Ogren JA, Moiyadi AS, Aysola RS, Kumar R, Yan-Go FL, Woo MA, Albert Thomas M, Harper RM: Sex-specific hippocampus volume changes in obstructive sleep apnea . Neuroimage Clin 2018, 20 :305-317. Olaithe M, Bucks RS, Hillman DR, Eastwood PR: Cognitive deficits in obstructive sleep apnea: Insights from a meta-review and comparison with deficits observed in COPD, insomnia, and sleep deprivation . Sleep Med Rev 2018, 38 :39-49. Bezzi P, Domercq M, Brambilla L, Galli R, Schols D, De Clercq E, Vescovi A, Bagetta G, Kollias G, Meldolesi J et al : CXCR4-activated astrocyte glutamate release via TNFalpha: amplification by microglia triggers neurotoxicity . Nat Neurosci 2001, 4 (7):702-710. Koivunen P, Laukka T: The TET enzymes . Cellular and Molecular Life Sciences 2017, 75 (8):1339-1348. Tahiliani M, Koh KP, Shen Y, Pastor WA, Bandukwala H, Brudno Y, Agarwal S, Iyer LM, Liu DR, Aravind L et al : Conversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1 . Science 2009, 324 (5929):930-935. Ito S, D'Alessio AC, Taranova OV, Hong K, Sowers LC, Zhang Y: Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification . Nature 2010, 466 (7310):1129-1133. Li W, Zhang X, Lu X, You L, Song Y, Luo Z, Zhang J, Nie J, Zheng W, Xu D et al : 5-Hydroxymethylcytosine signatures in circulating cell-free DNA as diagnostic biomarkers for human cancers . Cell research 2017, 27 (10):1243-1257. Armstrong MJ, Jin Y, Vattathil SM, Huang Y, Schroeder JP, Bennet DA, Qin ZS, Wingo TS, Jin P: Role of TET1-mediated epigenetic modulation in Alzheimer's disease . Neurobiol Dis 2023, 185 :106257. Spiers H, Hannon E, Schalkwyk LC, Bray NJ, Mill J: 5-hydroxymethylcytosine is highly dynamic across human fetal brain development . BMC genomics 2017, 18 (1):738. Szulwach KE, Li X, Li Y, Song CX, Wu H, Dai Q, Irier H, Upadhyay AK, Gearing M, Levey AI et al : 5-hmC-mediated epigenetic dynamics during postnatal neurodevelopment and aging . Nat Neurosci 2011, 14 (12):1607-1616. Johnson ND, Huang L, Li R, Li Y, Yang Y, Kim HR, Grant C, Wu H, Whitsel EA, Kiel DP et al : Age-related DNA hydroxymethylation is enriched for gene expression and immune system processes in human peripheral blood . Epigenetics 2020, 15 (3):294-306. Globisch D, Munzel M, Muller M, Michalakis S, Wagner M, Koch S, Bruckl T, Biel M, Carell T: Tissue distribution of 5-hydroxymethylcytosine and search for active demethylation intermediates . PLoS One 2010, 5 (12):e15367. Alaghband Y, Bredy TW, Wood MA: The role of active DNA demethylation and Tet enzyme function in memory formation and cocaine action . Neurosci Lett 2016, 625 :40-46. Kwon W, Kim HS, Jeong J, Sung Y, Choi M, Park S, Lee J, Jang S, Kim SH, Lee S et al : Tet1 overexpression leads to anxiety-like behavior and enhanced fear memories via the activation of calcium-dependent cascade through Egr1 expression in mice . FASEB J 2018, 32 (1):390-403. Xu W, Zhang X, Liang F, Cao Y, Li Z, Qu W, Zhang J, Bi Y, Sun C, Zhang J et al : Tet1 Regulates Astrocyte Development and Cognition of Mice Through Modulating GluA1 . Front Cell Dev Biol 2021, 9 :644375. Kaas GA, Zhong C, Eason DE, Ross DL, Vachhani RV, Ming GL, King JR, Song H, Sweatt JD: TET1 controls CNS 5-methylcytosine hydroxylation, active DNA demethylation, gene transcription, and memory formation . Neuron 2013, 79 (6):1086-1093. Rudenko A, Dawlaty MM, Seo J, Cheng AW, Meng J, Le T, Faull KF, Jaenisch R, Tsai LH: Tet1 is critical for neuronal activity-regulated gene expression and memory extinction . Neuron 2013, 79 (6):1109-1122. Zhang RR, Cui QY, Murai K, Lim YC, Smith ZD, Jin S, Ye P, Rosa L, Lee YK, Wu HP et al : Tet1 regulates adult hippocampal neurogenesis and cognition . Cell Stem Cell 2013, 13 (2):237-245. Greer CB, Wright J, Weiss JD, Lazarenko RM, Moran SP, Zhu J, Chronister KS, Jin AY, Kennedy AJ, Sweatt JD et al : Tet1 Isoforms Differentially Regulate Gene Expression, Synaptic Transmission, and Memory in the Mammalian Brain . J Neurosci 2021, 41 (4):578-593. Thienpont B, Steinbacher J, Zhao H, D'Anna F, Kuchnio A, Ploumakis A, Ghesquiere B, Van Dyck L, Boeckx B, Schoonjans L et al : Tumour hypoxia causes DNA hypermethylation by reducing TET activity . Nature 2016, 537 (7618):63-68. Morin A, Goncalves J, Moog S, Castro-Vega LJ, Job S, Buffet A, Fontenille MJ, Woszczyk J, Gimenez-Roqueplo AP, Letouze E et al : TET-Mediated Hypermethylation Primes SDH-Deficient Cells for HIF2alpha-Driven Mesenchymal Transition . Cell Rep 2020, 30 (13):4551-4566 e4557. Mariani CJ, Vasanthakumar A, Madzo J, Yesilkanal A, Bhagat T, Yu Y, Bhattacharyya S, Wenger RH, Cohn SL, Nanduri J et al : TET1-mediated hydroxymethylation facilitates hypoxic gene induction in neuroblastoma . Cell Rep 2014, 7 (5):1343-1352. Prasad P, Mittal SA, Chongtham J, Mohanty S, Srivastava T: Hypoxia-Mediated Epigenetic Regulation of Stemness in Brain Tumor Cells . Stem Cells 2017, 35 (6):1468-1478. Tsai YP, Chen HF, Chen SY, Cheng WC, Wang HW, Shen ZJ, Song C, Teng SC, He C, Wu KJ: TET1 regulates hypoxia-induced epithelial-mesenchymal transition by acting as a co-activator . Genome Biol 2014, 15 (12):513. Ma L, Qi T, Wang S, Hao M, Sakhawat A, Liang T, Zhang L, Cong X, Huang Y: Tet methylcytosine dioxygenase 1 promotes hypoxic gene induction and cell migration in colon cancer . J Cell Physiol 2019, 234 (5):6286-6297. Poulain L, Thomas A, Rieusset J, Casteilla L, Levy P, Arnaud C, Dematteis M: Visceral white fat remodelling contributes to intermittent hypoxia-induced atherogenesis . The European respiratory journal 2014, 43 (2):513-522. Ferrer I, Andrés-Benito P, Carmona M, del Rio JA: Common and Specific Marks of Different Tau Strains Following Intra-Hippocampal Injection of AD, PiD, and GGT Inoculum in hTau Transgenic Mice . International Journal of Molecular Sciences 2022, 23 (24):15940. Zhang X, Lan Y, Xu J, Quan F, Zhao E, Deng C, Luo T, Xu L, Liao G, Yan M et al : CellMarker: a manually curated resource of cell markers in human and mouse . Nucleic Acids Res 2019, 47 (D1):D721-D728. Li S, Li L, Li J, Liang X, Song C, Zou Y: miR-203, fine-tunning neuroinflammation by juggling different components of NF ‐κB signaling . Journal of Neuroinflammation 2022, 19 (1). Hu D, Cao Y, He R, Han N, Liu Z, Miao L, Yin J: Schizandrin, an antioxidant lignan from Schisandra chinensis, ameliorates Abeta1-42-induced memory impairment in mice . Oxid Med Cell Longev 2012, 2012 :721721. Alexander JF, Seua AV, Arroyo LD, Ray PR, Wangzhou A, Heibeta-Luckemann L, Schedlowski M, Price TJ, Kavelaars A, Heijnen CJ: Nasal administration of mitochondria reverses chemotherapy-induced cognitive deficits . Theranostics 2021, 11 (7):3109-3130. Zhou L, Chen P, Peng Y, Ouyang R: Role of Oxidative Stress in the Neurocognitive Dysfunction of Obstructive Sleep Apnea Syndrome . Oxid Med Cell Longev 2016, 2016 :9626831. Lamadema N, Burr S, Brewer AC: Dynamic regulation of epigenetic demethylation by oxygen availability and cellular redox . Free Radic Biol Med 2019, 131 :282-298. Matuleviciute R, Cunha PP, Johnson RS, Foskolou IP: Oxygen regulation of TET enzymes . FEBS J 2021, 288 (24):7143-7161. Yang Q, Dang H, Liu J, Wang X, Wang J, Lan X, Ji M, Xing M, Hou P: Hypoxia switches TET1 from being tumor-suppressive to oncogenic . Oncogene 2023, 42 (20):1634-1648. Joshi K, Liu S, Breslin SJP, Zhang J: Mechanisms that regulate the activities of TET proteins . Cell Mol Life Sci 2022, 79 (7):363. Xie J, Xie L, Wei H, Li XJ, Lin L: Dynamic Regulation of DNA Methylation and Brain Functions . Biology (Basel) 2023, 12 (2). Groves JO, Leslie I, Huang GJ, McHugh SB, Taylor A, Mott R, Munafo M, Bannerman DM, Flint J: Ablating adult neurogenesis in the rat has no effect on spatial processing: evidence from a novel pharmacogenetic model . PLoS Genet 2013, 9 (9):e1003718. Gontier G, Iyer M, Shea JM, Bieri G, Wheatley EG, Ramalho-Santos M, Villeda SA: Tet2 Rescues Age-Related Regenerative Decline and Enhances Cognitive Function in the Adult Mouse Brain . Cell Rep 2018, 22 (8):1974-1981. Pratt KJB, Shea JM, Remesal-Gomez L, Bieri G, Smith LK, Couthouis J, Chen CP, Roy IJ, Gontier G, Villeda SA: Loss of neuronal Tet2 enhances hippocampal-dependent cognitive function . Cell Rep 2022, 41 (6):111612. Antunes C, Da Silva JD, Guerra-Gomes S, Alves ND, Ferreira F, Loureiro-Campos E, Branco MR, Sousa N, Reik W, Pinto L et al : Tet3 ablation in adult brain neurons increases anxiety-like behavior and regulates cognitive function in mice . Mol Psychiatry 2021, 26 (5):1445-1457. Antunes C, Da Silva JD, Guerra-Gomes S, Alves ND, Loureiro-Campos E, Pinto L, Marques CJ: Tet3 Deletion in Adult Brain Neurons of Female Mice Results in Anxiety-like Behavior and Cognitive Impairments . Mol Neurobiol 2022, 59 (8):4892-4901. Yang Q, Wang Y, Feng J, Cao J, Chen B: Intermittent hypoxia from obstructive sleep apnea may cause neuronal impairment and dysfunction in central nervous system: the potential roles played by microglia . Neuropsychiatric disease and treatment 2013, 9 :1077-1086. Wang H, Wang X, Shen Y, Wang Y, Yang T, Sun J, Liu S: SENP1 modulates chronic intermittent hypoxia-induced inflammation of microglia and neuronal injury by inhibiting TOM1 pathway . International immunopharmacology 2023, 119 :110230. Marchetti B, Pluchino S: Wnt your brain be inflamed? Yes, it Wnt! Trends in molecular medicine 2013, 19 (3):144-156. Li C, Wu Y, Huang MY, Song XJ: Characterization of Inflammatory Signals in BV-2 Microglia in Response to Wnt3a . Biomedicines 2023, 11 (4). Lazarov O, Hollands C: Hippocampal neurogenesis: Learning to remember . Prog Neurobiol 2016, 138-140 :1-18. Zhang X, Wei X, Mei Y, Wang D, Wang J, Zhang Y, Li X, Gu Y, Peng G, Sun B: Modulating adult neurogenesis affects synaptic plasticity and cognitive functions in mouse models of Alzheimer's disease . Stem Cell Reports 2021, 16 (12):3005-3019. Lie D-C, Colamarino SA, Song H-J, Désiré L, Mira H, Consiglio A, Lein ES, Jessberger S, Lansford H, Dearie AR et al : Wnt signalling regulates adult hippocampal neurogenesis . Nature 2005, 437 (7063):1370-1375. Arredondo SB, Valenzuela-Bezanilla D, Santibanez SH, Varela-Nallar L: Wnt Signaling in the Adult Hippocampal Neurogenic Niche . Stem Cells 2022, 40 (7):630-640. Arredondo SB, Guerrero FG, Herrera-Soto A, Jensen-Flores J, Bustamante DB, Onate-Ponce A, Henny P, Varas-Godoy M, Inestrosa NC, Varela-Nallar L: Wnt5a promotes differentiation and development of adult-born neurons in the hippocampus by noncanonical Wnt signaling . Stem Cells 2020, 38 (3):422-436. Schafer ST, Han J, Pena M, von Bohlen Und Halbach O, Peters J, Gage FH: The Wnt adaptor protein ATP6AP2 regulates multiple stages of adult hippocampal neurogenesis . J Neurosci 2015, 35 (12):4983-4998. Heppt J, Wittmann MT, Schaffner I, Billmann C, Zhang J, Vogt-Weisenhorn D, Prakash N, Wurst W, Taketo MM, Lie DC: beta-catenin signaling modulates the tempo of dendritic growth of adult-born hippocampal neurons . EMBO J 2020, 39 (21):e104472. Varela-Nallar L, Inestrosa NC: Wnt signaling in the regulation of adult hippocampal neurogenesis . Front Cell Neurosci 2013, 7 :100. Martin PM, Stanley RE, Ross AP, Freitas AE, Moyer CE, Brumback AC, Iafrati J, Stapornwongkul KS, Dominguez S, Kivimae S et al : DIXDC1 contributes to psychiatric susceptibility by regulating dendritic spine and glutamatergic synapse density via GSK3 and Wnt/beta-catenin signaling . Mol Psychiatry 2018, 23 (2):467-475. Yu L, Huang L, Zhao Y, Liu S, Zhou R, Yue Y, Sun H, Su X, Liu Q, Li S et al : Atorvastatin Promotes Pro/anti-inflammatory Phenotypic Transformation of Microglia via Wnt/β-catenin Pathway in Hypoxic-Ischemic Neonatal Rats . Mol Neurobiol 2023. Lu Y, Liu M, Guo X, Wang P, Zeng F, Wang H, Tang J, Qin Z, Tao T: miR-26a-5p alleviates CFA-induced chronic inflammatory hyperalgesia through Wnt5a/CaMKII/NFAT signaling in mice . CNS neuroscience & therapeutics 2023, 29 (5):1254-1271. Yang Y, Zhang Z: Microglia and Wnt Pathways: Prospects for Inflammation in Alzheimer's Disease . Frontiers in aging neuroscience 2020, 12 :110. Song D, Zhang X, Chen J, Liu X, Xue J, Zhang L, Lan X: Wnt canonical pathway activator TWS119 drives microglial anti-inflammatory activation and facilitates neurological recovery following experimental stroke . J Neuroinflammation 2019, 16 (1):256. Yuan S, Shi Y, Guo K, Tang SJ: Nucleoside Reverse Transcriptase Inhibitors (NRTIs) Induce Pathological Pain through Wnt5a-Mediated Neuroinflammation in Aging Mice . Journal of neuroimmune pharmacology : the official journal of the Society on NeuroImmune Pharmacology 2018, 13 (2):230-236. Vallée A: Neuroinflammation in Schizophrenia: The Key Role of the WNT/β-Catenin Pathway . Int J Mol Sci 2022, 23 (5). Xiao Y, Guan T, Yang X, Xu J, Zhang J, Qi Q, Teng Z, Dong Y, Gao Y, Li M et al : Baicalin facilitates remyelination and suppresses neuroinflammation in rats with chronic cerebral hypoperfusion by activating Wnt/β-catenin and inhibiting NF-κB signaling . Behavioural brain research 2023, 442 :114301. Abu-Elfotuh K, Abdel-Sattar SA, Abbas AN, Mahran YF, Alshanwani AR, Hamdan AME, Atwa AM, Reda E, Ahmed YM, Zaghlool SS et al : The protective effect of thymoquinone or/and thymol against monosodium glutamate-induced attention-deficit/hyperactivity disorder (ADHD)-like behavior in rats: Modulation of Nrf2/HO-1, TLR4/NF-κB/NLRP3/caspase-1 and Wnt/β-Catenin signaling pathways in rat model . Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 2022, 155 :113799. Schneider R, Koop B, Schröter F, Cline J, Ingwersen J, Berndt C, Hartung HP, Aktas O, Prozorovski T: Activation of Wnt signaling promotes hippocampal neurogenesis in experimental autoimmune encephalomyelitis . Molecular neurodegeneration 2016, 11 (1):53. Dohare P, Cheng B, Ahmed E, Yadala V, Singla P, Thomas S, Kayton R, Ungvari Z, Ballabh P: Glycogen synthase kinase-3β inhibition enhances myelination in preterm newborns with intraventricular hemorrhage, but not recombinant Wnt3A . Neurobiol Dis 2018, 118 :22-39. Halleskog C, Mulder J, Dahlström J, Mackie K, Hortobágyi T, Tanila H, Kumar Puli L, Färber K, Harkany T, Schulte G: WNT signaling in activated microglia is proinflammatory . Glia 2011, 59 (1):119-131. Halleskog C, Schulte G: Pertussis toxin-sensitive heterotrimeric G(αi/o) proteins mediate WNT/β-catenin and WNT/ERK1/2 signaling in mouse primary microglia stimulated with purified WNT-3A . Cellular signalling 2013, 25 (4):822-828. Du Y, Yan T, Wu B, He B, Jia Y: Research on the mechanism of antidepressive effect of Suanzaoren Decoction through TLR4/MyD88/NF-κB pathway and Wnt/β-catenin pathway . Journal of ethnopharmacology 2024, 319 (Pt 1):117190. Liddelow SA, Guttenplan KA, Clarke LE, Bennett FC, Bohlen CJ, Schirmer L, Bennett ML, Münch AE, Chung WS, Peterson TC et al : Neurotoxic reactive astrocytes are induced by activated microglia . Nature 2017, 541 (7638):481-487. Additional Declarations No competing interests reported. Supplementary Files FigureS1.tif FigureS2.tif FigureS3.tif FigureS4.tif Table1Primer.xlsx Table2RNAseqmice.xlsx Table3RNAseqGOmice.xlsx Table4RNAseqKEGGmice.xlsx Table5hMeDIPseq.xlsx Table6hMeDIPseqGO.xlsx Table7MeDIPseq.xlsx Table8MeDIPseqGO.xlsx Table9hMeDIPseqKEGG.xlsx Table10MeDIPseqKEGG.xlsx Table11hMeDIPseqPromoter.xlsx Table12MeDIPseqPromoter.xlsx Table13Cytokinesmice.xlsx Textsummary.docx graphicabstract.tif Graphical Abstract Schematic representation (created with BioRender.com) of the role of epigenetic modification, 5-hydroxymethylcytosine (5hmC) in cognitive dysfunction induced by intermittent hypoxia (IH). IH-promoting the 5hmC producing enzyme ten-eleven translocase 1 (TET1) causes neuroinflammation by increasing the expression of Wnt signaling pathway genes, which further leads to hippocampal cognitive dysfunction. Hippocampal specific knockdown of Tet1 increased 5hmC levels and improved cognitive function. Cite Share Download PDF Status: Published Journal Publication published 21 Aug, 2024 Read the published version in Journal of Neuroinflammation → Version 1 posted Editorial decision: Revision requested 28 Apr, 2024 Reviews received at journal 28 Apr, 2024 Reviews received at journal 19 Apr, 2024 Reviewers agreed at journal 12 Apr, 2024 Reviewers agreed at journal 12 Apr, 2024 Reviewers agreed at journal 12 Apr, 2024 Reviewers agreed at journal 12 Apr, 2024 Reviewers invited by journal 12 Apr, 2024 Editor assigned by journal 12 Apr, 2024 Submission checks completed at journal 11 Apr, 2024 First submitted to journal 11 Apr, 2024 You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4251801","acceptedTermsAndConditions":true,"allowDirectSubmit":false,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":290627866,"identity":"e66cecbc-21cd-4eb3-b57f-cf48abbbe0d0","order_by":0,"name":"yaru kong","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences \u0026 Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"yaru","middleName":"","lastName":"kong","suffix":""},{"id":290627867,"identity":"115050ad-473e-42df-9525-d5b7aff012bf","order_by":1,"name":"Jie Ji","email":"","orcid":"","institution":"Capital Medical University, National Center for Children's Health","correspondingAuthor":false,"prefix":"","firstName":"Jie","middleName":"","lastName":"Ji","suffix":""},{"id":290627868,"identity":"7a28a86f-ba43-4871-b6cc-254e4339f330","order_by":2,"name":"Xiaojun Zhan","email":"","orcid":"","institution":"Children’s Hospital Capital Institute of Paediatrics","correspondingAuthor":false,"prefix":"","firstName":"Xiaojun","middleName":"","lastName":"Zhan","suffix":""},{"id":290627869,"identity":"3399879c-363a-4151-bfe7-0c486a96918b","order_by":3,"name":"Weiheng Yan","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences \u0026 Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"Weiheng","middleName":"","lastName":"Yan","suffix":""},{"id":290627870,"identity":"2955f1f0-d148-4b55-90ac-d443f20dce9c","order_by":4,"name":"Fan Liu","email":"","orcid":"","institution":"Chinese Academy of Medical Sciences \u0026 Peking Union Medical College","correspondingAuthor":false,"prefix":"","firstName":"Fan","middleName":"","lastName":"Liu","suffix":""},{"id":290627871,"identity":"93e0ac27-9581-4949-be33-668683dedeba","order_by":5,"name":"Pengfei Ye","email":"","orcid":"","institution":"Children’s Hospital Capital Institute of Paediatrics","correspondingAuthor":false,"prefix":"","firstName":"Pengfei","middleName":"","lastName":"Ye","suffix":""},{"id":290627872,"identity":"3b71aa61-1a63-4033-b9a0-c620154e552a","order_by":6,"name":"Shan Wang","email":"","orcid":"","institution":"Capital Medical University, National Center for Children's Health","correspondingAuthor":false,"prefix":"","firstName":"Shan","middleName":"","lastName":"Wang","suffix":""},{"id":290627873,"identity":"7dce6591-ca10-47f6-8275-0eca998c10a0","order_by":7,"name":"Jun Tai","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAArUlEQVRIiWNgGAWjYPACNjk29vYDxKnlAREHEtiM+XjOJJCkhSFxnoSDAXFa7KUPH3v88QdfepsEQwLDj4ptRNjCl5ZuAHRYbpt04wHGnjO3idDCw2MmAdYicyCBmbGNKC3830Ba0tkkEgyI1cLDBtKSQIKWM2xmEmfS2AzbgIF8kCi/sPcwP5OosDkmL9/efvDBjwoitEDBMTB5gGj1QFBDiuJRMApGwSgYaQAAx9Y1Sklr+g4AAAAASUVORK5CYII=","orcid":"","institution":"Chinese Academy of Medical Sciences \u0026 Peking Union Medical College","correspondingAuthor":true,"prefix":"","firstName":"Jun","middleName":"","lastName":"Tai","suffix":""}],"badges":[],"createdAt":"2024-04-11 10:23:31","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4251801/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4251801/v1","draftVersion":[],"editorialEvents":[{"content":"https://doi.org/10.1186/s12974-024-03189-2","type":"published","date":"2024-08-21T15:56:56+00:00"}],"editorialNote":"","failedWorkflow":false,"files":[{"id":54747727,"identity":"a6ee6ab1-fc14-4884-8f36-b5c9fd806b71","added_by":"auto","created_at":"2024-04-16 07:43:06","extension":"jpg","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":2830243,"visible":true,"origin":"","legend":"\u003cp\u003eIH exposure induced the upregulation of TETs and total 5hmC in the hippocampus of mice. (A) The illustration of IH modeling. (B) Body weight and hippocampal PO\u003csub\u003e2\u003c/sub\u003e. (C) BOLD-fMRI analysis of the hippocampus. (D) Total amount of 5hmC in the hippocampus using standard DNA dot blot. (E) The expression of TET1, TET2, and TET3 in the hippocampus using IHC staining and qPCR. Analysis was performed by Student’s t test. All data are presented as the mean ± standard deviation.\u003c/p\u003e","description":"","filename":"Figure1.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/1085dc58d44a43d66119d630.jpg"},{"id":54747728,"identity":"b6a6d313-90c4-42b8-8ba3-9b5a119839dc","added_by":"auto","created_at":"2024-04-16 07:43:06","extension":"jpg","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":2593515,"visible":true,"origin":"","legend":"\u003cp\u003eIH exposure caused DEGs in the hippocampus of mice. (A) The illustration of hMeDIP-sequencing. (B) DEGs were displayed by hierarchical clustering. (C) GO enrichment. (D) KEGG pathway enrichment.\u003c/p\u003e","description":"","filename":"Figure2.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/655ba910f5f578c385616bac.jpg"},{"id":54747726,"identity":"d04768a3-0c38-4496-8d20-22655b6512fb","added_by":"auto","created_at":"2024-04-16 07:43:06","extension":"jpg","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":3869068,"visible":true,"origin":"","legend":"\u003cp\u003eIH exposure caused DMG / DDG in the hippocampus of mice. (A) Mean normalized counts of 5mC- and 5hmC-enriched regions in the hippocampus. (B) (C) 5 kb distribution of 5mC and 5hmC peaks upstream and downstream of the TSS. (D) GO analysis of the DDGs. (E) GO analysis of the DMGs. (F) KEGG pathway analysis. (G) Cell types enrichment.\u003c/p\u003e","description":"","filename":"Figure3.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/0065fb8218d08e384346aacd.jpg"},{"id":54748157,"identity":"3f00327c-e496-4e5b-8baf-e659698f107f","added_by":"auto","created_at":"2024-04-16 07:51:06","extension":"jpg","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":1326268,"visible":true,"origin":"","legend":"\u003cp\u003eIH exposure promoted the binding of 5hmC to Wnt pathway genes in the hippocampi of mice. (A) The connection by assimilating RNA-sequencing data into methylation, demethylation and gene expression in promoter regions. (B) The expression of \u003cem\u003eWnt3a, Ccnd2\u003c/em\u003e,\u003cem\u003e Prickle2\u003c/em\u003e, \u003cem\u003eIl1b\u003c/em\u003e, \u003cem\u003eFgf13\u003c/em\u003e,\u003cem\u003eHtr4\u003c/em\u003e, \u003cem\u003eAdcy1\u003c/em\u003e, \u003cem\u003eSnap25\u003c/em\u003e, and \u003cem\u003eSyt1 \u003c/em\u003ein the hippocampus using qPCR. (C) 5hmC profiles of \u003cem\u003eWnt3a\u003c/em\u003e, \u003cem\u003eCcnd2\u003c/em\u003e, and \u003cem\u003ePrickle2.\u003c/em\u003e (D) The demethylation levels of specific regions in \u003cem\u003eWnt3a\u003c/em\u003e, \u003cem\u003eCcnd2\u003c/em\u003e and \u003cem\u003ePrickle2\u003c/em\u003e using hMeDIP-qPCR. Analysis was performed by Student’s t test. All data are presented as the mean ± standard deviation.\u003c/p\u003e","description":"","filename":"Figure4.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/6090fb7554dfc194af3c213c.jpg"},{"id":54747731,"identity":"789bea94-2900-463b-967a-bb2ae795cda1","added_by":"auto","created_at":"2024-04-16 07:43:07","extension":"jpg","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":5558301,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eTet1\u003c/em\u003e knockdown was effective in vitro and in vivo. (A) The illustration of \u003cem\u003eTet1 \u003c/em\u003eintervention. (B) The design of the lentivirus carrying sh\u003cem\u003eTet1. \u003c/em\u003e(C) The expression of\u003cem\u003e Tet1\u003c/em\u003ein N2A cells using qPCR. \u0026nbsp;(D) The expression of TET1 in the hippocampus using IHC staining and qPCR. (E) The subcellular localization of TET1 in the hippocampus using IF staining. Analysis was performed by Student’s t test. All data are presented as the mean ± standard deviation.\u003c/p\u003e","description":"","filename":"Figure5.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/9b58697b5bd45c3c9a1eca59.jpg"},{"id":54747738,"identity":"b2fdbe64-bc18-49a8-b5e1-c9b1c4240774","added_by":"auto","created_at":"2024-04-16 07:43:07","extension":"jpg","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":1932633,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eTet1\u003c/em\u003e intervention improved hippocampal cognitive dysfunction in IH mice. Measured in the Barnes maze: (A) Exploratory trajectories on days 5 and 12. (B) Latency to identify target box on days 5 and 12. (C) Latency to identify target box during the 4-day training period. Measured in the Y-maze: (D) Alternation behavior. (E) Number of arm entries. Measured in the NOR: (F) Discrimination index. (G) Total interaction time. Analysis was performed by Student’s t test. All data are presented as the mean ± standard deviation.\u003c/p\u003e","description":"","filename":"Figure6.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/808d36b31e1975fe45228f0d.jpg"},{"id":54748160,"identity":"bddf525d-1ff5-4dea-972d-39fd489456e0","added_by":"auto","created_at":"2024-04-16 07:51:07","extension":"jpg","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":4838217,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eTet1\u003c/em\u003e knockdown increased hippocampal microglia. (A) Hippocampal morphology using HE staining. (B)(C)(D) The expression of DCX, GFAP and IBA1 in the hippocampus using IF staining. Analysis was performed by Student’s t test. All data are presented as the mean± standard deviation.\u003c/p\u003e","description":"","filename":"Figure7.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/58fc7a5108a8cd0523363193.jpg"},{"id":54747733,"identity":"4ca84a4a-0814-4406-9a6c-b92e3428c4be","added_by":"auto","created_at":"2024-04-16 07:43:07","extension":"jpg","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":1680728,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cem\u003eTet1\u003c/em\u003e knockdown alleviated IH-induced hippocampal neuroinflammation in mice. (A) The expression of\u003cem\u003e Wnt3a\u003c/em\u003e,\u003cem\u003e Ccnd2\u003c/em\u003e, and \u003cem\u003ePrickle2\u003c/em\u003e in the hippocampus using qPCR. Analysis was performed by Student’s t test. All experiments were repeated at least three times. All data are presented as the mean± standard deviation. (B) Total amount of 5hmC in the hippocampus using standard DNA dot blot. (C) Differential expression of 23 cytokines was displayed by hierarchical clustering, and 13 of them were significantly upregulated after IH. Analysis was performed by Student’s t test. All data are presented as the mean ± standard deviation.\u003c/p\u003e","description":"","filename":"Figure8.jpg","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/9e996af7fe8b9270cf8579a3.jpg"},{"id":63300183,"identity":"b69cc532-34f8-453c-a9ee-bbe0942223d7","added_by":"auto","created_at":"2024-08-26 16:12:25","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":27370209,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/3afd18c4-ad2e-4a85-af96-a80c5ab5aabd.pdf"},{"id":54748726,"identity":"e7fe874a-e91a-450d-b9c3-1948249e050a","added_by":"auto","created_at":"2024-04-16 07:59:06","extension":"tif","order_by":1,"title":"","display":"","copyAsset":false,"role":"supplement","size":1023532,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS1.tif","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/41e06fb9145a85250a092058.tif"},{"id":54747736,"identity":"dffff80a-4ece-4516-9cd8-e62c4372e62d","added_by":"auto","created_at":"2024-04-16 07:43:07","extension":"tif","order_by":2,"title":"","display":"","copyAsset":false,"role":"supplement","size":396112,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS2.tif","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/2bf8f7149585205ace672658.tif"},{"id":54748161,"identity":"0407713e-d72e-4891-b67d-0b1eac155fa8","added_by":"auto","created_at":"2024-04-16 07:51:07","extension":"tif","order_by":3,"title":"","display":"","copyAsset":false,"role":"supplement","size":3463752,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS3.tif","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/ea8b6e883a4c40c931d8e1fc.tif"},{"id":54748159,"identity":"599f8bc5-4723-4dea-a288-8e593aca127a","added_by":"auto","created_at":"2024-04-16 07:51:07","extension":"tif","order_by":4,"title":"","display":"","copyAsset":false,"role":"supplement","size":1258870,"visible":true,"origin":"","legend":"","description":"","filename":"FigureS4.tif","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/99f1c61932d219b898c99b61.tif"},{"id":54747735,"identity":"bbae7e1e-340b-413a-87f9-c15409f2f8ea","added_by":"auto","created_at":"2024-04-16 07:43:07","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":10418,"visible":true,"origin":"","legend":"","description":"","filename":"Table1Primer.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/49109d84ef2161487bca0359.xlsx"},{"id":54748165,"identity":"759fdb3c-6ea3-4686-b798-f793a113c577","added_by":"auto","created_at":"2024-04-16 07:51:07","extension":"xlsx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":961724,"visible":true,"origin":"","legend":"","description":"","filename":"Table2RNAseqmice.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/e621c151ac5fe0974e0e883a.xlsx"},{"id":54747739,"identity":"2a3c843f-9824-4b54-ae97-fe61e17990b2","added_by":"auto","created_at":"2024-04-16 07:43:07","extension":"xlsx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":472814,"visible":true,"origin":"","legend":"","description":"","filename":"Table3RNAseqGOmice.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/007ee2fbbc58a3e627e2ecb9.xlsx"},{"id":54748163,"identity":"73eb5691-8989-4a9f-b08c-4b5fa60ce5c7","added_by":"auto","created_at":"2024-04-16 07:51:07","extension":"xlsx","order_by":8,"title":"","display":"","copyAsset":false,"role":"supplement","size":22783,"visible":true,"origin":"","legend":"","description":"","filename":"Table4RNAseqKEGGmice.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/09963def4f9778f03238bfaa.xlsx"},{"id":54747753,"identity":"e8109316-b6fb-4e51-b3bc-d35dbd6946b8","added_by":"auto","created_at":"2024-04-16 07:43:08","extension":"xlsx","order_by":9,"title":"","display":"","copyAsset":false,"role":"supplement","size":4765939,"visible":true,"origin":"","legend":"","description":"","filename":"Table5hMeDIPseq.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/4ef1a13dd294be39e964a665.xlsx"},{"id":54747743,"identity":"5b14b0e7-5138-4b31-b67a-03d8e9376033","added_by":"auto","created_at":"2024-04-16 07:43:07","extension":"xlsx","order_by":10,"title":"","display":"","copyAsset":false,"role":"supplement","size":890434,"visible":true,"origin":"","legend":"","description":"","filename":"Table6hMeDIPseqGO.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/493d2e12d82e1001ca3efaa0.xlsx"},{"id":54747752,"identity":"ab0445fc-6b6b-45ac-8937-5b011e83940f","added_by":"auto","created_at":"2024-04-16 07:43:08","extension":"xlsx","order_by":11,"title":"","display":"","copyAsset":false,"role":"supplement","size":12031903,"visible":true,"origin":"","legend":"","description":"","filename":"Table7MeDIPseq.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/33180b97fb656074fe5e0b21.xlsx"},{"id":54747745,"identity":"8f0a8e82-e422-49cf-90ec-e125512ebf6c","added_by":"auto","created_at":"2024-04-16 07:43:07","extension":"xlsx","order_by":12,"title":"","display":"","copyAsset":false,"role":"supplement","size":1452899,"visible":true,"origin":"","legend":"","description":"","filename":"Table8MeDIPseqGO.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/0edd534a11f811c3a109f522.xlsx"},{"id":54747750,"identity":"72d65b47-e203-4847-ace5-bae0bde605aa","added_by":"auto","created_at":"2024-04-16 07:43:07","extension":"xlsx","order_by":13,"title":"","display":"","copyAsset":false,"role":"supplement","size":41248,"visible":true,"origin":"","legend":"","description":"","filename":"Table9hMeDIPseqKEGG.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/e985c3128f3f699b99fa6a13.xlsx"},{"id":54747747,"identity":"53a3422d-b785-49b5-86c7-64ae71a25180","added_by":"auto","created_at":"2024-04-16 07:43:07","extension":"xlsx","order_by":14,"title":"","display":"","copyAsset":false,"role":"supplement","size":49759,"visible":true,"origin":"","legend":"","description":"","filename":"Table10MeDIPseqKEGG.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/fba7a3359a8bf18d2f08ca94.xlsx"},{"id":54748164,"identity":"400b38d3-a3b1-45e4-8478-352ccd8c7977","added_by":"auto","created_at":"2024-04-16 07:51:07","extension":"xlsx","order_by":15,"title":"","display":"","copyAsset":false,"role":"supplement","size":208393,"visible":true,"origin":"","legend":"","description":"","filename":"Table11hMeDIPseqPromoter.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/b22dced652a3fee86cfc8084.xlsx"},{"id":54748162,"identity":"654728b1-ee47-4e74-8d8a-f562505db607","added_by":"auto","created_at":"2024-04-16 07:51:07","extension":"xlsx","order_by":16,"title":"","display":"","copyAsset":false,"role":"supplement","size":426494,"visible":true,"origin":"","legend":"","description":"","filename":"Table12MeDIPseqPromoter.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/4c659719cbda102e77086bfd.xlsx"},{"id":54747748,"identity":"013a6e7d-9ab8-4eb1-9185-3df29df08e65","added_by":"auto","created_at":"2024-04-16 07:43:07","extension":"xlsx","order_by":17,"title":"","display":"","copyAsset":false,"role":"supplement","size":10515,"visible":true,"origin":"","legend":"","description":"","filename":"Table13Cytokinesmice.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/4cd4b400090f2e762d6378a8.xlsx"},{"id":54747741,"identity":"b71d22d0-b2fd-45b5-b3d3-8fd98c1d7118","added_by":"auto","created_at":"2024-04-16 07:43:07","extension":"docx","order_by":18,"title":"","display":"","copyAsset":false,"role":"supplement","size":14273,"visible":true,"origin":"","legend":"","description":"","filename":"Textsummary.docx","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/91852a5cb1fa5cf441550057.docx"},{"id":54747744,"identity":"c9ace72a-4bd8-438e-8971-79a6ce4d9313","added_by":"auto","created_at":"2024-04-16 07:43:07","extension":"tif","order_by":19,"title":"","display":"","copyAsset":false,"role":"supplement","size":706336,"visible":true,"origin":"","legend":"\u003cp\u003eGraphical Abstract\u003c/p\u003e\n\u003cp\u003eSchematic representation (created with BioRender.com) of the role of epigenetic modification, 5-hydroxymethylcytosine (5hmC) in cognitive dysfunction induced by intermittent hypoxia (IH). IH-promoting the 5hmC producing enzyme ten-eleven translocase 1 (TET1) causes neuroinflammation by increasing the expression of Wnt signaling pathway genes, which further leads to hippocampal cognitive dysfunction. Hippocampal specific knockdown of \u003cem\u003eTet1\u003c/em\u003e increased 5hmC levels and improved cognitive function.\u003c/p\u003e","description":"","filename":"graphicabstract.tif","url":"https://assets-eu.researchsquare.com/files/rs-4251801/v1/c8f04f334ad7b35e32aea9b5.tif"}],"financialInterests":"No competing interests reported.","formattedTitle":"Tet1-mediated 5hmC regulates hippocampal neuroinflammation via wnt signaling as a novel mechanism in obstructive sleep apnoea leads to cognitive deficit","fulltext":[{"header":"Introduction","content":"\u003cp\u003eObstructive sleep apnoea (OSA) is the most common type of sleep-disordered breathing, affecting approximately 1\u0026nbsp;billion adults worldwide; the largest number of OSA in China [\u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e1\u003c/span\u003e]. OSA is characterized by recurrent upper airway obstruction during sleep, resulting in intermittent hypoxia (IH), sleep fragmentation, further systemic inflammation and oxidative stress [\u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2\u003c/span\u003e]. Untreated OSA is widely recognized to be associated with an increased risk of hypertension [\u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e3\u003c/span\u003e], diabetes [\u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e4\u003c/span\u003e], and cognitive dysfunction [\u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e5\u003c/span\u003e], leading to substantial health and social burdens. In particular, the consequences of cognitive dysfunction, which includes impaired neurodevelopment in children [\u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e6\u003c/span\u003e, \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e7\u003c/span\u003e] and neurodegenerative diseases in elderly individuals [\u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e8\u003c/span\u003e], have received extensive attention in recent years. Cognitive dysfunction in OSA patients may be related to regional hippocampal volume changes; an increase in the volume suggests inflammation and glial activation and a decrease in volume may be a result of long-term neuronal damage [\u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e9\u003c/span\u003e]. IH may play a central role in causing attention, memory and executive function impairment in OSA patients [\u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e10\u003c/span\u003e]. In vivo experiments have demonstrated that IH can drive cognitive dysfunction through microglia-mediated hippocampal inflammatory injury in mice [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e]. However, the specific molecular mechanism involved is unclear.\u003c/p\u003e \u003cp\u003eDNA methylation, one of the most studied epigenetic modifications, occurs at the 5-carbon position of cytosine residues to generate 5-methylcytosine (5mC), which was once considered to be stable [\u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e12\u003c/span\u003e]. The ten-eleven translocation (TET) enzymes TET1-3 are members of the 2-oxoglutarate-dependent dioxygenase (2-OGDD) family and oxidize DNA 5mC to 5-hydroxymethylcytosine (5hmC), suggesting a novel mechanism for DNA demethylation [\u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e13\u003c/span\u003e, \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e14\u003c/span\u003e]. The importance of 5hmc-mediated epigenetic modifications in physiological processes is being revealed, as it dynamically regulates development and aging, and its dysregulation induces tumours and neurodegenerative diseases [\u003cspan additionalcitationids=\"CR16 CR17 CR18\" citationid=\"CR15\" class=\"CitationRef\"\u003e15\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e19\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eWhile the levels of 5mC are comparable across organs throughout the body, the distribution of 5hmC varies depending on tissue or cell type, with particularly high levels in neurons in the central nervous system (CNS) [\u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e20\u003c/span\u003e]. Therefore, TETs mediated DNA hydroxymethylation may be involved in regulating neuronal activity and cognitive processes. TET1 has been found to be the most characterized member of the TET family involved in learning and memory; however, this phenomenon is also controversial [\u003cspan citationid=\"CR21\" class=\"CitationRef\"\u003e21\u003c/span\u003e]. Both the loss and overexpression of \u003cem\u003eTet1\u003c/em\u003e have been reported to enhance or impair memory, which may be related to the cell type specificity of TET1 [\u003cspan additionalcitationids=\"CR23 CR24 CR25 CR26\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. For instance, knockdown of \u003cem\u003eTet1\u003c/em\u003e specifically in astrocytes resulted in abnormal neuronal development and impaired cognitive function in the hippocampus of mice [\u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e23\u003c/span\u003e]. However, \u003cem\u003eTet1\u003c/em\u003e overexpression in hippocampal CA1 pyramidal cells contributed to long-term memory impairment after episodic fear conditioning [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Although it is well established that TET requires oxygen for catalytic activity, the data reported on the response of TET to hypoxia are conflicting. In a variety of tumour cells, hypoxia can directly reduce the oxidative activity of TETs to promote DNA demethylation [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e29\u003c/span\u003e]. However, hypoxia increases \u003cem\u003eTet1\u003c/em\u003e expression and 5hmC levels in certain types of cells, such as neuroblastoma [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e] and glioblastoma cells [\u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e31\u003c/span\u003e], probably because \u003cem\u003eTet1\u003c/em\u003e coactivates with HIF independently of enzymatic activity [\u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e, \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e32\u003c/span\u003e, \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e33\u003c/span\u003e]. To date, changes in \u003cem\u003eTet1\u003c/em\u003e and 5hmC in the hippocampus and their effects on cognitive function in IH patients have not been studied.\u003c/p\u003e \u003cp\u003eHere, we assessed the role of DNA demethylation in cognitive dysfunction in IH mice. In addition, the therapeutic effect of hippocampal-specific knockdown of \u003cem\u003eTet1\u003c/em\u003e was investigated. This study aims to reveal the neuroinflammation -related molecular regulatory mechanism of OSA whit cognitive dysfunction from the perspective of Wnt signaling activation in hippocampal microglia.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cdiv id=\"Sec3\" class=\"Section2\"\u003e \u003ch2\u003eAnimals\u003c/h2\u003e \u003cp\u003e8-week-old male BALB/c mice, weighing 18\u0026ndash;20 g, were purchased from Beijing Shenghe Experimental Animal Technology Co., Ltd. The mice were kept at a specific pathogen-free condition of 18\u0026ndash;26 ℃ and 40\u0026ndash;70% humidity, accompanied by a standard light-dark cycle. Experiments were performed in strict accordance with institutional ethical codes and were approved by the Animal Care and Use Ethics Committee of the Capital Institute of Pediatrics (DWLL2021016).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eCell culture and transfection\u003c/h2\u003e \u003cp\u003eHuman embryonic kidney cell line 293T and mouse brain neuroma cell line N2A were obtained from the Capital Institute of Pediatrics Cell Bank. The cells were cultured in Dulbecco\u0026rsquo;s modified Eagle\u0026rsquo;s medium (DMEM; Gibco, USA) with 10% fetal bovine serum (FBS; Gibco), 100 \u0026micro;g/mL penicillin and 100 \u0026micro;g/mL streptomycin (Gibco) at 37\u0026deg;C and 5% CO\u003csub\u003e2\u003c/sub\u003e. To interfere the expression of \u003cem\u003eTet1\u003c/em\u003e, a shRNA interference sequence targeting \u003cem\u003eTet1\u003c/em\u003e (5'-3': GCAATCAGTTAGCAGACTTGA) was designed and synthesized and named \u003cem\u003eshTet1\u003c/em\u003e. The negative control virus was named shNC. These are purchased from Genechem (Shanghai, China). 293Ts were used for infections with a MOI of 1. N2As were used for infections with a MOI of 20. 72 h after transfection, the relative amount of green fluorescence in 293Ts was observed under a high-content microscope (Theo Fisher, USA), and N2As were collected for PCR identification.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003eGroup, modeling and treatment\u003c/h2\u003e \u003cdiv id=\"Sec6\" class=\"Section3\"\u003e \u003ch2\u003eGroup\u003c/h2\u003e \u003cp\u003eAfter three days of acclimatization to the new environment, a total of 80 mice were randomly divided into 4 groups (n\u0026thinsp;=\u0026thinsp;20/group): control group, IH group, IH\u0026thinsp;+\u0026thinsp;shNC group, and IH\u0026thinsp;+\u0026thinsp;sh\u003cem\u003eTet1\u003c/em\u003e group.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec7\" class=\"Section2\"\u003e \u003ch2\u003eModeling\u003c/h2\u003e \u003cp\u003eIH group, IH\u0026thinsp;+\u0026thinsp;shNC group, and IH\u0026thinsp;+\u0026thinsp;sh\u003cem\u003eTet1\u003c/em\u003e group were exposed to IH for 6 weeks using a hyperbaric oxygen chamber (Beijing Zhongshi Dichuang Technology Development Co., Ltd., China). The IH mode was 1 min alternating cycle (oxygen concentration 5%-21%) for 8 h / d (8:00 am to 4:00 pm) [\u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e34\u003c/span\u003e]. The control group was maintained in room air. At the end of the 4th week, the body weight and the hippocampal partial pressure of oxygen (PaO\u003csub\u003e2\u003c/sub\u003e) were measured in the control and IH groups.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eTreatment\u003c/h2\u003e \u003cp\u003eAfter 4 weeks of IH treatment, IH\u0026thinsp;+\u0026thinsp;shNC and IH\u0026thinsp;+\u0026thinsp;sh\u003cem\u003eTet1\u003c/em\u003e mice were injected with shNC and sh\u003cem\u003eTet1\u003c/em\u003e in the hippocampus, respectively. In brief, mice were anesthetized with isoflurane and fixed in the stereotaxy (Beijing Zhongshi Dichuang Technology Development Co., Ltd.). Artificial tear ointment was applied to the eyes of the mice. Hair was cut off from the top of the skull and a longitudinal incision was made in the skin. Blunt dissection was used to remove connective tissue overlying the skull. Two holes were made in the skull using a small dental drill, with coordinates of \u0026plusmn;\u0026thinsp;1.9 mm inter-aural, \u0026minus; 1.4 mm relative to the bregma, and +\u0026thinsp;1.8 mm from the dural surface [\u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e35\u003c/span\u003e]. The injection infusion rate was set at 0.8 \u0026micro;L/min, and the total infusion volume was 1\u0026micro;L/hemisphere. After infusion, the needle was left in place for 1min to minimize diffusion and then slowly withdrawn. Finally, the incision was sutured and the mice were returned to their cages.\u003c/p\u003e \u003cp\u003eAt the end of the 6th week, a portion of each group of mice was euthanized, and brains were rapidly removed and processed for study. The other part was used for behavioral assessment and then euthanized.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003ePartial pressure of oxygen (PO\u003csub\u003e2\u003c/sub\u003e) in the hippocampus\u003c/h2\u003e \u003cp\u003eThe PO\u003csub\u003e2\u003c/sub\u003e value in the hippocampus of mice was detected by tissue oxygen partial pressure detection device (Beijing Zhongshi Dichuang Technology Development Co., Ltd.). In brief, a stereotaxy was used to fix isoflurane-anesthetized mice and guide the probe into the hippocampus. PO\u003csub\u003e2\u003c/sub\u003e was detected in real time. It was recorded until PO\u003csub\u003e2\u003c/sub\u003e values were in the 10% range for 3 min. The left and right hippocampi were averaged.\u003c/p\u003e \u003cdiv id=\"Sec10\" class=\"Section3\"\u003e \u003ch2\u003eFunctional magnetic resonance imaging (fMRI) data acquisition and analysis\u003c/h2\u003e \u003cp\u003eThe MRI scanning was performed by the BRUKER 7.0-T MRI (Bruker Pharmasca 7.0/16us, Germany) scanner. Anatomical images were acquired using rapid acquisition with relaxation enhancement (RARE) sequence with the following parameters: matrix size 256 \u0026times; 256, field of view (FOV)\u0026thinsp;=\u0026thinsp;2 cm \u0026times; 2 cm, repetition time (TR)/ echo time (TE)\u0026thinsp;=\u0026thinsp;4500/45 ms, and number of excitation (NEX)\u0026thinsp;=\u0026thinsp;4. Functional scans were acquired using gradient-echo planar imaging (EPI): slice thickness\u0026thinsp;=\u0026thinsp;1 mm, matrix size\u0026thinsp;=\u0026thinsp;80 x 64, FOV\u0026thinsp;=\u0026thinsp;2.43 cm x 2.1 cm, TR/TE\u0026thinsp;=\u0026thinsp;2000/15 ms, and NEX\u0026thinsp;=\u0026thinsp;1. Statistical parametric mapping software was used for image pre-processing and statistical analysis. The blood oxygenation level dependent (BOLD) values were analyzed and compared between the the control and IH groups. All functional image post-processing was done by an experienced observer who was blinded to the scanned objects. The voxel-level height threshold was P\u0026thinsp;\u0026lt;\u0026thinsp;0.05, and the clusterextent threshold was 20 voxels.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec11\" class=\"Section2\"\u003e \u003ch2\u003eRNA-sequencing and transcriptomics analysis\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted by Trizol (Invitrogen, USA). Ribo-Zero rRNA Removal kit (Illumina, USA) was used to remove rRNAs from the total RNA. High-quality RNA was preprocessed by TruSeq Stranded Total RNA Library Prep kit (Illumina) to construct cDNA libraries. The libraries were qualified and quantified with BioAnalyzer 2100 system (Agilent Technologies, USA). High-quality libraries were denatured into single-stranded DNA, captured on Illumina flowcell and amplified into clusters in situ, and then 150 cycle sequencing was performed on NovaSeq 6000 sequencer (Illumina). The sequencing data were imported into R Platform 4.2.0 to screen differentially expressed genes (DEGs). Genes with adjust P values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 and |log2 (Fold change)| \u0026ge; 1 were considered to have differential expression. DEGs were used for Gene ontology (GO) analysis, Kyoto encyclopedia of genes and genomes (KEGG) pathway analysis and protein-protein interaction (PPI) network construction.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec12\" class=\"Section2\"\u003e \u003ch2\u003eHydroxymethylated / methylated DNA immunoprecipitation (hMeDIP / MeDIP) Sequencing\u003c/h2\u003e \u003cp\u003eGenomic DNA was extracted from the hippocampus of mice in the control and IH groups using the DNeasy kit (QIAGEN, Germany) and sonicated to fragments ranging from 100 to 300 bp. Subsequently, the fragmented DNA was end repaired with the Universal DNA Library Prep kit (GenSeq, China), adding dA tails and adaptor sequences. A portion of the DNA labeled input (about 10%) after the adaptor was added was retained, and the remaining was subjected to immunoprecipitation reaction with the 5mC MeDIP kit and 5hmC MeDIP kit (GenSeq), respectively. The Illumina PCR Primers and 2\u0026times;HiFi PCR Mix (GenSeq) were used for library amplification and purification of immunoprecipitated DNA as well as Input DNA that had not been immunoprecipitated. Purified DNA libraries were quantified by Qubit (ThermoFisher) fluorescence assay and sequenced with NovaSeq 6000 sequencer.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec13\" class=\"Section2\"\u003e \u003ch2\u003ehMeDIP-PCR\u003c/h2\u003e \u003cp\u003eDNA samples were fragmented to 100 to 300 bp, and each sample was divided into purified immunoprecipitated DNA and input DNA. The purified DNA was used to verify the target gene. Primer sequences are shown in Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec14\" class=\"Section2\"\u003e \u003ch2\u003eQuantitative real-time (qRT)-PCR\u003c/h2\u003e \u003cp\u003eTotal RNA was extracted by Trizol. Reverse transcription of cDNA using PrimeScriptTM RT kit (ABM, Canada). qRT-PCR with the LightCycler 480 system (Roche, Switzerland) was performed using Maxima SYBR Green/ROX qPCR Master Mix (ABM). The relative expression level was calculated by 2\u0026thinsp;\u0026minus;\u0026thinsp;ΔΔCt. Primer sequences are shown in Supplementary Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec15\" class=\"Section2\"\u003e \u003ch2\u003eCell-type annotation\u003c/h2\u003e \u003cp\u003eAccording to the existing annotations of the brain in the CellMarker database (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://biocc.hrbmu.edu.cn/CellMarker/\u003c/span\u003e\u003cspan address=\"http://biocc.hrbmu.edu.cn/CellMarker/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) [\u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e36\u003c/span\u003e], DEGs, differentially methylated/demethylated genes (DMG/DDG)-enriched cell types were marked.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec16\" class=\"Section2\"\u003e \u003ch2\u003eDNA extraction and dot blot\u003c/h2\u003e \u003cp\u003eThe TIANamp Genomic DNA Kit (Tiangen, Beijing, China) was used to extract genomic DNA from mice hippocampus. Genomic DNA was denatured and dot onto a nitrocellulose filter membrane (Whatman, UK) and violet cross-linked. The membrane was blocked with 5% milk and then incubated with primary antibodies against 5hmC (dilution 1: 1000; Cell Signaling Technology) and 5mC (dilution 1:1000; Cell Signaling Technology) antibodies overnight at 4\u0026deg;C. After washing with TBST, membrane was incubated with peroxidase-coupled secondary antibodies for 1 h at 37\u0026deg;C and then developed using enhanced chemiluminescence (7sea biotech, Shanghai, China). The signals were quantified using ImageJ software. In addition, 0.02% methylene blue was stained in 0.3 M sodium acetate (pH 5.2) to visualize DNA as a total genomic DNA loading control.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec17\" class=\"Section2\"\u003e \u003ch2\u003eHematoxylin-eosin (HE) staining\u003c/h2\u003e \u003cp\u003eBrain tissues were fixed in 4% paraformaldehyde for 48h. The tissues were washed with phosphate buffered saline (PBS), dehydrated with ethanol, embedded in paraffin, and sliced. Sections were stained with H\u0026amp;E and examined under a light microscope (Nikon, 80i, Japan). Representative images were obtained at high magnifications of 400\u0026times;.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec18\" class=\"Section2\"\u003e \u003ch2\u003eImmunohistochemistry (IHC) staining\u003c/h2\u003e \u003cp\u003eThe tissue antigen was repaired. Sections were blocked with 5% goat serum protein and then incubated with primary antibodies against TET1 (dilution 1:500; GeneTex, USA), TET2 (dilution 1:200; Cell Signaling Technology), and TET3 (dilution 1:500; GeneTex) antibodies overnight at 4\u0026deg;C. After washing with PBS, the sections were incubated with peroxidase-coupled secondary antibodies for 30 min at 37\u0026deg;C. Representative images were obtained at high magnifications of 400\u0026times;. Image J software was used to analyze the images.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec19\" class=\"Section2\"\u003e \u003ch2\u003eImmunofluorescence (IF) staining\u003c/h2\u003e \u003cp\u003eSections were incubated with primary antibodies against TET1 (dilution 1:100; GeneTex), DCX (dilution 1:100; Cell Signaling Technology), Iba-1 (dilution 1:100; Cell Signaling Technology), GFAP (dilution 1:100; Cell Signaling Technology) antibodies overnight at 4\u0026deg;C and subsequently incubated with Cy5-labeled secondary antibodies for 30min at 37\u0026deg;C. Nuclei were stained with DAPI. Representative images were observed under a fluorescence microscope (Leica, Wetzlar, Germany). Representative images were obtained at high magnifications of 400\u0026times;.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec20\" class=\"Section2\"\u003e \u003ch2\u003eLuminex liquid suspension chip analysis\u003c/h2\u003e \u003cp\u003eLuminex liquid suspension chip analysis was performed using the Bio-Plex Pro Mouse Cytokine Grp I Panel 23-plex Assay (Bio-Rad, USA). In brief, mouse hippocampi were incubated for 30min in 96-well plates embedded with microspheres, followed by 30min incubation with detection antibodies. Subsequently, Streptavidin-PE was added for 10min and values were read using the Bio-Plex 200 system (Luminex Corporation, USA).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec21\" class=\"Section2\"\u003e \u003ch2\u003eBehavior assessment\u003c/h2\u003e \u003cdiv id=\"Sec22\" class=\"Section3\"\u003e \u003ch2\u003eBarnes maze\u003c/h2\u003e \u003cp\u003eMice were assessed for behavior 2 weeks after stereotaxic injection. Short-term and long-term spatial learning and memory were assessed using the Barnes maze [\u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e37\u003c/span\u003e]. The maze consisted of a circular platform with 20 holes arranged equally spaced at the edges, one of which was connected to a dark chamber, the target hole. The stimulus of light (a 200 W white light lamp) forced mice to search for the target hole. Each mouse was allowed to adapt for 2 min the day before testing. During the training session, each mouse underwent a 4-day spatial acquisition phase in which two 3-min trials spaced 15 min apart were performed each day. Each mouse was placed in the center of the platform and covered with an opaque chamber for 5 s. The chamber was subsequently removed and the mice allowed to explore freely for 3 min. Aversive light was turned on to encourage the mouse to run and escape into the target hole. When the target hole failed to be entered within 3 min, the mice were gently guided into the target hole using a transparent chamber. Mice were allowed to explore the target hole for 1min before being returned to their main cage and the platform cleaned with 70% ethanol. Mice were tested for short-term memory on day 5 and long-term memory on day 12. The time to find the target hole was recorded for each trial, and the trajectory was depicted using the Tracking Master system v4.0 (Beijing Zhongshi Technology Co., Ltd.).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec23\" class=\"Section3\"\u003e \u003ch2\u003eY-maze maze\u003c/h2\u003e \u003cp\u003eY-maze maze consisted of three equiangularly arranged arms, labeled A, B, and C, each 40 cm long, 5 cm wide, and 13 cm high [\u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e38\u003c/span\u003e]. Each mouse was placed distal to arm A and moved freely through the maze over an 8-min period, and the order and number of its arm entries were recorded. Consecutive entry into all three arms (i.e., ABC, BAC, CBA) was considered a single spontaneous alternating behavior. Percentage alternation was calculated as the ratio of actual and possible alternation (the total number of entries into the arm minus 2), multiplied by 100. The number of entering arms was used as an indicator of motor function.\u003c/p\u003e \u003c/div\u003e \u003c/div\u003e \u003cdiv id=\"Sec24\" class=\"Section2\"\u003e \u003ch2\u003eNovel object recognition (NOR)\u003c/h2\u003e \u003cp\u003eNOR was performed in an open field 0.3m long, 0.3m wide, and 0.45 m high [\u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e39\u003c/span\u003e]. Mice were trained for 5min, during which time they were placed in the center of the arena in the presence of two identical objects. After 1h of training, mice were replaced into the open field for testing in which one of the objects was replaced by a novel object. Time spent exploring old and new objects was quantified using the Tracking Master system v4.0. The discrimination index was calculated as (T\u003csub\u003enovel\u003c/sub\u003e - T\u003csub\u003eFamiliar\u003c/sub\u003e) / (T\u003csub\u003eNovel\u003c/sub\u003e + T\u003csub\u003eFamiliar\u003c/sub\u003e).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec25\" class=\"Section2\"\u003e \u003ch2\u003eStatistical analysis\u003c/h2\u003e \u003cp\u003eAll data are in average\u0026thinsp;\u0026plusmn;\u0026thinsp;standard deviation (SD) and repeated at least 3 times. All data were analyzed using GraphPad Prism v9.4. The differences between the groups were determined by the student T-test (two groups) or one-way analysis of variance (ANOVA). P values\u0026thinsp;\u0026lt;\u0026thinsp;0.05 for difference was statistically significant.\u003c/p\u003e \u003c/div\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec27\" class=\"Section2\"\u003e \u003ch2\u003eIH exposure induced the upregulation of TETs and total 5hmC in the hippocampus of mice\u003c/h2\u003e \u003cp\u003eThe IH mouse model was established as described in previous studies (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA). The body weight and hippocampal PO\u003csub\u003e2\u003c/sub\u003e in the IH group were significantly lower than those in the control group (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB). fMRI analysis of the IH mice revealed significantly lower BOLD signal activation in the hippocampus, especially on the left side, than in the control mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC). Previous studies have shown that TETs mediated 5hmC modification plays an important role in regulating cognitive function. The total amount of 5hmC in the hippocampus of control and IH mice was quantified using standard dot blot analysis. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eD, 5hmC levels were significantly increased by IH compared with those in the controls. We determined the expression of TET1, TET2 and TET3 enzymes in the hippocampus by immunohistochemistry (IHC) and qPCR. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE, compared with those in the controls, the mRNA expression levels of \u003cem\u003eTet1\u003c/em\u003e, \u003cem\u003eTet2\u003c/em\u003e, and \u003cem\u003eTet3\u003c/em\u003e in the IH group increased significantly. Interestingly, \u003cem\u003eTet1\u003c/em\u003e level increased approximately 2-fold. Meanwhile, the protein expression levels of TET1, TET2 and TET3 were also increased in the hippocampal dentate gyrus of IH mice (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eE). Overall, IH induced the expression of DNA hydroxymethyltransferase TET and modification of global 5hmC.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec28\" class=\"Section2\"\u003e \u003ch2\u003eIH exposure caused DEGs in the hippocampus of mice\u003c/h2\u003e \u003cp\u003eThe hMeDIP-seq process is shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA. To evaluate the effect of IH on the hippocampus, the hippocampi of the control and IH mice were subjected to transcriptome sequencing. A total of 3263 DEGs were identified, including 1 309 upregulated DEGs and 1 954 downregulated DEGs (Supplementary Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e). Hierarchical clustering and volcano plot were used to analyse the DEGs and visualize the genomic data (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB, Supplementary Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eA). The PPI network was constructed and the degree was calculated to obtain the key target protein. The top 20 target proteins are mostly related to cell cycle (e.g., Cdk1, Ccnb1, Bub1) or Wnt (e.g., Wnt3a, Wnt2) (Supplementary Figure \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003eB). GO and KEGG pathway enrichment analyses were subsequently performed using the DEGs. A total of 1 703 GO terms were obtained, including 3 676 BP, 303 CC, and 573 MF (adjusted P value\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Supplementary Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e). As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eC, compared with those in the controls, the regulated transcripts in the hippocampi of IH mice were associated with the BP terms axonogenesis, axon guidance, and the pattern specification process, MF terms, such as ion and gated channel activity, and in CC terms, such as the synaptic membrane and ion channel complex. A total of 88 Signaling pathways were enriched according to KEGG pathway analysis (P value\u0026thinsp;\u0026lt;\u0026thinsp;0.05) (Supplementary Table \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e). Twenty pathways, including neuroactive ligand‒receptor interaction, the cAMP Signaling pathway, the Wnt Signaling pathway, and the MAPK Signaling pathway, were screened for visualization based on the P value (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eD). These results showed that IH altered the expression of inflammatory- and neuroactive-related genes in the hippocampus.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec29\" class=\"Section2\"\u003e \u003ch2\u003eIH exposure caused DMG/DDG in the hippocampus of mice\u003c/h2\u003e \u003cp\u003eMeDIP-seq and hMeDIP-seq were performed on 5mC and 5hmC, respectively, to map the genome differences between the hippocampi of control and IH mice. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eA, there were significant differences in the mean normalized counts of 5mC- and 5hmC-enriched regions in the hippocampus between control and IH mice. Heatmap clustering was used to visualize the 5 kb distribution of 5mC and 5hmC peaks upstream and downstream of the transcription start site (TSS) (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). Compared with control mice, IH mice presented decreased enrichment of 5mC in this genomic region, whereas the corresponding level of 5hmC increased (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eC). Genes containing altered 5hmC peaks were analysed, and 12 606 genes were found to be differentially demethylated in the hippocampus between control and IH mice; 10 994 of these genes were demethylated, and 1 612 were not demethylated (Supplementary Table \u003cspan refid=\"MOESM5\" class=\"InternalRef\"\u003eS5\u003c/span\u003e). GO analysis of the DDGs revealed a total of 5 824 enriched GO items, including 4 723 BP, 392 CC, and 709 MF terms (Supplementary Table \u003cspan refid=\"MOESM6\" class=\"InternalRef\"\u003eS6\u003c/span\u003e). According to the adjusted P value, 30 GO terms were screened for visual analysis. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eD, compared with controls, DDGs in the hippocampus of IH mice were involved in axonogenesis, synapse organization and cell junction assembly to BP, which were found to play a role in MF such as GTPase regulator activity and nucleoside-triphosphatase regulator activity and in CC such as glutamatergic synapse and neuron to neuron synapse. Genes containing altered 5mC peaks were analysed, and 16 033 genes were found to be differentially methylated in the hippocampus between control and IH mice, 15 620 of which were methylated and 413 of which were unmethylated (Supplementary Table \u003cspan refid=\"MOESM7\" class=\"InternalRef\"\u003eS7\u003c/span\u003e). GO analysis of the DMGs revealed a total of 4 732 enriched GO items, including 3 977 BP, 288 CC, and 467 MF terms (Supplementary Table \u003cspan refid=\"MOESM8\" class=\"InternalRef\"\u003eS8\u003c/span\u003e). According to the adjusted P value, 30 GO terms were screened for visual analysis. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eE, compared with controls, DMGs in the hippocampus of IH mice were involved in axonogenesis, positive regulation of kinase activity and synapse organization to BP, which were found to play a role in MF such as metal ion transmembrane transporter activity and gated channel activity and in CC such as receptor complex and synaptic membrane. Moreover, they were enriched in CCs such as receptor complexes and synaptic membranes. KEGG analysis of the DDGs and DMGs revealed 121 and 123 enriched Signaling pathways, respectively (Supplementary Table \u003cspan refid=\"MOESM9\" class=\"InternalRef\"\u003eS9\u003c/span\u003e, Supplementary Table \u003cspan refid=\"MOESM10\" class=\"InternalRef\"\u003eS10\u003c/span\u003e). According to the adjusted P value, 10 pathways were screened separately for visualization; among these pathways, the DDG-enriched pathways included axon guidance, the cAMP Signaling pathway, and the Wnt Signaling pathway, and the corresponding DMGs included the calcium Signaling pathway, the PI3K-Akt Signaling pathway, and axon guidance (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eF). The cell types enriched in the upregulated and downregulated DEGs, upregulated DDGs, and upregulated DMGs are marked. As shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e3\u003c/span\u003eG, the upregulated DEGs were enriched mainly in neurons and basket cells, and the downregulated DEGs were enriched mainly in ependymal cells and the other 4 cell types. The upregulated DMGs were enriched mainly in ependymal cells and the other 7 cell types, and the upregulated DDGs were enriched mainly in 10 cell types, including smooth muscle cells, Cajal\u0026ndash;Retzius cells, olfactory ensheathing glia, oligodendrocytes, endothelial cells and Bergmann glial cells. These data indicated that IH induced global enrichment of 5hmC markers, especially in genes related to inflammation and neural activity.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cem\u003eIH exposure promoted the binding of 5hmC to Wnt pathway genes in the hippocampi of mice\u003c/em\u003e \u003c/p\u003e \u003cp\u003eGiven the critical function of 5hmC alterations in controlling gene expression, we investigated the relationship between 5hmC and mRNA levels. Supplementary Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eA shows the proportion of 5mC and 5hmC peaks in each genomic region. Significant differences were found by comparing the enrichment of 5mC and 5hmC in promoter regions in the hippocampus of control and IH mice (Supplementary Figure \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003eB). The RNA-sequencing data was combined with the methylation, demethylation and gene expression in promoter regions data (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eA, Supplementary Table \u003cspan refid=\"MOESM11\" class=\"InternalRef\"\u003eS11\u003c/span\u003e, S12). Compared with those in the control group, the expression and demethylation levels of genes involved in the Wnt (\u003cem\u003eWnt3a\u003c/em\u003e, \u003cem\u003eCcnd2\u003c/em\u003e and \u003cem\u003ePrickle2\u003c/em\u003e), synaptic vesicle cycle (\u003cem\u003eSnap25\u003c/em\u003e, \u003cem\u003eSyt1\u003c/em\u003e), MAPK (\u003cem\u003eIl1b\u003c/em\u003e, \u003cem\u003eFgf13\u003c/em\u003e) and cAMP (\u003cem\u003eHtr4\u003c/em\u003e, \u003cem\u003eAdcy1\u003c/em\u003e) Signaling pathways were increased. The expression of the above genes in the hippocampi of control and IH mice was examined by qPCR. The results showed that the above genes were upregulated after IH stimulation (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). 5hmC profiles revealed high 5hmC levels during IH treatment (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eC, Supplementary Figure \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e). The demethylation levels of specific regions in \u003cem\u003eWnt3a\u003c/em\u003e, \u003cem\u003eCcnd2\u003c/em\u003e and \u003cem\u003ePrickle2\u003c/em\u003e were validated by hMeDIP-qPCR. The results showed that IH stimulation increased the binding of the above genes to 5hmC (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e4\u003c/span\u003eD). These findings suggested that 5hmC modification may play an epigenetic regulatory role in the expression of \u003cem\u003eWnt3a\u003c/em\u003e, \u003cem\u003eCcnd2\u003c/em\u003e and \u003cem\u003ePrickle2\u003c/em\u003e in the Wnt pathway in the hippocampi of IH-treated mice.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e\n\u003ch3\u003eTet1 intervention improved hippocampal cognitive dysfunction in IH mice\u003c/h3\u003e\n\u003cdiv class=\"Heading\"\u003eTet1 intervention improved hippocampal cognitive dysfunction in IH mice\u003c/div\u003e \u003cp\u003eTaken together, our data demonstrate that the expression of DNA hydroxymethyltransferases, especially TET1, is significantly altered in the hippocampus of IH mice, suggesting a critical role for DNA hydroxymethylation. To investigate IH further, we altered the DNA hydroxymethylation levels in the hippocampus by knocking down \u003cem\u003eTet1\u003c/em\u003e using a lentivirus plasmid (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). IH mice treated with shNC or sh\u003cem\u003eTet1\u003c/em\u003e are shown in Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eA. Figure\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eB illustrates the design of the lentivirus carrying sh\u003cem\u003eTet1\u003c/em\u003e. 293T cells were transfected with shNC or sh\u003cem\u003eTet1\u003c/em\u003e for 72 h, and green fluorescence was observed under a high-content microscope, confirming successful transfection (Supplementary Figure \u003cspan refid=\"MOESM4\" class=\"InternalRef\"\u003eS4\u003c/span\u003e). The qPCR results showed that the \u003cem\u003eTet1\u003c/em\u003e mRNA level in N2A cells transfected with sh\u003cem\u003eTet1\u003c/em\u003e was significantly lower than that in N2A cells transfected with shNC, while there was no significant difference between the shNC-transfected cells and the control cells (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eC). IHC and qPCR showed that both the staining and relative mRNA expression of total TET1 in the hippocampus of sh\u003cem\u003eTet1\u003c/em\u003e-treated mice were significantly lower than those in the IH group (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eD). Immunofluorescence (IF) staining demonstrated the subcellular localization of TET1 in the hippocampus, and the localization changes after IH treatment and \u003cem\u003eTet1\u003c/em\u003e knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e5\u003c/span\u003eE). Hippocampus is an important brain region responsible for encoding and storing memories. Therefore, behavioral assessments were performed after IH, including Barnes maze, Y maze, and NOR tests. The exploratory trajectories of the Barnes maze-treated mice on Days 5 and 12 showed that the short-term and long-term memory deficits, respectively, were impaired after IH exposure but recovered after \u003cem\u003eTet1\u003c/em\u003e knockdown (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eA). The latency to identify target box was significantly greater in the IH group than in the control group, while it was significantly lower in the IH\u0026thinsp;+\u0026thinsp;sh\u003cem\u003eTet1\u003c/em\u003e group than in the IH group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eB). Figure\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eC shows the changes in latency to reach the target box during the 4-day training period in each group of mice. The Y-maze test showed that spontaneous alternation behaviour was significantly lower in the IH group than in the control group but was significantly greater in the IH\u0026thinsp;+\u0026thinsp;sh\u003cem\u003eTet1\u003c/em\u003e group than in the IH group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eD). There was no significant difference in the total number of arm entries between the groups, suggesting that the changes in spontaneous alternation behaviour were not due to motor deficits (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eE). The NOR test showed that the preference of mice for new objects was significantly lower in the IH group than in the control group but was significantly greater in the IH\u0026thinsp;+\u0026thinsp;sh\u003cem\u003eTet1\u003c/em\u003e group than in the IH group (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eF). There was no significant difference in the total interaction time with old or new objects between the groups, suggesting that the changes in the discrimination index were not due to lack of interest (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003eG). These findings suggested that \u003cem\u003eTet1\u003c/em\u003e knockdown can ameliorate the short-term and long-term memory impairment caused by IH.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cdiv id=\"Sec31\" class=\"Section2\"\u003e \u003ch2\u003eTet1 knockdown decreased hippocampal gliocytes and immature neurons\u003c/h2\u003e \u003cp\u003eModerate neurogenesis and neuroinflammation have beneficial effects on the brain; however, their excess is often catastrophic. In our study, neurons in the hippocampi of control mice were arranged in order, clearly stained, and had a normal microstructure under normal oxygen conditions. The pathological changes in the IH group were obvious; the neurons were loosely arranged, the staining was light, and neuron loss and nuclear pyknosis were observed (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). The morphology of all the tissues tended to normalize after treatment with sh\u003cem\u003eTet1\u003c/em\u003e (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eA). IF staining was used to examine the expression of DCX (a marker of immature neurons), IBA1 (a marker of microglia) and GFAP (a marker of astrocytes). IH treatment significantly increased the expression of DCX, IBA1, and GFAP, of which DCX and GFAP were significantly decreased after sh\u003cem\u003eTet1\u003c/em\u003e injection, and IBA1, although not significantly, also tended to decrease (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003eB-E). These findings suggested that IH caused abnormal neurogenesis and neuroinflammation in the hippocampus, which was abolished by \u003cem\u003eTet1\u003c/em\u003e intervention.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec32\" class=\"Section2\"\u003e \u003ch2\u003eTet1 knockdown alleviated IH-induced hippocampal neuroinflammation in mice\u003c/h2\u003e \u003cp\u003eWnt pathway is a key pathway regulating neurogenesis and neuroinflammation, and its dysregulation causes a variety of neuropathologies. Compared with those in the hippocampi of IH mice, the \u003cem\u003eWnt3a\u003c/em\u003e, \u003cem\u003eCcnd2\u003c/em\u003e, and \u003cem\u003ePrickle2\u003c/em\u003e mRNA levels were significantly lower in the hippocampi of sh\u003cem\u003eTet1\u003c/em\u003e mice, as determined by qPCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eA). Compared with that in the hippocampi of IH mice, the 5hmC level in the hippocampi of sh\u003cem\u003eTet1\u003c/em\u003e mice was decreased, as determined by standard dot blot (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eB). Luminex liquid suspension chip analysis was used to compare the differential expression of 23 cytokines in the hippocampus of the control group, IH group and IH\u0026thinsp;+\u0026thinsp;sh\u003cem\u003eTet1\u003c/em\u003e group (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC). Thirteen cytokines were significantly upregulated after IH, and the five most upregulated proteins were MIP1a, IL17A, KC, IL3 and IL12 (p40). The expression of eight cytokines, such as TNFa, IL3, IL9 and IL17A, decreased significantly after sh\u003cem\u003eTet1\u003c/em\u003e injection (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003eC, Supplementary Table \u003cspan refid=\"MOESM13\" class=\"InternalRef\"\u003eS13\u003c/span\u003e). Taken together, these data indicate that \u003cem\u003eTet1\u003c/em\u003e-targeted therapy may be effective against IH-induced hippocampal inflammation, possibly by limiting the excessive levels of 5hmC and Wnt pathway genes.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cp\u003eIH is an important feature of OSA and plays a major role in hippocampal oxidative stress injury and cognitive dysfunction [\u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e40\u003c/span\u003e]; however, the exact mechanism involved remains poorly understood. In this study, for the first time, we revealed the effects of IH on the DNA demethylation process in the mouse hippocampus and linked these effects with changes in hippocampus-related cognitive functions. In addition, we found that IH regulated neuroinflammation and neurogenesis through the demethylation of Wnt Signaling pathway genes, which was reversed by \u003cem\u003eTet1\u003c/em\u003e knockdown.\u003c/p\u003e \u003cp\u003eThe enzymatic activity of TETs, members of the 2-OGDD superfamily, may be regulated by oxygen availability and redox-based mechanisms, thereby catalysing the progressive oxidation of 5mC from DNA [\u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e41\u003c/span\u003e, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e42\u003c/span\u003e]. There has been some understanding of the effect of hypoxia on the enzymatic activity and expression of TET in different tumors. Hypoxia can reduce oxygen-dependent TET enzyme activity without increasing \u003cem\u003eTET\u003c/em\u003e expression in several tumour cell lines [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e]. In neuroblastoma, however, hypoxia causes a strong compensatory increase in \u003cem\u003eTET\u003c/em\u003e expression [\u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e28\u003c/span\u003e, \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e30\u003c/span\u003e]. In thyroid cancer, \u003cem\u003eTET1\u003c/em\u003e changes from a tumour suppressor under normoxia to an oncogene under hypoxia [\u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e43\u003c/span\u003e]. These counterexamples may reflect the oxygen state-dependent nonenzymatic function of TET1. The TET-mediated demethylation intermediate 5hmC is a stable epigenetic marker that generally promotes gene expression [\u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e44\u003c/span\u003e, \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e]. 5hmC is most abundant in the central nervous system, and its continuous increase in the hippocampus and other brain regions of mice from early postnatal to adulthood and possibly into old age indicates its close association with brain function and disease [\u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e45\u003c/span\u003e, \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e46\u003c/span\u003e]. Interestingly, TET1, TET2, and TET3 expression as well as total 5hmC levels were significantly higher in the hippocampi of IH mice than in those of control mice. It is possible that IH, as a moderate chronic hypoxia, is not sufficient to cause a substantial reduction in TET enzyme activity or that TETs at least partially play a direct nonenzymatic role. Among the TET enzymes, TET1 is the most studied and highly controversial in the field of neuroscience, and both its loss and overexpression have been reported to enhance or impair memory, which may be partially attributed to the differential regulation of its two isoforms in neurons and glial cells, respectively [\u003cspan additionalcitationids=\"CR23 CR24 CR25 CR26\" citationid=\"CR22\" class=\"CitationRef\"\u003e22\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. \u003cem\u003eTet1\u003c/em\u003e\u003csup\u003e\u003cem\u003eS\u003c/em\u003e\u003c/sup\u003e is highly enriched in neurons, and its repression enhances hippocampus-dependent memory in mice, whereas \u003cem\u003eTet1\u003c/em\u003e\u003csup\u003e\u003cem\u003eFL\u003c/em\u003e\u003c/sup\u003e is more abundant in glial cells, and its repression impairs memory [\u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e27\u003c/span\u003e]. However, overexpression of \u003cem\u003eTet1\u003c/em\u003e specifically in hippocampal CA1 pyramidal cells caused memory impairment [\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e24\u003c/span\u003e]. Thus, it seems that the regulation of hippocampus-mediated cognitive function by \u003cem\u003eTet1\u003c/em\u003e is more complex than expected. \u003cem\u003eTet2\u003c/em\u003e also has cell type specificity in regulating cognitive processes, as its loss in adult neural progenitor cells impairs neurogenesis and cognitive function, whereas its loss in neurons enhances hippocampus-dependent memory by modulating synaptic plasticity [\u003cspan citationid=\"CR47\" class=\"CitationRef\"\u003e47\u003c/span\u003e, \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e48\u003c/span\u003e]. Loss of \u003cem\u003eTet3\u003c/em\u003e in brain neurons impairs hippocampal spatial orientation and short-term memory [\u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e49\u003c/span\u003e, \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e50\u003c/span\u003e]. Therefore, we hypothesized that IH-induced hippocampus-related cognitive dysfunction in mice may be associated with 5hmC modification mediated by TETs. We found that IH mice exhibited significant decreases in spatial learning and short-term and long-term memory. Pathological changes were found in the hippocampus by HE staining, and a decreased BOLD signal was found by fMRI, especially on the left side of the hippocampus. We will further investigate the reasons for this bilateral asymmetry in the future.\u003c/p\u003e \u003cp\u003eStudies have showen that IH can cause hippocampal inflammatory damage and subsequent cognitive dysfunction, which may be mediated mainly by microglia [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e51\u003c/span\u003e, \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e52\u003c/span\u003e]. We found several Signaling pathways that were enriched in the DDGs and DEGs. These genes were found to be involved in neuroregulation-related pathways, including axon guidance, neuroactive ligand‒receptor interaction, and calcium Signaling pathways, as well as inflammation-related pathways, such as MAPK Signaling pathways, NF-κB Signaling pathways and Th17 cell differentiation. Strikingly, the Wnt Signaling pathway, which is considered to regulate both neurogenesis and neuroinflammation [\u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e53\u003c/span\u003e], was also enriched. The Wnt Signaling pathway is divided into the canonical Wnt/β-catenin pathway and the noncanonical Wnt Signaling pathway, which include the calcium pathway and planar cell polarity pathway [\u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e54\u003c/span\u003e]. Neurogenesis, a highly dynamic process that continues throughout the lifetime in rodents and humans, plays an important role in hippocampus-dependent learning and memory [\u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e55\u003c/span\u003e]. Loss of normal neurogenesis or the generation of abnormal neurogenesis can disrupt hippocampal neural circuits, leading to cognitive dysfunction [\u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e56\u003c/span\u003e]. The Wnt Signaling pathway is the main factor controlling adult hippocampal neurogenesis, and proper Wnt Signaling pathway activation is required to regulate the proliferation, differentiation and maturation of neurons [\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e57\u003c/span\u003e, \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e58\u003c/span\u003e]. During the early stages of neurogenesis, canonical Wnt Signaling determines cell proliferation and maturation and subsequently, together with noncanonical Wnt Signaling, regulates differentiation and morphological development [\u003cspan additionalcitationids=\"CR60\" citationid=\"CR59\" class=\"CitationRef\"\u003e59\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e]. However, excessive activation of this pathway may impair the maturation of neurons, causing dendrite, spine and synapse dysplasia [\u003cspan additionalcitationids=\"CR62\" citationid=\"CR61\" class=\"CitationRef\"\u003e61\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e63\u003c/span\u003e]. The effect of the Wnt Signaling pathway on neuroinflammation is mainly achieved by regulating microglial activation. In a variety of CNS diseases, microglial activation mediated by canonical Wnt Signaling is generally characterized by an anti-inflammatory protective effect, while noncanonical Wnt Signaling-mediated microglial activation is proinflammatory and promotes disease progression [\u003cspan additionalcitationids=\"CR65 CR66 CR67 CR68 CR69 CR70\" citationid=\"CR64\" class=\"CitationRef\"\u003e64\u003c/span\u003e\u0026ndash;\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e71\u003c/span\u003e].\u003c/p\u003e \u003cp\u003eEven if, for instance, Wnt/β-catenin activity coincides with early neuronal damage and microglial inflammation in the hippocampi of mice with experimental autoimmune encephalomyelitis, this change can be interpreted as active inflammation activating Wnt Signaling, triggering hippocampal neurogenesis, and replenishing damaged neurons [\u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e72\u003c/span\u003e]. However, \u003cem\u003eWnt3a\u003c/em\u003e plays dual regulatory roles in microglial and may be related to the activation of other inflammatory pathways. Intraventrically injected GSK3β inhibitors to activate canonical Signaling pathways in premature rabbits with intraventricular haemorrhage inhibited microglial inflammation, while \u003cem\u003ert-Wnt3a\u003c/em\u003e promoted inflammation [\u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e73\u003c/span\u003e]. In vitro, \u003cem\u003eWnt3a\u003c/em\u003e can convert microglia to a proinflammatory phenotype, probably through its activation of the ERK1/2 pathway in addition to the canonical Wnt pathway [\u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e74\u003c/span\u003e, \u003cspan citationid=\"CR75\" class=\"CitationRef\"\u003e75\u003c/span\u003e]. Activation of the NF-κB pathway can be observed when a Wnt/β-catenin pathway agonist is added to microglia, and vice versa; this bidirectional positive feedback effect may cause sustained activation of both pathways and exacerbate inflammatory damage [\u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e76\u003c/span\u003e]. In addition, activated microglia can also enhance the neurotoxicity of astrocytes by secreting a variety of inflammatory mediators to jointly drive inflammatory damage in the CNS [\u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e11\u003c/span\u003e, \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e77\u003c/span\u003e]. Therefore, we identified \u003cem\u003eWnt3a\u003c/em\u003e, \u003cem\u003ePrickle2\u003c/em\u003e and \u003cem\u003eCcnd2\u003c/em\u003e in the Wnt Signaling pathway as key demethylation regulators and demonstrated increased demethylation and gene expression in the hippocampi of IH mice. The levels of IBA1 (a marker of microglia), GFAP (a marker of astrocytes) and DCX (a marker of immature neurons) in the DG region of the hippocampus were significantly increased after IH, and the levels of a variety of inflammatory cytokines were significantly upregulated.\u003c/p\u003e \u003cp\u003eGiven the importance and complexity of TET1 in regulating hippocampal cognitive function shown in the literature and its significant upregulation in the hippocampi of IH mice, we decided to validate the induced phenotypic changes by eliminating demethylation via hippocampus-specific knockdown of \u003cem\u003eTet1\u003c/em\u003e. TET1 was found to be expressed only in specific cells in the DG region by IF staining, and we will investigate its colocalization in the future. As we predicted, sh\u003cem\u003eTet1\u003c/em\u003e treatment resulted in significant improvements in spatial learning and memory, significant reductions in Wnt Signaling pathway gene demethylation and gene expression, and normalization of neurological function markers and some cytokines.\u003c/p\u003e"},{"header":"Conclusions","content":"\u003cp\u003eOur results demonstrated that Wnt pathway gene demethylation was involved in the development of IH-induced cognitive dysfunction in mice by regulating hippocampal neuroinflammation and neurogenesis, which could be reversed by specific knockdown of hippocampal \u003cem\u003eTet1\u003c/em\u003e. We hope that our study contributes to the understanding of the underlying mechanisms of cognitive impairment in OSA patients and suggests a potentially effective target for intervention.\u003c/p\u003e"},{"header":"Abbreviations","content":"\u003ctable border=\"0\" cellspacing=\"0\" cellpadding=\"0\" width=\"629\"\u003e\n \u003ctbody\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003e2-OGDD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003e2-oxoglutarate-dependent\u0026nbsp;dioxygenase\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003e5hmC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003e5-hydroxymethylcytosine\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003e5mC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003e5-methylcytosine\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003eBOLD\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003eblood oxygenation level dependent\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003eCNS\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003ecentral nervous system\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003eDDGs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003edifferentially demethylated genes\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003eDEGs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003edifferentially expressed genes\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003eDMGs\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003edifferentially methylated genes\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003efMRI\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003efunctional magnetic resonance imaging\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003eHE\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003ehematoxylin-eosin\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003ehMeDIP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003ehydroxymethylated DNA immunoprecipitation\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003eIF\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003eimmunofluorescence\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003eIHC\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003eimmunohistochemistry\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003eIH\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003eintermittent hypoxia\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003eMeDIP\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003emethylated DNA immunoprecipitation\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003eNOR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003enovel object recognition\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003eOSA\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003eobstructive sleep\u0026nbsp;apnoea\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003ePO\u003csub\u003e2\u003c/sub\u003e\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003epartial pressure of oxygen\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003eqRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003equantitative real-time qRT-PCR\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003ctr\u003e\n \u003ctd width=\"49.12559618441971%\" valign=\"top\"\u003e\n \u003cp\u003eTET\u003c/p\u003e\n \u003c/td\u003e\n \u003ctd width=\"50.87440381558029%\" valign=\"top\"\u003e\n \u003cp\u003eten-eleven translocation\u0026nbsp;\u003c/p\u003e\n \u003c/td\u003e\n \u003c/tr\u003e\n \u003c/tbody\u003e\n\u003c/table\u003e"},{"header":"Declarations","content":"\u003cp\u003e\u003cstrong\u003eAuthour Contribution\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll authors contributed to the conception and design of the study. KY and JJ conducted most of the experiments, prepared the manuscript and contributed equally. ZX, LF, and YP help analyze data and comment on previous manuscripts. All the authors approved the final draft. Dr. Fei Yang and Dr. Shan wang are the guarantor of this work, and as such, they has full access to all the data in the study and is responsible for the integrity of the data and the accuracy of the data analysis. All authors read and approved the final manuscript.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eFunding\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThis work was supported by grants from Public service development and reform pilot project of Beijing Medical Research Institute (BMR2021-3), National natural science foundation of China (81970900), Capital\u0026apos;s Funds for Health Improvement and Research (2022-2-1132),Beijing Hospitals Authority\u0026rsquo;s Ascent Plan (DFL20221102), and Research Foundation of Capital Institute of Pediatrics (LCY-2023-23).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eAvailability of data and materials\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eAll data generated or analyzed during this study are included in the published article (and its additional files) and are available from the corresponding author upon reasonable request. The raw RNA-seq, hMeDIP-seq and MeDIP-seq generated during and/or analyzed during the current study is available from the corresponding author upon reasonable request.\u003c/p\u003e\n\u003cp\u003eEthics approval and consent to participate\u003c/p\u003e\n\u003cp\u003eAll experiments were approved by the Animal Care and Use Ethics Committee of the Capital Institute of Pediatrics (DWLL2021016). Anesthesia and euthanasia of animals were consulted with the American Veterinary Medical Association (AVMA) Guidelines for the Euthanasia of Animals (2020).\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConsent for publication\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eNot applicable.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eCompeting interests\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe authors declare no competing interests.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eData availability\u003c/strong\u003e\u003c/p\u003e\n\u003cp\u003eThe data analyzed during this study are included in this published article and the supplemental data files. Additional supporting data are available from the corresponding authors upon reasonable request.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eBenjafield AV, Ayas NT, Eastwood PR, Heinzer R, Ip MSM, Morrell MJ, Nunez CM, Patel SR, Penzel T, Pepin JL\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eEstimation of the global prevalence and burden of obstructive sleep apnoea: a literature-based analysis\u003c/strong\u003e. \u003cem\u003eLancet Respir Med \u003c/em\u003e2019, \u003cstrong\u003e7\u003c/strong\u003e(8):687-698.\u003c/li\u003e\n\u003cli\u003ePatel SR: \u003cstrong\u003eObstructive Sleep Apnea\u003c/strong\u003e. \u003cem\u003eAnn Intern Med \u003c/em\u003e2019, \u003cstrong\u003e171\u003c/strong\u003e(11):ITC81-ITC96.\u003c/li\u003e\n\u003cli\u003eHou H, Zhao Y, Yu W, Dong H, Xue X, Ding J, Xing W, Wang W: \u003cstrong\u003eAssociation of obstructive sleep apnea with hypertension: A systematic review and meta-analysis\u003c/strong\u003e. \u003cem\u003eJ Glob Health \u003c/em\u003e2018, \u003cstrong\u003e8\u003c/strong\u003e(1):010405.\u003c/li\u003e\n\u003cli\u003eWang C, Tan J, Miao Y, Zhang Q: \u003cstrong\u003eObstructive sleep apnea, prediabetes and progression of type 2 diabetes: A systematic review and meta-analysis\u003c/strong\u003e. \u003cem\u003eJ Diabetes Investig \u003c/em\u003e2022, \u003cstrong\u003e13\u003c/strong\u003e(8):1396-1411.\u003c/li\u003e\n\u003cli\u003eLiu X, Ma Y, Ouyang R, Zeng Z, Zhan Z, Lu H, Cui Y, Dai Z, Luo L, He C\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eThe relationship between inflammation and neurocognitive dysfunction in obstructive sleep apnea syndrome\u003c/strong\u003e. \u003cem\u003eJ Neuroinflammation \u003c/em\u003e2020, \u003cstrong\u003e17\u003c/strong\u003e(1):229.\u003c/li\u003e\n\u003cli\u003eda Silva Gusmao Cardoso T, Pompeia S, Miranda MC: \u003cstrong\u003eCognitive and behavioral effects of obstructive sleep apnea syndrome in children: a systematic literature review\u003c/strong\u003e. \u003cem\u003eSleep Med \u003c/em\u003e2018, \u003cstrong\u003e46\u003c/strong\u003e:46-55.\u003c/li\u003e\n\u003cli\u003eYu C, Fu Y, Lu Y, Huang Y, Chen F, Wei J, Li L, Ampadu JA, Wang Y, Zheng W\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eAlterations of brain gray matter volume in children with obstructive sleep apnea\u003c/strong\u003e. \u003cem\u003eFrontiers in neurology \u003c/em\u003e2023, \u003cstrong\u003e14\u003c/strong\u003e:1107086.\u003c/li\u003e\n\u003cli\u003eBubu OM, Andrade AG, Umasabor-Bubu OQ, Hogan MM, Turner AD, de Leon MJ, Ogedegbe G, Ayappa I, Jean-Louis GG, Jackson ML\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eObstructive sleep apnea, cognition and Alzheimer\u0026apos;s disease: A systematic review integrating three decades of multidisciplinary research\u003c/strong\u003e. \u003cem\u003eSleep Med Rev \u003c/em\u003e2020, \u003cstrong\u003e50\u003c/strong\u003e:101250.\u003c/li\u003e\n\u003cli\u003eMacey PM, Prasad JP, Ogren JA, Moiyadi AS, Aysola RS, Kumar R, Yan-Go FL, Woo MA, Albert Thomas M, Harper RM: \u003cstrong\u003eSex-specific hippocampus volume changes in obstructive sleep apnea\u003c/strong\u003e. \u003cem\u003eNeuroimage Clin \u003c/em\u003e2018, \u003cstrong\u003e20\u003c/strong\u003e:305-317.\u003c/li\u003e\n\u003cli\u003eOlaithe M, Bucks RS, Hillman DR, Eastwood PR: \u003cstrong\u003eCognitive deficits in obstructive sleep apnea: Insights from a meta-review and comparison with deficits observed in COPD, insomnia, and sleep deprivation\u003c/strong\u003e. \u003cem\u003eSleep Med Rev \u003c/em\u003e2018, \u003cstrong\u003e38\u003c/strong\u003e:39-49.\u003c/li\u003e\n\u003cli\u003eBezzi P, Domercq M, Brambilla L, Galli R, Schols D, De Clercq E, Vescovi A, Bagetta G, Kollias G, Meldolesi J\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eCXCR4-activated astrocyte glutamate release via TNFalpha: amplification by microglia triggers neurotoxicity\u003c/strong\u003e. \u003cem\u003eNat Neurosci \u003c/em\u003e2001, \u003cstrong\u003e4\u003c/strong\u003e(7):702-710.\u003c/li\u003e\n\u003cli\u003eKoivunen P, Laukka T: \u003cstrong\u003eThe TET enzymes\u003c/strong\u003e. \u003cem\u003eCellular and Molecular Life Sciences \u003c/em\u003e2017, \u003cstrong\u003e75\u003c/strong\u003e(8):1339-1348.\u003c/li\u003e\n\u003cli\u003eTahiliani M, Koh KP, Shen Y, Pastor WA, Bandukwala H, Brudno Y, Agarwal S, Iyer LM, Liu DR, Aravind L\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eConversion of 5-methylcytosine to 5-hydroxymethylcytosine in mammalian DNA by MLL partner TET1\u003c/strong\u003e. \u003cem\u003eScience \u003c/em\u003e2009, \u003cstrong\u003e324\u003c/strong\u003e(5929):930-935.\u003c/li\u003e\n\u003cli\u003eIto S, D\u0026apos;Alessio AC, Taranova OV, Hong K, Sowers LC, Zhang Y: \u003cstrong\u003eRole of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification\u003c/strong\u003e. \u003cem\u003eNature \u003c/em\u003e2010, \u003cstrong\u003e466\u003c/strong\u003e(7310):1129-1133.\u003c/li\u003e\n\u003cli\u003eLi W, Zhang X, Lu X, You L, Song Y, Luo Z, Zhang J, Nie J, Zheng W, Xu D\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003e5-Hydroxymethylcytosine signatures in circulating cell-free DNA as diagnostic biomarkers for human cancers\u003c/strong\u003e. \u003cem\u003eCell research \u003c/em\u003e2017, \u003cstrong\u003e27\u003c/strong\u003e(10):1243-1257.\u003c/li\u003e\n\u003cli\u003eArmstrong MJ, Jin Y, Vattathil SM, Huang Y, Schroeder JP, Bennet DA, Qin ZS, Wingo TS, Jin P: \u003cstrong\u003eRole of TET1-mediated epigenetic modulation in Alzheimer\u0026apos;s disease\u003c/strong\u003e. \u003cem\u003eNeurobiol Dis \u003c/em\u003e2023, \u003cstrong\u003e185\u003c/strong\u003e:106257.\u003c/li\u003e\n\u003cli\u003eSpiers H, Hannon E, Schalkwyk LC, Bray NJ, Mill J: \u003cstrong\u003e5-hydroxymethylcytosine is highly dynamic across human fetal brain development\u003c/strong\u003e. \u003cem\u003eBMC genomics \u003c/em\u003e2017, \u003cstrong\u003e18\u003c/strong\u003e(1):738.\u003c/li\u003e\n\u003cli\u003eSzulwach KE, Li X, Li Y, Song CX, Wu H, Dai Q, Irier H, Upadhyay AK, Gearing M, Levey AI\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003e5-hmC-mediated epigenetic dynamics during postnatal neurodevelopment and aging\u003c/strong\u003e. \u003cem\u003eNat Neurosci \u003c/em\u003e2011, \u003cstrong\u003e14\u003c/strong\u003e(12):1607-1616.\u003c/li\u003e\n\u003cli\u003eJohnson ND, Huang L, Li R, Li Y, Yang Y, Kim HR, Grant C, Wu H, Whitsel EA, Kiel DP\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eAge-related DNA hydroxymethylation is enriched for gene expression and immune system processes in human peripheral blood\u003c/strong\u003e. \u003cem\u003eEpigenetics \u003c/em\u003e2020, \u003cstrong\u003e15\u003c/strong\u003e(3):294-306.\u003c/li\u003e\n\u003cli\u003eGlobisch D, Munzel M, Muller M, Michalakis S, Wagner M, Koch S, Bruckl T, Biel M, Carell T: \u003cstrong\u003eTissue distribution of 5-hydroxymethylcytosine and search for active demethylation intermediates\u003c/strong\u003e. \u003cem\u003ePLoS One \u003c/em\u003e2010, \u003cstrong\u003e5\u003c/strong\u003e(12):e15367.\u003c/li\u003e\n\u003cli\u003eAlaghband Y, Bredy TW, Wood MA: \u003cstrong\u003eThe role of active DNA demethylation and Tet enzyme function in memory formation and cocaine action\u003c/strong\u003e. \u003cem\u003eNeurosci Lett \u003c/em\u003e2016, \u003cstrong\u003e625\u003c/strong\u003e:40-46.\u003c/li\u003e\n\u003cli\u003eKwon W, Kim HS, Jeong J, Sung Y, Choi M, Park S, Lee J, Jang S, Kim SH, Lee S\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTet1 overexpression leads to anxiety-like behavior and enhanced fear memories via the activation of calcium-dependent cascade through Egr1 expression in mice\u003c/strong\u003e. \u003cem\u003eFASEB J \u003c/em\u003e2018, \u003cstrong\u003e32\u003c/strong\u003e(1):390-403.\u003c/li\u003e\n\u003cli\u003eXu W, Zhang X, Liang F, Cao Y, Li Z, Qu W, Zhang J, Bi Y, Sun C, Zhang J\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTet1 Regulates Astrocyte Development and Cognition of Mice Through Modulating GluA1\u003c/strong\u003e. \u003cem\u003eFront Cell Dev Biol \u003c/em\u003e2021, \u003cstrong\u003e9\u003c/strong\u003e:644375.\u003c/li\u003e\n\u003cli\u003eKaas GA, Zhong C, Eason DE, Ross DL, Vachhani RV, Ming GL, King JR, Song H, Sweatt JD: \u003cstrong\u003eTET1 controls CNS 5-methylcytosine hydroxylation, active DNA demethylation, gene transcription, and memory formation\u003c/strong\u003e. \u003cem\u003eNeuron \u003c/em\u003e2013, \u003cstrong\u003e79\u003c/strong\u003e(6):1086-1093.\u003c/li\u003e\n\u003cli\u003eRudenko A, Dawlaty MM, Seo J, Cheng AW, Meng J, Le T, Faull KF, Jaenisch R, Tsai LH: \u003cstrong\u003eTet1 is critical for neuronal activity-regulated gene expression and memory extinction\u003c/strong\u003e. \u003cem\u003eNeuron \u003c/em\u003e2013, \u003cstrong\u003e79\u003c/strong\u003e(6):1109-1122.\u003c/li\u003e\n\u003cli\u003eZhang RR, Cui QY, Murai K, Lim YC, Smith ZD, Jin S, Ye P, Rosa L, Lee YK, Wu HP\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTet1 regulates adult hippocampal neurogenesis and cognition\u003c/strong\u003e. \u003cem\u003eCell Stem Cell \u003c/em\u003e2013, \u003cstrong\u003e13\u003c/strong\u003e(2):237-245.\u003c/li\u003e\n\u003cli\u003eGreer CB, Wright J, Weiss JD, Lazarenko RM, Moran SP, Zhu J, Chronister KS, Jin AY, Kennedy AJ, Sweatt JD\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTet1 Isoforms Differentially Regulate Gene Expression, Synaptic Transmission, and Memory in the Mammalian Brain\u003c/strong\u003e. \u003cem\u003eJ Neurosci \u003c/em\u003e2021, \u003cstrong\u003e41\u003c/strong\u003e(4):578-593.\u003c/li\u003e\n\u003cli\u003eThienpont B, Steinbacher J, Zhao H, D\u0026apos;Anna F, Kuchnio A, Ploumakis A, Ghesquiere B, Van Dyck L, Boeckx B, Schoonjans L\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTumour hypoxia causes DNA hypermethylation by reducing TET activity\u003c/strong\u003e. \u003cem\u003eNature \u003c/em\u003e2016, \u003cstrong\u003e537\u003c/strong\u003e(7618):63-68.\u003c/li\u003e\n\u003cli\u003eMorin A, Goncalves J, Moog S, Castro-Vega LJ, Job S, Buffet A, Fontenille MJ, Woszczyk J, Gimenez-Roqueplo AP, Letouze E\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTET-Mediated Hypermethylation Primes SDH-Deficient Cells for HIF2alpha-Driven Mesenchymal Transition\u003c/strong\u003e. \u003cem\u003eCell Rep \u003c/em\u003e2020, \u003cstrong\u003e30\u003c/strong\u003e(13):4551-4566 e4557.\u003c/li\u003e\n\u003cli\u003eMariani CJ, Vasanthakumar A, Madzo J, Yesilkanal A, Bhagat T, Yu Y, Bhattacharyya S, Wenger RH, Cohn SL, Nanduri J\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTET1-mediated hydroxymethylation facilitates hypoxic gene induction in neuroblastoma\u003c/strong\u003e. \u003cem\u003eCell Rep \u003c/em\u003e2014, \u003cstrong\u003e7\u003c/strong\u003e(5):1343-1352.\u003c/li\u003e\n\u003cli\u003ePrasad P, Mittal SA, Chongtham J, Mohanty S, Srivastava T: \u003cstrong\u003eHypoxia-Mediated Epigenetic Regulation of Stemness in Brain Tumor Cells\u003c/strong\u003e. \u003cem\u003eStem Cells \u003c/em\u003e2017, \u003cstrong\u003e35\u003c/strong\u003e(6):1468-1478.\u003c/li\u003e\n\u003cli\u003eTsai YP, Chen HF, Chen SY, Cheng WC, Wang HW, Shen ZJ, Song C, Teng SC, He C, Wu KJ: \u003cstrong\u003eTET1 regulates hypoxia-induced epithelial-mesenchymal transition by acting as a co-activator\u003c/strong\u003e. \u003cem\u003eGenome Biol \u003c/em\u003e2014, \u003cstrong\u003e15\u003c/strong\u003e(12):513.\u003c/li\u003e\n\u003cli\u003eMa L, Qi T, Wang S, Hao M, Sakhawat A, Liang T, Zhang L, Cong X, Huang Y: \u003cstrong\u003eTet methylcytosine dioxygenase 1 promotes hypoxic gene induction and cell migration in colon cancer\u003c/strong\u003e. \u003cem\u003eJ Cell Physiol \u003c/em\u003e2019, \u003cstrong\u003e234\u003c/strong\u003e(5):6286-6297.\u003c/li\u003e\n\u003cli\u003ePoulain L, Thomas A, Rieusset J, Casteilla L, Levy P, Arnaud C, Dematteis M: \u003cstrong\u003eVisceral white fat remodelling contributes to intermittent hypoxia-induced atherogenesis\u003c/strong\u003e. \u003cem\u003eThe European respiratory journal \u003c/em\u003e2014, \u003cstrong\u003e43\u003c/strong\u003e(2):513-522.\u003c/li\u003e\n\u003cli\u003eFerrer I, Andr\u0026eacute;s-Benito P, Carmona M, del Rio JA: \u003cstrong\u003eCommon and Specific Marks of Different Tau Strains Following Intra-Hippocampal Injection of AD, PiD, and GGT Inoculum in hTau Transgenic Mice\u003c/strong\u003e. \u003cem\u003eInternational Journal of Molecular Sciences \u003c/em\u003e2022, \u003cstrong\u003e23\u003c/strong\u003e(24):15940.\u003c/li\u003e\n\u003cli\u003eZhang X, Lan Y, Xu J, Quan F, Zhao E, Deng C, Luo T, Xu L, Liao G, Yan M\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eCellMarker: a manually curated resource of cell markers in human and mouse\u003c/strong\u003e. \u003cem\u003eNucleic Acids Res \u003c/em\u003e2019, \u003cstrong\u003e47\u003c/strong\u003e(D1):D721-D728.\u003c/li\u003e\n\u003cli\u003eLi S, Li L, Li J, Liang X, Song C, Zou Y: \u003cstrong\u003emiR-203, fine-tunning neuroinflammation by juggling different components of NF\u003c/strong\u003e\u003cstrong\u003e‐\u0026kappa;B signaling\u003c/strong\u003e. \u003cem\u003eJournal of Neuroinflammation \u003c/em\u003e2022, \u003cstrong\u003e19\u003c/strong\u003e(1).\u003c/li\u003e\n\u003cli\u003eHu D, Cao Y, He R, Han N, Liu Z, Miao L, Yin J: \u003cstrong\u003eSchizandrin, an antioxidant lignan from Schisandra chinensis, ameliorates Abeta1-42-induced memory impairment in mice\u003c/strong\u003e. \u003cem\u003eOxid Med Cell Longev \u003c/em\u003e2012, \u003cstrong\u003e2012\u003c/strong\u003e:721721.\u003c/li\u003e\n\u003cli\u003eAlexander JF, Seua AV, Arroyo LD, Ray PR, Wangzhou A, Heibeta-Luckemann L, Schedlowski M, Price TJ, Kavelaars A, Heijnen CJ: \u003cstrong\u003eNasal administration of mitochondria reverses chemotherapy-induced cognitive deficits\u003c/strong\u003e. \u003cem\u003eTheranostics \u003c/em\u003e2021, \u003cstrong\u003e11\u003c/strong\u003e(7):3109-3130.\u003c/li\u003e\n\u003cli\u003eZhou L, Chen P, Peng Y, Ouyang R: \u003cstrong\u003eRole of Oxidative Stress in the Neurocognitive Dysfunction of Obstructive Sleep Apnea Syndrome\u003c/strong\u003e. \u003cem\u003eOxid Med Cell Longev \u003c/em\u003e2016, \u003cstrong\u003e2016\u003c/strong\u003e:9626831.\u003c/li\u003e\n\u003cli\u003eLamadema N, Burr S, Brewer AC: \u003cstrong\u003eDynamic regulation of epigenetic demethylation by oxygen availability and cellular redox\u003c/strong\u003e. \u003cem\u003eFree Radic Biol Med \u003c/em\u003e2019, \u003cstrong\u003e131\u003c/strong\u003e:282-298.\u003c/li\u003e\n\u003cli\u003eMatuleviciute R, Cunha PP, Johnson RS, Foskolou IP: \u003cstrong\u003eOxygen regulation of TET enzymes\u003c/strong\u003e. \u003cem\u003eFEBS J \u003c/em\u003e2021, \u003cstrong\u003e288\u003c/strong\u003e(24):7143-7161.\u003c/li\u003e\n\u003cli\u003eYang Q, Dang H, Liu J, Wang X, Wang J, Lan X, Ji M, Xing M, Hou P: \u003cstrong\u003eHypoxia switches TET1 from being tumor-suppressive to oncogenic\u003c/strong\u003e. \u003cem\u003eOncogene \u003c/em\u003e2023, \u003cstrong\u003e42\u003c/strong\u003e(20):1634-1648.\u003c/li\u003e\n\u003cli\u003eJoshi K, Liu S, Breslin SJP, Zhang J: \u003cstrong\u003eMechanisms that regulate the activities of TET proteins\u003c/strong\u003e. \u003cem\u003eCell Mol Life Sci \u003c/em\u003e2022, \u003cstrong\u003e79\u003c/strong\u003e(7):363.\u003c/li\u003e\n\u003cli\u003eXie J, Xie L, Wei H, Li XJ, Lin L: \u003cstrong\u003eDynamic Regulation of DNA Methylation and Brain Functions\u003c/strong\u003e. \u003cem\u003eBiology (Basel) \u003c/em\u003e2023, \u003cstrong\u003e12\u003c/strong\u003e(2).\u003c/li\u003e\n\u003cli\u003eGroves JO, Leslie I, Huang GJ, McHugh SB, Taylor A, Mott R, Munafo M, Bannerman DM, Flint J: \u003cstrong\u003eAblating adult neurogenesis in the rat has no effect on spatial processing: evidence from a novel pharmacogenetic model\u003c/strong\u003e. \u003cem\u003ePLoS Genet \u003c/em\u003e2013, \u003cstrong\u003e9\u003c/strong\u003e(9):e1003718.\u003c/li\u003e\n\u003cli\u003eGontier G, Iyer M, Shea JM, Bieri G, Wheatley EG, Ramalho-Santos M, Villeda SA: \u003cstrong\u003eTet2 Rescues Age-Related Regenerative Decline and Enhances Cognitive Function in the Adult Mouse Brain\u003c/strong\u003e. \u003cem\u003eCell Rep \u003c/em\u003e2018, \u003cstrong\u003e22\u003c/strong\u003e(8):1974-1981.\u003c/li\u003e\n\u003cli\u003ePratt KJB, Shea JM, Remesal-Gomez L, Bieri G, Smith LK, Couthouis J, Chen CP, Roy IJ, Gontier G, Villeda SA: \u003cstrong\u003eLoss of neuronal Tet2 enhances hippocampal-dependent cognitive function\u003c/strong\u003e. \u003cem\u003eCell Rep \u003c/em\u003e2022, \u003cstrong\u003e41\u003c/strong\u003e(6):111612.\u003c/li\u003e\n\u003cli\u003eAntunes C, Da Silva JD, Guerra-Gomes S, Alves ND, Ferreira F, Loureiro-Campos E, Branco MR, Sousa N, Reik W, Pinto L\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eTet3 ablation in adult brain neurons increases anxiety-like behavior and regulates cognitive function in mice\u003c/strong\u003e. \u003cem\u003eMol Psychiatry \u003c/em\u003e2021, \u003cstrong\u003e26\u003c/strong\u003e(5):1445-1457.\u003c/li\u003e\n\u003cli\u003eAntunes C, Da Silva JD, Guerra-Gomes S, Alves ND, Loureiro-Campos E, Pinto L, Marques CJ: \u003cstrong\u003eTet3 Deletion in Adult Brain Neurons of Female Mice Results in Anxiety-like Behavior and Cognitive Impairments\u003c/strong\u003e. \u003cem\u003eMol Neurobiol \u003c/em\u003e2022, \u003cstrong\u003e59\u003c/strong\u003e(8):4892-4901.\u003c/li\u003e\n\u003cli\u003eYang Q, Wang Y, Feng J, Cao J, Chen B: \u003cstrong\u003eIntermittent hypoxia from obstructive sleep apnea may cause neuronal impairment and dysfunction in central nervous system: the potential roles played by microglia\u003c/strong\u003e. \u003cem\u003eNeuropsychiatric disease and treatment \u003c/em\u003e2013, \u003cstrong\u003e9\u003c/strong\u003e:1077-1086.\u003c/li\u003e\n\u003cli\u003eWang H, Wang X, Shen Y, Wang Y, Yang T, Sun J, Liu S: \u003cstrong\u003eSENP1 modulates chronic intermittent hypoxia-induced inflammation of microglia and neuronal injury by inhibiting TOM1 pathway\u003c/strong\u003e. \u003cem\u003eInternational immunopharmacology \u003c/em\u003e2023, \u003cstrong\u003e119\u003c/strong\u003e:110230.\u003c/li\u003e\n\u003cli\u003eMarchetti B, Pluchino S: \u003cstrong\u003eWnt your brain be inflamed? Yes, it Wnt!\u003c/strong\u003e \u003cem\u003eTrends in molecular medicine \u003c/em\u003e2013, \u003cstrong\u003e19\u003c/strong\u003e(3):144-156.\u003c/li\u003e\n\u003cli\u003eLi C, Wu Y, Huang MY, Song XJ: \u003cstrong\u003eCharacterization of Inflammatory Signals in BV-2 Microglia in Response to Wnt3a\u003c/strong\u003e. \u003cem\u003eBiomedicines \u003c/em\u003e2023, \u003cstrong\u003e11\u003c/strong\u003e(4).\u003c/li\u003e\n\u003cli\u003eLazarov O, Hollands C: \u003cstrong\u003eHippocampal neurogenesis: Learning to remember\u003c/strong\u003e. \u003cem\u003eProg Neurobiol \u003c/em\u003e2016, \u003cstrong\u003e138-140\u003c/strong\u003e:1-18.\u003c/li\u003e\n\u003cli\u003eZhang X, Wei X, Mei Y, Wang D, Wang J, Zhang Y, Li X, Gu Y, Peng G, Sun B: \u003cstrong\u003eModulating adult neurogenesis affects synaptic plasticity and cognitive functions in mouse models of Alzheimer\u0026apos;s disease\u003c/strong\u003e. \u003cem\u003eStem Cell Reports \u003c/em\u003e2021, \u003cstrong\u003e16\u003c/strong\u003e(12):3005-3019.\u003c/li\u003e\n\u003cli\u003eLie D-C, Colamarino SA, Song H-J, D\u0026eacute;sir\u0026eacute; L, Mira H, Consiglio A, Lein ES, Jessberger S, Lansford H, Dearie AR\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eWnt signalling regulates adult hippocampal neurogenesis\u003c/strong\u003e. \u003cem\u003eNature \u003c/em\u003e2005, \u003cstrong\u003e437\u003c/strong\u003e(7063):1370-1375.\u003c/li\u003e\n\u003cli\u003eArredondo SB, Valenzuela-Bezanilla D, Santibanez SH, Varela-Nallar L: \u003cstrong\u003eWnt Signaling in the Adult Hippocampal Neurogenic Niche\u003c/strong\u003e. \u003cem\u003eStem Cells \u003c/em\u003e2022, \u003cstrong\u003e40\u003c/strong\u003e(7):630-640.\u003c/li\u003e\n\u003cli\u003eArredondo SB, Guerrero FG, Herrera-Soto A, Jensen-Flores J, Bustamante DB, Onate-Ponce A, Henny P, Varas-Godoy M, Inestrosa NC, Varela-Nallar L: \u003cstrong\u003eWnt5a promotes differentiation and development of adult-born neurons in the hippocampus by noncanonical Wnt signaling\u003c/strong\u003e. \u003cem\u003eStem Cells \u003c/em\u003e2020, \u003cstrong\u003e38\u003c/strong\u003e(3):422-436.\u003c/li\u003e\n\u003cli\u003eSchafer ST, Han J, Pena M, von Bohlen Und Halbach O, Peters J, Gage FH: \u003cstrong\u003eThe Wnt adaptor protein ATP6AP2 regulates multiple stages of adult hippocampal neurogenesis\u003c/strong\u003e. \u003cem\u003eJ Neurosci \u003c/em\u003e2015, \u003cstrong\u003e35\u003c/strong\u003e(12):4983-4998.\u003c/li\u003e\n\u003cli\u003eHeppt J, Wittmann MT, Schaffner I, Billmann C, Zhang J, Vogt-Weisenhorn D, Prakash N, Wurst W, Taketo MM, Lie DC: \u003cstrong\u003ebeta-catenin signaling modulates the tempo of dendritic growth of adult-born hippocampal neurons\u003c/strong\u003e. \u003cem\u003eEMBO J \u003c/em\u003e2020, \u003cstrong\u003e39\u003c/strong\u003e(21):e104472.\u003c/li\u003e\n\u003cli\u003eVarela-Nallar L, Inestrosa NC: \u003cstrong\u003eWnt signaling in the regulation of adult hippocampal neurogenesis\u003c/strong\u003e. \u003cem\u003eFront Cell Neurosci \u003c/em\u003e2013, \u003cstrong\u003e7\u003c/strong\u003e:100.\u003c/li\u003e\n\u003cli\u003eMartin PM, Stanley RE, Ross AP, Freitas AE, Moyer CE, Brumback AC, Iafrati J, Stapornwongkul KS, Dominguez S, Kivimae S\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eDIXDC1 contributes to psychiatric susceptibility by regulating dendritic spine and glutamatergic synapse density via GSK3 and Wnt/beta-catenin signaling\u003c/strong\u003e. \u003cem\u003eMol Psychiatry \u003c/em\u003e2018, \u003cstrong\u003e23\u003c/strong\u003e(2):467-475.\u003c/li\u003e\n\u003cli\u003eYu L, Huang L, Zhao Y, Liu S, Zhou R, Yue Y, Sun H, Su X, Liu Q, Li S\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eAtorvastatin Promotes Pro/anti-inflammatory Phenotypic Transformation of Microglia via Wnt/\u0026beta;-catenin Pathway in Hypoxic-Ischemic Neonatal Rats\u003c/strong\u003e. \u003cem\u003eMol Neurobiol \u003c/em\u003e2023.\u003c/li\u003e\n\u003cli\u003eLu Y, Liu M, Guo X, Wang P, Zeng F, Wang H, Tang J, Qin Z, Tao T: \u003cstrong\u003emiR-26a-5p alleviates CFA-induced chronic inflammatory hyperalgesia through Wnt5a/CaMKII/NFAT signaling in mice\u003c/strong\u003e. \u003cem\u003eCNS neuroscience \u0026amp; therapeutics \u003c/em\u003e2023, \u003cstrong\u003e29\u003c/strong\u003e(5):1254-1271.\u003c/li\u003e\n\u003cli\u003eYang Y, Zhang Z: \u003cstrong\u003eMicroglia and Wnt Pathways: Prospects for Inflammation in Alzheimer\u0026apos;s Disease\u003c/strong\u003e. \u003cem\u003eFrontiers in aging neuroscience \u003c/em\u003e2020, \u003cstrong\u003e12\u003c/strong\u003e:110.\u003c/li\u003e\n\u003cli\u003eSong D, Zhang X, Chen J, Liu X, Xue J, Zhang L, Lan X: \u003cstrong\u003eWnt canonical pathway activator TWS119 drives microglial anti-inflammatory activation and facilitates neurological recovery following experimental stroke\u003c/strong\u003e. \u003cem\u003eJ Neuroinflammation \u003c/em\u003e2019, \u003cstrong\u003e16\u003c/strong\u003e(1):256.\u003c/li\u003e\n\u003cli\u003eYuan S, Shi Y, Guo K, Tang SJ: \u003cstrong\u003eNucleoside Reverse Transcriptase Inhibitors (NRTIs) Induce Pathological Pain through Wnt5a-Mediated Neuroinflammation in Aging Mice\u003c/strong\u003e. \u003cem\u003eJournal of neuroimmune pharmacology : the official journal of the Society on NeuroImmune Pharmacology \u003c/em\u003e2018, \u003cstrong\u003e13\u003c/strong\u003e(2):230-236.\u003c/li\u003e\n\u003cli\u003eVall\u0026eacute;e A: \u003cstrong\u003eNeuroinflammation in Schizophrenia: The Key Role of the WNT/\u0026beta;-Catenin Pathway\u003c/strong\u003e. \u003cem\u003eInt J Mol Sci \u003c/em\u003e2022, \u003cstrong\u003e23\u003c/strong\u003e(5).\u003c/li\u003e\n\u003cli\u003eXiao Y, Guan T, Yang X, Xu J, Zhang J, Qi Q, Teng Z, Dong Y, Gao Y, Li M\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eBaicalin facilitates remyelination and suppresses neuroinflammation in rats with chronic cerebral hypoperfusion by activating Wnt/\u0026beta;-catenin and inhibiting NF-\u0026kappa;B signaling\u003c/strong\u003e. \u003cem\u003eBehavioural brain research \u003c/em\u003e2023, \u003cstrong\u003e442\u003c/strong\u003e:114301.\u003c/li\u003e\n\u003cli\u003eAbu-Elfotuh K, Abdel-Sattar SA, Abbas AN, Mahran YF, Alshanwani AR, Hamdan AME, Atwa AM, Reda E, Ahmed YM, Zaghlool SS\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eThe protective effect of thymoquinone or/and thymol against monosodium glutamate-induced attention-deficit/hyperactivity disorder (ADHD)-like behavior in rats: Modulation of Nrf2/HO-1, TLR4/NF-\u0026kappa;B/NLRP3/caspase-1 and Wnt/\u0026beta;-Catenin signaling pathways in rat model\u003c/strong\u003e. \u003cem\u003eBiomedicine \u0026amp; pharmacotherapy = Biomedecine \u0026amp; pharmacotherapie \u003c/em\u003e2022, \u003cstrong\u003e155\u003c/strong\u003e:113799.\u003c/li\u003e\n\u003cli\u003eSchneider R, Koop B, Schr\u0026ouml;ter F, Cline J, Ingwersen J, Berndt C, Hartung HP, Aktas O, Prozorovski T: \u003cstrong\u003eActivation of Wnt signaling promotes hippocampal neurogenesis in experimental autoimmune encephalomyelitis\u003c/strong\u003e. \u003cem\u003eMolecular neurodegeneration \u003c/em\u003e2016, \u003cstrong\u003e11\u003c/strong\u003e(1):53.\u003c/li\u003e\n\u003cli\u003eDohare P, Cheng B, Ahmed E, Yadala V, Singla P, Thomas S, Kayton R, Ungvari Z, Ballabh P: \u003cstrong\u003eGlycogen synthase kinase-3\u0026beta; inhibition enhances myelination in preterm newborns with intraventricular hemorrhage, but not recombinant Wnt3A\u003c/strong\u003e. \u003cem\u003eNeurobiol Dis \u003c/em\u003e2018, \u003cstrong\u003e118\u003c/strong\u003e:22-39.\u003c/li\u003e\n\u003cli\u003eHalleskog C, Mulder J, Dahlstr\u0026ouml;m J, Mackie K, Hortob\u0026aacute;gyi T, Tanila H, Kumar Puli L, F\u0026auml;rber K, Harkany T, Schulte G: \u003cstrong\u003eWNT signaling in activated microglia is proinflammatory\u003c/strong\u003e. \u003cem\u003eGlia \u003c/em\u003e2011, \u003cstrong\u003e59\u003c/strong\u003e(1):119-131.\u003c/li\u003e\n\u003cli\u003eHalleskog C, Schulte G: \u003cstrong\u003ePertussis toxin-sensitive heterotrimeric G(\u0026alpha;i/o) proteins mediate WNT/\u0026beta;-catenin and WNT/ERK1/2 signaling in mouse primary microglia stimulated with purified WNT-3A\u003c/strong\u003e. \u003cem\u003eCellular signalling \u003c/em\u003e2013, \u003cstrong\u003e25\u003c/strong\u003e(4):822-828.\u003c/li\u003e\n\u003cli\u003eDu Y, Yan T, Wu B, He B, Jia Y: \u003cstrong\u003eResearch on the mechanism of antidepressive effect of Suanzaoren Decoction through TLR4/MyD88/NF-\u0026kappa;B pathway and Wnt/\u0026beta;-catenin pathway\u003c/strong\u003e. \u003cem\u003eJournal of ethnopharmacology \u003c/em\u003e2024, \u003cstrong\u003e319\u003c/strong\u003e(Pt 1):117190.\u003c/li\u003e\n\u003cli\u003eLiddelow SA, Guttenplan KA, Clarke LE, Bennett FC, Bohlen CJ, Schirmer L, Bennett ML, M\u0026uuml;nch AE, Chung WS, Peterson TC\u003cem\u003e et al\u003c/em\u003e: \u003cstrong\u003eNeurotoxic reactive astrocytes are induced by activated microglia\u003c/strong\u003e. \u003cem\u003eNature \u003c/em\u003e2017, \u003cstrong\u003e541\u003c/strong\u003e(7638):481-487.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":false,"highlight":"","institution":"","isAcceptedByJournal":true,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"[email protected]","identity":"journal-of-neuroinflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jneu","sideBox":"Learn more about [Journal of Neuroinflammation](http://jneuroinflammation.biomedcentral.com)","snPcode":"12974","submissionUrl":"https://submission.nature.com/new-submission/12974/3","title":"Journal of Neuroinflammation","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true},"keywords":"5hmC1, IH2, Tet1 3 , Wnt pathway4, hippocampus5","lastPublishedDoi":"10.21203/rs.3.rs-4251801/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4251801/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"\u003cp\u003e\u003cstrong\u003eBackground: \u003c/strong\u003eObstructive sleep apnoea (OSA) is a sleep-disordered breathing characterized by intermittent hypoxia (IH) that may cause cognitive dysfunction. However, the impact of IH on molecular processes involved in cognitive function remains unclear.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eMethods:\u003c/strong\u003e C57BL / 6J mice were exposed to either normoxia (control) or IH for 6 weeks. DNA hydroxymethylation was quantified by hydroxymethylated DNA immunoprecipitation (hMeDIP) sequencing. ten-eleven translocation 1 (\u003cem\u003eTet1)\u003c/em\u003e was knocked down by lentivirus. Specifically, cognitive function was assessed by behavioral experiments, pathological features were assessed by HE staining, the hippocampal DNA hydroxymethylation was examined by DNA dot blot and immunohistochemical staining, while the Wnt signaling pathway and its downstream effects were studied using qRT-PCR, immunofluorescence staining, and Luminex liquid suspension chip analysis.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eResults:\u003c/strong\u003e IH mice showed pathological changes and cognitive dysfunction in the hippocampus. Compared with the control group, IH mice exhibited global DNA hydroxylmethylation in the hippocampus, and the expression of three hydroxylmethylases increased significantly. The Wnt signaling pathway was activated, and the mRNA and 5hmC levels of Wnt3a, Ccnd2, and Prickle2 were significantly up-regulated. Further caused downstream neurogenesis abnormalities and neuroinflammatory activation, manifested as increased expression of IBA1 (a marker of microglia), GFAP (a marker of astrocytes), and DCX (a marker of immature neurons), as well as a range of inflammatory cytokines (e.g. TNF-a, IL-3, IL-9, and IL-17A). After \u003cem\u003eTet1\u003c/em\u003e knocked down, the above indicators return to normal.\u003c/p\u003e\n\u003cp\u003e\u003cstrong\u003eConclusion: \u003c/strong\u003eActivation of Wnt signaling pathway by hippocampal \u003cem\u003eTet1\u003c/em\u003e is associated with cognitive dysfunction induced by IH.\u003c/p\u003e","manuscriptTitle":"Tet1-mediated 5hmC regulates hippocampal neuroinflammation via wnt signaling as a novel mechanism in obstructive sleep apnoea leads to cognitive deficit","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-04-16 07:43:01","doi":"10.21203/rs.3.rs-4251801/v1","editorialEvents":[{"type":"communityComments","content":0},{"type":"decision","content":"Revision requested","date":"2024-04-28T15:45:12+00:00","index":"","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-28T15:31:48+00:00","index":"hide","fulltext":""},{"type":"editorInvitedReview","content":"","date":"2024-04-19T05:08:46+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"0ba3d84b-b7df-4e64-a762-29badd202727","date":"2024-04-12T16:51:43+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"1a28a7d3-322b-4655-83ae-7207089388f7","date":"2024-04-12T15:11:07+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"02c19bf3-6d93-4be0-8ac6-dad97a2ec3da","date":"2024-04-12T12:08:38+00:00","index":"hide","fulltext":""},{"type":"reviewerAgreed","content":"3e9c594d-f87e-457d-b796-18a054877b57","date":"2024-04-12T11:55:29+00:00","index":"hide","fulltext":""},{"type":"reviewersInvited","content":"","date":"2024-04-12T11:04:59+00:00","index":"","fulltext":""},{"type":"editorAssigned","content":"","date":"2024-04-12T04:26:19+00:00","index":"","fulltext":""},{"type":"checksComplete","content":"","date":"2024-04-11T12:27:37+00:00","index":"","fulltext":""},{"type":"submitted","content":"Journal of Neuroinflammation","date":"2024-04-11T10:22:13+00:00","index":"","fulltext":""}],"status":"published","journal":{"display":true,"email":"[email protected]","identity":"journal-of-neuroinflammation","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":false,"externalIdentity":"jneu","sideBox":"Learn more about [Journal of Neuroinflammation](http://jneuroinflammation.biomedcentral.com)","snPcode":"12974","submissionUrl":"https://submission.nature.com/new-submission/12974/3","title":"Journal of Neuroinflammation","twitterHandle":"@bmc","acdcEnabled":true,"dfaEnabled":true,"editorialSystem":"em","reportingPortfolio":"BMC/SO AJ","inReviewEnabled":true,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"25f98c26-668a-46de-bcb4-28264496d5c2","owner":[],"postedDate":"April 16th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"published-in-journal","subjectAreas":[],"tags":[],"updatedAt":"2024-08-26T16:01:45+00:00","versionOfRecord":{"articleIdentity":"rs-4251801","link":"https://doi.org/10.1186/s12974-024-03189-2","journal":{"identity":"journal-of-neuroinflammation","isVorOnly":false,"title":"Journal of Neuroinflammation"},"publishedOn":"2024-08-21 15:56:56","publishedOnDateReadable":"August 21st, 2024"},"versionCreatedAt":"2024-04-16 07:43:01","video":"","vorDoi":"10.1186/s12974-024-03189-2","vorDoiUrl":"https://doi.org/10.1186/s12974-024-03189-2","workflowStages":[]},"version":"v1","identity":"rs-4251801","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4251801","identity":"rs-4251801","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2024) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00