Genetic variation between edible and toxic varieties of Detarium senegalense J.F. Gmel in Casamance (Senegal) based on chloroplast microsatellite markers

preprint OA: closed
Full text JSON View at publisher

Abstract

Maintenance of genetic diversity in endangered species requires conservation strategies and management. Here we study Detarium senegalense J.F. Gmel, a threatened African wild fruit tree species well known for its multiple uses in food and traditional medicine and, to produce two forms of fruits, edible and toxic. This study investigates the genetic variation and differentiation between edible and toxic forms of four populations of D. senegalense in the region of Basse Casamance in Senegal. Twenty-six chloroplast microsatellite markers (cpSSRs) were used to test their transferability to D. senegalense and to apply them for population genetic analyses. The results showed that 25 cpSSRs were monomorphic, while only one marker was polymorphic, revealing four distinct haplotypes. All populations exhibited a common haplotype H1_390 with different frequencies, also found to be the single haplotype in two populations with both edible and toxic fruits, whereas all four haplotypes coexisted within toxic D. senegalense of one population. The southern population is mainly represented by toxic forms and two distinct haplotypes occurring in 17 out of the 20 toxic forms. Since geographic origin is related to toxicity, the new chloroplast marker can be applied to indirectly evaluate the toxicity of reproductive material within the studied region.
Full text 35,527 characters · extracted from preprint-html · click to expand
Genetic variation between edible and toxic varieties of Detarium senegalense J.F. Gmel in Casamance (Senegal) based on chloroplast microsatellite markers | Authorea try { document.documentElement.classList.add('js'); } catch (e) { } var _gaq = _gaq || []; _gaq.push(['_setAccount', 'G-8VDV14Y67G']); _gaq.push(['_trackPageview']); (function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); Skip to main content Preprints Collections Wiley Open Research IET Open Research Ecological Society of Japan All Collections About About Authorea FAQs Contact Us Quick Search anywhere Search for preprint articles, keywords, etc. Search Search ADVANCED SEARCH SCROLL This is a preprint and has not been peer reviewed. Data may be preliminary. 24 February 2026 V1 Latest version Share on Genetic variation between edible and toxic varieties of Detarium senegalense J.F. Gmel in Casamance (Senegal) based on chloroplast microsatellite markers Authors : Oulimata DIATTA 0000-0003-1618-7829 [email protected] , Markus Mueller , and Oliver Gailing 0000-0002-4572-2408 Authors Info & Affiliations https://doi.org/10.22541/au.177195261.15508840/v1 138 views 61 downloads Contents Abstract Supplementary Material Information & Authors Metrics & Citations View Options References Figures Tables Media Share Abstract Maintenance of genetic diversity in endangered species requires conservation strategies and management. Here we study Detarium senegalense J.F. Gmel, a threatened African wild fruit tree species well known for its multiple uses in food and traditional medicine and, to produce two forms of fruits, edible and toxic. This study investigates the genetic variation and differentiation between edible and toxic forms of four populations of D. senegalense in the region of Basse Casamance in Senegal. Twenty-six chloroplast microsatellite markers (cpSSRs) were used to test their transferability to D. senegalense and to apply them for population genetic analyses. The results showed that 25 cpSSRs were monomorphic, while only one marker was polymorphic, revealing four distinct haplotypes. All populations exhibited a common haplotype H1_390 with different frequencies, also found to be the single haplotype in two populations with both edible and toxic fruits, whereas all four haplotypes coexisted within toxic D. senegalense of one population. The southern population is mainly represented by toxic forms and two distinct haplotypes occurring in 17 out of the 20 toxic forms. Since geographic origin is related to toxicity, the new chloroplast marker can be applied to indirectly evaluate the toxicity of reproductive material within the studied region. Introduction Detarium senegalense J.F. Gmel is a very important multipurpose indigenous fruit tree species originating from tropical Africa. The species belongs to the Caesalpiniaceae family, and the Detarium Juss. genus is found in Sub-Saharan areas and grows particularly in the wet dense forest borders, the coastal and septentrional regions, and in the Sudan-Guinea zone (Ndiaye et al. 2014). It is a tree species that plays an important role in the local economy due to the multiple advantages provided by its edible fruits. In Senegal, D. senegalense locally called ”ditakh” is mostly used as a food source because of its nutritious fruits and represents an important source of income for rural populations. The number of harvested fruits has increased from less than 10 t in 1997, to almost 840 t in 2006 (Anon 2012). The fruit is directly eaten or used as marmalade or Sherbet, or as nectar (Diop et al. 2010). Besides the fruits, the seeds have been reported to show high food energy and can be used to supplement the daily energy intake (Dassou et al. 2023). In Nigeria, the bark, seed, leaf, and root extracts are widely used in herbal medicine, while in Benin, the bark and the roots are the main plant parts exploited. The pulp of D. senegalense fruits is rich in vitamins, minerals, and essential amino acids, and vitamin C content is 29, 12, 7 and 5 times that of Citrus x aurantium , Citrus limon , Psidium guajava and Adansonia digitata pulps, respectively (Dassou et al. 2023). Detarium senegalense has long been used as traditional food and medicine across its distribution range in Africa. Unfortunately, research activities on this species remain very scarce. Despite its economic and social importance as well as the growing demand for Detarium fruits, the species is declining because of anthropogenic pressure, lack of natural regeneration coupled with climate change that have further contributed to a decrease in the stock of the plant in nature (Ndiaye et al. 2022). However, research initiatives targeting the silvicultural management and the ecology of this species are rare in Africa, consequently, the knowledge available on its potential for domestication is non-existent in Senegal. In addition, some varieties of D. senegalense produce toxic fruits (Cavin 2007, Diop et al. 2010) due to the presence of a cyanogenic glycoside derivative (Cavin 2007). The toxic variety of D. senegalense is mainly found in the southwestern part of Senegal in Basse Casamance. Objective methods to differentiate edible fruits from toxic fruits have not been developed, and usually people rely on the knowledge of the local communities. Furthermore, molecular investigations on Detarium spp. are scarce. To our knowledge, no molecular genetic markers have been developed for discriminating against the two forms (toxic vs edible fruits) of D. senegalense, hence the need for the genetic characterization and assessment of the genetic diversity of the species. Molecular studies on the Detarium genus were conducted by Agbo et al. (2022) who investigated the patterns of genetic diversity and relationships of populations of D. microcarpum from different climatic zones. Seventy-eight (78) accessions of D. microcarpum belonging to six populations (phytogeographic districts) were sampled, and the molecular analysis of the accessions was carried out using 7 chloroplast microsatellite markers. The results suggested that the genetic structure of D. microcarpum populations reflects fragmentation and limited gene dispersal. Fruit morphotypes of D. microcarpum and D. senegalense were investigated in the phytodistricts of Bassila and Borgou-Sud in Benin, by Houénon et al. (2022). In this study, five morphological descriptors were used to characterize fruits, and hierarchical clustering was performed to group fruits in morphotypes with similar characteristics. Three fruit morphotypes were identified for D. microcarpum and two morphotypes for D. senegalense . This study revealed that fruit morphotypes and their provenances influence seedling emergence and early growth parameters, and the Borgou-Sud morphotype 2 for each of the two species constitutes a potential candidate for domestication programs. The present study aimed to investigate the genetic variation of both toxic and edible varieties of D. senegalense provenances using chloroplast microsatellite markers well known to be frequently used in phylogeographic analyses of plant species (Fontaine et al. 2004, Muller et al. 2009). Materials and methods Sample collection Detarium senegalense grows particularly in the Sine-Saloum islands and in Casamance (Diop et al. 2010). While the edible variety is largely distributed in the region of Ziguinchor and Fatick, the toxic variety is mainly found in specific locations in Ziguinchor (Figure 1). To face the difficulty of finding a representative sample of toxic and edible trees within a population, the selected populations were chosen to maximize the representation of both edible and toxic forms of D. senegalense . Four populations covering a large part of the Senegalese distribution area of both toxic and edible D. senegalense were selected (Table 1; Figure 1). The annual precipitation ranges from 1054 to 1352 mm. At each locality, GPS coordinates were recorded for each of the sampled trees. An exhaustive sampling with a minimum distance between trees was applied in each population with edible and toxic fruits in the field, and for each of the natural populations of D. senegalense we sampled leaf tissue from all individual plants that were 20 m apart to increase the chances of sampling unrelated genotypes (Zimmer et al. 2023) since D. senegalense is usually propagated by gravity dispersed seeds (Sogo et al. 2017, Dangbo et al. 2019). In some cases, there were additional trees that were, however, not accessible i.e., toxic trees from the Hitou population. Trees with edible and toxic fruits were identified based on the knowledge and their uses by the local population. The toxic form is differentiated by its soft leaflets with bright green color on top and green underneath, and by a slightly more fibrous pulp (Cavin 2007). In Senegal, distinction of edible and toxic fruits relies solely on the knowledge of local populations who distinguish the two forms based on the bitterness and specific odor of toxic fruits, as well as by the presence of numerous unaltered fruits that have fallen to the ground and are not consumed by animals, particularly monkeys and birds (Adam et al. 1991). The number of our selected trees in each locality depends on the presence of both toxic and edible D. senegalense forms. In Djimbereng, there was only one edible tree identified by the residents, and all other trees from the species were from the toxic form. Leaf tissue was collected from each tree and immediately stored in silica gel until DNA extraction. DNA extraction Total genomic DNA was extracted from 96 dried leaf samples from the natural stands using the DNeasy 96 Plant kit (Qiagen, Hilden, Germany), following the manufacturer’s protocol for dry material. Isolated DNA was diluted 1:10 for PCR amplification. Microsatellite (SSR) and PCR amplification Twenty-six chloroplast microsatellite markers (cpSSRs), i.e. 16 Ntcp ( Nicotiana tabacum chloroplast) primers originally developed for N. tabacum (Bryan et al. 1999), and 10 ccmps (consensus chloroplast microsatellite primers), universal primers for angiosperms developed by Weising and Gardner (1999), were tested in eight samples for amplification and to detect polymorphisms. Eighteen primers showed clear amplification while seventeen were monomorphic, and only one primer particularly developed for N. tabacum (NTCP9) showed polymorphism (Appendix 1) when amplification products were separated on an AB3500 Genetic Analyzer (Applied Biosystems, USA). Ultimately, the NTCP9 polymorphic marker was genotyped in all samples. Polymerase chain reactions (PCR) were performed with M13 tails (5’-CACGACGTTGTAAAACGAC-3’) and dye labelled adaptors complementary to forward primers (Schuelke 2000; Kubisiak et al. 2013) and a PIG-tail (5’-GTTTCTT-3’) (Brownstein et al. 1996) added to the 5’ end of reverse primers, using a touchdown program with the following protocol: first denaturation at 95°C for 15 min, followed by ten cycles including a denaturation step of 1 min at 94°C, an annealing step at 60°C for 1 min (-1°C per cycle), an extension step at 72°C for 1 min, then 25 cycles with the same denaturation and extension time and temperature, but 50°C annealing for 1 min, and a final extension at 72°C for 20 min. The PCR mix was composed of 1.0 μL genomic DNA (ca 10 ng/μL), 1.5 μL 10x reaction buffer B (Solis BioDyne, Estonia), 1.5 μL MgCl 2 (25 mM), 1.0 μL dNTPs (2.5 mM each dNTP), 0.2 μL (5 U/ μL) HOT FIREPol® Taq DNA polymerase (Solis BioDyne, Estonia), 0.2 μL tailed (Schuelke 2000; Kubisiak et al. 2013) forward primer (5 picomole/μL), 0.5 μL PIG-tailed (Brownstein et al. 1996) reverse primer (5 picomole/μL), 1.0 μL (5 picomole/μL) dye labelled (6-FAM or HEX) M13 primer, and HPLC grade H 2 O (filled up to a volume of 13 μL). Genetic variation among sampled populations of D. senegalense The results from the only polymorphic microsatellite maker cpSSR (NTCP9) revealed the existence of different haplotypes (Table 2) among the four sampled populations of D. senegalense in Casamance, Senegal. Fragment sizes do not reflect differences in mononucleotide microsatellite motifs as observed in Nicotiana tabacum for which the marker was originally developed, but larger indels. Thus, the size of the different haplotypes varies from 390 base pairs (bp) to 434 bp with the occurrence of four haplotypes (H1_390, H2_402, H3_417 and H4_434). The distribution of the different haplotypes varies among the sampled populations. Most common was the haplotype H1_390 found in all populations and representing 77 of 96 (80%) individual trees. It is followed by H3_417 representing 15 of 96 (16%) individual trees in Djimbereng population only. The haplotypes H4_434 (3%) and H2_402 (1%) were found at lower frequencies with 3 of 96 individual trees in both Djimbereng and Oussouye populations and one out of 96 individual trees in Djimbereng population. Two populations, Thionck-essyl and Hitou, were fixed on H1_390. All four haplotypes occurred in the Djimbereng population, while H1_390 and H3_434 coexisted in one population (Oussouye). Genetic variation within edible and toxic D. senegalense When comparing genetic variation within edible D. senegalense , we found that the most common haplotype was H1_390 representing 97% of the investigated edible trees, while H4_434 only represents 3% (Figure 1). All the sampled edible trees from the three populations (Thionck-Essyl, Hitou and Djimbereng) were found with the common haplotype H1_390, except for the only edible tree from Oussouye population that was characterized by haplotype H4_434. These results revealed a low genetic variation within edible populations of D. senegalense . High genetic variation was found within toxic D. senegalense with the occurrence of the four haplotypes H1_390, H3_417, H2_402 and H4_434 (Figure 1). Although all the four haplotypes H1_390 (79%), H3_417 (11%), H2_402 (5%) and H4_434 (5%) coexisted in only one population (Djembereng), H1_390 is the common haplotype that appeared in all tested toxic trees from Hitou, Thionck-Essyl and Oussouye. Discussion The present study is the first to investigate genetic structure at maternally inherited cpDNA markers in Detarium senegalense in the two forms (toxic vs edible). Twenty-six chloroplast microsatellite markers (cpSSRs) were tested, and we found a low level of polymorphism in the studied populations. One out of the 26 tested markers was found to be polymorphic, and the remaining markers were monomorphic (17 markers) or did not amplify (8 markers). Generally, the chloroplast genome is characterized by a lower level of substitutions than the nuclear genome (Provan et al. 2001, Weising and Richard 1999, Burg 2017) and the low level of polymorphism in cpSSRs could be due to the absence of (highly) repetitive microsatellite regions targeted by the primers (Decroocq et al. 2004, Nanema et al. 2010). This finding is consistent with results by Ndiaye et al. (2024) who reported a low number of polymorphic cpSSRs in the chloroplast genome in the African Sahelian tree species Dalbergia melanoxylon . While the use of universal primers developed for other species may result in an underestimation of genetic diversity, higher levels of polymorphism and haplotype number were found in a related species, D. microcarpum (Agbo et al. 2021). Thus, the observed low number of polymorphic cpSSRs and the comparatively low level of haplotype diversity within some populations could also represent a founder effect as reflected in the near-fixation on the same haplotype (H1) in the three northern populations (Slatkin 1987). The only polymorphic microsatellite maker cpSSR (NTCP9) revealed four different haplotypes (H1_390, H2_402, H3_417 and H4_434) among sampled populations of D. senegalense in Casamance, Senegal. The occurrence of a common haplotype H1_390 in all but one individual tree of the three northern populations could be explained by the common origin of these populations and limited seed-mediated gene exchange with the southern population (Djimbereng). Toxic forms of D. senegalensis share the most common haplotype H1_390 and the rare haplotype H4_434 with edible forms in the three northern regions, suggesting a common geographic origin. However, more extensive sampling and study of the past human interactions with the tree species are needed to support this evidence. The southern (isolated) population Djimbereng mainly represented by toxic forms (20 out of 21) revealed the highest haplotype variation with the occurrence of one frequent (H3_417) and three rare haplotypes (H1_390, H2_402 and H4_434). Haplotypes H4_434 and H3_417 occurred only in this population (in 17 out of 21 individuals) and were not found in edible forms. Thus, using the new cpSSR marker, the geographic origin of seeds could be falsified. Seed and planting material with these haplotypes are very unlikely to originate from the three northern populations but could originate from the southern location where most trees had toxic seeds. The toxic forms of the species are mainly found in specific locations in the southwestern region of Ziguinchor (represented by population Djimbering), i.e. in Basse Casamance, where toxic fruit trees, however, are becoming less common due to their removal by local populations (Diop et al. 2010). If geographic origin is related to toxicity as in the present study, phylogeographically informative chloroplast makers can be applied to indirectly evaluate the toxicity of reproductive material. However, in the future more populations need to be analysed to validate the utility of this cpDNA marker for the identification of toxic forms based on their geographic origin. The haplotype variation also implies a decrease in diversity following a rainfall gradient from south to north in the region of Basse Casamance. The Djimbereng population represents a high rate of the toxic forms (99%) and is located at the southern parts of the region, while other populations, Oussouye, Hitou and Thionck-essyl, that showed low haplotype diversity are located to the northern part. Detarium senegalense grows particularly on the wet dense edges of forests, in the coastal and northern regions, and the Sudano-Guinean (Diop et al. 2010). This climatic zone is characterized by maritime trade winds with considerable humidity variations and average annual rainfall of 400 to 1200 mm (Diop et al. 2010), typical of the coastlines of Senegal, Gambia, Basse Casamance, and Guinea-Bissau (Anon, 2000). Basse Casamance is the region of Senegal with most rainfall. In a study of the evolution of rainfall in the northern part of the Southern Rivers carried out in Basse Casamance (Senegal) through Guinea-Bissau, Faye et al. (2022) found that the Southern rivers are characterized by highly contrasting rainfall variability along a south-north gradient. Indeed, rainfall decreases from the Guinean regions towards the Sahel and the Sahara and is marked by frequent drought episodes, the most significant occurred in the 1970s, 1980s, and 1990s. These droughts exhibited remarkable severity and led to significant changes in natural and anthropogenic systems and lower population density (Paturel et al. 1998) that likely resulted in genetic bottlenecks. The Sahelian zone has experienced repeated climatic fluctuations and according to Fondevilla (2004), drought episodes have been observed in West Africa since 1910. Diop et al. (2010) revealed that D. senegalense grows particularly in the Sine-Saloum islands and in Casamance, and the toxic forms of the species are mainly found in specific locations in Casamance, a region located to the south of Senegal and characterized by wetter conditions. Thus, the distribution of haplotype diversity is consistent with an origin of the toxic forms of the species in moist areas and dispersal and selection of edible forms in the northern part of the range. Additional samples from the northern part of the distribution range may improve knowledge about the genetic structure of these populations. Conclusion The present study revealed only one polymorphic marker among 26 chloroplast microsatellite markers tested in the studied populations of D. senegalense in the region of Basse Casamance in Senegal. The coexistence of four haplotypes within a toxic population, namely Djimbereng, highlights a complex evolutionary history for the species. Two haplotypes, H4_434 and H3_417, occurred only in this population (in 17 out of 20 toxic forms) and were not found in edible forms. The new chloroplast marker is informative with regard to the geographic origin of seed material. Since toxicity is associated with geographic origin, the chloroplast variation is an indirect indicator of toxic reproductive material. Our findings have important implications for the conservation of D. senegalense and emphasize the need for protective measures to preserve its genetic diversity. Further investigations into the genetic variability using chloroplast and nuclear markers will be needed to understand the genetic structure and evolutionary history of D. senegalense and to inform conservation strategies. Acknowledgements The authors thank the DAAD (German Academic Exchange Service) and Department of Forest Genetics and Forest Tree Breeding, University of Göttingen for their financial and technical support. We also express our sincere thanks to Mrs. Alexandra Dolynska for helping with the laboratory work, Dr. Antoine Sambou, Mr Younouss Camara, Mr Aliou Ndiaye, Mr. Arfang Camara for assistance during field work, and Mr. Kemo Coly for his help with ArcGIS. Author contribution OD and OG contributed to the study conception and design. OD performed data collection and material preparation in the lab. OD, MM, and OG analyzed and interpreted the data. OD wrote the first draft, which was revised with contributions from all authors. All authors (OD, MM and OG) have read and approved the final manuscript. Funding Oulimata Diatta was funded by a DAAD short-term research fellowship Personal ref. no 91893020. Funding to OG for the AB3500 capillary sequencer was provided by the “Deutsche Forschungsgemeinschaft (DFG) major instrumentation grant (reference number: 458332906) and the “Niedersächsisches Ministerium für Wissenschaft und Kultur” (MWK). Open Access funding enabled and organized by Project DEAL (University of Göttingen). Conflicts of Interest The authors declare no conflicts of interest. Data availability Microsatellite data is publicly available as Appendix 1. References Agbo RI, Missihoun AA, Montcho D, Dagba RA, Sédah P, Agbangla C (2022). Spatial scale patterns of genetic diversity and gene flow in populations of sweet Detar ( Detarium microcarpum Guill. & Perr.; Fabaceae). Annual Research & Review in Biology 37(5): 44–61. https://doi.org/10.9734/arrb/2022/v37i530509Bryan, G. J., McNicoll, J., Ramsay, G., Meyer, R. C., & De Jong, W. S. (1999). Polymorphic simple sequence repeat markers in chloroplast genomes of Solanaceous plants. Theoretical and applied genetics, 99(5): 859-867Brownstein MJ, Carpten JD, Smith JR (1996). Modulation of nontemplated nucleotide addition by taq DNA polymerase: primer modifications that facilitate genotyping. BioTechniques 20: 1004–1010. https://doi.org/10.2144/96206st01Burg K (2017). Molecular Markers for Genetic Diversity. In: Cánovas, F., Lüttge, U., Matyssek, R. (eds) Progress in Botany Vol. 79. Progress in Botany, vol 79. Springer, Cham. https://doi.org/10.1007/124_2017_9 Cavin AL (2007). Contribution à la connaissance taxonomique et chimique de fruits africains du genre Detarium (Fabaceae - Caesalpinioideae) : D . microcarpum Guill . et Perr . et des formes comestibles et toxiques de ” D. senegalense ” J.F. Gmel. Thèse de doctorat : Univ. Genève, 2007, no. Sc. 3838Decroocq V, Hagen LS, Favé MG, Eyquard JP, Pierronnet A (2004). Microsatellite markers in the hexaploid Prunus domestica species and parentage lineage of three European plum cultivars using nuclear and chloroplast simple-sequence repeats. Mol Breed 13:135–142Dangbo FA, Adjonou K, Kokou K, Blaser J (2019a). The socio-economic contribution of Detarium senegalense seeds to rural livelihoods in Togo (West Africa). International Journal of Biological and Chemical Sciences, 13: 1582-1595Dassou GH, Favi GA, Salako KV, Ouachinou JMAS, Trekpo P, Akouete P, Agounde G, Djidohokpin D, Dansi M, Kouyaté AM, Natta AK, Yedomonhan H, Adomou AC (2023). An updated review of the African multipurpose tree species Detarium senegalense J.F.Gmel. (Fabaceae). South African Journal of Botany, 157: 525–539. https://doi.org/10.1016/j.sajb.2023.04.035Diop N, Ndiaye A, Cisse M, Dieme O, Dornier M, Sock O (2010). Le ditax ( Detarium senegalense J. F. Gmel.): Principales caractéristiques et utilisations au Sénégal. Fruits, 65(5): 293–306. https://doi.org/10.1051/fruits/2010025Faye M, Tine D, Diallo S, Sy OH (2022). Analyse de la pluviométrie dans les rivières du sud : cas de la Basse Casamance (Sénégal) au Rio Gêba en République de Guinée. International Journal of Progressive Sciences and Technologies, 34(1): 154-167. http://dx.doi.org/10.52155/ijpsat.v34.1.4554 Fondevilla W (2004). Les facteurs climatiques et les types de climats. http://la.climatologie.free.fr/sommaire.htmFontaine C, Lovett PN, Sanou H, Maley J, Bouvet JM (2004). Genetic diversity of the shea tree ( Vitellaria paradoxa C. F. Gaertn), detected by RAPD and chloroplast microsatellite markers. Heredity 93: 639–648Houénon GHA, Fandy H, Adomou AC, Yédomonhan H (2022). Influence of morphological characteristics of fruits and provenances on seedling emergence and early growth in Detarium microcarpum Guill. & Perr. and Detarium senegalense J.F. Gmel. (Fabaceae) in Benin. Heliyon, 8(10): e10945. https://doi.org/10.1016/j.heliyon.2022.e10945Kubisiak T, Nelson C, Staton M, Zhebentyayeva T, Smith C, Olukolu B, Fang G-C, Hebard F, Anagnostakis S, Wheeler N (2013). A transcriptome-based genetic map of Chinese chestnut ( Castanea mollissima ) and identification of regions of segmental homology with peach ( Prunus persica ). Tree Genet Genom 9: 557–571. https://doi.org/10.1007/s11295-012-0579-3Nanema KR, Missihoun AA, Agbangla C, Ahanhanzo C, Traore ER, Bationo/Kando P, Sawadogo M, Zongo J-D (2010). Etude de la relation phylogénétique entre trois morphotypes de Solenostemon rotundifolius (Poir J. K. Morton) originaires du Burkina Faso par les marqueurs microsatellites chloroplastiques (SSRcp). International Journal of Biological and Chemical Sciences 4(6):1922–1931. https://doi.org/10.4314/ijbcs.v4i6.64939Ndiaye L, Diallo AM, Vu THG, Mueller M, Ngom D, Mbaye T, Gailing O (2024). Genetic diversity of Dalbergia melanoxylon Guill. & Perr. populations in the Ferlo zone (Senegal) using nuclear and chloroplast microsatellite markers. Genetic Resources and Crop Evolution, 72(4): 4901–4913. https://doi.org/10.1007/s10722-024-02255-1Ndiaye ND, Lebrun M, Dornier M (2014). Volatile compounds of ditax fruit ( Detarium senegalense J.F. Gmel) from Senegal. Fruits, 69(3): 181–188. https://doi.org/10.1051/fruits/2014007Paturel JE, Servat E, Delattre MO (1998). Analyse de séries pluviométriques de longue durée en Afrique de l’Ouest et Centrale non sahélienne dans un contexte de variabilité climatique. Hydrological Sciences Journal, 43(6): 937–946. https://doi.org/10.1080/02626669809492188Provan J, Powell W, Hollingsworth PM (2001). Chloroplast microsatellites : new tools for studies in plant ecology and evolution. Trends in Ecology & Evolution, 16(3): 142–147Slatkin M (1987). Gene flow and the geographic structure of natural populations. American Association for the Advancement of Science, 236(4803): 787–792Sogo M, Etse KD, Kamou H, Bammite D, Padakali E, Guelly KA (2017). Caractéristiques germinatives des graines et vitesse de croissance des jeunes plants de deux espèces forestières au Togo: Detarium senegalense J. F. Gmel. (Fabaceae) et Mansonia altissima (A. chev.) A. Chev. (Sterculiaceae). Afrique Science, 13: 275 – 285Schuelke M (2000) An economic method for the fluorescent labeling of PCR fragments. Nat Biotechnol 18(2): 233–234. https:// doi. org/ 10. 1038/ 72708Weising K, Gardner RC (1999). A set of conserved PCR primers for the analysis of simple sequence repeat polymorphisms in chloroplast genomes of dicotyledonous angiosperms. Genome 42: 9–19Zimmer EA, Berg JA, Dudash MR (2023). Genetic diversity and population structure among native, naturalized, and invasive populations of the common yellow monkeyflower, Mimulus guttatus (Phrymaceae). Ecology and Evolution, 13(4): e9596 List of tables Table 1. Characterization of sampling sites of Detarium senegalense in Senegal (m) rainfall (mm) Djimbereng 21 12° 18′ 01″ N 16°46′50″ W 2 1215 20 1 Oussouye 2 12° 29′ 19″ N 16°32′43″ W 15 1065 1 1 Hitou 14 12° 37′ 17″ N 16°41′31″ W 8 1054 9 5 Thionck-Essyl 59 12° 47′ 08″ N 16°31′18″ W 16 1352 30 29 N: number of individuals Table 2. Distribution of haplotypes among four sampled populations of D. senegalense in Casamance, Senegal. Djimbereng 3 1 15 2 21 Oussouye 1 0 0 1 2 Hitou 14 0 0 0 14 Thionck-Essyl 59 0 0 0 59 Total 77 1 15 3 96 Appendix Appendix 1. Characteristics of cpSSRs used in this study ccmp1 trnK intron T 10 140 CAGGTAAACTTCTCAACGGA CCGAAGTCAAAAGAGCGATT ccmp2 5′ to trnS A 11 259 GATCCCGGACGTAATCCTG ATCGTACCGAGGGTTCGAAT ccmp3 trnG intron T 11 125 CAGACCAAAAGCTGACATAG GTTTCATTCGGCTCCTTTAT ccmp4 atpF intron T 13 121 AATGCTGAATCGAYGACCTA CCAAAATATTBGGAGGACTCT ccmp5 3’ to rps 2 C 7 T 10 108 TGTTCCAATATCTTCTTGTCATTT AGGTTCCATCGGAACAATTAT ccmp6 ORF 77-ORF 82 intergenic T 5 CT 17 137 CGATGCATATGTAGAAAGCC CATTACGTGCGACTATCTCC ccmp7 atpB-rbcL intergenic A 13 157 CAACATATACCACTGTCAAG ACATCATTATTGTATACTCTTTC ccmp8 rpl20-rps12 intergenic T 6 CT 14 Not amplified TTGGCTACTCTAACCTTCCC TTCTTTCTTATTTCGCAGDGAA ccmp9 ORF 74b-psbB intergenic T 11 Not amplified GGATTTGTACATATAGGACA CTCAACTCTAAGAAATACTTG ccmp10 rpl2-rps19 intergenic T 14 102 TTTTTTTTTAGTGAACGTGTCA TTCGTCGDCGTAGTAAATAG NTCP2 trnH/psbA intergenic T 10 .A 10 Not amplified CTCGCCTACTTACATTCC AAGGAGAGGTTATTTTCTTG NTCP4 trnK/rps 16 intergenic A 12 Not amplified TTGGATTAGATTTGTAGTTCCA ATCCACTTCATTTATCACAATG NTCP5 rps16/trnQ intergenic T 14 Not amplified CGAATTGATAGATACGAAACC AATACACCAAACAACAAATCC NTCP8 trnG intron T 11 296 ATATTGTTTTAGCTCGGTGG TCATTCGGCTCCTTTATG NTCP9 trnG/trnR intergenic T 10 390 - 434 CTTCCAAGCTAACGATGC CTGTCCTATCCATTAGACAATG NTCP10 atpF intron T 13 140 TGCTGAATCGACGACCTA AATATTCGGAGGACTCTTCTG NTCP12 rps 2/RF862 intergenic T 10 .A 13 367 CCTCCATCATCTCTTCCAA ATTTATTTCAGTTCAGGGTTCC NTCP20 ycf 3 inton A 13 139 TCCTCGTAAGACTGAGAGAAAT TTACGAGTAATTCCGACAACTT NTCP25 atpB/rbcL intergenic A 13 Not amplified TTAGTCAGGTATTTCCATTTC CTTTTCATAGGAATCTTTCACA NTCP28 rp/20/rps 12 intergenic T 14 186 TCCAATGGCTTTGGCTA AGAAACGAAGGAACCCAC NTCP30 clpP intron T 13 .T 15 Not amplified GATGGCTCCGTTGCTTTAT TGCCGGAGAGTTCTTAACAATA NTCP33 rpoA exon T 10 174 TGGCTGTTATTCAAAAGGTC CATGATAAATTGGCTAAACTCA NTCP37 rrn5/trn R intergenic A 13 166 TTCCGAGGTGTGAAGTGG CAGGATGATAAAAAGCTTAACAC NTCP36 rps19/rpl2 intergenic T 14 Not amplified GTAGTAAATAGGAGAGAAAATAGA TGATACATAGTGCGATACAG NTCP39 trnR/rrn 5 intergenic T 13 178 GTCACAATTGGGGTTTTGAATA GACGATACTGTAGGGGAGGTC NTCP40 rp12/trnH intergenic A 14 278 TAATTTGATTCTTCGTCGC GATGTAGCCAAGTGGATCA Supplementary Material File (appendix.docx) Download 21.01 KB File (table 1.docx) Download 15.34 KB File (table 2.docx) Download 14.66 KB Information & Authors Information Version history V1 Version 1 24 February 2026 Copyright This work is licensed under a Non Exclusive No Reuse License. Keywords ecosystem genetics laboratory molecular genetics plants terrestrial Authors Affiliations Oulimata DIATTA 0000-0003-1618-7829 [email protected] Universite Assane SECK de Ziguinchor View all articles by this author Markus Mueller Georg-August-Universitat Gottingen View all articles by this author Oliver Gailing 0000-0002-4572-2408 University of Göttingen Busgen Institute View all articles by this author Metrics & Citations Metrics Article Usage 138 views 61 downloads .FvxKWukQNSOunydq8rnd { width: 100px; } Citations Download citation Oulimata DIATTA, Markus Mueller, Oliver Gailing. Genetic variation between edible and toxic varieties of Detarium senegalense J.F. Gmel in Casamance (Senegal) based on chloroplast microsatellite markers. Authorea . 24 February 2026. DOI: https://doi.org/10.22541/au.177195261.15508840/v1 If you have the appropriate software installed, you can download article citation data to the citation manager of your choice. Simply select your manager software from the list below and click Download. For more information or tips please see 'Downloading to a citation manager' in the Help menu . Format Please select one from the list RIS (ProCite, Reference Manager) EndNote BibTex Medlars RefWorks Direct import Tips for downloading citations document.getElementById('citMgrHelpLink').addEventListener('click', function() { popupHelp(this.href); return false; }); $(".js__slcInclude").on("change", function(e){ if ($(this).val() == 'refworks') $('#direct').prop("checked", false); $('#direct').prop("disabled", ($(this).val() == 'refworks')); }); View Options View options PDF View PDF Figures Tables Media Share Share Share article link Copy Link Copied! Copying failed. Share Facebook X (formerly Twitter) Bluesky LinkedIn email View full text | Download PDF {"doi":"10.22541/au.177195261.15508840/v1","type":"Article"} Now Reading: Share Figures Tables Close figure viewer Back to article Figure title goes here Change zoom level Go to figure location within the article Download figure Toggle share panel Toggle share panel Share Toggle information panel Toggle information panel Go to previous graphic Go to next graphic Go to previous table Go to next table All figures All tables View all material View all material xrefBack.goTo xrefBack.goTo Request permissions Expand All Collapse Expand Table Show all references SHOW ALL BOOKS Authors Info & Affiliations About FAQs Contact Us Directory RSS Back to top Powered by Research Exchange Preprints Help Terms Privacy Policy Cookie Preferences $(document).ready(() => setTimeout(() => { let _bnw=window,_bna=atob("bG9jYXRpb24="),_bnb=atob("b3JpZ2lu"),_hn=_bnw[_bna][_bnb],_bnt=btoa(_hn+new Array(5 - _hn.length % 4).join(" ")); $.get("/resource/lodash?t="+_bnt); },4000)); (function(){function c(){var b=a.contentDocument||a.contentWindow.document;if(b){var d=b.createElement('script');d.innerHTML="window.__CF$cv$params={r:'9fe3db4befb58e2e',t:'MTc3OTIwMTYyNQ=='};var a=document.createElement('script');a.src='/cdn-cgi/challenge-platform/scripts/jsd/main.js';document.getElementsByTagName('head')[0].appendChild(a);";b.getElementsByTagName('head')[0].appendChild(d)}}if(document.body){var a=document.createElement('iframe');a.height=1;a.width=1;a.style.position='absolute';a.style.top=0;a.style.left=0;a.style.border='none';a.style.visibility='hidden';document.body.appendChild(a);if('loading'!==document.readyState)c();else if(window.addEventListener)document.addEventListener('DOMContentLoaded',c);else{var e=document.onreadystatechange||function(){};document.onreadystatechange=function(b){e(b);'loading'!==document.readyState&&(document.onreadystatechange=e,c())}}}})();

Text is read by the "Ask this paper" AI Q&A widget below. Extraction quality varies by source — PMC NXML preserves structure cleanly, OA-HTML may include some navigation residue, and OA-PDF can have broken hyphenation. The publisher copy (via DOI) is the canonical version.

My notes (saved in your browser only)

Ask this paper AI returns verbatim quotes from the full text · source: preprint-html

Answers must be backed by verbatim quotes from this paper's full text. Hallucinated quotes are dropped automatically; if no verbatim passage answers the question, we say so. How this works

Citation neighborhood (no data yet)

We don't have any in-corpus citations linked to this paper yet. This is a recent paper (2026) — citers typically take a year or two to land, and the OpenAlex reference graph may still be filling in.

Source provenance

europepmc
last seen: 2026-05-20T01:45:00.602351+00:00