Downregulation of polygalacturonase (PG) gene expression caused significant changes in gene expression in sesame (Sesamum indicum L.) false septa tissues. | Research Square window.SnipcartSettings = { analytics: { enabled: false } }; (function() { var accessVector = localStorage.getItem('access_vector') || ''; window.dataLayer = window.dataLayer || []; if (accessVector) { window.dataLayer.push({ user: { profile: { profileInfo: { snid: accessVector } } } }); } })(); (function(w,d,s,l,i){w[l]=w[l]||[];w[l].push({'gtm.start':new Date().getTime(),event:'gtm.js'});var f=d.getElementsByTagName(s)[0],j=d.createElement(s),dl=l!='dataLayer'?'&l='+l:'';j.async=true;j.src='https://www.googletagmanager.com/gtm.js?id='+i+dl;f.parentNode.insertBefore(j,f);})(window,document,'script','dataLayer','GTM-K279D39R'); Browse Preprints In Review Journals COVID-19 Preprints AJE Video Bytes Research Tools Research Promotion AJE Professional Editing AJE Rubriq About Preprint Platform In Review Editorial Policies Our Team Advisory Board Help Center Sign In Submit a Preprint Cite Share Download PDF Research Article Downregulation of polygalacturonase (PG) gene expression caused significant changes in gene expression in sesame (Sesamum indicum L.) false septa tissues. Esraa A. A. Sultan, Mariam Oweda, Nagwa I. Elarabi, Mohamed El-Hadidi, and 3 more This is a preprint; it has not been peer reviewed by a journal. https://doi.org/ 10.21203/rs.3.rs-4624341/v1 This work is licensed under a CC BY 4.0 License Status: Posted Version 1 posted You are reading this latest preprint version Abstract Sesame (Sesamum indicum L.) is one of the oldest cultivated oil crops worldwide and struggles with low yield, which could be attributed to capsule dehiscence and seed shattering just before and during full maturation. The present study addresses the seed-shattering in sesame via downregulating the endo-polygalacturonase (endo-PG) gene activity “known as the ripening enzyme”. Five lines of sesame plants using an RNAi transformation strategy via a non-tissue culture-based transformation technique. Individual transformants were tested using BASTA leave-painting and spraying over mature plants, as well as conducting PCR, RT-PCR, and real-time PCR tests on T1 plants. The transgenics exhibited a significant reduction in endo-PG levels and showed delays in leaves, organ senescence, and a delay in capsule opening. A transcriptome profiling study was conducted to understand the effect of downregulating the endo-PG expression levels on the genetic expression profile of false septa tissues excised from sesame capsules. Different comparisons between the expression profile of the false septa in transgenic vs non-transgenic control were conducted, yet we are reporting one of the comparisons in this study. A total of 24,468 unigenes were annotated, and 514 differentially expressed genes (DEGs) were detected in the selected comparison, including 349 up-regulated and 165 down-regulated unigenes. Nineteen DEGs for genes directly involved in plant hormones, cell wall modification, and capsule shattering were selected. Our results indicate that silencing the endo-PG gene caused changes in the expression of a wide range of genes, eventually leading to a dramatic reduction in seed-shattering in transgenic sesame capsules. Sesamum indicum L. seed shattering endo-polygalacturonase transcriptome analysis Cell-wall modification Figures Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 Figure 10 Introduction Sesame (Sesamum indicum L .) is one of the oldest cultivated oil crops worldwide, and its cultivation is spread into many tropical and subtropical regions of Asia, Africa, and South America (Al-Shafeay et al. 2011 ; Al-Shafeay et al. 2018 ). Sesame is an annual diploid oilseed plant (2n = 26) from the Pedaliaceae family with a genome size of approximately 369 Mb (You et al. 2019 ; Zhang et al. 2021 ; Wang et al. 2022 ). Sesame seeds are also considered a rich source of protein, about 20% of dried seeds (Ogbonna and Ukaan 2013 ). Oil content in seeds ranges from 45 to 63%, with 83–90% in un-unsaturated fat form. The seeds also contain large quantities of antioxidants (sesamin, sesamol and sesamolin) reported to have health-promoting effects such as lowering cholesterol levels and hypertension (Shahidi et al. 2006 ; Anilakumar et al. 2010 ). Different factors negatively affect the yield in sesame, as in biotic and abiotic factors, as well as seed shattering (Day 2000 ; Lakhanpaul et al. 2012 ; Radhakrishnan et al. 2013 ; Liu et al. 2016 ; Al-Shafaey et al. 2018 and Dossa et al. 2019 ). Seed shattering is a mechanism that helps plants disperse and distribute their seeds into the surrounding environment (Roberts et al. 2000 ; Estornell et al. 2013 ; Maity et al. 2021 ). Seed dispersal increases the possibility of seed scattering via wind and water and sticking into animal hooves and wools (Lengyel et al. 2010 ). However, after thousands of years of selection and decades of breeding, scientists have been selecting for uniformity of seed maturation and selecting against seed shattering/scattering (Doebley 2006 ); this point, in particular, has been successful in many crops, yet still an issue in crops like sesame. Seed shattering is considered an undesirable trait in modern cultivated crops (Purugganan and Fuller 2009 ), where a dramatic yield loss occurs during crop harvesting, regardless of harvest mechanism, mechanically or manually (Fuller and Allaby 2009 ). Seed shattering (pod dehiscence or fruit shedding), which occurs at advanced seed/fruit stages (and is usually associated with semi or complete dryness of fruits), is a problem that is negatively-affecting yield in economically important crops, such as sesame, canola, and rice (Ferrandiz 2002 ; Girin et al. 2010 ; Dong and Wang 2015 ; Sultan et al. 2018 ). Generally, the first step in seed or pod shattering is forming an abscission layer at the point where the seeds or pods are connected to the plants. However, the fundamental mechanism of abscission differs from one family to another and within a given family species, as it may be the spikelet in rice, pod or siliques in canola and Arabidopsis (Robles and Pelaz 2005 ; Kourmpetli and Drea 2014 ). Seed shattering in plants is regulated by complex physiological, biochemical, and genetic mechanisms in conjunction with environmental factors. Some of these mechanisms are now better understood in some crops (Patterson et al. 2016 ). A complex network of interconnected genes somehow controls the different genetic factors, thus contributing to seed shattering (Maity et al. 2021 ). As an example, Arabidopsis thaliana has been used for decades to unveil the complexity of the dehiscence zone regulation, DZ (Liljegren et al. 2004 ; Lewis et al. 2006 ; Sorefan et al. 2009 ). As in MAD-box factors, several transcription factors were found to control the pod dehiscence (Liljegren et al. 2000; Ferrándiz 2002). Other transcription factors, like b-HLH transcription factors, INDEHISCENT (IND) and ALCATRAZ (ALC), were also identified. The IND gene was found to be responsible for directing the differentiation of DZ into a lignified layer and separation layer (Liljegren et al. 2004 ). ALCATRAZ (ALC) resides in the cell identity in the separation layer (Rajani and Sundaresan 2001 ). Both IND and ALC are expressed explicitly in the DZ during late fruit development (Liljegren et al. 2000; Sorefan et al. 2009 ). Studies by different groups also indicated that plant hormones are critical in detaining plant structures (Patharkar and Walker, 2018 ). Thickening, swelling, and dissolving of the cell layers in the abscission zones are accompanied by many genetic pathways that are switched on or off to trigger the process (Maity et al. 2021 ). Among the various phytohormones involved are ethylene (ETH) and abscisic acid (ABA), which tend to activate and promote organ shedding/abscission processes positively (Marciniak et al. 2018 ). In contrast, auxins, cytokinin (CTK) and gibberellin (GA) tend to play an inhibitory role in abscission (Bishopp et al. 2011 ). Furthermore, the ethylene/auxin ratio was found to be of great importance to plants in maintaining an adequate regulation of organ shedding (Jin et al. 2015 ). Consequently, genes responsible for synthesizing these phytohormones and their signal transduction pathways also play vital roles in the complex mechanism of plant organ abscission (Sun et al. 2012 ). Cellulose, hemicellulose, pectin, lignin, and structural proteins are the main components of plant cell walls (Yu et al. 2020 ). During seed shattering, the hydrolase enzymes, including cellulases (CELs), polygalacturonases (PGs), pectin methylesterases (PEMs), and pectate lyases (PLs), are responsible for the modification and degradation of these components of cell walls (Aalen et al. 2013 ). Moreover, some studies have shown that hydrolysis seems essential for cell expansion coordinated by other enzymes like expansins (EXPs), as well as xyloglucan endotransglucosylase/hydrolases (XTHs) (Li et al. 2022 ). Polygalacturonases (PGs) hydrolyze the alpha-1 and 4 glycosidic bonds between galacturonic acid residues. Polygalacturonan, whose major component is galacturonic acid, is a significant carbohydrate component of the pectin network that comprises plant cell walls (Yang et al. 2018 ). Polygalacturonase (PG) is an enzyme that plays a significant role in depolymerizing pectin (Sénéchal et al. 2014 ), and based on differences in hydrolyzing activity, PGs are divided into endo-PGs and exo-PGs (Markovic and Janecek, 2001 ; Sultan et al. 2018 ). Endo-PGs (EC 3.2.1.15) catalyze random hydrolytic cleavage of alpha-1,4 glycosidic bonds in polygalacturonic chains of pectin (Protsenko et al. 2008 ). Exo-PGs are divided into two types: the first type (EC 3.2.1.67) catalyzes the hydrolytic cleavage of one galacturonic acid residue from the non-reducing end, and the second type (EC 3.2.1.82) catalyzes the hydrolytic cleavage of two galacturonic acid residue from the non-reducing end (Pedrolli et al. 2009 ). In sesame, seed shattering is responsible for close to 50% of annual yield loss, especially in manually harvested areas (Langham and Wiemers 2002 ). Flowering and capsule development in sesame occurs first in older flowers (closer to the soil surface) up to the new flowers (close to apical meristem) along the growing sesame main stem (Ukan and Killi 2010). Therefore, it is of no surprise that farmers were advised to harvest sesame plants when about 50% of the capsules are dried and 20% of the capsules are open, causing a loss of seed yield (Nath et al. 2001 ; Langham and Wiemers 2002 ; Kim et al. 2007 ). Recently, sesame has been getting the attention of scientists, and transcriptome analysis studies are becoming more affordable. For example, transcriptome analysis has been extensively used to study the changes at the transcriptional level between fertile and non-fertile buds in sesame (Liu et al. 2016 ), changes in gene expression level when exposing plants to different abiotic stresses (Dossa et al. 2017 ; Dossa et al. 2019 ); changes in core drought-responsive genes (You et al. 2019 ); changes at transcription level to elucidate genes involved in seed coat color in sesame (Wang et al. 2020 ), and changes in PEG-treated sensitive-roots vs. PEG-tolerant-root of sesame (Song et al. 2021 ). In the current study, we have developed a new non-tissue culture-based technique for sesame transformation to minimize somaclonal variations among transgenic individuals (Sultan and Tawfik 2023 ). We previously isolated an endo-polygalacturonase gene from sesame cv. Sohag 1 (Sultan et al. 2018 ) used a 277 bp partial gene sequence to construct an RNAi-construct to downregulate the endo-PG expression level in transgenic sesame plants. Although we used a constitutive promoter (CaMV 35S), we were interested in understanding only gene expression changes in false septa tissues. Therefore, all sesame capsules were collected, and immediately false septa tissues were dissected at four different developmental stages (7-, 14-, 21- and 28 d ays a fter f lowering, DAF ) to conduct the comparative transcriptome analysis between the false septa derived from transgenic sesame lines and their non-transgenic counterparts. Materials and methods Plant materials. Sesame seeds cv. Sohag 1 was kindly provided by Field Crops Research Institute, ARC, Giza, Egypt. Methods. Construction of the RNAi vector : The partial sequence of polygalacturonase fragment (277 bp) was used to construct the RNAi vector; primers for sense and antisense fragments For1S and For2 A were designed (sense primer: For1S CCGCTCGAG ACAGGAGATGATTGTATC, Rev1S GCCGGGCGCGCC TTTGGTCTATGATGATTGGATT and antisense primer: For2A GCCGTCTAGA ACAGGAGATGATTGTATC, Rev2A CGCGGATCC TTTGGTCTATGATGATTGGATT) to include restriction sites AscІ & XhoІ , and BamhІ & XbaІІ to the 5' and 3’ ends, respectively. The newly amplified fragments with the newly introduced restriction sites were cloned into pGEM-T Easy Vector. The partial sequence was once digested with AscІ & XhoІ (NEB, USA, Cat No. R0558S and R0146S, respectively) to release the sense fragment from the pGEM T-easy vector. At the same time, the BamhІ & XbaІ (NEB, USA, Cat No. R0136S and R0145S, respectively) were used to digest the antisense-oriented fragment. For cloning, the pFGC5941 RNAi vector (Fig. 1 ) was digested once with AscІ & XhoІ , and in a second reaction, was digested with BamhІ & XbaІ to clone the sense and antisense fragment, respectively. The pFGC5941 vector-carrying fragment in sense and antisense orientation was then transformed into Agrobacterium tumefaciens strain LBA4404 via heat-shock treatment (Sambrook et al. 1989 ). Sesame transformation : Following the procedure by Sultan and Tawfik ( 2023 ), under aseptic conditions, the seeds of sesame were surface sterilized, de-coated, followed by incubation with an Agrobacterium solution (carrying the pFGC5941 engineered vector) for 2–3 hours. The seeds were placed on a germination medium consisting of ½ strength MS basal salt mixture (Murashige and Skoog, 1962 ), supplemented with Gamborg's B₅ vitamin (Gamborg et al. 1968 ) + 10 g/l sucrose + 7 g/l Agar. The plates were dark incubated overnight at room temperature. The next day, sesame seeds were transferred into a germination medium supplemented with 500 mg/l cefotaxime, and 24 hrs later, the seeds were transferred into plastic trays filled with soil mixture (peat moss: clay: sand at 2:1:1 ratio) in growth chambers at 25–28°C with 16/8 hr light/ dark period for 2– 3 weeks. Well-developed sesame seedlings were transplanted into 15 cm pots filled with the same soil mixture. DNA isolation : DNA was extracted from leaves using the CTAB method following Murray and Thompson's procedure (1980). PCR analysis : Individual putative transgenic plants were screened using 35S forward and reverse primers (35SF GCTCCTACAA ATGCCATCA, and 35SR GATAGTGGGAT TGTGCGTCA) and Bar forward and reverse primers (BarF GACAAGCACGGTCAACTTCC, and BarR CTTCAGCAGGTGGGTGTA GAG), which amplified a 200 and 247bp fragments, respectively. Herbicide Resistance Test : Transgenic sesame plants were tested by leaf painting and spraying with Basta solution {0.02% Basta and 0.1% (v/v) Tween 20®}. The leaves were observed and scored five days post-painting. Statistical analysis : The chi-square test calculated and statistically validated segregation ratios (Jelinski et al. 1990). RNA isolation and DNase treatment : RNA isolation from sesame tissues was conducted using the PureLink RNA Kit (Ambion, USA, Cat # 12183018A). RNA samples were treated with Turbo DNA-free™ (Ambion, USA, cat #AM1907) to clean any DNA contaminants. RT-PCR analysis : RNA isolated from sesame tissues was used for cDNA synthesis using the MMLV enzyme (Promega, USA, Cat no. M170B). The RT-PCR was carried out using the Bar forward and reverse primers. Preparation of RNA samples for transcriptome analysis : RNA was extracted by using PureLink RNA Kit (Ambion, USA, Cat # 12183018A) from five T 1 transgenic plants false septa tissues (at four developmental stages 7, 14, 21 and 28 DAF) were pooled together. RNA was treated with Turbo DNA-free™ (Ambion, USA, cat #AM1907) to eliminate DNA contamination. Three biological replicates were collected. RNA quality and concentration were determined using Experion™ Automated Electrophoresis System by Bio-Rad (Cat No. 7007010). The integrity of RNA was assessed using an Agilent 2100 bioanalyze. The samples were prepared, and BGI-China constructed and synthesized the cDNA library. Transcriptome analysis : The quality of the reads was analyzed using the FASTQC tool, which is a quality control tool for NGS-generated data ( http://www.bioinformatics.babraham.ac.uk/projects/fastqc/ ) and MultiQC ( https://github.com/ewels/MultiQC/releases ) was used for FASTQC reports combination, reads with a Phred quality score (Q) > 22, a length of 50 nt or higher and homopolymeric tract lower of the 50% of the total read length, was selected. Reads with good quality were mapped to the latest Sesamum indicum genome assembly (S_indicum_v1.0), which was retrieved from the Ensembl Plants genomic browser with the corresponding annotation GTF file using STAR (Dobin et al. 2013 ). STAR practical workflow consists of two steps: 1- Generating genome index files using the reference genome sequences (FASTA files) and annotations (GTF file) with an overhang of max (Read length) − 1. The maximum read length was 150 nt, so the index overhang was 149. 2- Mapping reads to the genome using the genome index files generated in the 1st step, as well as the RNA-seq reads (sequences) in the FASTQ files; the output files were saved in sorted-by-coordinate BAM format, and alignment quality was checked using qualimap (Okonechnikov et al. 2015 ) gene expression quantification by FeatureCounts. Differential gene expression (DEGS) using the DEseq2 package was used to compare control and transgenic samples at different stages. In addition to investigating DEGs, the mRNA raw counts were normalized using the DESeq2 median of ratios, followed by negative binomial linear regression data modelling; the contrast was specified based on the conditions of interest only and tested using the Wald test. The significance level of the P-adjusted value was set at false discovery rate (FDR) 1.5. Functional enrichment was analyzed with GProfiler analysis. A cutoff score of 0.05 FDR was set for significantly enriched terms. Quantitative Real-Time PCR analysis : The expression levels of selected target genes in the non-transgenic controls and the transgenics false septa tissue from sesame capsules at the four developmental stages were validated by qRT-PCR using the maxima SYBR™ Green qPCR kit (ThermoScientific, USA, cat #K0251). The reaction was conducted as follows:- in a volume of 10 µl, 5 µl SYBR Green Master Mix was added + 250 ng of cDNA template + 0.3 µM of each of the forward and reverse primers. The Real-time PCR was programmed to the following conditions: an initial step at 95 ºC for 10 min, followed by 40 cycles of (95 ⁰C for 5 sec and 58 ⁰C for 45 sec). All the primer sequences used for the different target genes are listed in Table S3 . The actin gene was used as a reference gene to normalize the relative quantification using the comparative 2 −∆∆Ct method (Schmittgen and Livak 2008 ). All reactions and validations were performed in three biological replicates. Results Construct preparation and transformation The pFGC5941vector was designed to contain two sites of insertions, sense and antisense, to achieve silencing (Fig. 1 A) and has been used successfully in multiple publications (Wesley et al. 2001 ; An et al. 2003 ; Hirai and Kodama, 2008 ). The full-length sequence of the endo-polygalacturonase gene was cloned (Sultan et al. 2018 ; accession no LC279244), and a 277 bp partial sequence of the endo-polygalacturonase was chosen to construct the silencing vector. New primers were designed to correspond to the pFGC5941 vector two cloning sites (Fig. 1 A; SenF1 & SenR1 and AntiF1& AntiR1, respectively). The newly synthesized fragments were ligated into the pGEM- T Easy Vector. The two partial sequences in pGEM were recovered via double digestion with AscI & XhoI to release the sense strand, while the BamHI & XbaI were used to release the antisense strand. Ligation into the pGFC5941 vector was conducted over two steps. The first step was performed by digesting the pFGC5941 RNAi vector with AscI & XhoI to ligate the sense fragment. The second step was achieved by linearizing the resulting vector with BamHI & XbaI digest and ligating the antisense fragment (Fig. 1 B). Agrobacterium tumefaciens carrying the engineered pFGC5941-PG vector was used to transform sesame cv. Sohag 1. A single positive colony was then used in the sesame transformation. Following the procedure of (Sultan and Tawfik 2023 ), de-coated seeds were incubated with Agrobacterium tumefaciens strain LBA4404 harboring the pFGC5941-PG vector and then immediately transferred onto germination media (½ strength MS basal salt mixture with B₅ vitamin ten g/l sucrose and seven g/l agar) for overnight (Fig. 1 C 1 and 2 ). The seeds were then transferred into trays filled with soil mixture (Fig. 1 C 3). Seedlings were allowed to recover in a biocontainment greenhouse facility for weeks. Then, well-developed sesame plantlets were transferred to bigger pots (Fig. 1 C 4 and 5 ). Over five hundred putative individual sesame plants were screened by PCR using 35S promoter-specific primers. Of these plants, Thirty PCR-positive transgenic plants (200 bp fragments were detected) were produced (Fig. 2 A). T 1 seeds were produced from thirty individual transgenics, and based on seed availability, we selected two lines for PCR screening and continuation of the work using bar gene primer, which amplified 247 bp fragments (Fig. 2 B). The precision and accuracy of our results were further confirmed by the chi-square (x2) analysis, which indicated a segregation of 3:1, demonstrating the Mendelian segregation of a single dominant gene. We further performed herbicide resistance tests using leaf-painting of mature leaves and spraying the entire plants with BASTA (Fig. 3 A and 3 B). This point was crucial, as we did not go through the tissue culture process (Sultan and Tawfik, 2023 ). We further performed RT-PCR using bar primers (Fig. 3 C) to confirm the incorporation of the bar gene in T 1 plants. Before going any further with our main goal to understand the transcriptional changes in the false septa tissues via performing transcriptome analysis, we had to ensure the presence of changes in transcription levels in the endo-PG gene (target gene) between transgenic and non-transgenic false septa counterparts. Therefore, an RT-PCR on endo-PG levels in false septa tissues was performed. Figure (4 A1) indicates the expression level of the endo-PG level in the four developmental stages in control false septa tissues compared to in transgenic false septa tissues (Fig. 4A2), which indicates a reduction in the levels over the four stages in the transgenic sesame plants. This result was also confirmed using qRT-PCR (Fig. 4 B). The level of endo-polygalacturonase (Endo-PG) was significantly lower in transgenic plants; the fold change was 100, 25.64, 50 and 11.11-folds at stages 1, 2, 3 and 4, respectively, with silencing per cent at four developmental stages in transgenic sesame plants about 99, 96, 98 and 91%, respectively. Phenotype of transgenic plants The transgenic plant continued vegetative growth and formed more capsules at the distal end compared to non-transgenic controls. Furthermore, harvested capsules from transgenic plants continued to be closed even after being placed in a petri dish in a 37C incubator for up to two weeks, compared to the non-transgenic capsules that were already partially open when harvested (Fig. 4 C). Transcriptome profiling and identifying differentially expressed genes (DEGs) Total RNA from false septa tissues at different developmental stages from control and transgenic sesame plants were sequenced using the Next Generation Sequencing (NGS). Three biological replicas represented all samples. A total of 25,174 genes were obtained from control and transgenic sesame plants. The differentially expressed genes (DEGs) were identified at a false discovery rate (FDR) 1.5. The control and transgenic gene expression levels were analyzed, and 514 DEGs were recognized (Table S1 ), with 349 up-regulated and 165 down-regulated (Fig. 5 A). Further analysis of the up/and down-regulated genes as a heat map revealed that the genes were divided into five clades based on their expression pattern (Fig. 5 B). Additionally, the gene expression profiles between control and transgenic plants at the four stages of capsules development revealed the following; 508 genes in total were differentially expressed at stage1; in stage 2, 280 DEGs were downregulated, and 203 DEGs were upregulated; In stages 3 and 4, the number of up-regulated DEGs were170 and 159, respectively, along with 324 and 344 down-regulated DEGs in stages 3 and 4, respectively (Fig. 5 C). Gene Ontology (GO) has been used to classify the function of genes in plants. Therefore, we generated GO to describe the results obtained for gene functions between false septa tissues of non-transgenic controls and their transgenic counterparts. A total of 24,468 unique genes (unigenes) in the GO database were classified into 21 functional categories (Table S2 ), among which 5988 unigenes were assigned to molecular functions (MF), 5349 genes were assigned to biological processes (BP), and 13131 unigenes were assigned to cellular components (CC) (Fig. 6 ). In the MF category, oxidoreductase activity, transporter activity and transmembrane transporter activity were the most abundant terms, along with DNA-binding transcription factor activity, monooxygenase activity, oxidoreductase activity acting on paired donors with incorporation or reduction of molecular oxygen, transcription regulator activity and UDP-glycosyltransferase activity. These results were unsurprising, considering that we selected a single cell layer tissue, “false septa,” mainly involved in transporting and signal transduction. The top three terms of BP were response to stimulus, transmembrane transport, and response to chemical along with defense response, secondary metabolic process, response to toxic substances, toxin catabolic process, regulation of response to external stimulus, toxin metabolic process and detoxification. For the CC category, membrane, intrinsic component of membrane, and integral component of membrane were the highest sub-categories. Genes related to seed-shattering. A large number of unigenes were obtained in this study, of which 19 DEGs were selected based on directly controlling the disruption of the false septa resulting in seed shattering (Fig. 7 ). The selected unigenes encode for individuals producing plant hormones or unigenes involved in cell wall modification enzymes and transcription factors. Interestingly, 15 out of 19 selected DEGs showed significant levels of decreased expression in transgenic false septa during the maturation of the sesame capsules “fruit”, with only 4 DEGs out of the 19 selected showed significant increase in their transcript levels in transgenic false septa tissues compared to their non-transgenic control counterparts. Validation of transcriptome data was performed via qRT-PCR, as indicated in (Fig. 8 ). Genes related to hormonal balance in plants. Our result in sesame indicates that the ethylene receptor 2 (ETR2; SIN_1021817) was down-regulated (-3.33, -1.4, -1.25 and − 1.4 folds) in transgenic sesame false-septa tissues across the four developmental stages when compared to the non-transgenic control counterparts. In the ABA signal transduction pathway, we identified two DEGs that encode for C2-domain ABA-related gene, CAR (SIN_1021335) and protein phosphatase 2C, PP2C (SIN_1009503). The CAR gene was down-regulated (-5.88, -1.8, -1.5 and − 1.25 folds), while the PP2C was upregulated considerably (1.1, 1.25, 1.93 and 3.75 folds) in transgenic sesame lines. The PP2C gene was significantly up-regulated at 28 DAF of sesame capsules in transgenic plants compared with non-transgenic plants, suggesting that increasing PP2C causes inhibition of ABA during capsule development, which led to decreased seed shattering. One of the DEGs highly expressed in transgenic sesame plants was the LOG1 gene (SIN_1002363). The LOG1 gene was significantly up-regulated by 2, 2.36 and 2.55 folds in transgenic sesame plants starting at stages 2, 3 and 4, respectively. IAA-amino acid hydrolase ILR1 (SIN_1005912) mRNA exhibited a reduction in transgenic false septa tissues at stages 1 and 4 (-2.5 and --2-fold at stages 1 and 4, respectively). Genes that are involved in the remodeling of cell walls. Cell wall remodeling enzymes constitute essential components of plant responses to seed shattering. The cell wall remodeling-related DEGs were significantly highly expressed in non-transgenic plants and down-regulated in transgenic plants. These DEGs included endo-polygalacturonase (Endo-PG) (SIN_1008859), Endo ꞵ-1,4 glucanase (Cellulase) (EG) (SIN_1015495), Pectate lyase (PL) (SIN_1004730), pectin methylesterase (PME) (SIN_1012659), ꞵ-glucosidase (bGlu) (SIN_1023287), Expansin (EXPA), (SIN_1011199), and Arabinogalactan (AGP) (SIN_1017961). Cellulose synthase (CSLG) (SIN_1014328) was detected, which was significantly highly expressed in transgenic plants and 4-Coumarate: CoA ligase (4CL) (SIN_1007390) was up-regulated in transgenic plants. These results indicate that cell wall remodeling-related genes are essential during seed shattering. The endo-polygalacturonase (Endo-PG) (SIN_1008859), the main target of the present work, was highly downregulated in transcriptome analysis at stages 1 and 4 compared to non-transgenic plants. This result was consistent with the qRT-PCR. Pectate lyase (PL) (SIN_1004730) was downregulated in transgenic false septa tissues compared to the non-transgenic controls. In transgenic sesame, the PL levels were significantly downregulated to 25, 2.5, and 12.5 folds in stages 1, 2, and 3 compared to the non-transgenic controls (Fig. 8 ). Pectin methyl-esterase, also known as pectin esterase (PME) (SIN_1012659), showed a significant decrease by -100, -3, -4.2 and − 3.6 folds in their expression patterns across the four false septs developmental stages in the transgenic sesame plants compared to the non-transgenic controls. The level of Endo ꞵ-1,4 glucanase (EG) (SIN_1015495) was found to be significantly lower in the different stages of the transgenic sesame plants compared to their non-transgenic counterparts, with the highest changes at the fourth stage (-4.35, -3, -2.44 and − 12.5 folds) (Fig. 8 ). The ꞵ-glucosidases (bGlu; SIN_1023287) expression level was significantly impaired in transgenic sesame plants when compared to the non-transgenics, especially at stages 2, 3 and 4 (-1.4, -2.3, -3.3 and − 3.2 folds) (Fig. 8 ). Expansins (EXPA) (SIN_1011199) decreased significantly at the four tested false septa stages in the transgenic plants (-100, -3.33, -3.85 and − 5-folds decrease at stages 1, 2, 3 and 4, respectively). Arabinogalactan (AGP) (SIN_1017961) was downregulated in transgenic plants at the four tested stages in transgenic sesame (-20, -2.5, -3.1 and − 1.7-folds). Cellulose synthase (CSLG) (SIN_1014328) and CoA ligase (4CL) (SIN_1007390) expression levels were up-regulated at the false septa tissues, especially at the 4th stage in the transgenic plants (3 folds). This result indicates minimal cellulose breakdown, providing more support for capsule indehiscence in transgenic sesame than their non-transgenic sesame counterparts. 4-coumarate: CoA ligase, the expression levels increased from 1.23-fold in the 1st stage to 6.45-fold in the 4th stage. Genes related to capsule maturation. Dicarboxylate transporter (DT) (SIN_1003272) was one of the transcripts that were down-regulated in transgenic false septa tissues (-16, -2.0, -2.7 and − 3.3-folds). Isoamylase (ISA3) (SIN_1016996) was downregulated in transgenic plants at the four tested stages (-7.7, -4.7, -6.6, and − 2-fold changes at stages 1, 2, 3 and 4, respectively), compared to the non-transgenic counterpart false septa tissues. Genes encoding for transcriptional factors. The molecular basis of dehiscence zone formation and degradation is controlled via a network of genes, including transcription factors (TFs). The RNA-Seq analysis of false septa tissues derived from transgenic and non-transgenic sesame plants in the 4th stage “28 DAF” revealed changes in the expression of some transcription factors, including bHLH, HD-Zip, ERF, Myb, MADS-box, WRKY and bZIP (Fig. 9 ). In our results, the MADS-box (SIN_1026469), the bZIP (SIN_1016792) and the dof (SIN_1011668) were found to be highly downregulated during capsule development in sesame and were verified by qRT-PCR (Fig. 8 ). The results showed that the expression levels of genes were consistent with the transcriptome analysis results. Their expression levels were increased in false septa tissues of non-transgenic sesame plants compared to their transgenic counterparts at the four tested stages. The expression level of MADS-box decreased − 7.14, -2.56, -4.2 and − 6.25-fold, compared to the transgenic tissues. In the sesame plant, our results indicated that the bZIP decreased by -14.3, -5.0, -2.0 and − 3.7-fold in transgenic plants vs. the non-transgenic controls. The expression level of DNA binding with one finger (dof) was down-regulated to -50, -11.10, -10 and − 6.7-fold in transgenic plants. Discussion RNAi vector and plant transformation RNA interfering technology has been used, with various degrees of success, in several plant species to control the expression of genes as an alternative to knockout mutant, as in the production of diseases resistant plants (Fritz et al. 2006 ; Escobar et al. 2001 ; Kang et al. 2008 ; Jiang et al. 2009 ), improving drought tolerance (Wang et al. 2009 ), improving nutritional value (Regina et al. 2006 ; Yin et al. 2007 ; Tang et al. 2007 ) and increasing shelf-life of fruits (Karlova et al. 2013 ; Meli et al. 2010 ; Zhang et al. 2011 ; Gupta et al. 2013 ). This study used the pFGC5941 vector (RNAi vector) to suppress the endo-polygalacturonase gene's expression in sesame. In previous studies, polygalacturonase has been examined for its role in fruit ripening (Ogasawara et al. 2007 ; Fabi et al. 2014 ; Jiang et al. 2019 ); silique dehiscence (Sander et al. 2001 ; Ogawa et al. 2009 ; Yu et al. 2020 ), and abscission zone formation (Carranza et al. 2002 ; Verlent et al. 2005 ; Palanivelu 2006 ; Babu and Bayer, 2014 néchal et al. 2014 ), yet little attention was paid to the role of PGs in seed shattering across different crops, and sesame in particular. The RNAi vector was transformed into Agrobacterium tumefaciens for sesame transformation. In previous studies, Sesame has been proven to be difficult/immune to regeneration and transformation for a long time, yet one of the first breakthroughs came from two groups (Yadav et al. 2010 ; Al-Shafeay et al. 2011 ). Both groups used de-embryonated cotyledons from mature seeds to achieve successful regeneration and stable transformation in sesame. Interestingly, both techniques reported a regeneration system time of 4–10 weeks long, along with low transformation efficiency (1.01–1.67%). The successful reported regeneration and transformation system for sesame, besides being time-consuming and the need to use multiple growth regulators in different media (Yadav et al. 2010 ; Al-Shafeay et al. 2011 ), has been proven to be highly genotype-dependent with low transformation percentage (Al-Shafeay et al. 2011 ). In general, prolonged exposure of explants to media tends to produce somaclonal variation among the resulting transgenics. This was the main reason behind developing a non-tissue culture-based planta technique for sesame (Sultan and Tawfik 2023 ). In the present work, we use a non-tissue culture-based method to transform sesame and screen transgenic plants via PCR, leaf painting, and spraying with BASTA on fully matured plants. Similar to previous studies using BATSA as the selectable marker for many crops, such as sugarcane, eggplant, okra and canola (Mayavan et al. 2013 ; Subramanyam et al. 2013 ; Manickavasagam et al. 2015 ; Qing et al., 2000 ), as it provides the option of spraying the entire plants upon reaching maturity, without the need of using it during the regeneration procedure, as some explant species tend to be more venerable to BASTA at earlier stages. The level of endo-polygalacturonase significantly decreased in transgenic sesame plants, revealing silencing about 99, 96, 98 and 91% at four development stages. In previous studies, the expression of antisense FaPG1 in strawberry transgenic lines reduced the level of FaPG1 by 90–95%, respectively, in transgenic strawberries, which caused fruit firmness at the ripening stage compared to non-transgenic controls (Quesada et al. 2009 ). In tomato ( Solanum lycopersicum ), downregulation of PG using PG-antisense in transgenic plants significantly reduced endogenous PG levels by 70–90% in ripening fruits (Sheehy et al. 1988 ). Further studies on tomatoes by Smith et al. ( 1990 ) revealed a successful downregulation of PG in ripening fruit up to 99%. Our results indicated that the transgenic sesame plants continued vegetative growth and delayed leaf and organ senescence, which might be attributed to the use of a constitutive promoter (35S), yet the harvested capsules showed a delay in opening even after incubating in a 37⁰C incubator for two weeks. Genes associated with seed shattering in sesame Previous studies have highlighted genes associated with organ abscission in different plants like sweet cherry (fruitlet), citrus (fruit), tomato (flower pedicel), passion fruit, and Stylosanthes (seed stalk). In sweet cherry, Qui et al. (2021) identified 15 DEGs related to abscission (abscising carpopodium in fruitlet) from generated transcriptome data. They further confirmed their data using qRT-PCR, indicating that twelve of the fifteen initially identified DEGs showed an upregulation in their expression patterns compared to three downregulated DEGs. Interestingly, polygalacturonase, endoglucanase and expansin were part of the 13 upregulated genes reported (Qiu et al. 2021 ), similar to the results we obtained in our work. In the citrus fruit abscission zone, Merelo et al. ( 2017 ) reported that genes related to cell wall remodeling enzymes (polygalacturonase, pectate lyase, pectin-methyl esterase, cellulase, xyloglucan endotransglucosylases/hydrolases, expansin, endo-β-mannosidase) were upregulated in fruit abscission zones during ethylene-induced abscission, shedding lights on the important of ethylene role in promoting and inducing abscission process. Further studies on tomato flower-pedicel abscission zone indicated the presence of a large number of genes (89 genes) with increased expression levels that were related to phytohormones (DFL1, MES1 and BAS1), transcription factors (MYB36, ERF1, ERF2 and LAS) and cell wall remodeling enzymes (polygalacturonase, expansin and peroxidase) in abscission zones (Nakano et al. 2013 ). Similarly, Li et al. ( 2020 ) identified 18 individual DEGs in the passion fruit abscission zone and validated their results with qRT-PCR. They stated that most of the upregulated genes were somehow involved in plant hormone signaling (ETR, EBF1-2 and CTR1) and cell wall modification enzymes (β-galactosidase, polygalacturonase, pectin methyl esterase, pectin lyase, cellulase and expansin). To understand pod shattering in vetch ( Vicia sativa L.) pod ventral sutures, Dong et al. ( 2017 ) performed transcriptome analysis of pod ventral sutures from shattering-susceptible and shattering-resistant accessions. Their work identified 22 DEGs significantly upregulated in the shattering-susceptible accession related to cell wall modification enzymes and hydrolases (Dong et al., 2017 ). To examine the genes associated with seed shattering in Stylosanthes spp., samples from seed shattering-resistant accession TF0041 and seed shattering-susceptible accession TF0275 were collected and subjected to transcriptome profiling. Li et al. ( 2022 ) identified 26 DEGs involved in lignin biosynthesis, cellulose ester (CE) synthesis, and plant hormone signal transduction. Studies have shown that alteration in the cell wall structure of the dehiscence zone is one of the leading causes of pod shattering in Arabidopsis thaliana (Dong and Wang 2015 ). The fruits which carry the seeds in Arabidopsis are called siliques, and a mature silique consists of three tissues: the valves, the replum, and the valve margins (Robles and Pelaz, 2005 ). The valve and the replum are usually differentiated into a lignified layer (LL) and a separation layer (SL), which together form a dehiscence zone along the silique (Seymour et al. 2013 ). Upon seed maturation, the silique layers dry, thus generating tension within the pod valve that causes the silique to open and the seeds to shatter (Sultan et al. 2018 ). Therefore, the silique dehiscence is a process that depends on the formation of the dehiscence zone along the silique (Ferrándiz, 2002; Dong and Wang, 2015 ). However, the dehiscence zone breakdown depends on various cell wall modification enzymes such as endo-polygalacturonase (Dong et al. 2017 ), cellulase (Merelo et al. 2017 ) and expansin (Marowa et al. 2016 ). The Arabidopsis Dehiscence Zone PG 1 (ADPG1) and ADPG2 are two genes that encode plant-specific endo-polygalacturonases (PGs) and are essential for silique dehiscence in Arabidopsis thaliana (Ogawa et al. 2009 ). In addition to cell wall hydrolytic enzymes, plant hormones also play a significant role in regulating the dehiscence zone's development processes, for example, ethylene and Abscisic acid (Jaradat et al. 2014 and Li et al. 2022 ). Transcription factors in Arabidopsis, it was found that transcription factors such as MADs box, INDEHISCENT (IND) and ALCATRAZ (ALC) were responsible for the differentiation of the dehiscence zone causing seed shattering (Liljegren et al. 2004 ). Phytohormones involved in seed-shattering. Plant hormones such as ethylene (ETH), abscisic acid (ABA), jasmonic acid (JA), and methyl jasmonate (MeJA) are believed to have a vital role in accelerating the abscission process in plants (Lewis et al. 2006 ; Aalen et al. 2013 ; Jaradat et al. 2014 ; Patterson et al. 2016 ; Tranbarger et al. 2017 ; Maity et al. 2021 ). For example, ethylene is known as a vital hormone in fruit ripening, seed shattering and the development of the abscission zones via activating different cascades of pathways (Vrebalov et al. 2002 ; Wang et al. 2002 ; Tacken et al. 2010 ). Similarly, Jaradat et al. ( 2014 ) reported downregulation of 2 ethylene receptors (ETR1 and ETR2) and two ethylene-positive regulators (EIN2 and EIN3) in Brassica juncea (shatter resistant) when compared to B. napus (shattering sensitive). They further proved that ethylene-negative regulator CTR1 was upregulated in B. juncea (shatter resistant) (Jaradat et al. 2014 ). According to Ziosi et al. ( 2006 ), the peaches PpETR1 and PpERS1 gene expression during fruit development and ripening increased significantly. Similar results were obtained in Apple fruits upon ripening and maturation, as there was a significant increase in the ETR2, ETR5, ERSs, EIL4, and ERFs genes, along with ACS1 and ACO1 genes (Yang et al. 2013 ). Abscisic acid (ABA) regulates organ abscission and seed shattering (Estornell et al. 2013 ; Lang et al. 2021 ; Zhai et al. 2022 ). Further analysis of transcriptome (in apple fruitlet abscission zone) shows that the ABA-responsive 9-cis-epoxy carotenoid dioxygenase (NCED) gene, “an essential ABA-biosynthesis gene”, was increased, along with an increased accumulation in ABA concentration before/and during the abscission process (Eccher et al. 2013 ). Further analysis also revealed activation of other genes downstream of the signal transduction of the ABA pathway. The same trend of results was also obtained in rice, as shown via RNA sequencing and expression analysis of NCED, suggesting the existence of a strong correlation between plant hormone ABA and seed shattering (Lang et al. 2021 ). Kim et al. ( 2010 ) showed that the CAR proteins directly interact with ABA receptors, also known as PYRABACTIN RESISTANCE1 (PYR1)/PYR1-LIKE (PYL)/REGULATORY COMPONENTS OF ABA RECEPTORS (RCAR). The receptors are localized at the plasma membrane, and CAR binding to the receptors occurs, allowing the ABA signal transduction through a calcium-dependent manner. This is consistent with Nishimura et al. ( 2010 ), which demonstrated that the CAR proteins might facilitate ABA signaling through ABA binding to PYR/PYL receptors. Diaz et al. (2015) provided solid evidence to clarify that the transient calcium-dependent interactions of the ABA receptors with membranes are mediated through the CAR Protein family and positively regulate ABA signaling. Genetic evidence obtained with combined CAR mutants supports that CAR proteins regulate the ABA responses. Similarly, CAR -mutants in Arabidopsis showed a decreased sensitivity for inhibition of seedling establishment and root growth by ABA (Rodriguez et al. 2014 ). Protein phosphatase 2C (PP2C) negatively regulates plants' ABA signal transduction pathway (Ma et al. 2009 ). In the absence of ABA, PP2C inhibits the activity of SnRK2 proteins (positive regulator of ABA signaling), causing a downregulation and blocking of ABA signaling (Antoni et al. 2012 ). Previous studies in tomato lines that are impaired in PP2C levels (SlPP2C1-RNAi; downregulating of the PP2C) had an acceleration in fruit ripening, which was associated with higher levels of ABA signaling (Zhang et al. 2017 ), while plants overexpressing PP2C were less sensitive to ABA, and had a delay in fruit ripening (Liang et al. 2021 ). In general, cytokinin plays an essential role in plant development and cellular differentiation (Dong and Wang, 2015 ). Cytokinin is involved in leaf formation, growth of apical meristem, cell division, embryonic growth and development, lateral root formation and fruit development (Jameson and Song 2020 ; Schwarz et al. 2020 ; Wu et al. 2021 ; Liu et al. 2021 ; Chen et al. 2022 ). Cytokinin biosynthesis in plants occurs in two steps (Chen 1997 ; Kurakawa et al. 2007 ). Cytokinin riboside 59-monophosphates are converted to the corresponding nucleosides and nucleobases by nucleotidase and nucleosidase (Chen 1997 ). The inactive cytokinin nucleotides are converted directly to the active free base forms (Kurakawa et al. 2007 ). This final step is controlled by the LONELY GUY gene (LOG: encodes a cytokinin riboside 5'-monophosphate phosphoribohydrolase). The LOG gene of rice is required to maintain meristem activity, and its loss of function causes premature termination of the shoot-meristem. Loss of function “the log -mutant” in rice plants severely reduced the panicle size and abnormal branching patterns and decreased the number of floral organs, dramatically reducing seed yield (Kurakawa et al. 2007 ). Kuroha et al. 2009 found that overexpression of the LOG gene in Arabidopsis caused a promotion in cell division in embryos and leaf vascular tissues, as well as causing a delay in leaf senescence. IAA-amino acid hydrolase enzymes are believed to convert auxin amino acid conjugates such as IAA-Ala and IAA-Leu into free active IAA (Schuller and Ludwig-Muller 2006). In peach, PpILR1 , which encodes an indole-3-acetic acid (IAA)-amino hydrolase, PpILR1 acts as a transcriptional activator of 1-amino cyclopropane-1-carboxylic acid synthase( PpACS1 ), a precursor for ethylene production. It hydrolyses auxin substrates to release free auxin (Wang et al. 2021 ). In general, IAA is required for ethylene's active production and release. Therefore, low levels of IAA lead to suppressing PpACS1 expression and low ethylene production at the late ripening stage of stony hard peach. In contrast, high concentrations of IAA are required for ethylene biosynthesis, which results in rapid fruit softening (Pan et al. 2015 ). Cell wall remodeling involved in seed-shattering. Cell wall remodeling is integral to seed shattering. Genes involved in cell wall modification play an important role in facilitating organ shedding. The PGs are enzymes that act in plant development processes such as tissue softening, organ abscission, fruit ripening and microspore release (Hadfield and Bennett 1998 ; Palanivelu 2006 ; Verlent et al. 2005 néchal et al. 2014). The endo-polygalacturonase enzyme breaks down the pectin network in the cell wall by cleaving the glycosidic bond via hydrolytic reactions (Palanivelu 2006 ; Babu and Bayer 2014 ). In previous studies, Sander et al. ( 2001 ) found that the expression of the endo -PG gene increased at later stages of silique development in Arabidopsis. The activity of ADPG1 and ADPG2 genes (endo-PGs) was essential for silique dehiscence in Arabidopsis thaliana (Ferrándiz 2002). Jaradat et al. ( 2014 ) showed that the endo-PG was highly expressed in the dehiscence zone of shatter-sensitive B. napus compared to the shatter-resistant B. juncea . Similarly, the expression of PG in sweet cherries decreased in non-abscising fruits and increased in abscising fruits (Qiu et al. 2021 ). Pectate lyase is believed to mediate pectin demethylation, facilitating the cell wall's middle lamella's degradation (Yang et al. 2018 ). PL gene expression has been reported in ripening fruits, including strawberries (Burraco et al. 2003 ), bananas (Pua et al. 2001 ), grapes (Nunan et al. 2001 ) and mangoes (Deshpande et al. 2017 ). Recent studies have suggested a central role for PL genes in tomato fruit softening and ripening, where tomato fruits impaired in their PL genes had a reduction in their PL mRNA expression, a reduced extractable PL enzyme activity and increased fruit firmness (Uliisik et al. 2016). Pectin-esterase (PE; EC 3.1.1.11) is an enzyme responsible for the demethylation of galactosyl residues in pectin-generating carboxyl groups and releasing free methanol in the cell wall (Phan et al. 2007 ). Pectin-esterase is widely present in plants that possess a cell wall degradation function. In plants, PME exists as multigene families, and different PME genes exhibit different expression specificities. PME plays multiple roles in plants, including methanol accumulation, abscission, plant defense, pollen tube growth, and fruit ripening (Wen et al. 2020 ). In strawberries, FaPE1 is expressed explicitly in fruit, and the expression level corresponds with fruit ripening (Castillejo et al. 2004 ). Endo ꞵ-1,4 glucanase (Cellulase; EG; EC 3.2.1.4) belongs to the glycosyl hydrolase family 9 (GH9). The EG is an enzyme that hydrolyses the 1,4-glycosidic bond between two contiguous D-glucopyranose units. This bond is found in the structure of cellulose, causing cell wall degradation (Perrot et al. 2022 ). As the primary fiber, cellulose provides strength and structural integrity to plant cells, which cellulase can hydrolyze to affect shattering directly. In many crops, cleavage of the abscission layers formed at seed bases leads to seed shattering. Moreover, abscission zone formation is related to the degradation of abscission layer cells by hydrolytic enzymes, including cellulase (Agrawal et al. 2002 ). The FaEG1 gene, “a secreted GH9B β-1,4-glucanase,” is induced explicitly in strawberries upon ripening. It was suggested that FaEG1 might function in disassembling the cellulose–hemicellulose fraction during the ripening of strawberry fruit (Jara et al. 2019 ). ꞵ-glucosidases (bGlu) are essential to the cellulase system (cellulose metabolizing enzymes) and catalyze the last and final step in cellulose hydrolysis. Cellulase enzymes hydrolyze the cellulose to produce cellobiose and other short oligosaccharides, which are finally hydrolyzed to glucose by b-glucosidase (Singh et al. 2016 ). Dong et al. ( 2017 ) previously reported that ꞵ-Glucosidases are essential in the breakdown of the cell wall and the degradation of the dehiscence zone. In strawberries, Zhang et al. ( 2014 ) reported that the expression of the β- glucosidase one gene (FaBG1) increased significantly upon fruit color development “ripening”. Expansins are cell wall proteins that consist of four subfamilies: a-expansin, b-expansin, expansin-like A, and expansin-like B. These proteins play essential roles in cell wall decomposition and disassembly during the ripening of fruits (Dong et al. 2017 ). In tomatoes, Expansin (SlEXP1) proteins cooperatively disassemble the polysaccharide network of tomato fruit cell walls during ripening, enabling the loosening of tight tissues and softening of fruit walls (Jiang et al. 2019 ). Suppression of the ripening-related EXP-encoding gene slowed tomato fruit softening during ripening (Brummell et al. 1999 ). In other fruits, such as strawberries and cantaloupe, expansin mRNAs are also expressed in the late stages of ripening, making expansin a constant feature of fruit softening (Civello et al. 1999 ). Arabinogalactan proteins (AGPs) are highly glycosylated members of the superfamily of hydroxyproline-rich glycoproteins (HRGPs) found in plants (Showalter 2001 ). AGPs are critical in cell wall dissolution, abscission zone differentiation, organ detachment and fruit softening (Leszczuk et al. 2019 ). In tomatoes, the SlAGP mRNA was significantly up-regulated during fruit ripening following climacteric ethylene production (Fragkostefanakis et al. 2012 ). Silencing of Prolyl 4 Hydroxylase 3 (SIP4H3) (an enzyme involved in AGP synthesis) leads to delay of abscission progression in overripe tomatoes, resulting in lower content of AGP (Perrakis et al. 2019 ). Cellulose is one of the contents in the primary (14%) and secondary cell walls (40–80%) (Gigli-Bisceglia et al. 2019 ). Further studies on Stylosanthes (a genus of flowering plants in the legume family Fabaceae) accessions showed that cellulose synthase was expressed significantly higher in the shattering-resistance accessions vs. the SS-susceptible accession (Li et al. 2022 ). 4-coumarate: CoA ligase contributes to lignin biosynthesis (Li et al. 2015 ). Lignin is the second most abundant polymer after cellulose and is present in the secondary cell walls of all plants (Lavhale et al. 2018 ; Naik et al. 2018 ). In a previous study, the results from the 4CL transgenic experiments suggest that the downregulation of 4CL leads to a reduction in lignin content in tobacco and Arabidopsis (Kajita et al. 1997 ; Lee et al. 1997 ). Yoon et al. ( 2014 ) reported that overexpression of SH5 (gene control of abscission zone development) in a non-shattering rice cultivar led to increasing seed shattering by enhancing abscission zone development and decreased the level of lignin in the basal region of spikelet. The expression level of several genes involved in the lignin biosynthesis pathway was also decreased in plants with overexpression of SH5. Other genes related to capsule maturation Dicarboxylate transporter (DT) is a transporter gene. Malate accumulation increased during fruit ripening in tomatoes and strawberries (Centeno et al. 2011 ; Hu et al. 2018 ). In tomatoes, a putative tonoplast dicarboxylate transporter gene (SlTDT) was cloned and was used to produce lines overexpressing the gene and others expressing an RNAi vector of the gene. Tomato plants overexpressing the TDT gene had high malate levels and low citrate content in their fruit, while the RNAi lines had low malate levels and higher citrate levels (Liu et al. 2017 ). Higher malate levels are believed to be associated with accelerated fruit ripening (Etienne et al. 2013 ). The Isoamylase (ISA3) gene type of starch-debranching enzyme (DBE) is used for starch degradation (Wattebled et al. 2005 ). During fruit development in bananas, the starch that accumulates in the fruits (makes up to 20–25% of total fruit dry weight) is usually converted by isoamylase 3 (EC 3.2.1.68) to give different forms of simple sugars via debranching the starch (Bierhals et al. 2004 ). In bananas, ISA is expressed when starch is degraded during fruit ripening (Xiao et al. 2018 ). Interestingly, it has been reported that drought induces pod shattering in beans ( Phaseolus vulgaris L.). The water-stress treatment induced a higher starch accumulation in the drought-resistant cultivar pods “Pinto Villa” than in those of the drought-sensitive cultivar “Canario 60” (Ortiz et al. 2008 ). Transcription factors regulate seed-shattering. In a previous study in soybeans, 18 different families of TFs, including homeobox, MYB, Zinc finger, bHLH, AP2, NAC, WRKY, YABBY (YAB) and ERF, were identified as part of the complex regulation of organ separation (Kim et al. 2016 ). In previous studies, the MADS-box was found to regulate the dehiscence zone development during pod-shattering of Arabidopsis (Ferrándiz 2002). Silencing of the FaMADS9 gene in strawberries leads to the inhibition of fruit ripening (Seymour et al., 2011 ). Furthermore, Liu et al. ( 2013 ) reported high levels of MuMADS transcripts at later stages of fruit ripening in bananas. In the bZIP gene, Lovisetto et al. ( 2013 ) showed that bZIP was highly expressed in peaches during ripening. In a previous study, bZIP was found to be involved in ABA signaling in grape berries (bZIP binds the AREP/ABF responsive element and causes activation of ABA signaling), ABF transcript accumulated in fruit during ripening, and ABA was upregulated (Nicolas et al. 2014 ). The DNA binding with one finger (dof) plays a vital role in biological processes such as plant growth, seed germination, fruit ripening and organ abscission (Zou and Sun 2023 ). In previous studies, ethylene accelerates organ abscission in Arabidopsis by regulating the expression of At DOF4.7 (Wang et al. 2016 ). Li et al. ( 2022 ) reported that, in Areca catechu L. , six AcDOF genes showed high expression levels in the abscission zone. The FaDof2 gene was expressed at high levels during fruit ripening in strawberries (Molina-Hidalgo et al. 2017 ). The high expression of DzDOF2.2 in durian increased the level of ethylene biosynthesis through the transcriptional activation of the ACC synthase gene and promoted early fruit ripening (Khaksar et al. 2019 ). Conclusion In the present work, we generated transgenic sesame plants expressing the pFGC5941-PG vector carrying the RNAi version of the sesame endo polygalacturonase gene. The endopolygalacturonase gene was previously identified in our laboratory. The non-tissue culture-based transformation technique was developed for sesame to minimize/eliminate somaclonal variation in the resulting transgenics. Successful transformation into T 0 and T 1 progeny was confirmed via PCR, leaf painting, and Basta spraying fully matured plants. RT-PCR and qRT-PCR were performed to confirm the successful incorporation and transfer of the transgene into the next generations. T 1 progeny was used to perform RNA-transcriptome analysis using the false-septs tissues excised from sesame capsules at four developmental stages. Analysis of the transcriptome data between false septa tissues excised from transgenic vs. non-transgenic controls indicated the presence of a total of 24,468 unigenes in total, which were classified into 21 functional categories (5988 MF, 5349 BP, and 13131 CC). In our selected comparison, 514 DEGs were recognized, with 349 up-regulated and 165 down-regulated. Transcriptome analysis of endo-PG expression patterns across the four developmental stages (transgenic vs. non-transgenic control sesame tissues) revealed a silencing of 99, 96, 98, and 91%, respectively, across the four developmental stages (the results were confirmed using realTime-PCR). Furthermore, transcriptome analysis revealed that silencing of endo-PG in transgenic sesame plants caused a universal change in gene expression in the false-septa tissue. Nineteen differentially expressed genes were further tested in detail to shed more light on their role in seed shattering in sesame. The 19 individual DEGs were classified into four categories related to seed shattering: 1) plant hormones, 2) cell wall remodeling, 3) transcription factors, and 4) the capsule maturation process. The expression pattern of these genes illustrates the differences between control and transgenic false septa tissues across the four developmental stages. The present work clearly shows how changing the expression of a single gene, “PG,” ultimately changes the expression of the gene network involved in seed shattering. Downregulating PG expression in sesame plants had a noticeable effect on other major players “cell-wall remodeling enzymes, hormonal balance within the false septa tissues, and changes in significant players in transcription factors that are known to play a critical role in capsules/fruits ripening”; this is represented by (Fig. 10 ) which summarizes the complexity of seed shattering in sesame upon downregulating a single gene at a time. The transgenic sesame plants showed a delay in leaf senescence and, most importantly, a delay in capsule shattering, which could be attributed to using the 35CaMV constitutive promoter. Our success in developing the non-tissue culture-based technique for transformation in sesame enables the present work to be achieved without the worry that some of the results might be mutation artefacts during the tissue culture procedure. The current work represents the first attempt at understanding how changing the expression of a single gene involved in fruit ripening could alter the global expression of genes within a single tissue layer in the capsule. The present work indicates the complexity of the different players involved in seed-shattering phenomena. We have proved that changing the expression of a single gene in sesame was enough to delay the seed-shattering phenomena, yet further work using capsule-specific promoters and more candidate genes “as a target for silencing” might be needed to understand the exact role of each gene. Declarations Ethical Statement All experiments and results in this manuscript were meticulously produced and analyzed using scientifically based methods and techniques. We assure you that no animal tests or products were used during this study, adhering to the highest ethical standards of scientific research. The manuscript has only been submitted to your journal and has not been published before in any publication (media, seminars, prints… etc.). Conflict of Interest Statement The Authors of the current manuscript reiterate that there is no conflict of interest with anyone concerning the present manuscript or the published data. We are committed to presenting our findings in an unbiased and transparent manner. Author contribution statement : Esraa A. A. Sultan In charge of constructing, generating, and testing transgenic plants. Drafting manuscript and figures, as well as repeating some of the transcriptome analysis. Mariam Oweda and Mohamed – El-Hadidi Their main duties was analysis of the transcriptome raw data. Nagwa I. Elarabi and Abdelhadi A. Abdelhadi Supervising the thesis at Faculty of Agriculture, Cairo University, (review and editing). Naglaa A. Abdallah She donated the pFGC5941construct that used in this research paper. Mohamed S. Tawfik The main supervisor, where the entire work was conducted in his lab “Oil Crops Biotechnology Lab, OCBL”. This research paper was funded by an STDF project that was supervised by Mohamed S. Tawfik. Drafting the manuscript and figures, conceptualization, funding acquisition, validation, and editing. Funding The work was partially funded through the Science and Technology Developmental Fund (STDF), Grant # 28934. References Aalen, R. B., Wildhagen, M., Stø, I. M. and Butenko, M. A. (2013). IDA: a peptide ligand regulating cell separation processes in Arabidopsis. J Exp Bot 17: 5253-5261. Agrawal, A. P., Basarkar, P. W., Salimath, P. M. and Patil, S. A. (2002). Role of cell wall-degrading enzymes in pod-shattering process of soybean, Glycine max (L.) Merrill. Cur Sci 82: 58-61. Al-Shafeay, A. F., Ibrahim, A. S., Nesiem, M. R., Tawfik, M. S. (2011). Establishment of regeneration and transformation system in Egyptian sesame ( Sesamum Indicum L.) Cv. Sohag 1. GMOs 2: 182-192. Al-Shafeay, A. F., Ibrahim, A. S., Nesiem, M. R., Tawfik, M. S. (2018). Dehydration stress tolerance in sesame plants ( Sesamum Indicum L.) overexpressing the Arabidopsis thaliana molybdenum cofactor sulfurase LOS5/aba3 gene under greenhouse conditions. Biosci. Res 15: 3131-3143. An, C., Sawada, A., Fukusaki, E. I. and Kobayashi, A. (2003). A transient RNA interference assay system using Arabidopsis protoplasts . Biosci Biotech Biochem 67: 2674-2677. Anilakumar, K. R., Pal, A., Khanum, F. and Bawa, A. S. (2010). Nutritional, medicinal, and industrial uses of sesame ( Sesamum Indicum L.) seeds. Agri Conspec Sci 75: 159–168. Antoni, R., Gonzalez-Guzman, M., Rodriguez, L., Rodrigues, A., Pizzio, G. A. and Rodriguez, P. L. (2012). Selective clade A phosphatase type 2C inhibition by PYR/PYL/RCAR abscisic acid receptors. Plant Physiol 158: 970-980. Babu, Y. and Bayer, M. (2014). Plant polygalacturonases involved in cell elongation and separation are the same but different. Plants 3: 613–623. Bierhals, J. D., Lajolo, F. M., Cordenunsi, B. R. and Nascimento, J. R. O. (2004). Activity, cloning, and expression of an isoamylase-type starch-debranching enzyme from banana fruit. J Agri Food Chem 52: 7412-7418. Bishopp, A., Benkova, E. and HelariuttA, Y. (2011). Sending mixed messages: auxin-cytokinin crosstalk in roots. Cur Open Plant Bio 14: 10-16. Brummell, D. A., Harpster, M. H., Civello, P. M., Palys, J. M., Bennett, A. B. and Dunsmuir, P. (1999). Modification of expansin protein abundance in tomato fruit alters softening and cell wall polymer metabolism during ripening. Plant Cell 11: 2203–2216. Burraco, A. B., Portales, R. B., Nevado, J. R., Bellido, M. L., Moyano, E., Caballero, J. L. and Blanco, J. M. (2003). Cloning and characterization of two ripening-related strawberry (FragariaHananassa cv. Chandler) pectate lyase genes. J Exp Bot 54: 633-645. Carranza, Z. H., Whitelaw, C. A., Swarup, R. and Roberts, J. A. (2002). Temporal and spatial expression of a polygalacturonase during leaf and flower abscission in oilseed rape and Arabidopsis. Plant Physiol 128: 534-543. Castillejo, C., Fuente, J. I., Iannetta, P., Botella, M. A. and Valpuesta, V. (2004). Pectin esterase gene family in strawberry fruit: a study of FaPE1, a ripening-specific isoform. J Exp Bot 55: 909-918. Centeno, D. C., Osorio, S., Nesi, A. N., Bertolo, A. L. F., Carneiro, R. T., Araujo, W. L., Steinhauser, M. C., Michalska, J., Rohrmann, J., Geigenberger, P., Oliver, S. N., Stitt, M., Carrari, F., Rose, J. K. C. and Ferniea, A. R. (2011). Malate plays a crucial role in starch metabolism, ripening, and soluble solid content of tomato fruit and affects postharvest softening. Plant Cell 23: 162-184. Chen, C. M. (1997). Cytokinin biosynthesis and interconverion. Physiol. Plant 101: 665-673. Chen, L., Jameson, G. B., Guo, Y., Song, J. and Jameson, P. E. (2022). The LONELY GUY gene family: from mosses to wheat, the key to the formation of active cytokinin in plants. Plant Biotechnol. J 20: 625-645. Civello, P. M., Powell, A. L. T., Sabehat, A. and Bennett, A. B. (1999). An expansin gene is expressed in ripening strawberry Fruit. Plant Physio 121: 1273–1279. Day, J. S. (2000). Anatomy of capsule dehiscence in sesame varieties. J Agri Sci 134: 45-53. Deshpande, A.B., Anamika, K., Jha, V., Chidley, H. G., Oak, P. S., Kadoo, N. Y., Pujari, K. H., Giri, A.P. and Gupta, V. S. (2017). Transcriptional transitions in Alphonso mango ( Mangifera indica L.) during fruit development and ripening explain its distinct aroma and shelf-life characteristics. Sci Rep 7: 8711-8730. Diaza,M., Barrenaa, M. J.S., Rubioa, J. M. R., Rodriguezb, L., Fernandezc, D., Antonib, R., Yuntaa, C., Palazonb, B. B., Guzmanb, M. G., Llobetb, M. P., Menendeza, M., Boskovicd, J., Marquezc, J. A., Rodriguezb, P. L., and Alberta, A. (2015). Calcium-dependent oligomerization of CAR proteins at cell membrane modulates ABA signaling, PNAS 113: 396-405. Dobin, A., Carrie A. Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Mark Chaisson, M. and Gingeras, T. R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29: 15-21. Doebley, J. (2006). Unfallen grains: How ancient farmers turned weeds into crops. Science 312: 1318–1319. Dong, R., Dong, D., Luo, D., Zhou, Q., Chai, X., Zhang, J., Xie, W., Liu, W., Dong, Y., Wang, Y. and Liu, Z. (2017). Transcriptome analyses reveal candidate pod-shattering-associated genes involved in the pod ventral sutures of common vetch ( Vicia sativa L.). Front Plant Sci 8: 649-663. Dong, Y. and Wang, Y. Z. (2015). Seed shattering: from models to crops. Front Plant Sci 6: 476-489. Dossa, K., Li, D., Wang, L., Zheng, X., Liu, A., Yu, J., Wei, X., Zhou, R., Fonceka, D., Diouf, D., Liao, B., Ndiaga Cissé, N. and Zhang, X. (2017). Transcriptomic, biochemical, and physio-anatomical investigations shed more light on responses to drought stress in two contrasting sesame genotypes. Scient Rep 7: 8755-8769. Dossa, K., Mmadi, M. A., Zhou, R., Zhang, T., Su, R., Zhang, Y., Wang, L., You, J. and Zhang, X. (2019). Depicting the core transcriptome modulating multiple abiotic stresses responses in Sesame ( Sesamum indicum L.). Inter J Mol Sci 20: 3930-3950. Eccher, G., Botton, A., Dimauro, M., Boschetti, A., Benedetto Ruperti, B. and Ramin, A. (2013). Early induction of apple fruitlet abscission is characterized by an increase in both isoprene emission and abscisic acid content. Plant Physio 161: 1952-1969. Escobar, M. A., Civerolo, E. L., Summerfelt, K. R. and Dandekar, A. M. (2001). RNAi-mediated oncogene silencing confers resistance to crown gall tumorigenesis. PNAS 98: 13437-1342. Estornell, L. H., Agusti, J., Merelo, P., Talon, M. and Tadeo, F. R. (2013). Elucidating mechanisms underlying organ abscission. Plant Sci 199: 48-60. Etienne, A., Génard, M., Lobit, P., Mbéguié, M. A. and Bugaud, C. (2013). What controls fleshy fruit acidity? A review of malate and citrate accumulation in fruit cells. J. Exp. Bot. 64: 1451-1469. Fabi, J. P., Broetto, S. G., Silva, S. L. G. L., Zhang, S., Lajolo, F. M. and Nascimento, J. R. O. (2014). Analysis of papaya cell-wall-related genes during fruit ripening indicates a central role of polygalacturonase during pulp softening. PLOS 9: 105685-105697. Ferrandiz, C. (2002). Regulation of fruit dehiscence in Arabidopsis. J. Agric. Sci 53: 2031-2038. Fragkostefanakis, S., Dandachi, F. and Panagiotis Kalaitzis, P. (2012). Expression of arabinogalactan proteins during tomato fruit ripening and in response to mechanical wounding, hypoxia, and anoxia. Plant Physio Biotech 52: 112-118. Fritz, J. H., Girardin, S. E. and Philpott, D. J. (2006). Innate immune defense through RNA interference. Sci Signal 339: 1-4. Fuller, D. Q. and Allaby, R. (2009). Seed dispersal and crop domestication: shattering, germination, and seasonality in evolution under cultivation. Ann Plant Rev 38: 238–295. Gamborg, O. L., Miller, R. A. and Ojimal, K. (1968). Nutrient requirements of suspension cultures of soybean root cells. Exp Cell Res 50: 151-158. Gigli-Bisceglia, N., Engelsdorf, T. and Hamann, T. (2019). Plant cell wall integrity maintenance in model plants and crops species-relevant cell wall components and underlying guiding principles. CMLS 77: 2049-2077. Girin, T., Stephenson, P., Goldsack, C. M. P., Kempin, S. A., Perez, A., Pires, N., Sparrow, P. A., Wood, T. A., Yanofsky, M. F.and Østergaard, L. (2010). Brassicaceae INDEHISCENT genes specify valve margin cell fate and repress replum formation. Plant J 63: 329–338. Gupta, A., Pal, R. K. and Rajam, M. V. (2013). Delayed ripening and improved fruit processing quality in tomato by RNAi-mediated silencing of three homologs of 1-aminopropane-1- carboxylate synthase gene. J Plant Physio 170: 987–995. Hadfield, K. A. and Bennett, A. B. (1998). Polygalacturonases: many genes in search of a function. Plant Physio 117: 337-343. Hirai, S. and Kodama, H. (2008). RNAi vectors for manipulation of gene expression in higher plants. Plant Sci J 2: 21-30. Hu, P., Li, G., Xia, X., Zhao, F., Li, L. and Zhou, H. (2018). Transcriptome profiling by RNA-Seq reveals differentially expressed genes related to fruit development and ripening characteristics in strawberries ( Fragaria ananassa ). Peer J 33: 4976-4995. Jameson, P. E. and Song, J. (2020). Will cytokinin underpin the second ‘ Green Revolution'? J. Exp. Bot. 71: 6872-6875. Jara, K., Castro, R. I., Ramos, P., Palma, C. P., Riffo, F. V., and Quintana, L. M. (2019). Molecular insights into FaEG1, a strawberry endoglucanase enzyme expressed during strawberry fruit ripening. Plants 8: 140-153. Jaradat, M. R., Ruegger, M., Bowling, A., Butler, H. and Cutler, A. J. (2014). A comprehensive transcriptome analysis of silique development and dehiscence in Arabidopsis and Brassica integrating genotypic, interspecies, and developmental comparisons. GM Crops Food 5: 302–320. Jelinski, D. E. (1990). On the use of chi-square analysis in studies of resource utilization. Can J For Res 21: 58-65. Jiang, C. J. Shimono, M., Maeda, S., Inoue, H., Mori, M., Hasegawa, M., Sugan, S. and Takatsuji, H. (2009). Suppression of the rice fatty-acid desaturase gene OsSSI2 enhances resistance to blast and leaf blight diseases in rice. Mol Plant Microbe Inter 22: 820-829. Jiang, F., Lopez, A., Jeon, S., Freitas, S. T., Yu, Q., Zhen Wu, Z., Labavitch, J. M., Shengke Tian, S., Powell, A. L. T. and Mitcham, E. (2019). Disassembly of the fruit cell wall by the ripening associated polygalacturonase and expansin influences tomato cracking. Hort Res 6: 1-15. Jin, X., Zimmermann, J., Polle, A. and Fischer, U. (2015). Auxin is a long-range signal that acts independently of ethylene signaling on leaf abscission in Populus . Front Plant Sci 6: 634-644. Kajita, S., Hishiyama, S., Tomimura, Y., Katayama, Y., and Omori, S. (1997). Structural Characterization of Modified Lignin in Transgenic Tobacco Plants in Which the Activity of 4-Coumarate: Coenzyme A Ligase 1s Depressed. Plant Physiol. 114: 871-879. Kang, L., Wang, Y. S., Uppalapati, S. R., Wang, K., Tang, Y., Vadapalli, V., Venables, B. J., Chapman, K. D., Blancaflor, E. B. and Mysore, K. S. (2008). Overexpression of a fatty acid amide hydrolase compromises innate immunity in Arabidopsis . Plant J 56: 336–349. Karlova, R., Haarst, J. C., Maliepaard, C., Geest, H., Bovy, A. G., Lammers, M., Angenent, G. C.and Maagd, R. A. (2013). Identification of micro-RNA targets in tomato fruit development using high-throughput sequencing and degradome analysis. J Exp Bot 64: 1863-1878. Khaksar, G., Sangchay, W., Pinsorn, P., Sangpong, L. and Sirikantaramas, S. (2019). Genome-wide analysis of the Dof gene family in durian reveals fruitripening-associated and cultivar-dependentDof transcription factors. Sci. Rep. 9: 1-13. Kim, J., Yang, J., Yang, R., Sicher, R. C., Chang, C. and Tucker, M. L. (2016). Transcriptome analysis of soybean leaf abscission identifies transcriptional regulators of organ polarity and cell fate. Front Plant Sci 7: 125-141. Kim, K. S., Park, S. H. and Jenks, M. A. (2007). Changes in leaf cuticular waxes of sesame ( Sesamum indicum L.) plants exposed to water deficit. Sci Dir 164: 1134-1143. Kim, T. H., Böhmer, M., Hu, H., Nishimura, N. and Schroeder, J. I. (2010). Guard cell signal transduction network: Advances in understanding abscisic Acid, CO2, and Ca2+ Signaling. Ann Rev Plant Bio 2: 561-591. Kourmpetli, S. and Drea, S. (2014). The fruit, the whole fruit, and everything about the fruit. J Exp Bot 65: 4491–4503. Kurakawa, T., Ueda, N., Maekawa, M., Kobayashi, K., Kojima, M., Nagato, Y., Sakakibara, H. and Kyozuka, J. (2007). Direct control of shoot meristem activity by a cytokinin-activating enzyme.Nature 455: 652-655. Kuroha, T., Tokunaga, H., Kojima, M., Ueda, N., Ishida, T., Nagawa, S., Fukuda, H., Sugimoto, K. and Sakakibaraa, H. (2009). Functional analyses of LONELY GUY cytokinin-activating enzymes reveal the importance of the direct activation pathway in Arabidopsis. Plant Cell 21: 3152-3169. Lakhanpaul, S., Singh, V., Bhardwaj, D. and Bhat, K. V. (2012). Sesame: Overcoming the abiotic stresses in the queen of oilseed crops. Improv Crop Resist Abiotic Stress 2: 1251–1283. Lang, H., He, Y., Li, F., Ma, D. and Sun, J. (2021). Integrative hormone and transcriptome analysis underline the role of abscisic acid in seed shattering of weedy rice. Plant Growth Regul 94: 261-273. Langham, D. R and Wiemers, T. (2002). Progress in mechanizing sesame in the US through breeding. Trends New Crops New Use 17: 157-173. Lavhale, S. G., Kalunke, R. M. and Giri, A. P. (2018). Structural, functional and evolutionary diversity of 4‑coumarate‑CoA ligase in plants. Planta. 248: 1063-1078. Lee, D., Meyer, K., Chapple, C. and Douglasa, C. J. (1997). Antisense Suppression of 4 Coumarate: Coenzyme A Ligase Activity in Arabidopsis Leads to Altered Lignin Subunit Composition. Plant Cell. 9: 1985-1998. Lengyel, S., Gove, A. D., Latimer, A. M., Majer, J. D. and Dunn, R. R.(2010). Perspectives in plant ecology, evolution, and systematics convergent evolution of seed dispersal by ants, and phylogeny and biogeography in flowering plants: a global survey. Sci Direct 12: 43-55. Leszczuk, A., Chylińska, M. and Zdunek, A. (2019). Enzymes and vitamin C are factors influencing the presence of arabinogalactan proteins (AGPs) in Solanum lycopersicum fruit. Plant Physiol Biochem. 139: 681-690. Lewis, M. W., Leslie, M. E. and Liljegren, S. J. (2006). Plant separation: 50 ways to leave your mother. Sci Direct 9: 59-65. Li, C., Xin, M., Li, L., He, X., Liu, G., Li, J., Sheng, J. and Sun, J. (2020). Transcriptome profiling helps to elucidate the mechanisms of ripening and epidermal senescence in passion fruit ( Passiflora edulia Sims). PLoS One 15: 236535-236553. Li, J., Jia, X., Yang, Y., Chen, Y., Wang, L., Liu, L. and Li, M. (2022). Genome-wide identification of the DOF gene family involved in fruitlet abscission in Areca catechu L. Inter J Mol Sci 23: 11768–11788. Li, X., Zhang, J., Zhang, J., Sheng, W., Huang, R., Dong, R., Ding, X., Liu, P. and Liu, G. (2022). Histological characteristics, cell wall hydrolytic enzyme activity, and transcriptome analysis with seed shattering of Stylosanthes accessions. Front Plant Sci 13: 1018404-1018417. Li, Y., Kim, J. I., Pysh, L. and Clint Chapple, C. (2015). Four isoforms of Arabidopsis 4-Coumarate: CoA Ligase have overlapping yet distinct roles in phenylpropanoid metabolism. Plant Physio 169: 2409–2421. Liang, B., Sun, Y., Wang, J., Zheng, Y., Zhang, W., Xu, Y., Li, Q. and Leng, P. (2021). Tomato protein phosphatase 2C influences the onset of fruit ripening and fruit glossiness. J Exp Botany 72: 2403-2418. Liljegren, S. J., Roeder, A. H. K., Kempin, S. A., Gremski, K., Østergaard, L., Guimil, S., Reyes, D. K. and Yanofsky, M. F. (2004). Control of fruit patterning in Arabidopsis by INDEHISCENT . Cell 116: 843-853. Liljergren, S. J., Ditta, G. S., Eshed, Y., Savidge, B., Bowman, J. L. and Yanofsky, M. F.(2000). SHATTERPROOF MADS-box genes control seed dispersal in Arabidopsis. Nature 404: 766-770. Liu, D., Zho, H., Xiao, Y., Zhang, G., Cao, S., Yin, W., Qian, Y., Yin, Y., Zhang, J., Chen, S., Chu, C. and Tong, H. (2021). A cryptic inhibitor of cytokinin phosphorelay controls rice grain size. Mol Plant 15: 293-307. Liu, H., Tan, M., Yu, H., Li, L., Zhou, F., Yang, M., Zhou, T. & Zhao, Y. (2016). Comparative transcriptome profiling of the fertile and sterile flower buds of a dominant genic male sterile line in sesame ( Sesamum indicum L.). BMC Plant Bio 16: 250–263. Liu, J. H., Zhang, J., Jia, C. H., Zhang, J. B., Wang, J. S., Yang, Z. X., Xu, B. Y. and Jin, Z. Q. (2013). The interaction of banana MA0DS-box protein MuMADS1 and ubiquitin-activating enzyme E-MuUBA in post-harvest banana fruit. Plant Cell Rep 32: 129-137. Liu, R., Li, B., Qin, G., Zhang, Z. and Tian, S. (2017). Identification and Functional Characterization of a Tonoplast Dicarboxylate Transporter in Tomato ( Solanum lycopersicum ). Front Plant Sci 8: 186-195. Lovisetto, A., Guzzo, F., Tadiello, A., Confortin, E., Pavanello, A., Botton, A. and Casadoro, G. (2013). Characterisation of the bzip gene is highly expressed during the ripening of the peach fruit. Plant Physiol Biochem 70: 462-470. Ma, Y., Szostkiewicz, L., Korte, A., Moes, D., Yang, Y., Christmann, A. and Grill, E. (2009). Regulators of PP2C Phosphatase Activity Function as Abscisic Acid Sensors. Science 324: 1064-1068. Maity, A., Lamichaney, A., Joshi, D. C., Bajwa, A., Subramanian, N., Walsh, M. and Bagavathiannan, M. (2021). Seed shattering: A trait of evolutionary importance in plants. Front Plant Sci 12: 657773-657790. Manickavasagam, M., Subramanyam, K., Ishwarya, R., Elayaraja, D. and Ganapathi, A. (2015). Assessment of factors influencing the tissue culture-independent Agrobacterium-mediated in planta genetic transformation of okra [Abelmoschus esculentus (L.) Moench]. PCTOC 123: 309-320. Marciniak, K., Kućkoa, A., Wilmowicza, E., Michał Świdzińskic, M., Krzysztof Przedniczeka, K. and Kopcewicza, J. (2018). Gibberellic acid affects the functioning of the flower abscission zone in Lupinus luteus via cooperation with the ethylene precursor independently of abscisic acid. J Plant Physio 229: 170-174. Markovic. O and Janecek. S. (2001). Pectin degrading glycoside hydrolases of family 28: sequence-structural features, specificities, and evolution. Protein Engin 14: 615–631. Marowa, P., Anming Ding, A. and Kong, Y. (2016). Expansins: roles in plant growth and potential applications in crop improvement. Plant Cell Rep 35: 949–965. Mayavan, S., Subramanyam, K., Arun, M., Rajesh, M., Dev, G. K., Sivanandhan, G., Jagannath, B., Manickavasagam, M., Selvaraj, N. and Ganapathi, A. (2013). Agrobacterium tumefaciens-mediated in planta seed transformation strategy in sugarcane. Plant Cell Rep 32: 1557–1575. Meli, V. S., Ghosh, S., Prabha, T. N., Chakraborty, N., Chakraborty, S and Datta, A. (2010). Enhancement of fruit shelf life by suppressing N-glycan processing enzymes. PNAS 107: 2413-2418. Merelo, P., Agusti, J., Arbona, V., Costa, M. L., Estornell, L. H., Gomez-Cadenas, A., Coimbra, S., Gomez, M. D., Perez-Amador, M. A., Domingo, C. Talon, M. and Tadeo, F. R. (2017). Cell wall remodeling in abscission zone cells during ethylene-promoted fruit abscission in citrus. Front. Plant Sci 8: 126-146. Molina-Hidalgo, F. J., Medina-Puche, L., Cañete -Gómez, C.., Franco-Zorrilla, J. M., López -Vidriero, I., Solano, R., Caballero, J. L., Rodríguez-Franco, A., Blanco-Portales, R., Muñoz-Blanco, J. and Moyano, E. (2017). The fruit-specific transcription factor FaDOF2 regulates the production of eugenol in ripe fruit receptacles. J. Exp. Bot. 68: 4529-4543. Murashige, T. and Skoog, F. (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physio Planta 15: 473-497. Murray, M. G. and Thompson, W. F. (1980). Rapid isolation of high molecular weight plant DNA. Nuc Acids Res 8: 4321–4325. Naik, P., Wang, J. P., Sederoff, R., Chiang, V., Williams, C., Ducoste, J. J. (2018). Assessing the impact of the 4CL enzyme complex on the robustness of monolignol biosynthesis using metabolic pathway analysis. PloS One. 13: 193896-193915. Nakano, T., Fujisawa, M., Shima, Y. and Ito, Y. (2013). Expression profiling of tomato pre-abscission pedicels provides insights into abscission zone properties, including competence in responding to abscission signals. BMC Plant Biol 13: 40-60. Nath, R.; Chakraborty, P. K. and Chakraborty. A. (2001). Effect of climatic variation on yield of sesame ( Sesamum indicum L.) at different dates of sowing. J Agro Crop Sci 186: 97–102. Nicolas, P., Lecourieux, D., Kappel, C., Cluzet, S., Cramer, G., Delrot, S. and Lecourieux, F. (2014). The basic leucine zipper transcription factor ABSCISIC ACID RESPONSE ELEMNETBINDING FACTOR2 is an important transcriptional regulator of abscisic acid-dependent grape berry ripening processes. Plant Physiol 164: 365-383. Nishimura, N., Sarkeshik, A., Nito, K., Park, S. Y., Wang, A., Carvalho, P. C., Lee, S., Caddell, D. F., Cutler, S. R., Chory, J., Yates, J. R. and Schroeder, J. I. (2010). PYR/PYL/RCAR family members are major in-vivo ABI1 protein phosphatase 2C interacting proteins in Arabidopsis. Plant J 61: 290–299. Nunan, K. J., Davies, C., Robinson, S. P. & Fincher, G. B. (2001). Expression patterns of cell wall-modifying enzymes during grape berry development. Planta 214: 257-264. Ogasawara, S., Abe, K. and Nakajima, T. (2007). Pepper β- galactosidse 1 ( PBG1 ) plays a significant role in fruit ripening in bell pepper ( Capsicum annuum L. ). Biosci. Biotechnol. Biochem 71: 309–322. Ogawa, M., Kay, P., Wilson, S. and Swain, S. M. (2009). Arabidopsis dehiscence zone polygalacturonase 1 ( ADPG1 ), ADPG2 and QUARTET2 are polygalacturonases required for cell separation during reproductive development in Arabidopsis. Plant Cell 21: 216-233. Ogbonna, P. E. and Ukaan, S. I. (2013). Chemical composition and oil quality of seeds of sesame accessions grown in the Nsukka plains of southeastern Nigeria. Afr J Agri Res 8: 797-803. Okonechnikov, K., Conesa, A. and Alcalde, F. G. (2015). Qualimap 2: Advanced multi-sample quality control for high-throughput sequencing data. Bioinformatics 32: 292- 295. Ortiz, C. S., Montiel,M. D. L. P., Gallegos, J. A. and Covarrubias, A. A. (2008). Relationship between carbohydrate partitioning and drought resistance in common bean . Plant Cell Environ 31: 1399-1409. Palanivelu, P. (2006). Polygalacturonases: active site analyses and mechanism of action. Ind J Biotech , 5, 148-162. Pan, L., Zeng, W., Niu, L., Lu, Z., Wang, X., Liu, H., Cui, G., Zhu, Y., Chu, J., Li, W., Fang, W., Cai, Z., Li, G. and Wang, Z. (2015). PpYUC11 , a strong candidate gene for the stony hard phenotype in peach ( Prunus persica L. Batsch), participates in IAA biosynthesis during fruit ripening . J Exp Bot 66: 7031–7045. Patharkar, O. R. and Walker, J. C. (2018). Advances in abscission signalling. J Exp Bot 69: 733–740. Patterson, S. E., Medina, J. L. B., Falbel, T. G., Hedtcke, J. L., McBride, D. N., Andrew F. Maule, A. F. and Zalapa, J. E. (2016). Are we on the right track: can our understanding of abscission in model systems promote or derail making improvements in less studied crops? Front Plant Sci 6: 1268-1276. Pedrolli, D. B., Monteiro, A. C., Gomes, E. and Carmona, E. C. (2009). Pectin and pectinases: production, characterization, and industrial application of microbial pectinolytic enzymes. Open Biotech J 3: 9-18. Perrakis, A., Bita, C. E., Arhondakis, S., Krokida, A., Mekkaoui, K., Denic, D., Blazakis, K. N., Kaloudas, D. and Kalaitzis, P. (2019). Suppression of a Prolyl 4 Hydroxylase Results in Delayed Abscission of Overripe Tomato Fruits. Front. Plant Sci. 28: 348-359. Perrot, T., Pauly, M. and Ramírez, V. (2022). Emerging roles of ꞵ-Glucanases in plant development and adaptative responses. Plants 11: 1119-1141. Phan, T. D., Bo, W., West, G., Lycett, G. W., and Tucker, G. A. (2007). Silencing of the major salt-dependent isoform of pectin esterase in tomato alters fruit softening. Plant Physio 144: 1960-1967. Protsenko, M. A., Buza, N. L., Krinitsyna, A. A., Bulantseva, E. A. and Korableva, N. P. (2008). Polygalacturonase-inhibiting Protein is a structural component of plant cell walls. Biochemistry 73: 1053-1062. Pua, E. C., Ong, C. K., Liu, P. and Liu, j. z. (2001). Isolation and expression of two pectate lyase genes during fruit ripening of banana ( Musa acuminate ). Physio Planta 113: 92–99. Purugganan, M. D. and Fuller, D. Q. (2009). The nature of selection during plant domestication. Nature 457: 843–848. Qing, C. M., Fan, L., Lei, Y., Bouchez, D., Tourneur, C., Li Yan, L. and Robaglia, C. (2000). Transformation of Pakchoi ( Brassica rapa L. ssp. chinensis ) by Agrobacterium infiltration.Mol Breed 6: 67–72. Qiu, Z., Wen, Z., Hou, Q., Qiao, G., Yang, K., Hong, Y. and Wen, X. (2021). Crosstalk between transcriptome, phytohormone and HD-ZIP gene family analysis illuminates the molecular mechanism underlying fruitlet abscission in sweet cherry ( Prunus avium L). BMC Plant Bio 21: 173-191. Quesada, M. A., Portales, R. B., Pose, S., Gago, J. A. G., Bermudez, S. J., Serrano, A. M., Caballero, J. L., Alfaro, F. P., Mercado, J. A. and Blanco, J. M. (2009). Antisense down-regulation of the FaPG1 gene reveals an unexpected central role for polygalacturonase in strawberry fruit softening. Plant Physiol 150: 1022-1032. Radhakrishnan, R., Pae, S. B., Shim, K. B. and Baek, I. Y. (2013). Penicillium Sp. Mitigates Fusarium -induced biotic stress in sesame plants. Biotech Let 35: 1073–1078. Rajani, S. and Sundaresan, V. (2001). The Arabidopsis myc/ bHLH gene ALCATRAZ enables cell separation in fruit dehiscence.Cur Bio 11: 1914-1922. Regina, A., Bird, A., Topping, D., Bowden, S., Freeman, J., Barsby, T., Hashemi, B. K., Li, Z., Rahman, S and Morell, M. (2006). High-amylose wheat generated by RNA interference improves indices of large-bowel health in rats. PNAS 103: 3546-3551. Roberts, J. A., Whitelaw, C. A., Carranza, Z. H. G. and Mcmanus, M. T.(2000). Cell separation processes in plants-models, mechanisms, and manipulation. Ann Bot 86: 223-235. Robles, P. and Pelaz, S. (2005). Flower and fruit development in Arabidopsis thaliana . Inter J Develop Bio 49: 633-643. Rodriguez, L., Guzman, M. G., Diaz, M., Rodrigues, A., Garcia, A. C.I., Llobet, M. P., Fernandez, M. A., Antoni, R., Fernandez, D., Marquez, J. A., Mulet, J. M., Albert, A. and Rodrigueza, P. L. (2014). C2-domain abscisic acid-related proteins mediate the interaction of PYR/PYL/RCAR abscisic acid receptors with the plasma membrane and regulate abscisic acid sensitivity in Arabidopsis. Plant Cell 26: 4802-4820. Sambrook, J., Fritschi, E. F.and Maniatis, T. (1989). Molecular cloning: A laboratory manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press. Sander, L., Child, R., Ulvskov, P., Alberchtsen, M. and Borkhardt, B. (2001). Analysis of a dehiscence zone endopolygalacturonase in oilseed rape ( Brassica napus ) and Arabidopsis thaliana : evidence for roles in cell separation in dehiscence and abscission zones, and in stylar tissues during pollen tube growth. Plant Mol Bio 46: 469-479. Schmittgen, T. D. and Livak, K. J. (2008). Analyzing real-time PCR data by the comparative CT method. Nature Pro 3: 1101-1108. Schuller, A. and Ludwig-Müller, J. (2006). A family of auxin conjugate hydrolases from Brassica rapa : characterization and expression during clubroot disease. New Phyto 171: 145-158. Schwarz, I., Scheirlinck, M. T., Otto, E., Bartrina, I., Schmidt, R. C. and Schmulling, T. (2020). Cytokinin regulates the activity of the inflorescence meristem and components of seed yield in oilseed rape. J. Exp. Bot. 71: 7146-4158. Sénéchal, F.; Wattier, C.; Rustérucci, C. and Pelloux, J. (2014). Homogalacturonan-modifying enzymes: structure, expression, and roles in plants. J Exp Bot 65: 5125-5160. Seymour, G. B., Østergaard, L., Chapman, N. H., Knapp, S. and Martin, C. ( 2013). Fruit development and ripening. Ann Rev Plant Bio 64: 1–23. Seymour, G. B., Ryder, C. D., Cevik, V., Hammond, J. P., Alexandra Popovich, A., King, G. J., Vrebalov, J., Giovannoni, J. J. and Manning, K. (2011). A SEPALLATA gene is involved in the development and ripening of strawberry (Fragaria3ananassa Duch.) fruit, a non-climacteric tissue. J. Exp. Bot. 62: 1179-1188. Singh, G., Verma, A. K. and Kumar, V. (2016). Catalytic properties, functional attributes and industrial applications of ꞵ-glucosidases. 3 Biotech 6: 3-17. Shahidi, F., Pathirana, C. M. L., Wall, D. S. (2006). Antioxidant activity of white and black sesame seeds and their hull fractions. Food Chem 99: 478–473. Sheehy, R. E., Kramer, M. and Hiatt, W. R. (1988). Reduction of polygalacturonase activity in tomato fruit by antisense RNA. PNAS 85: 8805-8809. Showalter, A. M. (2001). Arabinogalactan-proteins: structure, expression and function. CMLS, Cell. Mol. Life Sci. 58: 1399-1417. Smith, C. J. S., Watson, C. F., Morris, P. C., Bird, C. R., Seymour, G.B., Gray, J. E., Arnold, C., Tucker, G. A., Schuch, W., Harding, S. and Grierson, D. (1990). Inheritance and effect on ripening of antisense polygalacturonase genes in transgenic tomatoes. Plant Mol Biol 14: 369-379. Song, Q., Joshi, M., Wang, S., Johnson, C. D. and Joshi, V. (2021). Comparative Analysis of Root Transcriptome Profiles of Sesame (Sesamum indicum L.) in Response to osmotic stress. J Plant Grow Reg 40: 1787-1801. Sorefan, K., Girin, T., Liljegren, S. J., Ljung, K., Robles, P., Ampudia, C. S. G., Offringa, R., Friml, J., Yanofsky, M. F. and Østergaard, L. (2009). A regulated auxin minimum is required for seed dispersal in Arabidopsis . Nature 459: 583- 586. Subramanyam, K., Rajesh, M., Jaganath, B., Vasuki, A., Theboral, J., Elayaraja, D., Karthik, S., Manickavasagam, M. and Ganapathi, A. (2013). Assessment of factors influencing the Agrobacterium -mediated in planta seed transformation of brinjal ( Solanum melongena L.). Appl Biochem Biotechnol 17: 450-469. Sultan, E. A. A., Abdel-Hadi, A. A., Abdallah, N. A. and Tawfik, M. S. (2018). Identification and molecular characterization of false septa-expressed polygalacturonase gene homologue from sesame ( Sesamum indicum L.). Biosci. Res 15: 3175-3187. Sultan, E. A. A. and Tawfik, M. S. (2023). Stable In-Planta transformation system for Egyptian sesame ( Sesamum indicum L.) cv. Sohag 1. GM Crops Food 14: 21-31. Sun, L., Sun, Y., Zhang, M., Wang, L., Ren, J., Cui, M., Wang, Y., Ji, K., Li, P., Li, Q., Chen, P., Dai, S., Duan, C., Wu, Y. and Leng, P. (2012). Suppression of 9-cis epoxy carotenoid dioxygenase, which encodes a key enzyme in abscisic acid biosynthesis, Alters fruit texture in transgenic tomatoes . Plant Physio 158: 283-298. Tacken, E., Ireland, H., Gunaseelan, K., Karunairetnam, S., Wang, D., Schultz, K., Bowen, J., Atkinson, R. G., Johnston, J. W., Putterill, J., Hellens, R. P., and Schaffer, R. J. (2010). The role of ethylene and cold temperature in the regulation of the apple POLYGALACTURONASE1 gene and fruit softening. Plant Physiol 153: 294-305. Tang, G., Galili, G. and Zhuang, X. (2007). RNAi and microRNA: breakthrough technologies for the improvement of plant nutritional value and metabolic engineering. Metabolomics 3: 357–369. Tranbarger, T. J., Tucker, M. L., Roberts, J. A. and Meir, S. (2017). Editorial: Plant organ abscission: From models to crops. Front. Plant Sci. 8: 196-200. Ucana, K and killi, F. (2010). Effects of different irrigation programs on flower and capsule numbers and shedding percentage of sesame. Agri Water Manag 98: 227–233. Uluisik, S., Chapman, N. H., Smith, R., Poole, M., Adam, G., Gillis, R. B., Besong, T. M. D., Sheldon, J., Stiegelmeyer, S., Perez, L., Samsulrizal, N., Wang, D., Fisk, I. D., Yang, N., Baxter, C., Rickett, D., Fray, R., Ulate, B. B., Powell, A. L. T., Harding, S. E., Craigon, J., Rose, J. K. C., Fich, E. A., Sun, L., Domozych, D. S., Paul D Fraser, P. D., Tucker, G. A., Don Grierson, D. and Seymour, G. B. (2016). Genetic improvement of tomato by targeted control of fruit softening, Nature Biotech 34: 950–956. Verlent, I., Loey, A. V., Smout, C., Duvetter, T. and Hendrickx, M., E. (2005). Purified tomato polygalacturonase activity during thermal and high-pressure treatment. Biotech Bioengin 86: 63–71. Vrebalov, J., Ruezinsky, D. Padmanabhan, V. White, R. Medrano, D., Drake, R., Wolfgang Schuch, W. and Giovannoni, J. (2002). A MADS-Box gene is necessary for fruit ripening at the tomato Ripening-Inhibitor ( Rin ) locus. Sci 296: 343-247. Wang, G. Q., Wei, P. C., Tan, F., Yu, M., Zhang, X. Y., Chen, Q. J. and Wang, X. C. (2016). The transcription factor AtDOF4.7 is involved in ethylene- and IDa-mediated organ abscission in Arabidopsis. Front. Plant Sci 7: 863-875. Wang, K. L. C., Li, H. and Ecker, J. R. (2002).Ethylene biosynthesis and signaling networks. Plant Cell 14: 131-151. Wang, L., Dossou, S. S. K., Wei, X., Zhang, Y., Li, d., Yu, J. and Zhang, X. (2020). Transcriptome dynamics during black and white sesame ( Sesamum indicum L.) seed development and identification of candidate genes associated with black pigmentation. MDPI 11: 1399-1413. Wang, M., Huang, J., Liu, S., Liu, X., Li, R., Luo, J. and Fu, Z. (2022). Improved assembly and annotation of the sesame genome. DNA Res 29: 1-8. Wang, X., Meng, J., Deng, L., Wang, Y., Liu, H., Yao, J. L., Nieuwenhuizen, N. J., Zhiqiang Wang, Z. and Zeng, W. (2021). Diverse functions of IAA-Leucine resistant PpILR1 provide a genetic basis for auxin-ethylene crosstalk during peach fruit ripening. Front Plant Sci 12: 655758-655770. Wang, Y., Beaith, M., Chalifoux, M., Ying, J., Uchacz, T., Sarvas, C., Griffiths, R., Kuzma, M., Wan, J. and Huang, Y. (2009). Shoot-specific down-regulation of protein farnesyltransferase (a subunit) for yield protection against drought in canola. Mol Plant 2: 191–200. Wattebled, F., Dong, Y., Dumez, S., Delvalle, D., Planchot, V., Pierre Berbezy, P., Vyas, D., Colonna, P., Chatterjee, M., Ball, S., and D’Hulst, C. (2005). Mutants of Arabidopsis lacking a chloroplastic isoamylase accumulate phytoglycogen and an abnormal form of amylopectin. Plant Physio 138: 184-195. Wen, B., Zhang, F., Wu, X. and Li, H. (2020). Characterization of the tomato ( Solanum lycopersicum ) pectin methylesterases: Evolution, activity of isoforms and expression during fruit ripening. Front Plant Sci 11: 238-255. Wesley, S. V., Helliwell, C. A., Smith, N. A., Wang, M., Rouse, D. T., Liu, Q., Gooding, P. S., Singh, S. P., Abbott, D., Stoutjesdijk, P. A., Robinson, S. P., Gleave, A. P., Green, A. G. and Waterhouse, P. M. (2001). Construct design for efficient, effective, and high-throughput gene silencing in plants. Plant J 27: 581-590. Wu, W., Du, K., Kang, X. and Wei, H. (2021). The drivers roles of cytokinins in regulating leaf development. Hortic. Res 8: 118-131. Xiao, Y. Y., Kuang, J. F., Qi, X. N., Ye, Y. J., Wu, Z. X., Chen, J. Y. and Lu, w. j. (2018). A comprehensive investigation of starch degradation process and identification of a transcriptional activator MabHLH6 during banana fruit ripening. Plant Biotech J 16: 151–164. Yadav, M., Chaudhary, D., Sainger, M. and Jaiwal, P. K. (2010). Agrobacterium tumefaciens-mediated genetic transformation of sesame ( Sesamum indicum L.). PCTOC 103: 377-386. Yang, X., Jun Song, J., Palmer, L. C., Fillmore, S. and Zhang, Z. (2013). Effect of ethylene and 1-MCP on expression of genes involved in ethylene biosynthesis and perception during ripening of apple fruit. Posthar Bio Tech 78: 55-66. Yang, Y., Yu, Y., Liang, Y., Anderson, C. T. and Cao, J. (2018). A profusion of molecular scissors for pectins: Classification, expression, and functions of plant polygalacturonases. Frontiers in Plant Sci 9: 1208-1224. Yin, D., Deng, S., Zhan, K. and Cui, D. (2007). High-oleic peanut oils are produced by hpRNA-mediated gene silencing of oleate desaturase. Plant Mol Bio Rep 25: 154–163. Yoon, J., Cho, L. H., Kim, S. L., Choi, H., Koh, H. J. and An, G. (2014). The BEL1-type homeobox gene SH5 induces seed shattering by enhancing abscission-zone development and inhibiting lignin biosynthesis. Plant J 79: 717–728. You, J., Zhang, Y., Liu, A., Li, D., Wang, X., Dossa, K., Zhou, R., Yu, J., Zhang, Y., Wang, L. and Xiurong Zhang, X. (2019). Transcriptomic and metabolomic profiling of drought-tolerant and susceptible sesame genotypes in response to drought stress. BMC Plant Bio 19: 267-283. Yu, Y. K., Li, Y. L., Ding, L. N., Sarwar, R., Zhao, F. Y. and Tan, X. L. (2020). Mechanism and regulation of silique dehiscence, which affects oil seed production. Front Plant Sci 11: 580-594. Zhai, Z., Xiao, Y., Wang, Y., Sun, Y., Peng, x., Feng, c., Zhang, X., Du, B., Zhou, X., Wang, C., Liu, Y. and Li, T. (2022). Plant Physiol 190: 2501-2518. Zhang, S. H., Sun, J. H., Dong, Y. H., Shen, Y. Y., Li, C. L., Li, Y. Z. and Guo, J. X. (2014). Enzymatic and functional analysis of ꞵ-glucosidase FaBG1 during strawberry fruit ripening. J Hort Sci Biotech 89: 733–739. Zhang, X., Zou, Z., Zhang, J., Zhang, Y., Han, Q., Hu, T., Xu, X., Liu, H., Li, H. and Ye, Z. (2011). Over-expression of SlymiR156a in tomato results in multiple vegetative and reproductive trait alterations and partial phenocopy of the Sft mutant. Fed Euro Biochem Soc Let 585: 435–439. Zhang, Y. P., Zhang, Y. Y., Thakur, K., Zhang, F., Hu, F., Zhang, J. G., Wei, P. C. & Wei, Z. J. (2021). Integration of miRNAs, Degradome, and transcriptome omics uncovers a complex regulatory network and provides insights into lipid and fatty acid synthesis during sesame seed development. Front Plant Sci 12: 709197-709211. Zhang, Y., Li, Q., Jiang, L., Kai, W., Liang, B., Wang, J., Du, Y., Zhai1, X., Wang, J., Zhang, Y., Sun, Y., Zhang, L. and Leng, P. (2017). Suppressing type 2C Protein Phosphatases alters fruit ripening and the stress response in tomato. Plant Cell Physio 59: 142–145. Ziosi, V., Bregoli, A. M., Bonghi, C., Fossati, T., Biondi,S., Costa, G. and Torrigiani, P. (2006). Transcription of ethylene perception and biosynthesis genes is altered by putrescine, spermidine and aminoethoxyvinylglycine (AVG) during ripening in peach fruit ( Prunus persica ). New Phyto 172: 229-239. Zou, X. and Sun, H. (2023). DOF transcription factors: Specific regulators of plant biological processes. Front. Plant. Sci. 14: 1044918-1044931. Supplementary Files TableS1.xlsx TableS2.xlsx TableS3.xlsx Cite Share Download PDF Status: Posted Version 1 posted You are reading this latest preprint version Research Square lets you share your work early, gain feedback from the community, and start making changes to your manuscript prior to peer review in a journal. As a division of Research Square Company, we’re committed to making research communication faster, fairer, and more useful. We do this by developing innovative software and high quality services for the global research community. Our growing team is made up of researchers and industry professionals working together to solve the most critical problems facing scientific publishing. Also discoverable on Platform About Our Team In Review Editorial Policies Advisory Board Help Center Resources Author Services Accessibility API Access RSS feed Manage Cookie Preferences © Research Square 2026 | ISSN 2693-5015 (online) Privacy Policy Terms of Service Do Not Sell My Personal Information {"props":{"pageProps":{"initialData":{"identity":"rs-4624341","acceptedTermsAndConditions":true,"allowDirectSubmit":true,"archivedVersions":[],"articleType":"Research Article","associatedPublications":[],"authors":[{"id":324953757,"identity":"f8e5f5c6-c7c4-44f4-8a74-212620587b99","order_by":0,"name":"Esraa A. A. Sultan","email":"","orcid":"","institution":"AGERI: Agricultural Genetic Engineering Research Institute","correspondingAuthor":false,"prefix":"","firstName":"Esraa","middleName":"A. A.","lastName":"Sultan","suffix":""},{"id":324953758,"identity":"fc7d53f8-558a-4116-a29d-df8af72ed34f","order_by":1,"name":"Mariam Oweda","email":"","orcid":"","institution":"Bioinformatics Group, Center for Informatics Science (CIS), School of Information Technology and Computer Science (ITCS), Nile University, Giza","correspondingAuthor":false,"prefix":"","firstName":"Mariam","middleName":"","lastName":"Oweda","suffix":""},{"id":324953759,"identity":"96adbe5c-f335-4fa0-851f-ff9c26e66858","order_by":2,"name":"Nagwa I. Elarabi","email":"","orcid":"","institution":"Department of Genetics, Faculty of Agriculture, Cairo University, Giza","correspondingAuthor":false,"prefix":"","firstName":"Nagwa","middleName":"I.","lastName":"Elarabi","suffix":""},{"id":324953760,"identity":"b7da7ef0-a66b-42f6-8c43-b34bb4b555b9","order_by":3,"name":"Mohamed El-Hadidi","email":"","orcid":"","institution":"Bioinformatics Group, Center for Informatics Science (CIS), School of Information Technology and Computer Science (ITCS), Nile University, Giza","correspondingAuthor":false,"prefix":"","firstName":"Mohamed","middleName":"","lastName":"El-Hadidi","suffix":""},{"id":324953761,"identity":"71ff0f0d-c87c-445d-bb26-89f7a8ce1375","order_by":4,"name":"Abdelhadi A. Abdelhadi","email":"","orcid":"","institution":"Department of Genetics, Faculty of Agriculture, Cairo University, Giza","correspondingAuthor":false,"prefix":"","firstName":"Abdelhadi","middleName":"A.","lastName":"Abdelhadi","suffix":""},{"id":324953762,"identity":"b3d0c2da-ab8d-41cb-9095-b976eab08c18","order_by":5,"name":"Naglaa A. Abdallah","email":"","orcid":"","institution":"Department of Genetics, Faculty of Agriculture, Cairo University, Giza","correspondingAuthor":false,"prefix":"","firstName":"Naglaa","middleName":"A.","lastName":"Abdallah","suffix":""},{"id":324953763,"identity":"3e315143-d5e5-4eaf-8556-db020af0faad","order_by":6,"name":"Mohamed S. Tawfik","email":"data:image/png;base64,iVBORw0KGgoAAAANSUhEUgAAAZAAAAAyAQMAAABI0h/eAAAABlBMVEX///8AAABVwtN+AAAACXBIWXMAAA7EAAAOxAGVKw4bAAAAvUlEQVRIiWNgGAWjYFACHgYDICkHYh54QKyWAiBpDNaSQKyWD0AysQHEJkqLbnvvwU03Ku6kzw87/BBoi52cbgMBLWZnziUb55x5lrvxdpoBUEuysdkBQlpu5JgZ57Ydzt04OwGk5UDiNiK0mP8Gakk3nJ3+gWgtBiBbEuSlc4i15cwZA6BfDhtukM4pOJBgQIxfjvcAtVQclpefnb75w4cKOzmCWuDAAKzSgFjlICDfQIrqUTAKRsEoGFEAAHm+SlpE4tC9AAAAAElFTkSuQmCC","orcid":"https://orcid.org/0009-0003-4374-8529","institution":"AGERI: Agricultural Genetic Engineering Research Institute","correspondingAuthor":true,"prefix":"","firstName":"Mohamed","middleName":"S.","lastName":"Tawfik","suffix":""}],"badges":[],"createdAt":"2024-06-23 08:13:03","currentVersionCode":1,"declarations":"","doi":"10.21203/rs.3.rs-4624341/v1","doiUrl":"https://doi.org/10.21203/rs.3.rs-4624341/v1","draftVersion":[],"editorialEvents":[],"editorialNote":"","failedWorkflow":false,"files":[{"id":62156001,"identity":"397a5f42-451b-4431-bb4c-11be70ea760f","added_by":"auto","created_at":"2024-08-09 21:07:24","extension":"png","order_by":1,"title":"Figure 1","display":"","copyAsset":false,"role":"figure","size":265860,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eA Schematic representation of the cloning of the two partial sequences in the sense and antisense orientation in the pFGC5941 RNAi vector;B Cloning of core fragment of PG into pFGC5941 vector; B1 amplified sense and antisense strand lane 1: sense fragment, lane 2: negative control, lane 3: antisense fragment and lane 4: negative control; B2 Cloning into pGEM- T Easy Vector and digestion with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eSalI \u0026amp; SacII \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003elanes 1,2: sense fragment and lanes 3,4: antisense fragment; B3 Cloning into pGEM- T Easy Vector and double digested with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAscI\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026amp; \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eXhoI\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ein sense strand, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eBamHI\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026amp; \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eXbaI \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ein antisense strand lanes 1,2: sense fragment and lanes 3,4: antisense fragment; B4 cloning into pFGC5941 vector and double digested with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAscI\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026amp; \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eXhoI\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ein sense strand, \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eBamHI\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026amp; \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eXbaI \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003ein antisense strand lane1: undigested plasmid, lane 2: digested with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eAscI\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026amp; \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eXhoI \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003efor sense strand and lane 3: digested with \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eBamHI\u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003e \u0026amp; \u003c/strong\u003e\u003cem\u003e\u003cstrong\u003eXbaI \u003c/strong\u003e\u003c/em\u003e\u003cstrong\u003efor antisense strand. M: 100bp ladder DNA marker; C Schematic representation of the different stages of transformation of sesame. C1 de-coated sesame seeds placed on germination media; C2 de-coated sesame seeds placed on germination media supplemented with cefotaxime; C3 sesame seeds transplanted into trays filled with soil; C4 transplanting of sesame plants in bigger pots “plant height 50 cm long; C5 sesame plant 1.5 m.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"1.png","url":"https://assets-eu.researchsquare.com/files/rs-4624341/v1/97710fc1099df98feb84a78e.png"},{"id":62156002,"identity":"e7ea57d9-6acc-464d-8ed2-83128006e026","added_by":"auto","created_at":"2024-08-09 21:07:24","extension":"png","order_by":2,"title":"Figure 2","display":"","copyAsset":false,"role":"figure","size":90764,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eScreening of putative transgenic plants. A Screening of putative transgenics T\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e0\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e plants by 35 s promoter primer amplified 200 bp using DNA samples isolated. M: 100bp ladder DNA marker, lane 1: negative control: water, lane 2: negative control (non-transgenic plant), lane 3: positive control (pFGC5941 RNAi vector) and lane 4 to 16 transgenic plants; B PCR screening of putative transgenic T\u003c/strong\u003e\u003csub\u003e\u003cstrong\u003e1\u003c/strong\u003e\u003c/sub\u003e\u003cstrong\u003e plants by BAR primer (247 bp). M: 100bp ladder DNA marker, lane 1: negative control (water), lane 2: negative control (non-transgenic plant), lane 3: positive control (pFGC5941 RNAi vector) and from lane 4 to lane 13 transgenic plants.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"2.png","url":"https://assets-eu.researchsquare.com/files/rs-4624341/v1/4c2e4cdfa6f7b549b0a8fa7a.png"},{"id":62157143,"identity":"59629df9-0cd6-4022-ba87-508d6f474da1","added_by":"auto","created_at":"2024-08-09 21:15:24","extension":"png","order_by":3,"title":"Figure 3","display":"","copyAsset":false,"role":"figure","size":300814,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eEffect of basta leaf-painting and spraying on sesame plants and exhibiting varying bar gene expression five days post-treatment (0.02% Basta). A Basta-leaf painting for leaves from non-transgenic (1) and transgenic plants (2); B Full-plant spraying with Basta (1) control plant and (2) transgenic sprayed plant; C Reverse transcriptase reaction using BAR primer (247 bp). Lane 1 is positive control (pFGC5941 RNAi vector), Lane 2 is RT (transgenic plant), Lane 3 is -RT and Lane 4 is negative control (water). M: 100bp ladder DNA marker.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"3.png","url":"https://assets-eu.researchsquare.com/files/rs-4624341/v1/8bad2ae8acdf22210a38f8ca.png"},{"id":62157152,"identity":"6a438343-7f5c-4b5a-8372-2e9c1a7aa4b2","added_by":"auto","created_at":"2024-08-09 21:15:24","extension":"png","order_by":4,"title":"Figure 4","display":"","copyAsset":false,"role":"figure","size":146539,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eReverse transcriptase reaction with Endo-PG RT primer (160 bp) RNA samples isolated from Different developmental stages of sesame capsules. A1 Control capsules: lanes 1 – 4: RT for stages 1, 2, 3 and 4. (A2) Transgenic capsules: lanes 1 – 4: RT. M: 100bp ladder DNA marker.; B qRT-PCR for Different developmental stages of sesame capsules stage 1 (S1), stage 2 (S2), stage 3 (S3) and stage 4 (S4); C Mature sesame plants: 1) transgenic plants and 2) non-transgenic plants.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"4.png","url":"https://assets-eu.researchsquare.com/files/rs-4624341/v1/adb6af463dc0699edddba954.png"},{"id":62157132,"identity":"be4b0e4a-c3ff-4b54-b9fc-db6b7efb192b","added_by":"auto","created_at":"2024-08-09 21:15:24","extension":"png","order_by":5,"title":"Figure 5","display":"","copyAsset":false,"role":"figure","size":132250,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDifferential expression genes between control and transgenic sesame plants at four stages of capsules devolvement. A The Volcano diagram of differentially expressed genes. The x-axis represents the multiple differential expressions; The y-axis represents the statistically significant degree of gene expression change.\u003c/strong\u003e \u003cstrong\u003eThe scattered dots represent each gene, the grey and blue dots indicate genes with no significant differences, the red dots indicate up-regulated genes with significant differences, and the green dots indicate down-regulated genes with significant differences; B Heat map of the expression levels of the unigenes. The unigene expression levels are indicated with colored bars; C Numbers of up and down-regulated differentially expressed genes (DEGs).\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"5.png","url":"https://assets-eu.researchsquare.com/files/rs-4624341/v1/bb4990fbc1a23790bce51d55.png"},{"id":62156008,"identity":"4930784d-0ada-4ec6-b8d7-bbaffe21e84e","added_by":"auto","created_at":"2024-08-09 21:07:24","extension":"png","order_by":6,"title":"Figure 6","display":"","copyAsset":false,"role":"figure","size":60619,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eGene ontology (GO) classification of DEGs. The X-axis represents the functional classification, and the Y-axis represents the number of genes annotated into the GO terms.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"6.png","url":"https://assets-eu.researchsquare.com/files/rs-4624341/v1/683eccb116005ef9344edb22.png"},{"id":62157151,"identity":"f0da763c-d13e-4b95-82a7-a0202fe807c2","added_by":"auto","created_at":"2024-08-09 21:15:24","extension":"png","order_by":7,"title":"Figure 7","display":"","copyAsset":false,"role":"figure","size":94228,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eDifferentially expressed genes that were up and down-regulated in sesame false-septa tissues. The selected genes encode for cell-wall remodeling component, plant hormone, transcription factors, and capsule maturation. Red lines indicate the expression absolute values in transgenic sesame plants, while the blue lines represents the expression absolute values in non-transgenic control sesame plants. A Expression of polygalacturonase in the four tested stages of sesame capsules development; B The expression of the down-regulated genes with absolute values up to 1500. B1, 2, 3 and 4, represents the four developmental stages I, II, III and IV, respectively; C The expression of the down-regulated genes with absolute values up to 6000. C1, 2, 3, and 4, represents the four developmental stages I, II, III and IV, respectively; D The expression of the up-regulated genes. D1, 2, 3, and 4, represents the four developmental stages I, II, III and IV, respectively.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"7.png","url":"https://assets-eu.researchsquare.com/files/rs-4624341/v1/4b11d75adc0d9e8a602d9688.png"},{"id":62156012,"identity":"cef0a9fd-4c09-428f-8ddc-08191b5be8ba","added_by":"auto","created_at":"2024-08-09 21:07:24","extension":"png","order_by":8,"title":"Figure 8","display":"","copyAsset":false,"role":"figure","size":158429,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eThe expression patterns of 19 selected genes identified by RNA-Seq were validated by qRT-PCR in transgenic and control plants. Bars represented the relative expression levels determined by qRT-PCR. Lines indicate the transcript from RNA–Seq analysis.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"8.png","url":"https://assets-eu.researchsquare.com/files/rs-4624341/v1/43c9ab6ac2ebe572306522e2.png"},{"id":62157154,"identity":"52dc7a7c-c018-4495-b796-3ea594aae4fd","added_by":"auto","created_at":"2024-08-09 21:15:24","extension":"png","order_by":9,"title":"Figure 9","display":"","copyAsset":false,"role":"figure","size":15954,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eTranscription factors expression data in control and transgenic sesame plants at stage 4\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"9.png","url":"https://assets-eu.researchsquare.com/files/rs-4624341/v1/56c4c2ef51359319d456fed4.png"},{"id":62157133,"identity":"e633d8e3-d7d1-4f7f-b722-ba18626cf4d7","added_by":"auto","created_at":"2024-08-09 21:15:24","extension":"png","order_by":10,"title":"Figure 10","display":"","copyAsset":false,"role":"figure","size":216923,"visible":true,"origin":"","legend":"\u003cp\u003e\u003cstrong\u003eSummary of the different individuals that were identified from the transcriptome experiment. Nineteen individual DEGs were identified and were found to be controlling the false septa/capsules dehiscence in sesame. The four boxes within the cell represents the following Red box: represents DEGs involved in plant hormonal signaling, Blue box: represent DEGs related to master switches/transcriptional factors, Green box: represents DEGs related to cell wall remodeling enzymes, finally Orange box: represents DEGs that are related to capsules maturation. All Red arrows indicate a blockage or downregulation of the pathway.\u003c/strong\u003e\u003c/p\u003e","description":"","filename":"10.png","url":"https://assets-eu.researchsquare.com/files/rs-4624341/v1/a6e310396ce7b334a29e9237.png"},{"id":62405083,"identity":"8443fffe-2cd7-436e-bc3b-6fe570367313","added_by":"auto","created_at":"2024-08-13 20:27:40","extension":"pdf","order_by":0,"title":"","display":"","copyAsset":false,"role":"manuscript-pdf","size":3787212,"visible":true,"origin":"","legend":"","description":"","filename":"manuscript.pdf","url":"https://assets-eu.researchsquare.com/files/rs-4624341/v1/e32e8196-54e8-4a4e-a2f5-d38428bff553.pdf"},{"id":62156004,"identity":"3cdc1f67-c8a8-432c-9260-0d706c5e84a2","added_by":"auto","created_at":"2024-08-09 21:07:24","extension":"xlsx","order_by":5,"title":"","display":"","copyAsset":false,"role":"supplement","size":89860,"visible":true,"origin":"","legend":"","description":"","filename":"TableS1.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4624341/v1/a6e135f815d12d37bd38127d.xlsx"},{"id":62156011,"identity":"89697b52-4abf-4b9c-9a47-a64905c527ee","added_by":"auto","created_at":"2024-08-09 21:07:24","extension":"xlsx","order_by":6,"title":"","display":"","copyAsset":false,"role":"supplement","size":10560,"visible":true,"origin":"","legend":"","description":"","filename":"TableS2.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4624341/v1/9da267e0285cfc386cdc4c15.xlsx"},{"id":62156014,"identity":"20aab65c-a91f-4638-b1c5-5865a5ef3f1a","added_by":"auto","created_at":"2024-08-09 21:07:24","extension":"xlsx","order_by":7,"title":"","display":"","copyAsset":false,"role":"supplement","size":11661,"visible":true,"origin":"","legend":"","description":"","filename":"TableS3.xlsx","url":"https://assets-eu.researchsquare.com/files/rs-4624341/v1/25cc33d8236cf022513b88a7.xlsx"}],"financialInterests":"","formattedTitle":"Downregulation of polygalacturonase (PG) gene expression caused significant changes in gene expression in sesame (Sesamum indicum L.) false septa tissues.","fulltext":[{"header":"Introduction","content":"\u003cp\u003eSesame \u003cem\u003e(Sesamum indicum L\u003c/em\u003e.) is one of the oldest cultivated oil crops worldwide, and its cultivation is spread into many tropical and subtropical regions of Asia, Africa, and South America (Al-Shafeay et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Al-Shafeay et al. \u003cspan citationid=\"CR4\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Sesame is an annual diploid oilseed plant (2n\u0026thinsp;=\u0026thinsp;26) from the Pedaliaceae family with a genome size of approximately 369 Mb (You et al. \u003cspan citationid=\"CR166\" class=\"CitationRef\"\u003e2019\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR171\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR153\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Sesame seeds are also considered a rich source of protein, about 20% of dried seeds (Ogbonna and Ukaan \u003cspan citationid=\"CR101\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Oil content in seeds ranges from 45 to 63%, with 83\u0026ndash;90% in un-unsaturated fat form. The seeds also contain large quantities of antioxidants (sesamin, sesamol and sesamolin) reported to have health-promoting effects such as lowering cholesterol levels and hypertension (Shahidi et al. \u003cspan citationid=\"CR133\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Anilakumar et al. \u003cspan citationid=\"CR6\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Different factors negatively affect the yield in sesame, as in biotic and abiotic factors, as well as seed shattering (Day \u003cspan citationid=\"CR19\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Lakhanpaul et al. \u003cspan citationid=\"CR61\" class=\"CitationRef\"\u003e2012\u003c/span\u003e; Radhakrishnan et al. \u003cspan citationid=\"CR118\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Al-Shafaey et al. 2018 and Dossa et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eSeed shattering is a mechanism that helps plants disperse and distribute their seeds into the surrounding environment (Roberts et al. \u003cspan citationid=\"CR121\" class=\"CitationRef\"\u003e2000\u003c/span\u003e; Estornell et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Maity et al. \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Seed dispersal increases the possibility of seed scattering via wind and water and sticking into animal hooves and wools (Lengyel et al. \u003cspan citationid=\"CR66\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). However, after thousands of years of selection and decades of breeding, scientists have been selecting for uniformity of seed maturation and selecting against seed shattering/scattering (Doebley \u003cspan citationid=\"CR23\" class=\"CitationRef\"\u003e2006\u003c/span\u003e); this point, in particular, has been successful in many crops, yet still an issue in crops like sesame. Seed shattering is considered an undesirable trait in modern cultivated crops (Purugganan and Fuller \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), where a dramatic yield loss occurs during crop harvesting, regardless of harvest mechanism, mechanically or manually (Fuller and Allaby \u003cspan citationid=\"CR36\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). Seed shattering (pod dehiscence or fruit shedding), which occurs at advanced seed/fruit stages (and is usually associated with semi or complete dryness of fruits), is a problem that is negatively-affecting yield in economically important crops, such as sesame, canola, and rice (Ferrandiz \u003cspan citationid=\"CR33\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Girin et al. \u003cspan citationid=\"CR39\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Dong and Wang \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Sultan et al. \u003cspan citationid=\"CR140\" class=\"CitationRef\"\u003e2018\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eGenerally, the first step in seed or pod shattering is forming an abscission layer at the point where the seeds or pods are connected to the plants. However, the fundamental mechanism of abscission differs from one family to another and within a given family species, as it may be the spikelet in rice, pod or siliques in canola and Arabidopsis (Robles and Pelaz \u003cspan citationid=\"CR122\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Kourmpetli and Drea \u003cspan citationid=\"CR58\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). Seed shattering in plants is regulated by complex physiological, biochemical, and genetic mechanisms in conjunction with environmental factors. Some of these mechanisms are now better understood in some crops (Patterson et al. \u003cspan citationid=\"CR107\" class=\"CitationRef\"\u003e2016\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eA complex network of interconnected genes somehow controls the different genetic factors, thus contributing to seed shattering (Maity et al. \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). As an example, Arabidopsis thaliana has been used for decades to unveil the complexity of the dehiscence zone regulation, DZ (Liljegren et al. \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2004\u003c/span\u003e; Lewis et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Sorefan et al. \u003cspan citationid=\"CR138\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). As in MAD-box factors, several transcription factors were found to control the pod dehiscence (Liljegren et al. 2000; Ferr\u0026aacute;ndiz 2002). Other transcription factors, like b-HLH transcription factors, INDEHISCENT (IND) and ALCATRAZ (ALC), were also identified. The IND gene was found to be responsible for directing the differentiation of DZ into a lignified layer and separation layer (Liljegren et al. \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). ALCATRAZ (ALC) resides in the cell identity in the separation layer (Rajani and Sundaresan \u003cspan citationid=\"CR119\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). Both IND and ALC are expressed explicitly in the DZ during late fruit development (Liljegren et al. 2000; Sorefan et al. \u003cspan citationid=\"CR138\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eStudies by different groups also indicated that plant hormones are critical in detaining plant structures (Patharkar and Walker, \u003cspan citationid=\"CR106\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Thickening, swelling, and dissolving of the cell layers in the abscission zones are accompanied by many genetic pathways that are switched on or off to trigger the process (Maity et al. \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Among the various phytohormones involved are ethylene (ETH) and abscisic acid (ABA), which tend to activate and promote organ shedding/abscission processes positively (Marciniak et al. \u003cspan citationid=\"CR84\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In contrast, auxins, cytokinin (CTK) and gibberellin (GA) tend to play an inhibitory role in abscission (Bishopp et al. \u003cspan citationid=\"CR10\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Furthermore, the ethylene/auxin ratio was found to be of great importance to plants in maintaining an adequate regulation of organ shedding (Jin et al. \u003cspan citationid=\"CR50\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Consequently, genes responsible for synthesizing these phytohormones and their signal transduction pathways also play vital roles in the complex mechanism of plant organ abscission (Sun et al. \u003cspan citationid=\"CR142\" class=\"CitationRef\"\u003e2012\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eCellulose, hemicellulose, pectin, lignin, and structural proteins are the main components of plant cell walls (Yu et al. \u003cspan citationid=\"CR167\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). During seed shattering, the hydrolase enzymes, including cellulases (CELs), polygalacturonases (PGs), pectin methylesterases (PEMs), and pectate lyases (PLs), are responsible for the modification and degradation of these components of cell walls (Aalen et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Moreover, some studies have shown that hydrolysis seems essential for cell expansion coordinated by other enzymes like expansins (EXPs), as well as xyloglucan endotransglucosylase/hydrolases (XTHs) (Li et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003ePolygalacturonases (PGs) hydrolyze the alpha-1 and 4 glycosidic bonds between galacturonic acid residues. Polygalacturonan, whose major component is galacturonic acid, is a significant carbohydrate component of the pectin network that comprises plant cell walls (Yang et al. \u003cspan citationid=\"CR163\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Polygalacturonase (PG) is an enzyme that plays a significant role in depolymerizing pectin (S\u0026eacute;n\u0026eacute;chal et al. \u003cspan citationid=\"CR129\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), and based on differences in hydrolyzing activity, PGs are divided into endo-PGs and exo-PGs (Markovic and Janecek, \u003cspan citationid=\"CR85\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Sultan et al. \u003cspan citationid=\"CR140\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Endo-PGs (EC 3.2.1.15) catalyze random hydrolytic cleavage of alpha-1,4 glycosidic bonds in polygalacturonic chains of pectin (Protsenko et al. \u003cspan citationid=\"CR112\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). Exo-PGs are divided into two types: the first type (EC 3.2.1.67) catalyzes the hydrolytic cleavage of one galacturonic acid residue from the non-reducing end, and the second type (EC 3.2.1.82) catalyzes the hydrolytic cleavage of two galacturonic acid residue from the non-reducing end (Pedrolli et al. \u003cspan citationid=\"CR108\" class=\"CitationRef\"\u003e2009\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn sesame, seed shattering is responsible for close to 50% of annual yield loss, especially in manually harvested areas (Langham and Wiemers \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). Flowering and capsule development in sesame occurs first in older flowers (closer to the soil surface) up to the new flowers (close to apical meristem) along the growing sesame main stem (Ukan and Killi 2010). Therefore, it is of no surprise that farmers were advised to harvest sesame plants when about 50% of the capsules are dried and 20% of the capsules are open, causing a loss of seed yield (Nath et al. \u003cspan citationid=\"CR95\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Langham and Wiemers \u003cspan citationid=\"CR63\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Kim et al. \u003cspan citationid=\"CR56\" class=\"CitationRef\"\u003e2007\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eRecently, sesame has been getting the attention of scientists, and transcriptome analysis studies are becoming more affordable. For example, transcriptome analysis has been extensively used to study the changes at the transcriptional level between fertile and non-fertile buds in sesame (Liu et al. \u003cspan citationid=\"CR77\" class=\"CitationRef\"\u003e2016\u003c/span\u003e), changes in gene expression level when exposing plants to different abiotic stresses (Dossa et al. \u003cspan citationid=\"CR26\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Dossa et al. \u003cspan citationid=\"CR27\" class=\"CitationRef\"\u003e2019\u003c/span\u003e); changes in core drought-responsive genes (You et al. \u003cspan citationid=\"CR166\" class=\"CitationRef\"\u003e2019\u003c/span\u003e); changes at transcription level to elucidate genes involved in seed coat color in sesame (Wang et al. \u003cspan citationid=\"CR152\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), and changes in PEG-treated sensitive-roots vs. PEG-tolerant-root of sesame (Song et al. \u003cspan citationid=\"CR137\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn the current study, we have developed a new non-tissue culture-based technique for sesame transformation to minimize somaclonal variations among transgenic individuals (Sultan and Tawfik \u003cspan citationid=\"CR141\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). We previously isolated an endo-polygalacturonase gene from sesame cv. Sohag 1 (Sultan et al. \u003cspan citationid=\"CR140\" class=\"CitationRef\"\u003e2018\u003c/span\u003e) used a 277 bp partial gene sequence to construct an RNAi-construct to downregulate the endo-PG expression level in transgenic sesame plants. Although we used a constitutive promoter (CaMV 35S), we were interested in understanding only gene expression changes in false septa tissues. Therefore, all sesame capsules were collected, and immediately false septa tissues were dissected at four different developmental stages (7-, 14-, 21- and 28 \u003cb\u003ed\u003c/b\u003eays \u003cb\u003ea\u003c/b\u003efter \u003cb\u003ef\u003c/b\u003elowering, \u003cb\u003eDAF\u003c/b\u003e) to conduct the comparative transcriptome analysis between the false septa derived from transgenic sesame lines and their non-transgenic counterparts.\u003c/p\u003e"},{"header":"Materials and methods","content":"\u003cp\u003e \u003cb\u003ePlant materials.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eSesame seeds cv. Sohag 1 was kindly provided by Field Crops Research Institute, ARC, Giza, Egypt.\u003c/p\u003e \u003cp\u003e \u003cb\u003eMethods.\u003c/b\u003e \u003c/p\u003e \u003cp\u003e\u003cb\u003eConstruction of the RNAi vector\u003c/b\u003e: The partial sequence of polygalacturonase fragment (277 bp) was used to construct the RNAi vector; primers for sense and antisense fragments For1S and For2 A were designed (sense primer: For1S \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eCCGCTCGAG\u003c/span\u003eACAGGAGATGATTGTATC, Rev1S \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGCCGGGCGCGCC\u003c/span\u003eTTTGGTCTATGATGATTGGATT and antisense primer: For2A \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eGCCGTCTAGA\u003c/span\u003eACAGGAGATGATTGTATC, Rev2A \u003cspan type=\"Underline\" class=\"Underline\" name=\"Emphasis\"\u003eCGCGGATCC\u003c/span\u003eTTTGGTCTATGATGATTGGATT) to include restriction sites \u003cem\u003eAscІ\u003c/em\u003e \u0026amp; \u003cem\u003eXhoІ\u003c/em\u003e, and \u003cem\u003eBamhІ\u003c/em\u003e \u0026amp; \u003cem\u003eXbaІІ\u003c/em\u003e to the 5' and 3\u0026rsquo; ends, respectively. The newly amplified fragments with the newly introduced restriction sites were cloned into pGEM-T Easy Vector. The partial sequence was once digested with \u003cem\u003eAscІ\u003c/em\u003e \u0026amp; \u003cem\u003eXhoІ\u003c/em\u003e (NEB, USA, Cat No. R0558S and R0146S, respectively) to release the sense fragment from the pGEM T-easy vector. At the same time, the \u003cem\u003eBamhІ\u003c/em\u003e \u0026amp; \u003cem\u003eXbaІ\u003c/em\u003e (NEB, USA, Cat No. R0136S and R0145S, respectively) were used to digest the antisense-oriented fragment. For cloning, the pFGC5941 RNAi vector (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e) was digested once with \u003cem\u003eAscІ\u003c/em\u003e \u0026amp; \u003cem\u003eXhoІ\u003c/em\u003e, and in a second reaction, was digested with \u003cem\u003eBamhІ\u003c/em\u003e \u0026amp; \u003cem\u003eXbaІ\u003c/em\u003e to clone the sense and antisense fragment, respectively. The pFGC5941 vector-carrying fragment in sense and antisense orientation was then transformed into \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e strain LBA4404 \u003cem\u003evia\u003c/em\u003e heat-shock treatment (Sambrook et al. \u003cspan citationid=\"CR124\" class=\"CitationRef\"\u003e1989\u003c/span\u003e). \u003cb\u003eSesame transformation\u003c/b\u003e: Following the procedure by Sultan and Tawfik (\u003cspan citationid=\"CR141\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), under aseptic conditions, the seeds of sesame were surface sterilized, de-coated, followed by incubation with \u003cem\u003ean Agrobacterium\u003c/em\u003e solution (carrying the pFGC5941 engineered vector) for 2\u0026ndash;3 hours. The seeds were placed on a germination medium consisting of \u0026frac12; strength MS basal salt mixture (Murashige and Skoog, \u003cspan citationid=\"CR91\" class=\"CitationRef\"\u003e1962\u003c/span\u003e), supplemented with Gamborg's B₅ vitamin (Gamborg et al. \u003cspan citationid=\"CR37\" class=\"CitationRef\"\u003e1968\u003c/span\u003e)\u0026thinsp;+\u0026thinsp;10 g/l sucrose\u0026thinsp;+\u0026thinsp;7 g/l Agar. The plates were dark incubated overnight at room temperature. The next day, sesame seeds were transferred into a germination medium supplemented with 500 mg/l cefotaxime, and 24 hrs later, the seeds were transferred into plastic trays filled with soil mixture (peat moss: clay: sand at 2:1:1 ratio) in growth chambers at 25\u0026ndash;28\u0026deg;C with 16/8 hr light/ dark period for 2\u0026ndash; 3 weeks. Well-developed sesame seedlings were transplanted into 15 cm pots filled with the same soil mixture. \u003cb\u003eDNA isolation\u003c/b\u003e: DNA was extracted from leaves using the CTAB method following Murray and Thompson's procedure (1980). \u003cb\u003ePCR analysis\u003c/b\u003e: Individual putative transgenic plants were screened using 35S forward and reverse primers (35SF GCTCCTACAA ATGCCATCA, and 35SR GATAGTGGGAT TGTGCGTCA) and Bar forward and reverse primers (BarF GACAAGCACGGTCAACTTCC, and BarR CTTCAGCAGGTGGGTGTA GAG), which amplified a 200 and 247bp fragments, respectively. \u003cb\u003eHerbicide Resistance Test\u003c/b\u003e: Transgenic sesame plants were tested by leaf painting and spraying with Basta solution {0.02% Basta and 0.1% (v/v) Tween 20\u0026reg;}. The leaves were observed and scored five days post-painting. \u003cb\u003eStatistical analysis\u003c/b\u003e: The chi-square test calculated and statistically validated segregation ratios (Jelinski et al. 1990). \u003cb\u003eRNA isolation and DNase treatment\u003c/b\u003e: RNA isolation from sesame tissues was conducted using the PureLink RNA Kit (Ambion, USA, Cat # 12183018A). RNA samples were treated with Turbo DNA-free\u0026trade; (Ambion, USA, cat #AM1907) to clean any DNA contaminants. \u003cb\u003eRT-PCR analysis\u003c/b\u003e: RNA isolated from sesame tissues was used for cDNA synthesis using the MMLV enzyme (Promega, USA, Cat no. M170B). The RT-PCR was carried out using the Bar forward and reverse primers. \u003cb\u003ePreparation of RNA samples for transcriptome analysis\u003c/b\u003e: RNA was extracted by using PureLink RNA Kit (Ambion, USA, Cat # 12183018A) from five T\u003csub\u003e1\u003c/sub\u003e transgenic plants false septa tissues (at four developmental stages 7, 14, 21 and 28 DAF) were pooled together. RNA was treated with Turbo DNA-free\u0026trade; (Ambion, USA, cat #AM1907) to eliminate DNA contamination. Three biological replicates were collected. RNA quality and concentration were determined using Experion\u0026trade; Automated Electrophoresis System by Bio-Rad (Cat No. 7007010). The integrity of RNA was assessed using an Agilent 2100 bioanalyze. The samples were prepared, and BGI-China constructed and synthesized the cDNA library. \u003cb\u003eTranscriptome analysis\u003c/b\u003e: The quality of the reads was analyzed using the FASTQC tool, which is a quality control tool for NGS-generated data (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttp://www.bioinformatics.babraham.ac.uk/projects/fastqc/\u003c/span\u003e\u003cspan address=\"http://www.bioinformatics.babraham.ac.uk/projects/fastqc/\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) and MultiQC (\u003cspan class=\"ExternalRef\"\u003e\u003cspan class=\"RefSource\"\u003ehttps://github.com/ewels/MultiQC/releases\u003c/span\u003e\u003cspan address=\"https://github.com/ewels/MultiQC/releases\" targettype=\"URL\" class=\"RefTarget\"\u003e\u003c/span\u003e\u003c/span\u003e) was used for FASTQC reports combination, reads with a Phred quality score (Q)\u0026thinsp;\u0026gt;\u0026thinsp;22, a length of 50 nt or higher and homopolymeric tract lower of the 50% of the total read length, was selected. Reads with good quality were mapped to the latest \u003cem\u003eSesamum indicum\u003c/em\u003e genome assembly (S_indicum_v1.0), which was retrieved from the Ensembl Plants genomic browser with the corresponding annotation GTF file using STAR (Dobin et al. \u003cspan citationid=\"CR22\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). STAR practical workflow consists of two steps: 1- Generating genome index files using the reference genome sequences (FASTA files) and annotations (GTF file) with an overhang of max (Read length) \u0026minus;\u0026thinsp;1. The maximum read length was 150 nt, so the index overhang was 149. 2- Mapping reads to the genome using the genome index files generated in the 1st step, as well as the RNA-seq reads (sequences) in the FASTQ files; the output files were saved in sorted-by-coordinate BAM format, and alignment quality was checked using qualimap (Okonechnikov et al. \u003cspan citationid=\"CR102\" class=\"CitationRef\"\u003e2015\u003c/span\u003e) gene expression quantification by FeatureCounts. Differential gene expression (DEGS) using the DEseq2 package was used to compare control and transgenic samples at different stages. In addition to investigating DEGs, the mRNA raw counts were normalized using the DESeq2 median of ratios, followed by negative binomial linear regression data modelling; the contrast was specified based on the conditions of interest only and tested using the Wald test. The significance level of the P-adjusted value was set at false discovery rate (FDR)\u0026thinsp;\u0026lt;\u0026thinsp;0.05, and the fold change (FC) thresholds were set as |log2FC| \u0026gt; 1.5. Functional enrichment was analyzed with GProfiler analysis. A cutoff score of 0.05 FDR was set for significantly enriched terms. \u003cb\u003eQuantitative Real-Time PCR analysis\u003c/b\u003e: The expression levels of selected target genes in the non-transgenic controls and the transgenics false septa tissue from sesame capsules at the four developmental stages were validated by qRT-PCR using the maxima SYBR\u0026trade; Green qPCR kit (ThermoScientific, USA, cat #K0251). The reaction was conducted as follows:- in a volume of 10 \u0026micro;l, 5 \u0026micro;l SYBR Green Master Mix was added\u0026thinsp;+\u0026thinsp;250 ng of cDNA template\u0026thinsp;+\u0026thinsp;0.3 \u0026micro;M of each of the forward and reverse primers. The Real-time PCR was programmed to the following conditions: an initial step at 95 \u0026ordm;C for 10 min, followed by 40 cycles of (95 ⁰C for 5 sec and 58 ⁰C for 45 sec). All the primer sequences used for the different target genes are listed in Table \u003cspan refid=\"MOESM3\" class=\"InternalRef\"\u003eS3\u003c/span\u003e. The actin gene was used as a reference gene to normalize the relative quantification using the comparative 2\u003csup\u003e\u0026minus;∆∆Ct\u003c/sup\u003e method (Schmittgen and Livak \u003cspan citationid=\"CR126\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). All reactions and validations were performed in three biological replicates.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e"},{"header":"Results","content":"\u003cdiv id=\"Sec4\" class=\"Section2\"\u003e \u003ch2\u003eConstruct preparation and transformation\u003c/h2\u003e \u003cp\u003eThe pFGC5941vector was designed to contain two sites of insertions, sense and antisense, to achieve silencing (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA) and has been used successfully in multiple publications (Wesley et al. \u003cspan citationid=\"CR158\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; An et al. \u003cspan citationid=\"CR5\" class=\"CitationRef\"\u003e2003\u003c/span\u003e; Hirai and Kodama, \u003cspan citationid=\"CR42\" class=\"CitationRef\"\u003e2008\u003c/span\u003e). The full-length sequence of the endo-polygalacturonase gene was cloned (Sultan et al. \u003cspan citationid=\"CR140\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; accession no LC279244), and a 277 bp partial sequence of the endo-polygalacturonase was chosen to construct the silencing vector. New primers were designed to correspond to the pFGC5941 vector two cloning sites (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eA; SenF1 \u0026amp; SenR1 and AntiF1\u0026amp; AntiR1, respectively). The newly synthesized fragments were ligated into the pGEM- T Easy Vector. The two partial sequences in pGEM were recovered via double digestion with AscI \u0026amp; XhoI to release the sense strand, while the BamHI \u0026amp; XbaI were used to release the antisense strand. Ligation into the pGFC5941 vector was conducted over two steps. The first step was performed by digesting the pFGC5941 RNAi vector with AscI \u0026amp; XhoI to ligate the sense fragment. The second step was achieved by linearizing the resulting vector with BamHI \u0026amp; XbaI digest and ligating the antisense fragment (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eB).\u003c/p\u003e \u003cp\u003e \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e carrying the engineered pFGC5941-PG vector was used to transform sesame cv. Sohag 1. A single positive colony was then used in the sesame transformation. Following the procedure of (Sultan and Tawfik \u003cspan citationid=\"CR141\" class=\"CitationRef\"\u003e2023\u003c/span\u003e), de-coated seeds were incubated with \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e strain LBA4404 harboring the pFGC5941-PG vector and then immediately transferred onto germination media (\u0026frac12; strength MS basal salt mixture with B₅ vitamin ten g/l sucrose and seven g/l agar) for overnight (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC \u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003e and \u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003e). The seeds were then transferred into trays filled with soil mixture (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC 3). Seedlings were allowed to recover in a biocontainment greenhouse facility for weeks. Then, well-developed sesame plantlets were transferred to bigger pots (Fig.\u0026nbsp;\u003cspan refid=\"Fig1\" class=\"InternalRef\"\u003e1\u003c/span\u003eC 4 and \u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003e). Over five hundred putative individual sesame plants were screened by PCR using \u003cem\u003e35S\u003c/em\u003e promoter-specific primers. Of these plants, Thirty PCR-positive transgenic plants (200 bp fragments were detected) were produced (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eA). T\u003csub\u003e1\u003c/sub\u003e seeds were produced from thirty individual transgenics, and based on seed availability, we selected two lines for PCR screening and continuation of the work using bar gene primer, which amplified 247 bp fragments (Fig.\u0026nbsp;\u003cspan refid=\"Fig2\" class=\"InternalRef\"\u003e2\u003c/span\u003eB). The precision and accuracy of our results were further confirmed by the chi-square (x2) analysis, which indicated a segregation of 3:1, demonstrating the Mendelian segregation of a single dominant gene.\u003c/p\u003e \u003cp\u003eWe further performed herbicide resistance tests using leaf-painting of mature leaves and spraying the entire plants with BASTA (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eA and \u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eB). This point was crucial, as we did not go through the tissue culture process (Sultan and Tawfik, \u003cspan citationid=\"CR141\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). We further performed RT-PCR using bar primers (Fig.\u0026nbsp;\u003cspan refid=\"Fig4\" class=\"InternalRef\"\u003e3\u003c/span\u003eC) to confirm the incorporation of the bar gene in T\u003csub\u003e1\u003c/sub\u003e plants.\u003c/p\u003e \u003cp\u003eBefore going any further with our main goal to understand the transcriptional changes in the false septa tissues \u003cem\u003evia\u003c/em\u003e performing transcriptome analysis, we had to ensure the presence of changes in transcription levels in the endo-PG gene (target gene) between transgenic and non-transgenic false septa counterparts. Therefore, an RT-PCR on endo-PG levels in false septa tissues was performed. Figure\u0026nbsp;(4 A1) indicates the expression level of the endo-PG level in the four developmental stages in control false septa tissues compared to in transgenic false septa tissues (Fig.\u0026nbsp;4A2), which indicates a reduction in the levels over the four stages in the transgenic sesame plants. This result was also confirmed using qRT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eB). The level of endo-polygalacturonase (Endo-PG) was significantly lower in transgenic plants; the fold change was 100, 25.64, 50 and 11.11-folds at stages 1, 2, 3 and 4, respectively, with silencing per cent at four developmental stages in transgenic sesame plants about 99, 96, 98 and 91%, respectively.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec5\" class=\"Section2\"\u003e \u003ch2\u003ePhenotype of transgenic plants\u003c/h2\u003e \u003cp\u003eThe transgenic plant continued vegetative growth and formed more capsules at the distal end compared to non-transgenic controls. Furthermore, harvested capsules from transgenic plants continued to be closed even after being placed in a petri dish in a 37C incubator for up to two weeks, compared to the non-transgenic capsules that were already partially open when harvested (Fig.\u0026nbsp;\u003cspan refid=\"Fig5\" class=\"InternalRef\"\u003e4\u003c/span\u003eC).\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec6\" class=\"Section2\"\u003e \u003ch2\u003eTranscriptome profiling and identifying differentially expressed genes (DEGs)\u003c/h2\u003e \u003cp\u003eTotal RNA from false septa tissues at different developmental stages from control and transgenic sesame plants were sequenced using the Next Generation Sequencing (NGS). Three biological replicas represented all samples. A total of 25,174 genes were obtained from control and transgenic sesame plants. The differentially expressed genes (DEGs) were identified at a false discovery rate (FDR)\u0026thinsp;\u0026lt;\u0026thinsp;0.05, and the fold change (FC) thresholds were set as |log2FC| \u0026gt; 1.5. The control and transgenic gene expression levels were analyzed, and 514 DEGs were recognized (Table \u003cspan refid=\"MOESM1\" class=\"InternalRef\"\u003eS1\u003c/span\u003e), with 349 up-regulated and 165 down-regulated (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003eA). Further analysis of the up/and down-regulated genes as a heat map revealed that the genes were divided into five clades based on their expression pattern (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003eB). Additionally, the gene expression profiles between control and transgenic plants at the four stages of capsules development revealed the following; 508 genes in total were differentially expressed at stage1; in stage 2, 280 DEGs were downregulated, and 203 DEGs were upregulated; In stages 3 and 4, the number of up-regulated DEGs were170 and 159, respectively, along with 324 and 344 down-regulated DEGs in stages 3 and 4, respectively (Fig.\u0026nbsp;\u003cspan refid=\"Fig3\" class=\"InternalRef\"\u003e5\u003c/span\u003eC).\u003c/p\u003e \u003cp\u003eGene Ontology (GO) has been used to classify the function of genes in plants. Therefore, we generated GO to describe the results obtained for gene functions between false septa tissues of non-transgenic controls and their transgenic counterparts. A total of 24,468 unique genes (unigenes) in the GO database were classified into 21 functional categories (Table \u003cspan refid=\"MOESM2\" class=\"InternalRef\"\u003eS2\u003c/span\u003e), among which 5988 unigenes were assigned to molecular functions (MF), 5349 genes were assigned to biological processes (BP), and 13131 unigenes were assigned to cellular components (CC) (Fig.\u0026nbsp;\u003cspan refid=\"Fig6\" class=\"InternalRef\"\u003e6\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eIn the MF category, oxidoreductase activity, transporter activity and transmembrane transporter activity were the most abundant terms, along with DNA-binding transcription factor activity, monooxygenase activity, oxidoreductase activity acting on paired donors with incorporation or reduction of molecular oxygen, transcription regulator activity and UDP-glycosyltransferase activity. These results were unsurprising, considering that we selected a single cell layer tissue, \u0026ldquo;false septa,\u0026rdquo; mainly involved in transporting and signal transduction.\u003c/p\u003e \u003cp\u003eThe top three terms of BP were response to stimulus, transmembrane transport, and response to chemical along with defense response, secondary metabolic process, response to toxic substances, toxin catabolic process, regulation of response to external stimulus, toxin metabolic process and detoxification. For the CC category, membrane, intrinsic component of membrane, and integral component of membrane were the highest sub-categories.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGenes related to seed-shattering.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eA large number of unigenes were obtained in this study, of which 19 DEGs were selected based on directly controlling the disruption of the false septa resulting in seed shattering (Fig.\u0026nbsp;\u003cspan refid=\"Fig7\" class=\"InternalRef\"\u003e7\u003c/span\u003e). The selected unigenes encode for individuals producing plant hormones or unigenes involved in cell wall modification enzymes and transcription factors. Interestingly, 15 out of 19 selected DEGs showed significant levels of decreased expression in transgenic false septa during the maturation of the sesame capsules \u0026ldquo;fruit\u0026rdquo;, with only 4 DEGs out of the 19 selected showed significant increase in their transcript levels in transgenic false septa tissues compared to their non-transgenic control counterparts. Validation of transcriptome data was performed \u003cem\u003evia\u003c/em\u003e qRT-PCR, as indicated in (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003e \u003cb\u003eGenes related to hormonal balance in plants.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eOur result in sesame indicates that the ethylene receptor 2 (ETR2; SIN_1021817) was down-regulated (-3.33, -1.4, -1.25 and \u0026minus;\u0026thinsp;1.4 folds) in transgenic sesame false-septa tissues across the four developmental stages when compared to the non-transgenic control counterparts. In the ABA signal transduction pathway, we identified two DEGs that encode for C2-domain ABA-related gene, CAR (SIN_1021335) and protein phosphatase 2C, PP2C (SIN_1009503). The CAR gene was down-regulated (-5.88, -1.8, -1.5 and \u0026minus;\u0026thinsp;1.25 folds), while the PP2C was upregulated considerably (1.1, 1.25, 1.93 and 3.75 folds) in transgenic sesame lines. The PP2C gene was significantly up-regulated at 28 DAF of sesame capsules in transgenic plants compared with non-transgenic plants, suggesting that increasing PP2C causes inhibition of ABA during capsule development, which led to decreased seed shattering. One of the DEGs highly expressed in transgenic sesame plants was the LOG1 gene (SIN_1002363). The LOG1 gene was significantly up-regulated by 2, 2.36 and 2.55 folds in transgenic sesame plants starting at stages 2, 3 and 4, respectively. IAA-amino acid hydrolase ILR1 (SIN_1005912) mRNA exhibited a reduction in transgenic false septa tissues at stages 1 and 4 (-2.5 and --2-fold at stages 1 and 4, respectively).\u003c/p\u003e \u003cp\u003e \u003cb\u003eGenes that are involved in the remodeling of cell walls.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCell wall remodeling enzymes constitute essential components of plant responses to seed shattering. The cell wall remodeling-related DEGs were significantly highly expressed in non-transgenic plants and down-regulated in transgenic plants. These DEGs included endo-polygalacturonase (Endo-PG) (SIN_1008859), Endo ꞵ-1,4 glucanase (Cellulase) (EG) (SIN_1015495), Pectate lyase (PL) (SIN_1004730), pectin methylesterase (PME) (SIN_1012659), ꞵ-glucosidase (bGlu) (SIN_1023287), Expansin (EXPA), (SIN_1011199), and Arabinogalactan (AGP) (SIN_1017961). Cellulose synthase (CSLG) (SIN_1014328) was detected, which was significantly highly expressed in transgenic plants and 4-Coumarate: CoA ligase (4CL) (SIN_1007390) was up-regulated in transgenic plants. These results indicate that cell wall remodeling-related genes are essential during seed shattering.\u003c/p\u003e \u003cp\u003eThe endo-polygalacturonase (Endo-PG) (SIN_1008859), the main target of the present work, was highly downregulated in transcriptome analysis at stages 1 and 4 compared to non-transgenic plants. This result was consistent with the qRT-PCR. Pectate lyase (PL) (SIN_1004730) was downregulated in transgenic false septa tissues compared to the non-transgenic controls. In transgenic sesame, the PL levels were significantly downregulated to 25, 2.5, and 12.5 folds in stages 1, 2, and 3 compared to the non-transgenic controls (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). Pectin methyl-esterase, also known as pectin esterase (PME) (SIN_1012659), showed a significant decrease by -100, -3, -4.2 and \u0026minus;\u0026thinsp;3.6 folds in their expression patterns across the four false septs developmental stages in the transgenic sesame plants compared to the non-transgenic controls. The level of Endo ꞵ-1,4 glucanase (EG) (SIN_1015495) was found to be significantly lower in the different stages of the transgenic sesame plants compared to their non-transgenic counterparts, with the highest changes at the fourth stage (-4.35, -3, -2.44 and \u0026minus;\u0026thinsp;12.5 folds) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). The ꞵ-glucosidases (bGlu; SIN_1023287) expression level was significantly impaired in transgenic sesame plants when compared to the non-transgenics, especially at stages 2, 3 and 4 (-1.4, -2.3, -3.3 and \u0026minus;\u0026thinsp;3.2 folds) (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). Expansins (EXPA) (SIN_1011199) decreased significantly at the four tested false septa stages in the transgenic plants (-100, -3.33, -3.85 and \u0026minus;\u0026thinsp;5-folds decrease at stages 1, 2, 3 and 4, respectively). Arabinogalactan (AGP) (SIN_1017961) was downregulated in transgenic plants at the four tested stages in transgenic sesame (-20, -2.5, -3.1 and \u0026minus;\u0026thinsp;1.7-folds). Cellulose synthase (CSLG) (SIN_1014328) and CoA ligase (4CL) (SIN_1007390) expression levels were up-regulated at the false septa tissues, especially at the 4th stage in the transgenic plants (3 folds). This result indicates minimal cellulose breakdown, providing more support for capsule indehiscence in transgenic sesame than their non-transgenic sesame counterparts. 4-coumarate: CoA ligase, the expression levels increased from 1.23-fold in the 1st stage to 6.45-fold in the 4th stage.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGenes related to capsule maturation.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eDicarboxylate transporter (DT) (SIN_1003272) was one of the transcripts that were down-regulated in transgenic false septa tissues (-16, -2.0, -2.7 and \u0026minus;\u0026thinsp;3.3-folds). Isoamylase (ISA3) (SIN_1016996) was downregulated in transgenic plants at the four tested stages (-7.7, -4.7, -6.6, and \u0026minus;\u0026thinsp;2-fold changes at stages 1, 2, 3 and 4, respectively), compared to the non-transgenic counterpart false septa tissues.\u003c/p\u003e \u003cp\u003e \u003cb\u003eGenes encoding for transcriptional factors.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eThe molecular basis of dehiscence zone formation and degradation is controlled \u003cem\u003evia\u003c/em\u003e a network of genes, including transcription factors (TFs). The RNA-Seq analysis of false septa tissues derived from transgenic and non-transgenic sesame plants in the 4th stage \u0026ldquo;28 DAF\u0026rdquo; revealed changes in the expression of some transcription factors, including bHLH, HD-Zip, ERF, Myb, MADS-box, WRKY and bZIP (Fig.\u0026nbsp;\u003cspan refid=\"Fig9\" class=\"InternalRef\"\u003e9\u003c/span\u003e). In our results, the MADS-box (SIN_1026469), the bZIP (SIN_1016792) and the dof (SIN_1011668) were found to be highly downregulated during capsule development in sesame and were verified by qRT-PCR (Fig.\u0026nbsp;\u003cspan refid=\"Fig8\" class=\"InternalRef\"\u003e8\u003c/span\u003e). The results showed that the expression levels of genes were consistent with the transcriptome analysis results. Their expression levels were increased in false septa tissues of non-transgenic sesame plants compared to their transgenic counterparts at the four tested stages. The expression level of MADS-box decreased \u0026minus;\u0026thinsp;7.14, -2.56, -4.2 and \u0026minus;\u0026thinsp;6.25-fold, compared to the transgenic tissues. In the sesame plant, our results indicated that the bZIP decreased by -14.3, -5.0, -2.0 and \u0026minus;\u0026thinsp;3.7-fold in transgenic plants vs. the non-transgenic controls. The expression level of DNA binding with one finger (dof) was down-regulated to -50, -11.10, -10 and \u0026minus;\u0026thinsp;6.7-fold in transgenic plants.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003c/div\u003e"},{"header":"Discussion","content":"\u003cdiv id=\"Sec8\" class=\"Section2\"\u003e \u003ch2\u003eRNAi vector and plant transformation\u003c/h2\u003e \u003cp\u003eRNA interfering technology has been used, with various degrees of success, in several plant species to control the expression of genes as an alternative to knockout mutant, as in the production of diseases resistant plants (Fritz et al. \u003cspan citationid=\"CR35\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Escobar et al. \u003cspan citationid=\"CR29\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Kang et al. \u003cspan citationid=\"CR52\" class=\"CitationRef\"\u003e2008\u003c/span\u003e; Jiang et al. \u003cspan citationid=\"CR48\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), improving drought tolerance (Wang et al. \u003cspan citationid=\"CR155\" class=\"CitationRef\"\u003e2009\u003c/span\u003e), improving nutritional value (Regina et al. \u003cspan citationid=\"CR120\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Yin et al. \u003cspan citationid=\"CR164\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Tang et al. \u003cspan citationid=\"CR144\" class=\"CitationRef\"\u003e2007\u003c/span\u003e) and increasing shelf-life of fruits (Karlova et al. \u003cspan citationid=\"CR53\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Meli et al. \u003cspan citationid=\"CR88\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Zhang et al. \u003cspan citationid=\"CR170\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Gupta et al. \u003cspan citationid=\"CR40\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). This study used the pFGC5941 vector (RNAi vector) to suppress the endo-polygalacturonase gene's expression in sesame. In previous studies, polygalacturonase has been examined for its role in fruit ripening (Ogasawara et al. \u003cspan citationid=\"CR99\" class=\"CitationRef\"\u003e2007\u003c/span\u003e; Fabi et al. \u003cspan citationid=\"CR32\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Jiang et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2019\u003c/span\u003e); silique dehiscence (Sander et al. \u003cspan citationid=\"CR125\" class=\"CitationRef\"\u003e2001\u003c/span\u003e; Ogawa et al. \u003cspan citationid=\"CR100\" class=\"CitationRef\"\u003e2009\u003c/span\u003e; Yu et al. \u003cspan citationid=\"CR167\" class=\"CitationRef\"\u003e2020\u003c/span\u003e), and abscission zone formation (Carranza et al. \u003cspan citationid=\"CR13\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Verlent et al. \u003cspan citationid=\"CR148\" class=\"CitationRef\"\u003e2005\u003c/span\u003e; Palanivelu \u003cspan citationid=\"CR104\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Babu and Bayer, \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2014\u003c/span\u003en\u0026eacute;chal et al. \u003cspan citationid=\"CR129\" class=\"CitationRef\"\u003e2014\u003c/span\u003e), yet little attention was paid to the role of PGs in seed shattering across different crops, and sesame in particular.\u003c/p\u003e \u003cp\u003eThe RNAi vector was transformed into \u003cem\u003eAgrobacterium tumefaciens\u003c/em\u003e for sesame transformation. In previous studies, Sesame has been proven to be difficult/immune to regeneration and transformation for a long time, yet one of the first breakthroughs came from two groups (Yadav et al. \u003cspan citationid=\"CR161\" class=\"CitationRef\"\u003e2010\u003c/span\u003e; Al-Shafeay et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Both groups used de-embryonated cotyledons from mature seeds to achieve successful regeneration and stable transformation in sesame. Interestingly, both techniques reported a regeneration system time of 4\u0026ndash;10 weeks long, along with low transformation efficiency (1.01\u0026ndash;1.67%). The successful reported regeneration and transformation system for sesame, besides being time-consuming and the need to use multiple growth regulators in different media (Yadav et al. \u003cspan citationid=\"CR161\" class=\"CitationRef\"\u003e2010\u003c/span\u003e ; Al-Shafeay et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2011\u003c/span\u003e), has been proven to be highly genotype-dependent with low transformation percentage (Al-Shafeay et al. \u003cspan citationid=\"CR3\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). In general, prolonged exposure of explants to media tends to produce somaclonal variation among the resulting transgenics. This was the main reason behind developing a non-tissue culture-based planta technique for sesame (Sultan and Tawfik \u003cspan citationid=\"CR141\" class=\"CitationRef\"\u003e2023\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn the present work, we use a non-tissue culture-based method to transform sesame and screen transgenic plants via PCR, leaf painting, and spraying with BASTA on fully matured plants. Similar to previous studies using BATSA as the selectable marker for many crops, such as sugarcane, eggplant, okra and canola (Mayavan et al. \u003cspan citationid=\"CR87\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Subramanyam et al. \u003cspan citationid=\"CR139\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Manickavasagam et al. \u003cspan citationid=\"CR83\" class=\"CitationRef\"\u003e2015\u003c/span\u003e; Qing et al., \u003cspan citationid=\"CR115\" class=\"CitationRef\"\u003e2000\u003c/span\u003e), as it provides the option of spraying the entire plants upon reaching maturity, without the need of using it during the regeneration procedure, as some explant species tend to be more venerable to BASTA at earlier stages. The level of endo-polygalacturonase significantly decreased in transgenic sesame plants, revealing silencing about 99, 96, 98 and 91% at four development stages. In previous studies, the expression of antisense FaPG1 in strawberry transgenic lines reduced the level of FaPG1 by 90\u0026ndash;95%, respectively, in transgenic strawberries, which caused fruit firmness at the ripening stage compared to non-transgenic controls (Quesada et al. \u003cspan citationid=\"CR117\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). In tomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e), downregulation of PG using PG-antisense in transgenic plants significantly reduced endogenous PG levels by 70\u0026ndash;90% in ripening fruits (Sheehy et al. \u003cspan citationid=\"CR134\" class=\"CitationRef\"\u003e1988\u003c/span\u003e). Further studies on tomatoes by Smith et al. (\u003cspan citationid=\"CR136\" class=\"CitationRef\"\u003e1990\u003c/span\u003e) revealed a successful downregulation of PG in ripening fruit up to 99%.\u003c/p\u003e \u003cp\u003eOur results indicated that the transgenic sesame plants continued vegetative growth and delayed leaf and organ senescence, which might be attributed to the use of a constitutive promoter (35S), yet the harvested capsules showed a delay in opening even after incubating in a 37⁰C incubator for two weeks.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec9\" class=\"Section2\"\u003e \u003ch2\u003eGenes associated with seed shattering in sesame\u003c/h2\u003e \u003cp\u003ePrevious studies have highlighted genes associated with organ abscission in different plants like sweet cherry (fruitlet), citrus (fruit), tomato (flower pedicel), passion fruit, and Stylosanthes (seed stalk). In sweet cherry, Qui et al. (2021) identified 15 DEGs related to abscission (abscising carpopodium in fruitlet) from generated transcriptome data. They further confirmed their data using qRT-PCR, indicating that twelve of the fifteen initially identified DEGs showed an upregulation in their expression patterns compared to three downregulated DEGs. Interestingly, polygalacturonase, endoglucanase and expansin were part of the 13 upregulated genes reported (Qiu et al. \u003cspan citationid=\"CR116\" class=\"CitationRef\"\u003e2021\u003c/span\u003e), similar to the results we obtained in our work. In the citrus fruit abscission zone, Merelo et al. (\u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) reported that genes related to cell wall remodeling enzymes (polygalacturonase, pectate lyase, pectin-methyl esterase, cellulase, xyloglucan endotransglucosylases/hydrolases, expansin, endo-β-mannosidase) were upregulated in fruit abscission zones during ethylene-induced abscission, shedding lights on the important of ethylene role in promoting and inducing abscission process.\u003c/p\u003e \u003cp\u003eFurther studies on tomato flower-pedicel abscission zone indicated the presence of a large number of genes (89 genes) with increased expression levels that were related to phytohormones (DFL1, MES1 and BAS1), transcription factors (MYB36, ERF1, ERF2 and LAS) and cell wall remodeling enzymes (polygalacturonase, expansin and peroxidase) in abscission zones (Nakano et al. \u003cspan citationid=\"CR94\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Similarly, Li et al. (\u003cspan citationid=\"CR69\" class=\"CitationRef\"\u003e2020\u003c/span\u003e) identified 18 individual DEGs in the passion fruit abscission zone and validated their results with qRT-PCR. They stated that most of the upregulated genes were somehow involved in plant hormone signaling (ETR, EBF1-2 and CTR1) and cell wall modification enzymes (β-galactosidase, polygalacturonase, pectin methyl esterase, pectin lyase, cellulase and expansin).\u003c/p\u003e \u003cp\u003eTo understand pod shattering in vetch (\u003cem\u003eVicia sativa\u003c/em\u003e L.) pod ventral sutures, Dong et al. (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) performed transcriptome analysis of pod ventral sutures from shattering-susceptible and shattering-resistant accessions. Their work identified 22 DEGs significantly upregulated in the shattering-susceptible accession related to cell wall modification enzymes and hydrolases (Dong et al., \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). To examine the genes associated with seed shattering in \u003cem\u003eStylosanthes\u003c/em\u003e spp., samples from seed shattering-resistant accession TF0041 and seed shattering-susceptible accession TF0275 were collected and subjected to transcriptome profiling. Li et al. (\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) identified 26 DEGs involved in lignin biosynthesis, cellulose ester (CE) synthesis, and plant hormone signal transduction.\u003c/p\u003e \u003cp\u003eStudies have shown that alteration in the cell wall structure of the dehiscence zone is one of the leading causes of pod shattering in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e (Dong and Wang \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). The fruits which carry the seeds in Arabidopsis are called siliques, and a mature silique consists of three tissues: the valves, the replum, and the valve margins (Robles and Pelaz, \u003cspan citationid=\"CR122\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). The valve and the replum are usually differentiated into a lignified layer (LL) and a separation layer (SL), which together form a dehiscence zone along the silique (Seymour et al. \u003cspan citationid=\"CR130\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Upon seed maturation, the silique layers dry, thus generating tension within the pod valve that causes the silique to open and the seeds to shatter (Sultan et al. \u003cspan citationid=\"CR140\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Therefore, the silique dehiscence is a process that depends on the formation of the dehiscence zone along the silique (Ferr\u0026aacute;ndiz, 2002; Dong and Wang, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). However, the dehiscence zone breakdown depends on various cell wall modification enzymes such as endo-polygalacturonase (Dong et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), cellulase (Merelo et al. \u003cspan citationid=\"CR89\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) and expansin (Marowa et al. \u003cspan citationid=\"CR86\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). The Arabidopsis Dehiscence Zone PG 1 (ADPG1) and ADPG2 are two genes that encode plant-specific endo-polygalacturonases (PGs) and are essential for silique dehiscence in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e (Ogawa et al. \u003cspan citationid=\"CR100\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). In addition to cell wall hydrolytic enzymes, plant hormones also play a significant role in regulating the dehiscence zone's development processes, for example, ethylene and Abscisic acid (Jaradat et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2014\u003c/span\u003e and Li et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Transcription factors in Arabidopsis, it was found that transcription factors such as MADs box, INDEHISCENT (IND) and ALCATRAZ (ALC) were responsible for the differentiation of the dehiscence zone causing seed shattering (Liljegren et al. \u003cspan citationid=\"CR74\" class=\"CitationRef\"\u003e2004\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003ePhytohormones involved in seed-shattering.\u003c/b\u003e \u003c/p\u003e \u003cp\u003ePlant hormones such as ethylene (ETH), abscisic acid (ABA), jasmonic acid (JA), and methyl jasmonate (MeJA) are believed to have a vital role in accelerating the abscission process in plants (Lewis et al. \u003cspan citationid=\"CR68\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Aalen et al. \u003cspan citationid=\"CR1\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Jaradat et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2014\u003c/span\u003e; Patterson et al. \u003cspan citationid=\"CR107\" class=\"CitationRef\"\u003e2016\u003c/span\u003e; Tranbarger et al. \u003cspan citationid=\"CR145\" class=\"CitationRef\"\u003e2017\u003c/span\u003e; Maity et al. \u003cspan citationid=\"CR82\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). For example, ethylene is known as a vital hormone in fruit ripening, seed shattering and the development of the abscission zones \u003cem\u003evia\u003c/em\u003e activating different cascades of pathways (Vrebalov et al. \u003cspan citationid=\"CR149\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Wang et al. \u003cspan citationid=\"CR151\" class=\"CitationRef\"\u003e2002\u003c/span\u003e; Tacken et al. \u003cspan citationid=\"CR143\" class=\"CitationRef\"\u003e2010\u003c/span\u003e). Similarly, Jaradat et al. (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) reported downregulation of 2 ethylene receptors (ETR1 and ETR2) and two ethylene-positive regulators (EIN2 and EIN3) in \u003cem\u003eBrassica juncea\u003c/em\u003e (shatter resistant) when compared to \u003cem\u003eB. napus\u003c/em\u003e (shattering sensitive). They further proved that ethylene-negative regulator CTR1 was upregulated in \u003cem\u003eB. juncea\u003c/em\u003e (shatter resistant) (Jaradat et al. \u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). According to Ziosi et al. (\u003cspan citationid=\"CR173\" class=\"CitationRef\"\u003e2006\u003c/span\u003e), the peaches PpETR1 and PpERS1 gene expression during fruit development and ripening increased significantly. Similar results were obtained in Apple fruits upon ripening and maturation, as there was a significant increase in the ETR2, ETR5, ERSs, EIL4, and ERFs genes, along with ACS1 and ACO1 genes (Yang et al. \u003cspan citationid=\"CR162\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eAbscisic acid (ABA) regulates organ abscission and seed shattering (Estornell et al. \u003cspan citationid=\"CR30\" class=\"CitationRef\"\u003e2013\u003c/span\u003e; Lang et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Zhai et al. \u003cspan citationid=\"CR168\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Further analysis of transcriptome (in apple fruitlet abscission zone) shows that the ABA-responsive 9-cis-epoxy carotenoid dioxygenase (NCED) gene, \u0026ldquo;an essential ABA-biosynthesis gene\u0026rdquo;, was increased, along with an increased accumulation in ABA concentration before/and during the abscission process (Eccher et al. \u003cspan citationid=\"CR28\" class=\"CitationRef\"\u003e2013\u003c/span\u003e). Further analysis also revealed activation of other genes downstream of the signal transduction of the ABA pathway. The same trend of results was also obtained in rice, as shown \u003cem\u003evia\u003c/em\u003e RNA sequencing and expression analysis of NCED, suggesting the existence of a strong correlation between plant hormone ABA and seed shattering (Lang et al. \u003cspan citationid=\"CR62\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eKim et al. (\u003cspan citationid=\"CR57\" class=\"CitationRef\"\u003e2010\u003c/span\u003e) showed that the CAR proteins directly interact with ABA receptors, also known as PYRABACTIN RESISTANCE1 (PYR1)/PYR1-LIKE (PYL)/REGULATORY COMPONENTS OF ABA RECEPTORS (RCAR). The receptors are localized at the plasma membrane, and CAR binding to the receptors occurs, allowing the ABA signal transduction through a calcium-dependent manner. This is consistent with Nishimura et al. (\u003cspan citationid=\"CR97\" class=\"CitationRef\"\u003e2010\u003c/span\u003e), which demonstrated that the CAR proteins might facilitate ABA signaling through ABA binding to PYR/PYL receptors. Diaz et al. (2015) provided solid evidence to clarify that the transient calcium-dependent interactions of the ABA receptors with membranes are mediated through the CAR Protein family and positively regulate ABA signaling. Genetic evidence obtained with combined \u003cem\u003eCAR\u003c/em\u003e mutants supports that CAR proteins regulate the ABA responses. Similarly, \u003cem\u003eCAR\u003c/em\u003e-mutants in Arabidopsis showed a decreased sensitivity for inhibition of seedling establishment and root growth by ABA (Rodriguez et al. \u003cspan citationid=\"CR123\" class=\"CitationRef\"\u003e2014\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eProtein phosphatase 2C (PP2C) negatively regulates plants' ABA signal transduction pathway (Ma et al. \u003cspan citationid=\"CR81\" class=\"CitationRef\"\u003e2009\u003c/span\u003e). In the absence of ABA, PP2C inhibits the activity of SnRK2 proteins (positive regulator of ABA signaling), causing a downregulation and blocking of ABA signaling (Antoni et al. \u003cspan citationid=\"CR7\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Previous studies in tomato lines that are impaired in PP2C levels (SlPP2C1-RNAi; downregulating of the PP2C) had an acceleration in fruit ripening, which was associated with higher levels of ABA signaling (Zhang et al. \u003cspan citationid=\"CR172\" class=\"CitationRef\"\u003e2017\u003c/span\u003e), while plants overexpressing PP2C were less sensitive to ABA, and had a delay in fruit ripening (Liang et al. \u003cspan citationid=\"CR73\" class=\"CitationRef\"\u003e2021\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eIn general, cytokinin plays an essential role in plant development and cellular differentiation (Dong and Wang, \u003cspan citationid=\"CR25\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Cytokinin is involved in leaf formation, growth of apical meristem, cell division, embryonic growth and development, lateral root formation and fruit development (Jameson and Song \u003cspan citationid=\"CR44\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Schwarz et al. \u003cspan citationid=\"CR128\" class=\"CitationRef\"\u003e2020\u003c/span\u003e; Wu et al. \u003cspan citationid=\"CR159\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Liu et al. \u003cspan citationid=\"CR76\" class=\"CitationRef\"\u003e2021\u003c/span\u003e; Chen et al. \u003cspan citationid=\"CR17\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). Cytokinin biosynthesis in plants occurs in two steps (Chen \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Kurakawa et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Cytokinin riboside 59-monophosphates are converted to the corresponding nucleosides and nucleobases by nucleotidase and nucleosidase (Chen \u003cspan citationid=\"CR16\" class=\"CitationRef\"\u003e1997\u003c/span\u003e). The inactive cytokinin nucleotides are converted directly to the active free base forms (Kurakawa et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). This final step is controlled by the LONELY GUY gene (LOG: encodes a cytokinin riboside 5'-monophosphate phosphoribohydrolase). The LOG gene of rice is required to maintain meristem activity, and its loss of function causes premature termination of the shoot-meristem. Loss of function \u0026ldquo;the \u003cem\u003elog\u003c/em\u003e-mutant\u0026rdquo; in rice plants severely reduced the panicle size and abnormal branching patterns and decreased the number of floral organs, dramatically reducing seed yield (Kurakawa et al. \u003cspan citationid=\"CR59\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Kuroha et al. \u003cspan citationid=\"CR60\" class=\"CitationRef\"\u003e2009\u003c/span\u003e found that overexpression of the LOG gene in Arabidopsis caused a promotion in cell division in embryos and leaf vascular tissues, as well as causing a delay in leaf senescence. IAA-amino acid hydrolase enzymes are believed to convert auxin amino acid conjugates such as IAA-Ala and IAA-Leu into free active IAA (Schuller and Ludwig-Muller 2006). In peach, \u003cem\u003ePpILR1\u003c/em\u003e, which encodes an indole-3-acetic acid (IAA)-amino hydrolase, PpILR1 acts as a transcriptional activator of 1-amino cyclopropane-1-carboxylic acid synthase(\u003cem\u003ePpACS1\u003c/em\u003e), a precursor for ethylene production. It hydrolyses auxin substrates to release free auxin (Wang et al. \u003cspan citationid=\"CR154\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). In general, IAA is required for ethylene's active production and release. Therefore, low levels of IAA lead to suppressing PpACS1 expression and low ethylene production at the late ripening stage of stony hard peach. In contrast, high concentrations of IAA are required for ethylene biosynthesis, which results in rapid fruit softening (Pan et al. \u003cspan citationid=\"CR105\" class=\"CitationRef\"\u003e2015\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eCell wall remodeling involved in seed-shattering.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eCell wall remodeling is integral to seed shattering. Genes involved in cell wall modification play an important role in facilitating organ shedding. The PGs are enzymes that act in plant development processes such as tissue softening, organ abscission, fruit ripening and microspore release (Hadfield and Bennett \u003cspan citationid=\"CR41\" class=\"CitationRef\"\u003e1998\u003c/span\u003e; Palanivelu \u003cspan citationid=\"CR104\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Verlent et al. \u003cspan citationid=\"CR148\" class=\"CitationRef\"\u003e2005\u003c/span\u003en\u0026eacute;chal et al. 2014). The endo-polygalacturonase enzyme breaks down the pectin network in the cell wall by cleaving the glycosidic bond \u003cem\u003evia\u003c/em\u003e hydrolytic reactions (Palanivelu \u003cspan citationid=\"CR104\" class=\"CitationRef\"\u003e2006\u003c/span\u003e; Babu and Bayer \u003cspan citationid=\"CR8\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). In previous studies, Sander et al. (\u003cspan citationid=\"CR125\" class=\"CitationRef\"\u003e2001\u003c/span\u003e) found that the expression of the \u003cem\u003eendo\u003c/em\u003e-PG gene increased at later stages of silique development in Arabidopsis. The activity of ADPG1 and ADPG2 genes (endo-PGs) was essential for silique dehiscence in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e (Ferr\u0026aacute;ndiz 2002). Jaradat et al. (\u003cspan citationid=\"CR46\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) showed that the endo-PG was highly expressed in the dehiscence zone of shatter-sensitive \u003cem\u003eB. napus\u003c/em\u003e compared to the shatter-resistant \u003cem\u003eB. juncea\u003c/em\u003e. Similarly, the expression of PG in sweet cherries decreased in non-abscising fruits and increased in abscising fruits (Qiu et al. \u003cspan citationid=\"CR116\" class=\"CitationRef\"\u003e2021\u003c/span\u003e). Pectate lyase is believed to mediate pectin demethylation, facilitating the cell wall's middle lamella's degradation (Yang et al. \u003cspan citationid=\"CR163\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). PL gene expression has been reported in ripening fruits, including strawberries (Burraco et al. \u003cspan citationid=\"CR12\" class=\"CitationRef\"\u003e2003\u003c/span\u003e), bananas (Pua et al. \u003cspan citationid=\"CR113\" class=\"CitationRef\"\u003e2001\u003c/span\u003e), grapes (Nunan et al. \u003cspan citationid=\"CR98\" class=\"CitationRef\"\u003e2001\u003c/span\u003e) and mangoes (Deshpande et al. \u003cspan citationid=\"CR20\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Recent studies have suggested a central role for PL genes in tomato fruit softening and ripening, where tomato fruits impaired in their PL genes had a reduction in their PL mRNA expression, a reduced extractable PL enzyme activity and increased fruit firmness (Uliisik et al. 2016).\u003c/p\u003e \u003cp\u003ePectin-esterase (PE; EC 3.1.1.11) is an enzyme responsible for the demethylation of galactosyl residues in pectin-generating carboxyl groups and releasing free methanol in the cell wall (Phan et al. \u003cspan citationid=\"CR111\" class=\"CitationRef\"\u003e2007\u003c/span\u003e). Pectin-esterase is widely present in plants that possess a cell wall degradation function. In plants, PME exists as multigene families, and different PME genes exhibit different expression specificities. PME plays multiple roles in plants, including methanol accumulation, abscission, plant defense, pollen tube growth, and fruit ripening (Wen et al. \u003cspan citationid=\"CR157\" class=\"CitationRef\"\u003e2020\u003c/span\u003e). In strawberries, FaPE1 is expressed explicitly in fruit, and the expression level corresponds with fruit ripening (Castillejo et al. \u003cspan citationid=\"CR14\" class=\"CitationRef\"\u003e2004\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eEndo ꞵ-1,4 glucanase (Cellulase; EG; EC 3.2.1.4) belongs to the glycosyl hydrolase family 9 (GH9). The EG is an enzyme that hydrolyses the 1,4-glycosidic bond between two contiguous D-glucopyranose units. This bond is found in the structure of cellulose, causing cell wall degradation (Perrot et al. \u003cspan citationid=\"CR110\" class=\"CitationRef\"\u003e2022\u003c/span\u003e). As the primary fiber, cellulose provides strength and structural integrity to plant cells, which cellulase can hydrolyze to affect shattering directly. In many crops, cleavage of the abscission layers formed at seed bases leads to seed shattering. Moreover, abscission zone formation is related to the degradation of abscission layer cells by hydrolytic enzymes, including cellulase (Agrawal et al. \u003cspan citationid=\"CR2\" class=\"CitationRef\"\u003e2002\u003c/span\u003e). The FaEG1 gene, \u0026ldquo;a secreted GH9B β-1,4-glucanase,\u0026rdquo; is induced explicitly in strawberries upon ripening. It was suggested that FaEG1 might function in disassembling the cellulose\u0026ndash;hemicellulose fraction during the ripening of strawberry fruit (Jara et al. \u003cspan citationid=\"CR45\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eꞵ-glucosidases (bGlu) are essential to the cellulase system (cellulose metabolizing enzymes) and catalyze the last and final step in cellulose hydrolysis. Cellulase enzymes hydrolyze the cellulose to produce cellobiose and other short oligosaccharides, which are finally hydrolyzed to glucose by b-glucosidase (Singh et al. \u003cspan citationid=\"CR132\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Dong et al. (\u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e) previously reported that ꞵ-Glucosidases are essential in the breakdown of the cell wall and the degradation of the dehiscence zone. In strawberries, Zhang et al. (\u003cspan citationid=\"CR169\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) reported that the expression of the β- glucosidase one gene (FaBG1) increased significantly upon fruit color development \u0026ldquo;ripening\u0026rdquo;.\u003c/p\u003e \u003cp\u003eExpansins are cell wall proteins that consist of four subfamilies: a-expansin, b-expansin, expansin-like A, and expansin-like B. These proteins play essential roles in cell wall decomposition and disassembly during the ripening of fruits (Dong et al. \u003cspan citationid=\"CR24\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). In tomatoes, Expansin (SlEXP1) proteins cooperatively disassemble the polysaccharide network of tomato fruit cell walls during ripening, enabling the loosening of tight tissues and softening of fruit walls (Jiang et al. \u003cspan citationid=\"CR49\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Suppression of the ripening-related EXP-encoding gene slowed tomato fruit softening during ripening (Brummell et al. \u003cspan citationid=\"CR11\" class=\"CitationRef\"\u003e1999\u003c/span\u003e). In other fruits, such as strawberries and cantaloupe, expansin mRNAs are also expressed in the late stages of ripening, making expansin a constant feature of fruit softening (Civello et al. \u003cspan citationid=\"CR18\" class=\"CitationRef\"\u003e1999\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eArabinogalactan proteins (AGPs) are highly glycosylated members of the superfamily of hydroxyproline-rich glycoproteins (HRGPs) found in plants (Showalter \u003cspan citationid=\"CR135\" class=\"CitationRef\"\u003e2001\u003c/span\u003e). AGPs are critical in cell wall dissolution, abscission zone differentiation, organ detachment and fruit softening (Leszczuk et al. \u003cspan citationid=\"CR67\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). In tomatoes, the SlAGP mRNA was significantly up-regulated during fruit ripening following climacteric ethylene production (Fragkostefanakis et al. \u003cspan citationid=\"CR34\" class=\"CitationRef\"\u003e2012\u003c/span\u003e). Silencing of Prolyl 4 Hydroxylase 3 (SIP4H3) (an enzyme involved in AGP synthesis) leads to delay of abscission progression in overripe tomatoes, resulting in lower content of AGP (Perrakis et al. \u003cspan citationid=\"CR109\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Cellulose is one of the contents in the primary (14%) and secondary cell walls (40\u0026ndash;80%) (Gigli-Bisceglia et al. \u003cspan citationid=\"CR38\" class=\"CitationRef\"\u003e2019\u003c/span\u003e). Further studies on \u003cem\u003eStylosanthes\u003c/em\u003e (a genus of flowering plants in the legume family Fabaceae) accessions showed that cellulose synthase was expressed significantly higher in the shattering-resistance accessions vs. the SS-susceptible accession (Li et al. \u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2022\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e4-coumarate: CoA ligase contributes to lignin biosynthesis (Li et al. \u003cspan citationid=\"CR72\" class=\"CitationRef\"\u003e2015\u003c/span\u003e). Lignin is the second most abundant polymer after cellulose and is present in the secondary cell walls of all plants (Lavhale et al. \u003cspan citationid=\"CR64\" class=\"CitationRef\"\u003e2018\u003c/span\u003e; Naik et al. \u003cspan citationid=\"CR93\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In a previous study, the results from the 4CL transgenic experiments suggest that the downregulation of 4CL leads to a reduction in lignin content in tobacco and Arabidopsis (Kajita et al. \u003cspan citationid=\"CR51\" class=\"CitationRef\"\u003e1997\u003c/span\u003e; Lee et al. \u003cspan citationid=\"CR65\" class=\"CitationRef\"\u003e1997\u003c/span\u003e). Yoon et al. (\u003cspan citationid=\"CR165\" class=\"CitationRef\"\u003e2014\u003c/span\u003e) reported that overexpression of SH5 (gene control of abscission zone development) in a non-shattering rice cultivar led to increasing seed shattering by enhancing abscission zone development and decreased the level of lignin in the basal region of spikelet. The expression level of several genes involved in the lignin biosynthesis pathway was also decreased in plants with overexpression of SH5.\u003c/p\u003e \u003c/div\u003e \u003cdiv id=\"Sec10\" class=\"Section2\"\u003e \u003ch2\u003eOther genes related to capsule maturation\u003c/h2\u003e \u003cp\u003eDicarboxylate transporter (DT) is a transporter gene. Malate accumulation increased during fruit ripening in tomatoes and strawberries (Centeno et al. \u003cspan citationid=\"CR15\" class=\"CitationRef\"\u003e2011\u003c/span\u003e; Hu et al. \u003cspan citationid=\"CR43\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). In tomatoes, a putative tonoplast dicarboxylate transporter gene (SlTDT) was cloned and was used to produce lines overexpressing the gene and others expressing an RNAi vector of the gene. Tomato plants overexpressing the TDT gene had high malate levels and low citrate content in their fruit, while the RNAi lines had low malate levels and higher citrate levels (Liu et al. \u003cspan citationid=\"CR79\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). Higher malate levels are believed to be associated with accelerated fruit ripening (Etienne et al. \u003cspan citationid=\"CR31\" class=\"CitationRef\"\u003e2013\u003c/span\u003e).\u003c/p\u003e \u003cp\u003eThe Isoamylase (ISA3) gene type of starch-debranching enzyme (DBE) is used for starch degradation (Wattebled et al. \u003cspan citationid=\"CR156\" class=\"CitationRef\"\u003e2005\u003c/span\u003e). During fruit development in bananas, the starch that accumulates in the fruits (makes up to 20\u0026ndash;25% of total fruit dry weight) is usually converted by isoamylase 3 (EC 3.2.1.68) to give different forms of simple sugars \u003cem\u003evia\u003c/em\u003e debranching the starch (Bierhals et al. \u003cspan citationid=\"CR9\" class=\"CitationRef\"\u003e2004\u003c/span\u003e). In bananas, ISA is expressed when starch is degraded during fruit ripening (Xiao et al. \u003cspan citationid=\"CR160\" class=\"CitationRef\"\u003e2018\u003c/span\u003e). Interestingly, it has been reported that drought induces pod shattering in beans (\u003cem\u003ePhaseolus vulgaris\u003c/em\u003e L.). The water-stress treatment induced a higher starch accumulation in the drought-resistant cultivar pods \u0026ldquo;Pinto Villa\u0026rdquo; than in those of the drought-sensitive cultivar \u0026ldquo;Canario 60\u0026rdquo; (Ortiz et al. \u003cspan citationid=\"CR103\" class=\"CitationRef\"\u003e2008\u003c/span\u003e).\u003c/p\u003e \u003cp\u003e \u003cb\u003eTranscription factors regulate seed-shattering.\u003c/b\u003e \u003c/p\u003e \u003cp\u003eIn a previous study in soybeans, 18 different families of TFs, including homeobox, MYB, Zinc finger, bHLH, AP2, NAC, WRKY, YABBY (YAB) and ERF, were identified as part of the complex regulation of organ separation (Kim et al. \u003cspan citationid=\"CR55\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). In previous studies, the MADS-box was found to regulate the dehiscence zone development during pod-shattering of Arabidopsis (Ferr\u0026aacute;ndiz 2002). Silencing of \u003cem\u003ethe FaMADS9 gene in strawberries leads to the\u003c/em\u003e inhibition of fruit ripening (Seymour et al., \u003cspan citationid=\"CR131\" class=\"CitationRef\"\u003e2011\u003c/span\u003e). Furthermore, Liu et al. (\u003cspan citationid=\"CR78\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) reported high levels of \u003cem\u003eMuMADS\u003c/em\u003e transcripts at later stages of fruit ripening in bananas. In the bZIP gene, Lovisetto et al. (\u003cspan citationid=\"CR80\" class=\"CitationRef\"\u003e2013\u003c/span\u003e) showed that bZIP was highly expressed in peaches during ripening. In a previous study, bZIP was found to be involved in ABA signaling in grape berries (bZIP binds the AREP/ABF responsive element and causes activation of ABA signaling), ABF transcript accumulated in fruit during ripening, and ABA was upregulated (Nicolas et al. \u003cspan citationid=\"CR96\" class=\"CitationRef\"\u003e2014\u003c/span\u003e). The DNA binding with one finger (dof) plays a vital role in biological processes such as plant growth, seed germination, fruit ripening and organ abscission (Zou and Sun \u003cspan citationid=\"CR174\" class=\"CitationRef\"\u003e2023\u003c/span\u003e). In previous studies, ethylene accelerates organ abscission in Arabidopsis by regulating the expression of \u003cem\u003eAt\u003c/em\u003eDOF4.7 (Wang et al. \u003cspan citationid=\"CR150\" class=\"CitationRef\"\u003e2016\u003c/span\u003e). Li et al. (\u003cspan citationid=\"CR71\" class=\"CitationRef\"\u003e2022\u003c/span\u003e) reported that, in \u003cem\u003eAreca catechu L.\u003c/em\u003e, six AcDOF genes showed high expression levels in the abscission zone. The \u003cem\u003eFaDof2\u003c/em\u003e gene was expressed at high levels during fruit ripening in strawberries (Molina-Hidalgo et al. \u003cspan citationid=\"CR90\" class=\"CitationRef\"\u003e2017\u003c/span\u003e). The high expression of DzDOF2.2 in durian increased the level of ethylene biosynthesis through the transcriptional activation of the ACC synthase gene and promoted early fruit ripening (Khaksar et al. \u003cspan citationid=\"CR54\" class=\"CitationRef\"\u003e2019\u003c/span\u003e).\u003c/p\u003e \u003c/div\u003e"},{"header":"Conclusion","content":"\u003cp\u003eIn the present work, we generated transgenic sesame plants expressing the pFGC5941-PG vector carrying the RNAi version of the sesame endo polygalacturonase gene. The endopolygalacturonase gene was previously identified in our laboratory. The non-tissue culture-based transformation technique was developed for sesame to minimize/eliminate somaclonal variation in the resulting transgenics. Successful transformation into T\u003csub\u003e0\u003c/sub\u003e and T\u003csub\u003e1\u003c/sub\u003e progeny was confirmed \u003cem\u003evia\u003c/em\u003e PCR, leaf painting, and Basta spraying fully matured plants. RT-PCR and qRT-PCR were performed to confirm the successful incorporation and transfer of the transgene into the next generations. T\u003csub\u003e1\u003c/sub\u003e progeny was used to perform RNA-transcriptome analysis using the false-septs tissues excised from sesame capsules at four developmental stages. Analysis of the transcriptome data between false septa tissues excised from transgenic vs. non-transgenic controls indicated the presence of a total of 24,468 unigenes in total, which were classified into 21 functional categories (5988 MF, 5349 BP, and 13131 CC). In our selected comparison, 514 DEGs were recognized, with 349 up-regulated and 165 down-regulated. Transcriptome analysis of endo-PG expression patterns across the four developmental stages (transgenic vs. non-transgenic control sesame tissues) revealed a silencing of 99, 96, 98, and 91%, respectively, across the four developmental stages (the results were confirmed using realTime-PCR). Furthermore, transcriptome analysis revealed that silencing of endo-PG in transgenic sesame plants caused a universal change in gene expression in the false-septa tissue. Nineteen differentially expressed genes were further tested in detail to shed more light on their role in seed shattering in sesame. The 19 individual DEGs were classified into four categories related to seed shattering: 1) plant hormones, 2) cell wall remodeling, 3) transcription factors, and 4) the capsule maturation process. The expression pattern of these genes illustrates the differences between control and transgenic false septa tissues across the four developmental stages. The present work clearly shows how changing the expression of a single gene, \u0026ldquo;PG,\u0026rdquo; ultimately changes the expression of the gene network involved in seed shattering. Downregulating PG expression in sesame plants had a noticeable effect on other major players \u0026ldquo;cell-wall remodeling enzymes, hormonal balance within the false septa tissues, and changes in significant players in transcription factors that are known to play a critical role in capsules/fruits ripening\u0026rdquo;; this is represented by (Fig.\u0026nbsp;\u003cspan refid=\"Fig10\" class=\"InternalRef\"\u003e10\u003c/span\u003e) which summarizes the complexity of seed shattering in sesame upon downregulating a single gene at a time.\u003c/p\u003e \u003cp\u003e \u003c/p\u003e \u003cp\u003eThe transgenic sesame plants showed a delay in leaf senescence and, most importantly, a delay in capsule shattering, which could be attributed to using the 35CaMV constitutive promoter. Our success in developing the non-tissue culture-based technique for transformation in sesame enables the present work to be achieved without the worry that some of the results might be mutation artefacts during the tissue culture procedure. The current work represents the first attempt at understanding how changing the expression of a single gene involved in fruit ripening could alter the global expression of genes within a single tissue layer in the capsule. The present work indicates the complexity of the different players involved in seed-shattering phenomena. We have proved that changing the expression of a single gene in sesame was enough to delay the seed-shattering phenomena, yet further work using capsule-specific promoters and more candidate genes \u0026ldquo;as a target for silencing\u0026rdquo; might be needed to understand the exact role of each gene.\u003c/p\u003e"},{"header":"Declarations","content":"\u003cp\u003e \u003ch2\u003eEthical Statement\u003c/h2\u003e \u003cp\u003eAll experiments and results in this manuscript were meticulously produced and analyzed using scientifically based methods and techniques. We assure you that no animal tests or products were used during this study, adhering to the highest ethical standards of scientific research.\u003c/p\u003e \u003cp\u003eThe manuscript has only been submitted to your journal and has not been published before in any publication (media, seminars, prints\u0026hellip; etc.).\u003c/p\u003e \u003c/p\u003e\u003cp\u003e \u003ch2\u003eConflict of Interest Statement\u003c/h2\u003e \u003cp\u003eThe Authors of the current manuscript reiterate that there is no conflict of interest with anyone concerning the present manuscript or the published data. We are committed to presenting our findings in an unbiased and transparent manner.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003e \u003cb\u003eAuthor contribution statement\u003c/b\u003e:\u003c/h2\u003e \u003cp\u003e \u003cstrong\u003eEsraa A. A. Sultan\u003c/strong\u003e \u003cp\u003eIn charge of constructing, generating, and testing transgenic plants. Drafting manuscript and figures, as well as repeating some of the transcriptome analysis.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eMariam Oweda and Mohamed \u0026ndash; El-Hadidi\u003c/strong\u003e \u003cp\u003eTheir main duties was analysis of the transcriptome raw data.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eNagwa I. Elarabi and Abdelhadi A. Abdelhadi\u003c/strong\u003e \u003cp\u003eSupervising the thesis at Faculty of Agriculture, Cairo University, (review and editing).\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eNaglaa A. Abdallah\u003c/strong\u003e \u003cp\u003eShe donated the pFGC5941construct that used in this research paper.\u003c/p\u003e \u003c/p\u003e \u003cp\u003e \u003cstrong\u003eMohamed S. Tawfik\u003c/strong\u003e \u003cp\u003eThe main supervisor, where the entire work was conducted in his lab \u0026ldquo;Oil Crops Biotechnology Lab, OCBL\u0026rdquo;. This research paper was funded by an STDF project that was supervised by Mohamed S. Tawfik. Drafting the manuscript and figures, conceptualization, funding acquisition, validation, and editing.\u003c/p\u003e \u003c/p\u003e\u003ch2\u003eFunding\u003c/h2\u003e \u003cp\u003eThe work was partially funded through the Science and Technology Developmental Fund (STDF), Grant # 28934.\u003c/p\u003e"},{"header":"References","content":"\u003col\u003e\n\u003cli\u003eAalen, R. B., Wildhagen, M., St\u0026oslash;, I. M. and Butenko, M. A. (2013). IDA: a peptide ligand regulating cell separation processes in Arabidopsis. J Exp Bot 17: 5253-5261.\u003c/li\u003e\n\u003cli\u003eAgrawal, A. P., Basarkar, P. W., Salimath, P. M. and Patil, S. A. (2002). Role of cell wall-degrading enzymes in pod-shattering process of soybean, \u003cem\u003eGlycine max \u003c/em\u003e(L.) Merrill. Cur Sci 82: 58-61.\u003c/li\u003e\n\u003cli\u003eAl-Shafeay, A. F., Ibrahim, A. S., Nesiem, M. R., Tawfik, M. S. (2011). Establishment of regeneration and transformation system in Egyptian sesame (\u003cem\u003eSesamum Indicum \u003c/em\u003eL.) Cv. Sohag 1. GMOs 2: 182-192.\u003c/li\u003e\n\u003cli\u003eAl-Shafeay, A. F., Ibrahim, A. S., Nesiem, M. R., Tawfik, M. S. (2018). Dehydration stress tolerance in sesame plants (\u003cem\u003eSesamum Indicum \u003c/em\u003eL.) overexpressing the Arabidopsis thaliana molybdenum cofactor sulfurase LOS5/aba3 gene under greenhouse conditions. Biosci. Res 15: 3131-3143. \u003c/li\u003e\n\u003cli\u003eAn, C., Sawada, A., Fukusaki, E. I. and Kobayashi, A. (2003). A transient RNA interference assay system using \u003cem\u003eArabidopsis\u003c/em\u003e protoplasts\u003cem\u003e. \u003c/em\u003eBiosci Biotech Biochem 67: 2674-2677.\u003c/li\u003e\n\u003cli\u003eAnilakumar, K. R., Pal, A., Khanum, F. and Bawa, A. S. (2010). Nutritional, medicinal, and industrial uses of sesame (\u003cem\u003eSesamum Indicum \u003c/em\u003eL.) seeds. Agri Conspec Sci 75: 159\u0026ndash;168.\u003c/li\u003e\n\u003cli\u003eAntoni, R., Gonzalez-Guzman, M., Rodriguez, L., Rodrigues, A., Pizzio, G. A. and Rodriguez, P. L. (2012). Selective clade A phosphatase type 2C inhibition by PYR/PYL/RCAR abscisic acid receptors. Plant Physiol 158: 970-980.\u003c/li\u003e\n\u003cli\u003eBabu, Y. and Bayer, M. (2014). Plant polygalacturonases involved in cell elongation and separation are the same but different. Plants 3: 613\u0026ndash;623.\u003c/li\u003e\n\u003cli\u003eBierhals, J. D., Lajolo, F. M., Cordenunsi, B. R. and Nascimento, J. R. O. (2004). Activity, cloning, and expression of an isoamylase-type starch-debranching enzyme from banana fruit. J Agri Food Chem 52: 7412-7418.\u003c/li\u003e\n\u003cli\u003eBishopp, A., Benkova, E. and HelariuttA, Y. (2011). Sending mixed messages: auxin-cytokinin crosstalk in roots. Cur Open Plant Bio 14: 10-16.\u003c/li\u003e\n\u003cli\u003eBrummell, D. A., Harpster, M. H., Civello, P. M., Palys, J. M., Bennett, A. B. and Dunsmuir, P. (1999). Modification of expansin protein abundance in tomato fruit alters softening and cell wall polymer metabolism during ripening. Plant Cell 11: 2203\u0026ndash;2216.\u003c/li\u003e\n\u003cli\u003eBurraco, A. B., Portales, R. B., Nevado, J. R., Bellido, M. L., Moyano, E., Caballero, J. L. and Blanco, J. M. (2003). Cloning and characterization of two ripening-related strawberry (FragariaHananassa cv. Chandler) pectate lyase genes. J Exp Bot 54: 633-645.\u003c/li\u003e\n\u003cli\u003eCarranza, Z. H., Whitelaw, C. A., Swarup, R. and Roberts, J. A. (2002). Temporal and spatial expression of a polygalacturonase during leaf and flower abscission in oilseed rape and Arabidopsis. Plant Physiol 128: 534-543. \u003c/li\u003e\n\u003cli\u003eCastillejo, C., Fuente, J. I., Iannetta, P., Botella, M. A. and Valpuesta, V. (2004). Pectin esterase gene family in strawberry fruit: a study of FaPE1, a ripening-specific isoform. J Exp Bot 55: 909-918.\u003c/li\u003e\n\u003cli\u003eCenteno, D. C., Osorio, S., Nesi, A. N., Bertolo, A. L. F., Carneiro, R. T., Araujo, W. L., Steinhauser, M. C., Michalska, J., Rohrmann, J., Geigenberger, P., Oliver, S. N., Stitt, M., Carrari, F., Rose, J. K. C. and Ferniea, A. R. (2011). Malate plays a crucial role in starch metabolism, ripening, and soluble solid content of tomato fruit and affects postharvest softening. Plant Cell 23: 162-184.\u003c/li\u003e\n\u003cli\u003eChen, C. M. (1997). Cytokinin biosynthesis and interconverion. Physiol. Plant 101: 665-673.\u003c/li\u003e\n\u003cli\u003eChen, L., Jameson, G. B., Guo, Y., Song, J. and Jameson, P. E. (2022). The LONELY GUY gene family: from mosses to wheat, the key to the formation of active cytokinin in plants. Plant Biotechnol. J 20: 625-645.\u003c/li\u003e\n\u003cli\u003eCivello, P. M., Powell, A. L. T., Sabehat, A. and Bennett, A. B. (1999). An expansin gene is expressed in ripening strawberry Fruit. Plant Physio 121: 1273\u0026ndash;1279.\u003c/li\u003e\n\u003cli\u003eDay, J. S. (2000). Anatomy of capsule dehiscence in sesame varieties. J Agri Sci 134: 45-53.\u003c/li\u003e\n\u003cli\u003eDeshpande, A.B., Anamika, K., Jha, V., Chidley, H. G., Oak, P. S., Kadoo, N. Y., Pujari, K. H., Giri, A.P. and Gupta, V. S. (2017). Transcriptional transitions in Alphonso mango (\u003cem\u003eMangifera indica\u003c/em\u003e L.) during fruit development and ripening explain its distinct aroma and shelf-life characteristics. Sci Rep 7: 8711-8730.\u003c/li\u003e\n\u003cli\u003eDiaza,M., Barrenaa, M. J.S., Rubioa, J. M. R., Rodriguezb, L., Fernandezc, D., Antonib, R., Yuntaa, C., Palazonb, B. B., Guzmanb, M. G., Llobetb, M. P., Menendeza, M., Boskovicd, J., Marquezc, J. A., Rodriguezb, P. L., and Alberta, A. (2015). Calcium-dependent oligomerization of CAR proteins at cell membrane modulates ABA signaling, PNAS 113: 396-405.\u003c/li\u003e\n\u003cli\u003eDobin, A., Carrie A. Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., Jha, S., Batut, P., Mark Chaisson, M. and Gingeras, T. R. (2013). STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29: 15-21.\u003c/li\u003e\n\u003cli\u003eDoebley, J. (2006). Unfallen grains: How ancient farmers turned weeds into crops. Science 312: 1318\u0026ndash;1319.\u003c/li\u003e\n\u003cli\u003eDong, R., Dong, D., Luo, D., Zhou, Q., Chai, X., Zhang, J., Xie, W., Liu, W., Dong, Y., Wang, Y. and Liu, Z. (2017). Transcriptome analyses reveal candidate pod-shattering-associated genes involved in the pod ventral sutures of common vetch (\u003cem\u003eVicia sativa\u003c/em\u003e L.). Front Plant Sci 8: 649-663.\u003c/li\u003e\n\u003cli\u003eDong, Y. and Wang, Y. Z. (2015). Seed shattering: from models to crops. Front Plant Sci 6: 476-489. \u003c/li\u003e\n\u003cli\u003eDossa, K., Li, D., Wang, L., Zheng, X., Liu, A., Yu, J., Wei, X., Zhou, R., Fonceka, D., Diouf, D., Liao, B., Ndiaga Ciss\u0026eacute;, N. and Zhang, X. (2017). Transcriptomic, biochemical, and physio-anatomical investigations shed more light on responses to drought stress in two contrasting sesame genotypes. Scient Rep 7: 8755-8769. \u003c/li\u003e\n\u003cli\u003eDossa, K., Mmadi, M. A., Zhou, R., Zhang, T., Su, R., Zhang, Y., Wang, L., You, J. and Zhang, X. (2019). Depicting the core transcriptome modulating multiple abiotic stresses responses in Sesame (\u003cem\u003eSesamum indicum\u003c/em\u003e L.). Inter J Mol Sci 20: 3930-3950. \u003c/li\u003e\n\u003cli\u003eEccher, G., Botton, A., Dimauro, M., Boschetti, A., Benedetto Ruperti, B. and Ramin, A. (2013). Early induction of apple fruitlet abscission is characterized by an increase in both isoprene emission and abscisic acid content. Plant Physio 161: 1952-1969. \u003c/li\u003e\n\u003cli\u003eEscobar, M. A., Civerolo, E. L., Summerfelt, K. R. and Dandekar, A. M. (2001). RNAi-mediated oncogene silencing confers resistance to crown gall tumorigenesis. PNAS 98: 13437-1342. \u003c/li\u003e\n\u003cli\u003eEstornell, L. H., Agusti, J., Merelo, P., Talon, M. and Tadeo, F. R. (2013). Elucidating mechanisms underlying organ abscission. Plant Sci 199: 48-60. \u003c/li\u003e\n\u003cli\u003eEtienne, A., G\u0026eacute;nard, M., Lobit, P., Mb\u0026eacute;gui\u0026eacute;, M. A. and Bugaud, C. (2013). What controls fleshy fruit acidity? A review of malate and citrate accumulation in fruit cells. J. Exp. Bot. 64: 1451-1469.\u003c/li\u003e\n\u003cli\u003eFabi, J. P., Broetto, S. G., Silva, S. L. G. L., Zhang, S., Lajolo, F. M. and Nascimento, J. R. O. (2014). Analysis of papaya cell-wall-related genes during fruit ripening indicates a central role of polygalacturonase during pulp softening. PLOS 9: 105685-105697.\u003c/li\u003e\n\u003cli\u003eFerrandiz, C. (2002). Regulation of fruit dehiscence in Arabidopsis. J. Agric. Sci 53: 2031-2038.\u003c/li\u003e\n\u003cli\u003eFragkostefanakis, S., Dandachi, F. and Panagiotis Kalaitzis, P. (2012). Expression of arabinogalactan proteins during tomato fruit ripening and in response to mechanical wounding, hypoxia, and anoxia. Plant Physio Biotech 52: 112-118. \u003c/li\u003e\n\u003cli\u003eFritz, J. H., Girardin, S. E. and Philpott, D. J. (2006). Innate immune defense through RNA interference. Sci Signal 339: 1-4. \u003c/li\u003e\n\u003cli\u003eFuller, D. Q. and Allaby, R. (2009). Seed dispersal and crop domestication: shattering, germination, and seasonality in evolution under cultivation. Ann Plant Rev 38: 238\u0026ndash;295. \u003c/li\u003e\n\u003cli\u003eGamborg, O. L., Miller, R. A. and Ojimal, K. (1968). Nutrient requirements of suspension cultures of soybean root cells. Exp Cell Res 50: 151-158.\u003c/li\u003e\n\u003cli\u003eGigli-Bisceglia, N., Engelsdorf, T. and Hamann, T. (2019). Plant cell wall integrity maintenance in model plants and crops species-relevant cell wall components and underlying guiding principles. CMLS 77: 2049-2077. \u003c/li\u003e\n\u003cli\u003eGirin, T., Stephenson, P., Goldsack, C. M. P., Kempin, S. A., Perez, A., Pires, N., Sparrow, P. A., Wood, T. A., Yanofsky, M. F.and \u0026Oslash;stergaard, L. (2010). Brassicaceae \u003cem\u003eINDEHISCENT\u003c/em\u003e genes specify valve margin cell fate and repress replum formation. Plant J 63: 329\u0026ndash;338. \u003c/li\u003e\n\u003cli\u003eGupta, A., Pal, R. K. and Rajam, M. V. (2013). Delayed ripening and improved fruit processing quality in tomato by RNAi-mediated silencing of three homologs of 1-aminopropane-1- carboxylate synthase gene. J Plant Physio 170: 987\u0026ndash;995. \u003c/li\u003e\n\u003cli\u003eHadfield, K. A. and Bennett, A. B. (1998). Polygalacturonases: many genes in search of a function. Plant Physio 117: 337-343. \u003c/li\u003e\n\u003cli\u003eHirai, S. and Kodama, H. (2008). RNAi vectors for manipulation of gene expression in higher plants. Plant Sci J 2: 21-30.\u003c/li\u003e\n\u003cli\u003eHu, P., Li, G., Xia, X., Zhao, F., Li, L. and Zhou, H. (2018). Transcriptome profiling by RNA-Seq reveals differentially expressed genes related to fruit development and ripening characteristics in strawberries (\u003cem\u003eFragaria ananassa\u003c/em\u003e). Peer J 33: 4976-4995.\u003c/li\u003e\n\u003cli\u003eJameson, P. E. and Song, J. (2020). Will cytokinin underpin the second \u0026lsquo; Green Revolution\u0026apos;? J. Exp. Bot. 71: 6872-6875.\u003c/li\u003e\n\u003cli\u003eJara, K., Castro, R. I., Ramos, P., Palma, C. P., Riffo, F. V., and Quintana, L. M. (2019). Molecular insights into FaEG1, a strawberry endoglucanase enzyme expressed during strawberry fruit ripening. Plants 8: 140-153.\u003c/li\u003e\n\u003cli\u003eJaradat, M. R., Ruegger, M., Bowling, A., Butler, H. and Cutler, A. J. (2014). A comprehensive transcriptome analysis of silique development and dehiscence in Arabidopsis and Brassica integrating genotypic, interspecies, and developmental comparisons. GM Crops Food 5: 302\u0026ndash;320.\u003c/li\u003e\n\u003cli\u003eJelinski, D. E. (1990). On the use of chi-square analysis in studies of resource utilization. Can J For Res 21: 58-65.\u003c/li\u003e\n\u003cli\u003eJiang, C. J. Shimono, M., Maeda, S., Inoue, H., Mori, M., Hasegawa, M., Sugan, S. and Takatsuji, H. (2009). Suppression of the rice fatty-acid desaturase gene \u003cem\u003eOsSSI2\u003c/em\u003e enhances resistance to blast and leaf blight diseases in rice. Mol Plant Microbe Inter 22: 820-829.\u003c/li\u003e\n\u003cli\u003eJiang, F., Lopez, A., Jeon, S., Freitas, S. T., Yu, Q., Zhen Wu, Z., Labavitch, J. M., Shengke Tian, S., Powell, A. L. T. and Mitcham, E. (2019). Disassembly of the fruit cell wall by the ripening associated polygalacturonase and expansin influences tomato cracking. Hort Res 6: 1-15.\u003c/li\u003e\n\u003cli\u003eJin, X., Zimmermann, J., Polle, A. and Fischer, U. (2015). Auxin is a long-range signal that acts independently of ethylene signaling on leaf abscission in \u003cem\u003ePopulus\u003c/em\u003e. Front Plant Sci 6: 634-644.\u003c/li\u003e\n\u003cli\u003eKajita, S., Hishiyama, S., Tomimura, Y., Katayama, Y., and Omori, S. (1997). Structural Characterization of Modified Lignin in Transgenic Tobacco Plants in Which the Activity of 4-Coumarate: Coenzyme A Ligase 1s Depressed. Plant Physiol. 114: 871-879.\u003c/li\u003e\n\u003cli\u003eKang, L., Wang, Y. S., Uppalapati, S. R., Wang, K., Tang, Y., Vadapalli, V., Venables, B. J., Chapman, K. D., Blancaflor, E. B. and Mysore, K. S. (2008). Overexpression of a fatty acid amide hydrolase compromises innate immunity in \u003cem\u003eArabidopsis\u003c/em\u003e. Plant J 56: 336\u0026ndash;349.\u003c/li\u003e\n\u003cli\u003eKarlova, R., Haarst, J. C., Maliepaard, C., Geest, H., Bovy, A. G., Lammers, M., Angenent, G. C.and Maagd, R. A. (2013). Identification of micro-RNA targets in tomato fruit development using high-throughput sequencing and degradome analysis. J Exp Bot 64: 1863-1878.\u003c/li\u003e\n\u003cli\u003eKhaksar, G., Sangchay, W., Pinsorn, P., Sangpong, L. and Sirikantaramas, S. (2019). Genome-wide analysis of the \u003cem\u003eDof \u003c/em\u003egene family in durian reveals fruitripening-associated and cultivar-dependentDof transcription factors. Sci. Rep. 9: 1-13.\u003c/li\u003e\n\u003cli\u003eKim, J., Yang, J., Yang, R., Sicher, R. C., Chang, C. and Tucker, M. L. (2016). Transcriptome analysis of soybean leaf abscission identifies transcriptional regulators of organ polarity and cell fate. Front Plant Sci 7: 125-141.\u003c/li\u003e\n\u003cli\u003eKim, K. S., Park, S. H. and Jenks, M. A. (2007). Changes in leaf cuticular waxes of sesame (\u003cem\u003eSesamum indicum \u003c/em\u003eL.) plants exposed to water deficit. Sci Dir 164: 1134-1143.\u003c/li\u003e\n\u003cli\u003eKim, T. H., B\u0026ouml;hmer, M., Hu, H., Nishimura, N. and Schroeder, J. I. (2010). Guard cell signal transduction network: Advances in understanding abscisic Acid, CO2, and Ca2+ Signaling. Ann Rev Plant Bio 2: 561-591.\u003c/li\u003e\n\u003cli\u003eKourmpetli, S. and Drea, S. (2014). The fruit, the whole fruit, and everything about the fruit. J Exp Bot 65: 4491\u0026ndash;4503.\u003c/li\u003e\n\u003cli\u003eKurakawa, T., Ueda, N., Maekawa, M., Kobayashi, K., Kojima, M., Nagato, Y., Sakakibara, H. and Kyozuka, J. (2007). Direct control of shoot meristem activity by a cytokinin-activating enzyme.Nature 455: 652-655.\u003c/li\u003e\n\u003cli\u003eKuroha, T., Tokunaga, H., Kojima, M., Ueda, N., Ishida, T., Nagawa, S., Fukuda, H., Sugimoto, K. and Sakakibaraa, H. (2009). Functional analyses of LONELY GUY cytokinin-activating enzymes reveal the importance of the direct activation pathway in Arabidopsis. Plant Cell 21: 3152-3169.\u003c/li\u003e\n\u003cli\u003eLakhanpaul, S., Singh, V., Bhardwaj, D. and Bhat, K. V. (2012). Sesame: Overcoming the abiotic stresses in the queen of oilseed crops. Improv Crop Resist Abiotic Stress 2: 1251\u0026ndash;1283.\u003c/li\u003e\n\u003cli\u003eLang, H., He, Y., Li, F., Ma, D. and Sun, J. (2021). Integrative hormone and transcriptome analysis underline the role of abscisic acid in seed shattering of weedy rice. Plant Growth Regul 94: 261-273. \u003c/li\u003e\n\u003cli\u003eLangham, D. R and Wiemers, T. (2002). Progress in mechanizing sesame in the US through breeding. Trends New Crops New Use 17: 157-173.\u003c/li\u003e\n\u003cli\u003eLavhale, S. G., Kalunke, R. M. and Giri, A. P. (2018). Structural, functional and evolutionary diversity of 4‑coumarate‑CoA ligase in plants. Planta. 248: 1063-1078.\u003c/li\u003e\n\u003cli\u003eLee, D., Meyer, K., Chapple, C. and Douglasa, C. J. (1997). Antisense Suppression of 4 Coumarate: Coenzyme A Ligase Activity in Arabidopsis Leads to Altered Lignin Subunit Composition. Plant Cell. 9: 1985-1998.\u003c/li\u003e\n\u003cli\u003eLengyel, S., Gove, A. D., Latimer, A. M., Majer, J. D. and Dunn, R. R.(2010). Perspectives in plant ecology, evolution, and systematics convergent evolution of seed dispersal by ants, and phylogeny and biogeography in flowering plants: a global survey. Sci Direct 12: 43-55.\u003c/li\u003e\n\u003cli\u003eLeszczuk, A., Chylińska, M. and Zdunek, A. (2019). Enzymes and vitamin C are factors influencing the presence of arabinogalactan proteins (AGPs) in Solanum lycopersicum fruit. Plant Physiol Biochem. 139: 681-690. \u003c/li\u003e\n\u003cli\u003eLewis, M. W., Leslie, M. E. and Liljegren, S. J. (2006). Plant separation: 50 ways to leave your mother. Sci Direct 9: 59-65.\u003c/li\u003e\n\u003cli\u003eLi, C., Xin, M., Li, L., He, X., Liu, G., Li, J., Sheng, J. and Sun, J. (2020). Transcriptome profiling helps to elucidate the mechanisms of ripening and epidermal senescence in passion fruit (\u003cem\u003ePassiflora edulia\u003c/em\u003e Sims). PLoS One 15: 236535-236553. \u003c/li\u003e\n\u003cli\u003eLi, J., Jia, X., Yang, Y., Chen, Y., Wang, L., Liu, L. and Li, M. (2022). Genome-wide identification of the DOF gene family involved in fruitlet abscission in \u003cem\u003eAreca catechu\u003c/em\u003e L. Inter J Mol Sci 23: 11768\u0026ndash;11788.\u003c/li\u003e\n\u003cli\u003eLi, X., Zhang, J., Zhang, J., Sheng, W., Huang, R., Dong, R., Ding, X., Liu, P. and Liu, G. (2022). Histological characteristics, cell wall hydrolytic enzyme activity, and transcriptome analysis with seed shattering of \u003cem\u003eStylosanthes\u003c/em\u003e accessions. Front Plant Sci 13: 1018404-1018417.\u003c/li\u003e\n\u003cli\u003eLi, Y., Kim, J. I., Pysh, L. and Clint Chapple, C. (2015). Four isoforms of Arabidopsis 4-Coumarate: CoA Ligase have overlapping yet distinct roles in phenylpropanoid metabolism. Plant Physio 169: 2409\u0026ndash;2421.\u003c/li\u003e\n\u003cli\u003eLiang, B., Sun, Y., Wang, J., Zheng, Y., Zhang, W., Xu, Y., Li, Q. and Leng, P. (2021). Tomato protein phosphatase 2C influences the onset of fruit ripening and fruit glossiness. J Exp Botany 72: 2403-2418.\u003c/li\u003e\n\u003cli\u003eLiljegren, S. J., Roeder, A. H. K., Kempin, S. A., Gremski, K., \u0026Oslash;stergaard, L., Guimil, S., Reyes, D. K. and Yanofsky, M. F. (2004). Control of fruit patterning in Arabidopsis by \u003cem\u003eINDEHISCENT\u003c/em\u003e. Cell 116: 843-853.\u003c/li\u003e\n\u003cli\u003eLiljergren, S. J., Ditta, G. S., Eshed, Y., Savidge, B., Bowman, J. L. and Yanofsky, M. F.(2000). \u003cem\u003eSHATTERPROOF \u003c/em\u003eMADS-box genes control seed dispersal in Arabidopsis. Nature 404: 766-770.\u003c/li\u003e\n\u003cli\u003eLiu, D., Zho, H., Xiao, Y., Zhang, G., Cao, S., Yin, W., Qian, Y., Yin, Y., Zhang, J., Chen, S., Chu, C. and Tong, H. (2021). A cryptic inhibitor of cytokinin phosphorelay controls rice grain size. Mol Plant 15: 293-307. \u003c/li\u003e\n\u003cli\u003eLiu, H., Tan, M., Yu, H., Li, L., Zhou, F., Yang, M., Zhou, T. \u0026amp; Zhao, Y. (2016). Comparative transcriptome profiling of the fertile and sterile flower buds of a dominant genic male sterile line in sesame (\u003cem\u003eSesamum indicum\u003c/em\u003e L.). BMC Plant Bio 16: 250\u0026ndash;263.\u003c/li\u003e\n\u003cli\u003eLiu, J. H., Zhang, J., Jia, C. H., Zhang, J. B., Wang, J. S., Yang, Z. X., Xu, B. Y. and Jin, Z. Q. (2013). The interaction of banana MA0DS-box protein MuMADS1 and ubiquitin-activating enzyme E-MuUBA in post-harvest banana fruit. Plant Cell Rep 32: 129-137. \u003c/li\u003e\n\u003cli\u003eLiu, R., Li, B., Qin, G., Zhang, Z. and Tian, S. (2017). Identification and Functional Characterization of a Tonoplast Dicarboxylate Transporter in Tomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e). Front Plant Sci 8: 186-195.\u003c/li\u003e\n\u003cli\u003eLovisetto, A., Guzzo, F., Tadiello, A., Confortin, E., Pavanello, A., Botton, A. and Casadoro, G. (2013). Characterisation of\u003cem\u003e the bzip\u003c/em\u003e gene is highly expressed during the ripening of the peach fruit. Plant Physiol Biochem 70: 462-470.\u003c/li\u003e\n\u003cli\u003eMa, Y., Szostkiewicz, L., Korte, A., Moes, D., Yang, Y., Christmann, A. and Grill, E. (2009). Regulators of PP2C Phosphatase Activity Function as Abscisic Acid Sensors. Science 324: 1064-1068.\u003c/li\u003e\n\u003cli\u003eMaity, A., Lamichaney, A., Joshi, D. C., Bajwa, A., Subramanian, N., Walsh, M. and Bagavathiannan, M. (2021). Seed shattering: A trait of evolutionary importance in plants. Front Plant Sci 12: 657773-657790.\u003c/li\u003e\n\u003cli\u003eManickavasagam, M., Subramanyam, K., Ishwarya, R., Elayaraja, D. and Ganapathi, A. (2015). Assessment of factors influencing the tissue culture-independent Agrobacterium-mediated in planta genetic transformation of okra [Abelmoschus esculentus (L.) Moench]. PCTOC 123: 309-320. \u003c/li\u003e\n\u003cli\u003eMarciniak, K., Kućkoa, A., Wilmowicza, E., Michał Świdzińskic, M., Krzysztof Przedniczeka, K. and Kopcewicza, J. (2018). Gibberellic acid affects the functioning of the flower abscission zone in \u003cem\u003eLupinus luteus\u003c/em\u003e via cooperation with the ethylene precursor independently of abscisic acid. J Plant Physio 229: 170-174.\u003c/li\u003e\n\u003cli\u003eMarkovic. O and Janecek. S. (2001). Pectin degrading glycoside hydrolases of family 28: sequence-structural features, specificities, and evolution. Protein Engin 14: 615\u0026ndash;631.\u003c/li\u003e\n\u003cli\u003eMarowa, P., Anming Ding, A. and Kong, Y. (2016). Expansins: roles in plant growth and potential applications in crop improvement. Plant Cell Rep 35: 949\u0026ndash;965. \u003c/li\u003e\n\u003cli\u003eMayavan, S., Subramanyam, K., Arun, M., Rajesh, M., Dev, G. K., Sivanandhan, G., Jagannath, B., Manickavasagam, M., Selvaraj, N. and Ganapathi, A. (2013). Agrobacterium tumefaciens-mediated in planta seed transformation strategy in sugarcane. Plant Cell Rep 32: 1557\u0026ndash;1575.\u003c/li\u003e\n\u003cli\u003eMeli, V. S., Ghosh, S., Prabha, T. N., Chakraborty, N., Chakraborty, S and Datta, A. (2010). Enhancement of fruit shelf life by suppressing N-glycan processing enzymes. PNAS 107: 2413-2418.\u003c/li\u003e\n\u003cli\u003eMerelo, P., Agusti, J., Arbona, V., Costa, M. L., Estornell, L. H., Gomez-Cadenas, A., Coimbra, S., Gomez, M. D., Perez-Amador, M. A., Domingo, C. Talon, M. and Tadeo, F. R. (2017). Cell wall remodeling in abscission zone cells during ethylene-promoted fruit abscission in citrus. Front. Plant Sci 8: 126-146.\u003c/li\u003e\n\u003cli\u003eMolina-Hidalgo, F. J., Medina-Puche, L., Ca\u0026ntilde;ete -G\u0026oacute;mez, C.., Franco-Zorrilla, J. M., L\u0026oacute;pez -Vidriero, I., Solano, R., Caballero, J. L., Rodr\u0026iacute;guez-Franco, A., Blanco-Portales, R., Mu\u0026ntilde;oz-Blanco, J. and Moyano, E. (2017). The fruit-specific transcription factor FaDOF2 regulates the production of eugenol in ripe fruit receptacles. J. Exp. Bot. 68: 4529-4543. \u003c/li\u003e\n\u003cli\u003eMurashige, T. and Skoog, F. (1962). A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physio Planta 15: 473-497.\u003c/li\u003e\n\u003cli\u003eMurray, M. G. and Thompson, W. F. (1980). Rapid isolation of high molecular weight plant DNA. Nuc Acids Res 8: 4321\u0026ndash;4325.\u003c/li\u003e\n\u003cli\u003eNaik, P., Wang, J. P., Sederoff, R., Chiang, V., Williams, C., Ducoste, J. J. (2018). Assessing the impact of the 4CL enzyme complex on the robustness of monolignol biosynthesis using metabolic pathway analysis. PloS One. 13: 193896-193915.\u003c/li\u003e\n\u003cli\u003eNakano, T., Fujisawa, M., Shima, Y. and Ito, Y. (2013). Expression profiling of tomato pre-abscission pedicels provides insights into abscission zone properties, including competence in responding to abscission signals. BMC Plant Biol 13: 40-60. \u003c/li\u003e\n\u003cli\u003eNath, R.; Chakraborty, P. K. and Chakraborty. A. (2001). Effect of climatic variation on yield of sesame (\u003cem\u003eSesamum indicum \u003c/em\u003eL.) at different dates of sowing. J Agro Crop Sci 186: 97\u0026ndash;102.\u003c/li\u003e\n\u003cli\u003eNicolas, P., Lecourieux, D., Kappel, C., Cluzet, S., Cramer, G., Delrot, S. and Lecourieux, F. (2014). The basic leucine zipper transcription factor ABSCISIC ACID RESPONSE ELEMNETBINDING FACTOR2 is an important transcriptional regulator of abscisic acid-dependent grape berry ripening processes. Plant Physiol 164: 365-383.\u003c/li\u003e\n\u003cli\u003eNishimura, N., Sarkeshik, A., Nito, K., Park, S. Y., Wang, A., Carvalho, P. C., Lee, S., Caddell, D. F., Cutler, S. R., Chory, J., Yates, J. R. and Schroeder, J. I. (2010). PYR/PYL/RCAR family members are major in-vivo ABI1 protein phosphatase 2C interacting proteins in Arabidopsis. Plant J 61: 290\u0026ndash;299.\u003c/li\u003e\n\u003cli\u003eNunan, K. J., Davies, C., Robinson, S. P. \u0026amp; Fincher, G. B. (2001). Expression patterns of cell wall-modifying enzymes during grape berry development. Planta 214: 257-264.\u003c/li\u003e\n\u003cli\u003eOgasawara, S., Abe, K. and Nakajima, T. (2007). Pepper \u0026beta;- galactosidse 1 (\u003cem\u003ePBG1\u003c/em\u003e) plays a significant role in fruit ripening in bell pepper (\u003cem\u003eCapsicum annuum L.\u003c/em\u003e). Biosci. Biotechnol. Biochem 71: 309\u0026ndash;322.\u003c/li\u003e\n\u003cli\u003eOgawa, M., Kay, P., Wilson, S. and Swain, S. M. (2009). Arabidopsis dehiscence zone polygalacturonase 1 (\u003cem\u003eADPG1\u003c/em\u003e), \u003cem\u003eADPG2\u003c/em\u003e and \u003cem\u003eQUARTET2\u003c/em\u003e are polygalacturonases required for cell separation during reproductive development in Arabidopsis. Plant Cell 21: 216-233. \u003c/li\u003e\n\u003cli\u003eOgbonna, P. E. and Ukaan, S. I. (2013). Chemical composition and oil quality of seeds of sesame accessions grown in the Nsukka plains of southeastern Nigeria. Afr J Agri Res 8: 797-803.\u003c/li\u003e\n\u003cli\u003eOkonechnikov, K., Conesa, A. and Alcalde, F. G. (2015). Qualimap 2: Advanced multi-sample quality control for high-throughput sequencing data. Bioinformatics 32: 292- 295.\u003c/li\u003e\n\u003cli\u003eOrtiz, C. S., Montiel,M. D. L. P., Gallegos, J. A. and Covarrubias, A. A. (2008). Relationship between carbohydrate partitioning and drought resistance in common bean\u003cem\u003e. \u003c/em\u003ePlant Cell Environ 31: 1399-1409.\u003c/li\u003e\n\u003cli\u003ePalanivelu, P. (2006). Polygalacturonases: active site analyses and mechanism of action. \u003cem\u003eInd J Biotech\u003c/em\u003e, 5, 148-162. \u003c/li\u003e\n\u003cli\u003ePan, L., Zeng, W., Niu, L., Lu, Z., Wang, X., Liu, H., Cui, G., Zhu, Y., Chu, J., Li, W., Fang, W., Cai, Z., Li, G. and Wang, Z. (2015).\u003cem\u003e PpYUC11\u003c/em\u003e, a strong candidate gene for the stony hard phenotype in peach (\u003cem\u003ePrunus persica \u003c/em\u003eL. Batsch), participates in IAA biosynthesis during fruit ripening\u003cem\u003e. \u003c/em\u003eJ Exp Bot 66: 7031\u0026ndash;7045.\u003c/li\u003e\n\u003cli\u003ePatharkar, O. R. and Walker, J. C. (2018). Advances in abscission signalling. J Exp Bot 69: 733\u0026ndash;740. \u003c/li\u003e\n\u003cli\u003ePatterson, S. E., Medina, J. L. B., Falbel, T. G., Hedtcke, J. L., McBride, D. N., Andrew F. Maule, A. F. and Zalapa, J. E. (2016). Are we on the right track: can our understanding of abscission in model systems promote or derail making improvements in less studied crops? Front Plant Sci 6: 1268-1276.\u003c/li\u003e\n\u003cli\u003ePedrolli, D. B., Monteiro, A. C., Gomes, E. and Carmona, E. C. (2009). Pectin and pectinases: production, characterization, and industrial application of microbial pectinolytic enzymes. Open Biotech J 3: 9-18.\u003c/li\u003e\n\u003cli\u003ePerrakis, A., Bita, C. E., Arhondakis, S., Krokida, A., Mekkaoui, K., Denic, D., Blazakis, K. N., Kaloudas, D. and Kalaitzis, P. (2019). Suppression of a Prolyl 4 Hydroxylase Results in Delayed Abscission of Overripe Tomato Fruits. Front. Plant Sci. 28: 348-359. \u003c/li\u003e\n\u003cli\u003ePerrot, T., Pauly, M. and Ram\u0026iacute;rez, V. (2022). Emerging roles of ꞵ-Glucanases in plant development and adaptative responses. Plants 11: 1119-1141.\u003c/li\u003e\n\u003cli\u003ePhan, T. D., Bo, W., West, G., Lycett, G. W., and Tucker, G. A. (2007). Silencing of the major salt-dependent isoform of pectin esterase in tomato alters fruit softening. Plant Physio 144: 1960-1967.\u003c/li\u003e\n\u003cli\u003eProtsenko, M. A., Buza, N. L., Krinitsyna, A. A., Bulantseva, E. A. and Korableva, N. P. (2008). Polygalacturonase-inhibiting Protein is a structural component of plant cell walls. Biochemistry 73: 1053-1062.\u003c/li\u003e\n\u003cli\u003ePua, E. C., Ong, C. K., Liu, P. and Liu, j. z. (2001). Isolation and expression of two pectate lyase genes during fruit ripening of banana (\u003cem\u003eMusa acuminate\u003c/em\u003e). Physio Planta 113: 92\u0026ndash;99.\u003c/li\u003e\n\u003cli\u003ePurugganan, M. D. and Fuller, D. Q. (2009). The nature of selection during plant domestication. Nature 457: 843\u0026ndash;848.\u003c/li\u003e\n\u003cli\u003eQing, C. M., Fan, L., Lei, Y., Bouchez, D., Tourneur, C., Li Yan, L. and Robaglia, C. (2000). Transformation of Pakchoi (\u003cem\u003eBrassica rapa\u003c/em\u003e L. ssp. \u003cem\u003echinensis\u003c/em\u003e) by Agrobacterium infiltration.Mol Breed 6: 67\u0026ndash;72.\u003c/li\u003e\n\u003cli\u003eQiu, Z., Wen, Z., Hou, Q., Qiao, G., Yang, K., Hong, Y. and Wen, X. (2021). Crosstalk between transcriptome, phytohormone and HD-ZIP gene family analysis illuminates the molecular mechanism underlying fruitlet abscission in sweet cherry (\u003cem\u003ePrunus avium\u003c/em\u003e L). BMC Plant Bio 21: 173-191.\u003c/li\u003e\n\u003cli\u003eQuesada, M. A., Portales, R. B., Pose, S., Gago, J. A. G., Bermudez, S. J., Serrano, A. M., Caballero, J. L., Alfaro, F. P., Mercado, J. A. and Blanco, J. M. (2009). Antisense down-regulation of the \u003cem\u003eFaPG1\u003c/em\u003e gene reveals an unexpected central role for polygalacturonase in strawberry fruit softening. Plant Physiol 150: 1022-1032.\u003c/li\u003e\n\u003cli\u003eRadhakrishnan, R., Pae, S. B., Shim, K. B. and Baek, I. Y. (2013). \u003cem\u003ePenicillium \u003c/em\u003eSp. Mitigates \u003cem\u003eFusarium\u003c/em\u003e-induced biotic stress in sesame plants. Biotech Let 35: 1073\u0026ndash;1078.\u003c/li\u003e\n\u003cli\u003eRajani, S. and Sundaresan, V. (2001). The \u003cem\u003eArabidopsis \u003c/em\u003emyc/\u003cem\u003ebHLH \u003c/em\u003egene \u003cem\u003eALCATRAZ \u003c/em\u003eenables cell separation in fruit dehiscence.Cur Bio 11: 1914-1922.\u003c/li\u003e\n\u003cli\u003eRegina, A., Bird, A., Topping, D., Bowden, S., Freeman, J., Barsby, T., Hashemi, B. K., Li, Z., Rahman, S and Morell, M. (2006). High-amylose wheat generated by RNA interference improves indices of large-bowel health in rats. PNAS 103: 3546-3551.\u003c/li\u003e\n\u003cli\u003eRoberts, J. A., Whitelaw, C. A., Carranza, Z. H. G. and Mcmanus, M. T.(2000). Cell separation processes in plants-models, mechanisms, and manipulation. Ann Bot 86: 223-235.\u003c/li\u003e\n\u003cli\u003eRobles, P. and Pelaz, S. (2005). Flower and fruit development in \u003cem\u003eArabidopsis thaliana\u003c/em\u003e. Inter J Develop Bio 49: 633-643.\u003c/li\u003e\n\u003cli\u003eRodriguez, L., Guzman, M. G., Diaz, M., Rodrigues, A., Garcia, A. C.I., Llobet, M. P., Fernandez, M. A., Antoni, R., Fernandez, D., Marquez, J. A., Mulet, J. M., Albert, A. and Rodrigueza, P. L. (2014). C2-domain abscisic acid-related proteins mediate the interaction of PYR/PYL/RCAR abscisic acid receptors with the plasma membrane and regulate abscisic acid sensitivity in Arabidopsis. Plant Cell 26: 4802-4820.\u003c/li\u003e\n\u003cli\u003eSambrook, J., Fritschi, E. F.and Maniatis, T. (1989). Molecular cloning: A laboratory manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.\u003c/li\u003e\n\u003cli\u003eSander, L., Child, R., Ulvskov, P., Alberchtsen, M. and Borkhardt, B. (2001). Analysis of a dehiscence zone endopolygalacturonase in oilseed rape (\u003cem\u003eBrassica napus \u003c/em\u003e) and \u003cem\u003eArabidopsis thaliana\u003c/em\u003e: evidence for roles in cell separation in dehiscence and abscission zones, and in stylar tissues during pollen tube growth. Plant Mol Bio 46: 469-479.\u003c/li\u003e\n\u003cli\u003eSchmittgen, T. D. and Livak, K. J. (2008). Analyzing real-time PCR data by the comparative CT method. Nature Pro 3: 1101-1108. \u003c/li\u003e\n\u003cli\u003eSchuller, A. and Ludwig-M\u0026uuml;ller, J. (2006). A family of auxin conjugate hydrolases from \u003cem\u003eBrassica rapa\u003c/em\u003e: characterization and expression during clubroot disease. New Phyto 171: 145-158.\u003c/li\u003e\n\u003cli\u003eSchwarz, I., Scheirlinck, M. T., Otto, E., Bartrina, I., Schmidt, R. C. and Schmulling, T. (2020). Cytokinin regulates the activity of the inflorescence meristem and components of seed yield in oilseed rape. J. Exp. Bot. 71: 7146-4158. \u003c/li\u003e\n\u003cli\u003eS\u0026eacute;n\u0026eacute;chal, F.; Wattier, C.; Rust\u0026eacute;rucci, C. and Pelloux, J. (2014). Homogalacturonan-modifying enzymes: structure, expression, and roles in plants. J Exp Bot 65: 5125-5160.\u003c/li\u003e\n\u003cli\u003eSeymour, G. B., \u0026Oslash;stergaard, L., Chapman, N. H., Knapp, S. and Martin, C. ( 2013). Fruit development and ripening. Ann Rev Plant Bio 64: 1\u0026ndash;23.\u003c/li\u003e\n\u003cli\u003eSeymour, G. B., Ryder, C. D., Cevik, V., Hammond, J. P., Alexandra Popovich, A., King, G. J., Vrebalov, J., Giovannoni, J. J. and Manning, K. (2011). A SEPALLATA gene is involved in the development and ripening of strawberry (Fragaria3ananassa Duch.) fruit, a non-climacteric tissue. J. Exp. Bot. 62: 1179-1188.\u003c/li\u003e\n\u003cli\u003eSingh, G., Verma, A. K. and Kumar, V. (2016). Catalytic properties, functional attributes and industrial applications of ꞵ-glucosidases. 3 Biotech 6: 3-17.\u003c/li\u003e\n\u003cli\u003eShahidi, F., Pathirana, C. M. L., Wall, D. S. (2006). Antioxidant activity of white and black sesame seeds and their hull fractions. Food Chem 99: 478\u0026ndash;473.\u003c/li\u003e\n\u003cli\u003eSheehy, R. E., Kramer, M. and Hiatt, W. R. (1988). Reduction of polygalacturonase activity in tomato fruit by antisense RNA. PNAS 85: 8805-8809.\u003c/li\u003e\n\u003cli\u003eShowalter, A. M. (2001). Arabinogalactan-proteins: structure, expression and function. CMLS, Cell. Mol. Life Sci. 58: 1399-1417.\u003c/li\u003e\n\u003cli\u003eSmith, C. J. S., Watson, C. F., Morris, P. C., Bird, C. R., Seymour, G.B., Gray, J. E., Arnold, C., Tucker, G. A., Schuch, W., Harding, S. and Grierson, D. (1990). Inheritance and effect on ripening of antisense polygalacturonase genes in transgenic tomatoes. Plant Mol Biol 14: 369-379.\u003c/li\u003e\n\u003cli\u003eSong, Q., Joshi, M., Wang, S., Johnson, C. D. and Joshi, V. (2021). Comparative Analysis of Root Transcriptome Profiles of Sesame (Sesamum indicum L.) in Response to osmotic stress. J Plant Grow Reg 40: 1787-1801.\u003c/li\u003e\n\u003cli\u003eSorefan, K., Girin, T., Liljegren, S. J., Ljung, K., Robles, P., Ampudia, C. S. G., Offringa, R., Friml, J., Yanofsky, M. F. and \u0026Oslash;stergaard, L. (2009). A regulated auxin minimum is required for seed dispersal in \u003cem\u003eArabidopsis\u003c/em\u003e. Nature 459: 583- 586.\u003c/li\u003e\n\u003cli\u003eSubramanyam, K., Rajesh, M., Jaganath, B., Vasuki, A., Theboral, J., Elayaraja, D., Karthik, S., Manickavasagam, M. and Ganapathi, A. (2013). Assessment of factors influencing the \u003cem\u003eAgrobacterium\u003c/em\u003e-mediated in planta seed transformation of brinjal (\u003cem\u003eSolanum melongena\u003c/em\u003e L.). Appl Biochem Biotechnol 17: 450-469.\u003c/li\u003e\n\u003cli\u003eSultan, E. A. A., Abdel-Hadi, A. A., Abdallah, N. A. and Tawfik, M. S. (2018). Identification and molecular characterization of false septa-expressed polygalacturonase gene homologue from sesame (\u003cem\u003eSesamum indicum \u003c/em\u003eL.). Biosci. Res 15: 3175-3187.\u003c/li\u003e\n\u003cli\u003eSultan, E. A. A. and Tawfik, M. S. (2023). Stable In-Planta transformation system for Egyptian sesame (\u003cem\u003eSesamum indicum \u003c/em\u003eL.) cv. Sohag 1. GM Crops Food 14: 21-31.\u003c/li\u003e\n\u003cli\u003eSun, L., Sun, Y., Zhang, M., Wang, L., Ren, J., Cui, M., Wang, Y., Ji, K., Li, P., Li, Q., Chen, P., Dai, S., Duan, C., Wu, Y. and Leng, P. (2012). Suppression of 9-cis epoxy carotenoid dioxygenase, which encodes a key enzyme in abscisic acid biosynthesis, Alters fruit texture in transgenic tomatoes\u003cem\u003e. \u003c/em\u003ePlant Physio 158: 283-298.\u003c/li\u003e\n\u003cli\u003eTacken, E., Ireland, H., Gunaseelan, K., Karunairetnam, S., Wang, D., Schultz, K., Bowen, J., Atkinson, R. G., Johnston, J. W., Putterill, J., Hellens, R. P., and Schaffer, R. J. (2010). The role of ethylene and cold temperature in the regulation of the apple \u003cem\u003ePOLYGALACTURONASE1\u003c/em\u003e gene and fruit softening. Plant Physiol 153: 294-305.\u003c/li\u003e\n\u003cli\u003eTang, G., Galili, G. and Zhuang, X. (2007). RNAi and microRNA: breakthrough technologies for the improvement of plant nutritional value and metabolic engineering. Metabolomics 3: 357\u0026ndash;369.\u003c/li\u003e\n\u003cli\u003eTranbarger, T. J., Tucker, M. L., Roberts, J. A. and Meir, S. (2017). Editorial: Plant organ abscission: From models to crops. Front. Plant Sci. 8: 196-200.\u003c/li\u003e\n\u003cli\u003eUcana, K and killi, F. (2010). Effects of different irrigation programs on flower and capsule numbers and shedding percentage of sesame. Agri Water Manag 98: 227\u0026ndash;233.\u003c/li\u003e\n\u003cli\u003eUluisik, S., Chapman, N. H., Smith, R., Poole, M., Adam, G., Gillis, R. B., Besong, T. M. D., Sheldon, J., Stiegelmeyer, S., Perez, L., Samsulrizal, N., Wang, D., Fisk, I. D., Yang, N., Baxter, C., Rickett, D., Fray, R., Ulate, B. B., Powell, A. L. T., Harding, S. E., Craigon, J., Rose, J. K. C., Fich, E. A., Sun, L., Domozych, D. S., Paul D Fraser, P. D., Tucker, G. A., Don Grierson, D. and Seymour, G. B. (2016). Genetic improvement of tomato by targeted control of fruit softening, Nature Biotech 34: 950\u0026ndash;956.\u003c/li\u003e\n\u003cli\u003eVerlent, I., Loey, A. V., Smout, C., Duvetter, T. and Hendrickx, M., E. (2005). Purified tomato polygalacturonase activity during thermal and high-pressure treatment. Biotech Bioengin 86: 63\u0026ndash;71.\u003c/li\u003e\n\u003cli\u003eVrebalov, J., Ruezinsky, D. Padmanabhan, V. White, R. Medrano, D., Drake, R., Wolfgang Schuch, W. and Giovannoni, J. (2002). A MADS-Box gene is necessary for fruit ripening at the tomato \u003cem\u003eRipening-Inhibitor \u003c/em\u003e(\u003cem\u003eRin\u003c/em\u003e) locus. Sci 296: 343-247.\u003c/li\u003e\n\u003cli\u003eWang, G. Q., Wei, P. C., Tan, F., Yu, M., Zhang, X. Y., Chen, Q. J. and Wang, X. C. (2016). The transcription factor \u003cem\u003eAtDOF4.7 \u003c/em\u003eis involved in ethylene- and \u003cem\u003eIDa-mediated\u003c/em\u003e organ abscission in Arabidopsis. Front. Plant Sci 7: 863-875.\u003c/li\u003e\n\u003cli\u003eWang, K. L. C., Li, H. and Ecker, J. R. (2002).Ethylene biosynthesis and signaling networks. Plant Cell 14: 131-151.\u003c/li\u003e\n\u003cli\u003eWang, L., Dossou, S. S. K., Wei, X., Zhang, Y., Li, d., Yu, J. and Zhang, X. (2020). Transcriptome dynamics during black and white sesame (\u003cem\u003eSesamum indicum\u003c/em\u003e L.) seed development and identification of candidate genes associated with black pigmentation. MDPI 11: 1399-1413.\u003c/li\u003e\n\u003cli\u003eWang, M., Huang, J., Liu, S., Liu, X., Li, R., Luo, J. and Fu, Z. (2022). Improved assembly and annotation of the sesame genome. DNA Res 29: 1-8.\u003c/li\u003e\n\u003cli\u003eWang, X., Meng, J., Deng, L., Wang, Y., Liu, H., Yao, J. L., Nieuwenhuizen, N. J., Zhiqiang Wang, Z. and Zeng, W. (2021). Diverse functions of IAA-Leucine resistant PpILR1 provide a genetic basis for auxin-ethylene crosstalk during peach fruit ripening. Front Plant Sci 12: 655758-655770.\u003c/li\u003e\n\u003cli\u003eWang, Y., Beaith, M., Chalifoux, M., Ying, J., Uchacz, T., Sarvas, C., Griffiths, R., Kuzma, M., Wan, J. and Huang, Y. (2009). Shoot-specific down-regulation of protein farnesyltransferase (a subunit) for yield protection against drought in canola. Mol Plant 2: 191\u0026ndash;200.\u003c/li\u003e\n\u003cli\u003eWattebled, F., Dong, Y., Dumez, S., Delvalle, D., Planchot, V., Pierre Berbezy, P., Vyas, D., Colonna, P., Chatterjee, M., Ball, S., and D\u0026rsquo;Hulst, C. (2005). Mutants of Arabidopsis lacking a chloroplastic isoamylase accumulate phytoglycogen and an abnormal form of amylopectin. Plant Physio 138: 184-195.\u003c/li\u003e\n\u003cli\u003eWen, B., Zhang, F., Wu, X. and Li, H. (2020). Characterization of the tomato (\u003cem\u003eSolanum lycopersicum\u003c/em\u003e) pectin methylesterases: Evolution, activity of isoforms and expression during fruit ripening. Front Plant Sci 11: 238-255.\u003c/li\u003e\n\u003cli\u003eWesley, S. V., Helliwell, C. A., Smith, N. A., Wang, M., Rouse, D. T., Liu, Q., Gooding, P. S., Singh, S. P., Abbott, D., Stoutjesdijk, P. A., Robinson, S. P., Gleave, A. P., Green, A. G. and Waterhouse, P. M. (2001). Construct design for efficient, effective, and high-throughput gene silencing in plants. Plant J 27: 581-590.\u003c/li\u003e\n\u003cli\u003eWu, W., Du, K., Kang, X. and Wei, H. (2021). The drivers roles of cytokinins in regulating leaf development. Hortic. Res 8: 118-131.\u003c/li\u003e\n\u003cli\u003eXiao, Y. Y., Kuang, J. F., Qi, X. N., Ye, Y. J., Wu, Z. X., Chen, J. Y. and Lu, w. j. (2018). A comprehensive investigation of starch degradation process and identification of a transcriptional activator MabHLH6 during banana fruit ripening. Plant Biotech J 16: 151\u0026ndash;164.\u003c/li\u003e\n\u003cli\u003eYadav, M., Chaudhary, D., Sainger, M. and Jaiwal, P. K. (2010). Agrobacterium tumefaciens-mediated genetic transformation of sesame (\u003cem\u003eSesamum indicum \u003c/em\u003eL.). PCTOC 103: 377-386.\u003c/li\u003e\n\u003cli\u003eYang, X., Jun Song, J., Palmer, L. C., Fillmore, S. and Zhang, Z. (2013). Effect of ethylene and 1-MCP on expression of genes involved in ethylene biosynthesis and perception during ripening of apple fruit. Posthar Bio Tech 78: 55-66.\u003c/li\u003e\n\u003cli\u003eYang, Y., Yu, Y., Liang, Y., Anderson, C. T. and Cao, J. (2018). A profusion of molecular scissors for pectins: Classification, expression, and functions of plant polygalacturonases. Frontiers in Plant Sci 9: 1208-1224.\u003c/li\u003e\n\u003cli\u003eYin, D., Deng, S., Zhan, K. and Cui, D. (2007). High-oleic peanut oils are produced by hpRNA-mediated gene silencing of oleate desaturase. Plant Mol Bio Rep 25: 154\u0026ndash;163.\u003c/li\u003e\n\u003cli\u003eYoon, J., Cho, L. H., Kim, S. L., Choi, H., Koh, H. J. and An, G. (2014). The BEL1-type homeobox gene SH5 induces seed shattering by enhancing abscission-zone development and inhibiting lignin biosynthesis. Plant J 79: 717\u0026ndash;728.\u003c/li\u003e\n\u003cli\u003eYou, J., Zhang, Y., Liu, A., Li, D., Wang, X., Dossa, K., Zhou, R., Yu, J., Zhang, Y., Wang, L. and Xiurong Zhang, X. (2019). Transcriptomic and metabolomic profiling of drought-tolerant and susceptible sesame genotypes in response to drought stress. BMC Plant Bio 19: 267-283.\u003c/li\u003e\n\u003cli\u003eYu, Y. K., Li, Y. L., Ding, L. N., Sarwar, R., Zhao, F. Y. and Tan, X. L. (2020). Mechanism and regulation of silique dehiscence, which affects oil seed production. Front Plant Sci 11: 580-594.\u003c/li\u003e\n\u003cli\u003eZhai, Z., Xiao, Y., Wang, Y., Sun, Y., Peng, x., Feng, c., Zhang, X., Du, B., Zhou, X., Wang, C., Liu, Y. and Li, T. (2022). Plant Physiol 190: 2501-2518. \u003c/li\u003e\n\u003cli\u003eZhang, S. H., Sun, J. H., Dong, Y. H., Shen, Y. Y., Li, C. L., Li, Y. Z. and Guo, J. X. (2014). Enzymatic and functional analysis of ꞵ-glucosidase FaBG1 during strawberry fruit ripening. J Hort Sci Biotech 89: 733\u0026ndash;739.\u003c/li\u003e\n\u003cli\u003eZhang, X., Zou, Z., Zhang, J., Zhang, Y., Han, Q., Hu, T., Xu, X., Liu, H., Li, H. and Ye, Z. (2011). Over-expression of SlymiR156a in tomato results in multiple vegetative and reproductive trait alterations and partial phenocopy of the \u003cem\u003eSft \u003c/em\u003emutant. Fed Euro Biochem Soc Let 585: 435\u0026ndash;439.\u003c/li\u003e\n\u003cli\u003eZhang, Y. P., Zhang, Y. Y., Thakur, K., Zhang, F., Hu, F., Zhang, J. G., Wei, P. C. \u0026amp; Wei, Z. J. (2021). Integration of miRNAs, Degradome, and transcriptome omics uncovers a complex regulatory network and provides insights into lipid and fatty acid synthesis during sesame seed development. Front Plant Sci 12: 709197-709211.\u003c/li\u003e\n\u003cli\u003eZhang, Y., Li, Q., Jiang, L., Kai, W., Liang, B., Wang, J., Du, Y., Zhai1, X., Wang, J., Zhang, Y., Sun, Y., Zhang, L. and Leng, P. (2017). Suppressing type 2C Protein Phosphatases alters fruit ripening and the stress response in tomato. Plant Cell Physio 59: 142\u0026ndash;145.\u003c/li\u003e\n\u003cli\u003eZiosi, V., Bregoli, A. M., Bonghi, C., Fossati, T., Biondi,S., Costa, G. and Torrigiani, P. (2006). Transcription of ethylene perception and biosynthesis genes is altered by putrescine, spermidine and aminoethoxyvinylglycine (AVG) during ripening in peach fruit (\u003cem\u003ePrunus persica\u003c/em\u003e). New Phyto 172: 229-239.\u003c/li\u003e\n\u003cli\u003eZou, X. and Sun, H. (2023). DOF transcription factors: Specific regulators of plant biological processes. Front. Plant. Sci. 14: 1044918-1044931.\u003c/li\u003e\n\u003c/ol\u003e"}],"fulltextSource":"","fullText":"","funders":[],"hasAdminPriorityOnWorkflow":false,"hasManuscriptDocX":true,"hasOptedInToPreprint":true,"hasPassedJournalQc":"","hasAnyPriority":false,"hideJournal":true,"highlight":"","institution":"","isAcceptedByJournal":false,"isAuthorSuppliedPdf":false,"isDeskRejected":"","isHiddenFromSearch":false,"isInQc":false,"isInWorkflow":false,"isPdf":false,"isPdfUpToDate":true,"isWithdrawnOrRetracted":false,"journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true},"keywords":"Sesamum indicum L., seed shattering, endo-polygalacturonase, transcriptome analysis, Cell-wall modification","lastPublishedDoi":"10.21203/rs.3.rs-4624341/v1","lastPublishedDoiUrl":"https://doi.org/10.21203/rs.3.rs-4624341/v1","license":{"name":"CC BY 4.0","url":"https://creativecommons.org/licenses/by/4.0/"},"manuscriptAbstract":"Sesame (Sesamum indicum L.) is one of the oldest cultivated oil crops worldwide and struggles with low yield, which could be attributed to capsule dehiscence and seed shattering just before and during full maturation. The present study addresses the seed-shattering in sesame via downregulating the endo-polygalacturonase (endo-PG) gene activity “known as the ripening enzyme”. Five lines of sesame plants using an RNAi transformation strategy via a non-tissue culture-based transformation technique. Individual transformants were tested using BASTA leave-painting and spraying over mature plants, as well as conducting PCR, RT-PCR, and real-time PCR tests on T1 plants. The transgenics exhibited a significant reduction in endo-PG levels and showed delays in leaves, organ senescence, and a delay in capsule opening. A transcriptome profiling study was conducted to understand the effect of downregulating the endo-PG expression levels on the genetic expression profile of false septa tissues excised from sesame capsules. Different comparisons between the expression profile of the false septa in transgenic vs non-transgenic control were conducted, yet we are reporting one of the comparisons in this study. A total of 24,468 unigenes were annotated, and 514 differentially expressed genes (DEGs) were detected in the selected comparison, including 349 up-regulated and 165 down-regulated unigenes. Nineteen DEGs for genes directly involved in plant hormones, cell wall modification, and capsule shattering were selected. Our results indicate that silencing the endo-PG gene caused changes in the expression of a wide range of genes, eventually leading to a dramatic reduction in seed-shattering in transgenic sesame capsules.","manuscriptTitle":"Downregulation of polygalacturonase (PG) gene expression caused significant changes in gene expression in sesame (Sesamum indicum L.) false septa tissues.","msid":"","msnumber":"","nonDraftVersions":[{"code":1,"date":"2024-08-09 21:07:19","doi":"10.21203/rs.3.rs-4624341/v1","editorialEvents":[{"type":"communityComments","content":0}],"status":"published","journal":{"display":true,"email":"
[email protected]","identity":"researchsquare","isNatureJournal":false,"hasQc":true,"allowDirectSubmit":true,"externalIdentity":"","sideBox":"","snPcode":"","submissionUrl":"/submission","title":"Research Square","twitterHandle":"researchsquare","acdcEnabled":true,"dfaEnabled":false,"editorialSystem":"","reportingPortfolio":"","inReviewEnabled":false,"inReviewRevisionsEnabled":true}}],"origin":"","ownerIdentity":"616b5aed-d8dc-4942-b303-de8584d7a074","owner":[],"postedDate":"August 9th, 2024","published":true,"recentEditorialEvents":[],"rejectedJournal":[],"revision":"","amendment":"","status":"posted","subjectAreas":[],"tags":[],"updatedAt":"2024-08-13T20:19:31+00:00","versionOfRecord":[],"versionCreatedAt":"2024-08-09 21:07:19","video":"","vorDoi":"","vorDoiUrl":"","workflowStages":[]},"version":"v1","identity":"rs-4624341","journalConfig":"researchsquare"},"__N_SSP":true},"page":"/article/[identity]/[[...version]]","query":{"redirect":"/article/rs-4624341","identity":"rs-4624341","version":["v1"]},"buildId":"qtupq5eGEP_6zYnWcrvyt","isFallback":false,"isExperimentalCompile":false,"dynamicIds":[84888],"gssp":true,"scriptLoader":[]}
Text is read by the "Ask this paper" AI Q&A widget below.
Extraction quality varies by source — PMC NXML preserves structure
cleanly, OA-HTML may include some navigation residue, and OA-PDF can
have broken hyphenation. The publisher copy
(via DOI)
is the canonical version.